| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Medical Service, VA Palo Alto Health Care System, and Division of Endocrinology, Department of Medicine, Stanford University, Palo Alto, California 94304
Address all correspondence and requests for reprints to: Andrew R. Hoffman, M.D., Medical Service, Building 101, Room B2–125, VA Palo Alto Health Care System, 3801 Miranda Avenue, Palo Alto, California 94304. E-mail: arhoffman{at}leland.stanford.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The degree of core histone acetylation has also been shown to modulate the expression of numerous genes. In general, histone deacetylation leads to transcriptional repression, whereas histone acetylation increases gene transcription. Histone acetylation is maintained during mitosis, so the acetylation pattern represents a heritable epigenetic imprint that can influence gene transcription (3). Thus, the degree of histone acetylation may represent another potential mechanism that could initiate or maintain genomic imprinting.
DNA that is rich in methylated CpG is associated with hypoacetylated histone cores and increased histone H1, whereas DNA containing unmethylated CpG islands is associated with chromatin enriched in hyperacetylated histone cores and less histone H1 (4). Although the methylation of DNA may repress transcription by preventing the binding of transcription factors or by enhancing the binding of specific inhibitory proteins (5), it has also been shown that DNA methylation generates an inactive DNase-resistant local chromatin structure with hypoacetylated core histones. Moreover, the inactive chromatin structure generated by the methylated DNA can spread from the methylated area to adjacent nonmethylated DNA, thereby inhibiting gene transcription over a larger segment of the chromosome (6), and thus providing a potential mechanism for creating a region containing clusters of imprinted genes. Recent studies have demonstrated that the methyl-CpG-binding protein MeCP2 is in fact found in a complex with histone deacetylase and other proteins that might regulate transcription. Moreover, TSA, an inhibitor of histone deacetylase, overcomes DNA methylation-induced transcriptional repression, indicating a linkage between these two known mechanisms of transcriptional repression (7, 8). We previously demonstrated that inhibition of histone deacetylation by trichostatin A (TSA) induces the expression of the normally imprinted maternal IGF2 allele, leading to biallelic expression in human and murine cells (9). TSA-treated mouse conceptuses also demonstrated loss of H19 imprinting (10). In conjunction with DNA methylation, histone acetylation may represent a crucial molecular mechanism for initiating, maintaining and/or transmitting the genomic imprint.
The reciprocally imprinted Igf2r sense and antisense transcripts provide a convenient model for examining the molecular mechanisms underlying the imprinting process as the tissue-specific methylation imprint and transcript expression have been well delineated. The expression of the paternally imprinted Igf2r sense gene correlates with the methylation of the differentially methylated region (DMR) in its promoter region (region 1) (11, 12, 13). In peripheral tissues, where Igf2r sense is expressed only from the maternal allele, region 1 methylation is found only on the paternal allele. In the CNS, where biallelic expression is seen, neither allele demonstrates CpG methylation in this region (13). Igf2r antisense RNA is expressed only from the paternal allele in both peripheral tissues and CNS. The paternally derived antisense DNA sequence is unmethylated in its promoter region, DMR region 2, a CpG island that is methylated on the suppressed maternal allele (11, 13).
We hypothesized that nonmethylated, nonimprinted alleles would preferentially be associated with acetylated histones. Furthermore, we proposed that the methylation status of an imprinted gene would be altered by modulating the acetylation of core histones. Therefore, we have studied the status of histone H4 acetylation and DNA methylation in the promoter regions of Igf2r sense and Igf2r antisense, where the genomic DNA has been shown to be differentially methylated (11, 13).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Chromosome immunoprecipitation
All of the following steps were carried out at 4 C in the
presence of 5 mM sodium butyrate. Fresh livers were
collected in PBS and minced into small pieces with scissors. Tissues
were gently homogenized in 10 ml of PBS into single cells in a glass
tissue grinder with a loose pestle. Cells were centrifuged at 600
x g for 10 min, and washed twice with PBS. Nuclei from
these cells were prepared by the method described by O’Neill et
al. (16). Briefly, liver cells were suspended in
buffer A (10 mM Tris-HCI, pH 7.5, 3
mM CaCl2, 2 mM MgCl2, 1.5%
Triton 100, and 0.1 M PMSF) and were homogenized
with a tight glass pestle in a glass tissue grinder to exclude the
nuclei. Nuclei were pelleted by centrifugation at 600 x
g for 20 min, and were applied to 25% and 50% sucrose
gradients in TBS (10 mM Tris-HCI, pH 7.5, 3
mM CaCl2, 2 mM MgCl2).
Nuclei were collected by centrifugation (1,500 x g, 4
C, 20 min) and washed once in 25% sucrose.
Oligonucleosomes were released from nuclei by mild digestion using micrococcal nuclease (16). Nuclear extracts (equivalent to 20 µg of DNA nuclei) were digested with 0.5–5 U of micrococcal nuclease (Amersham Pharmacia Biotech, Piscataway, NJ) for 15 min in buffer B (0.32 M sucrose, 50 mM Tris-HCl, pH 7.5, 4 mM MgCl2, 1 mM CaCl2, 0.1 mM PMSF, 5 mM sodium butyrate), and dialyzed overnight in lysis buffer (1 mM Tris-HCI, pH 7.4, 0.2 mM Na2 EDTA, 0.2 mM PMSF, 5 mM sodium butyrate). After centrifugation at 11,600 x g at 4 C for 20 min, an aliquot of the supernatant nucleosome DNA was extracted with phenol/chloroform and run on 2% agarose gel. An appropriate micrococcal nuclease digestion of chromatin produced a range of 1–5 oligonucleosomes.
Oligonucleosomes (10 µg) were then incubated with antiserum to acetylated histone H4 antiserum (0–4 µl) (Serotec Inc., Raleigh, NC). Acetylated-histone nucleosomes were separated from unacetylated-histone nucleosomes by precipitation with protein A-Sepharose (Amersham Pharmacia Biotech, Piscataway, NJ). DNA associated with acetylated histones was extracted from nucleosomes with phenol/chloroform and was precipitated with ethanol for PCR analysis.
Allele-specific histone acetylation
Allele-specific histone acetylation in Igf2r promoter
regions was analyzed by PCR using specific Igf2r
polymorphisms (13). Specifically, DNA associated with
acetyl-H4 antiserum-immunoprecipitated oligonucleosomes was used as
template for PCR analysis as previously described (14, 17). Briefly, immunoprecipitated DNA from Igf2r
promoter regions was amplified in a 2.5-µl reaction mixture in the
presence of 50 µM dNTP, 0.2
µM Igf2r primers, 0.25 µCi
-dCTP (Amersham Pharmacia Biotech), 0.125 U Tfl DNA
polymerase (Epicentre Technologies, Madison, WI). DNA was amplified for
35 cycles at 94 C for 15 sec, 65 C for 40 sec, followed by a 30-sec
extension at 72 C. The PCR products were diluted and digested with
polymorphic restriction enzymes, and then separated on 5%
polyacrylamide-urea gel to examine allelic distribution. For the
Igf2r antisense promoter region, two restriction enzymes
(Fok1 and XhoI) (13) were
used to distinguish the parental alleles. Fok1 specifically
digests the M. spretus allele, whereas XhoI cuts
only the C57BL allele. For the Igf2r sense RNA promoter, a
16-bp deletion polymorphism (13) was used to separate the
two parental alleles (Fig. 1
).
|
]
ATP (Amersham Pharmacia Biotech, Arlington Heights, IL)
using T4 polynucleotide kinase (New England Biolabs, Inc., Beverly, MA).
Treatment of fibroblasts (C6W and C8W) with histone deacetylase
inhibitor
Fibroblasts were cultured from the skin of F1 mice (M.
spretus males x C57BL/6 females) as previously described
(9). Tissues were minced with scissors into small pieces
and suspended in DMEM (Life Technologies, Inc.,
Gaithersburg, MD), supplemented with 15% FBS and 100 U/ml of
penicillin and 100 µg/ml of streptomycin, and grown at 37 C with 5%
CO2. The medium was replaced with fresh media 24 h after plating.
When confluent, the fibroblasts were trypsinized and used for the
treatment.
C6W and C8W fibroblasts at passages 3–5 were seeded in 6-well plates at a density of 2 x 105 cells/ml and were treated with the histone deacetylase inhibitor, trichostatin A (TSA, Wako BioProducts, Richmond, VA) as previously described (9). The cells were randomly assigned into treatment and control groups. In treatment wells, the culture medium was replaced with media containing TSA (0.5 µM, 2 µM, and 6 µM) 24 h after seeding. Higher concentrations of TSA are potentially toxic to cells. For control wells, the cells were supplied with DMEM supplemented with the same volume of PBS as used in the treatment wells. After overnight treatment, the medium containing drugs was removed, and the cells were washed twice with PBS. The cells were allowed to grow in fresh media with FBS until they became confluent.
Measurement of Igf2r allelic expression
Confluent fibroblasts from treatment and control wells were
directly lysed with 0.6 ml Tri-reagent solution provided by the
Tri-reagent kit (Sigma, St. Louis, MO). To avoid DNA
contamination, RNA was digested with DNase I before cDNA was
synthesized with RNA reverse transcriptase (9, 17).
Igf2r allelic expression was analyzed by the same PCR condition as described above. The PCR products were diluted and digested with 1.0 U HaeIII for Igf2r sense RNA. For Igf2r antisense RNA, a 16-bp polymorphism was used to separate the two parental alleles (13). After restriction enzyme digestion, PCR products were separated on 5% polyacrylamide-urea gel to assess the allelic expression of Igf2r.
The oligonucleotide primers used for examining sense Igf2r
RNA imprinting were: no. 6105 (5'-primer): CAGAAGAAGCTCGGGCGTGTCCTAC
and no. 6294 (3'-primer): CTCCGCTCCTCGGCCTGAGTGAACT; and antisense
Igf2r RNA imprinting were: no. 8–04 (5'-primer):
GGCACGAGCGCCAGGTACCTACTCGA and no. 6458 (3'-primer). Primers (nos.
6105, and 8–04) were end-labeled with
[32P-] ATP by T4 polynucleotide kinase
(New England Biolabs, Inc.) for PCR amplification. Allelic
expression was quantitated by PhosphorImager Analyzer (Molecular Dynamics, Inc., Sunnyvale, CA).
DNA methylation analysis
DNA methylation in the regions of Igf2r sense and
antisense promoters was examined by the DNA-sensitive restriction
enzyme, HpaII, as previously described (11).
Briefly, 2 µg of genomic DNA was digested by 6 U HpaII in
a 10 µl reaction covered with liquid wax at 37 C overnight. The
digested DNA was diluted and directly amplified by PCR. When genomic
DNA is methylated, HpaII will not digest the DNA and PCR
will amplify the DNA at full-length when separated on 5%
polyacrylamide-urea gel. However, unmethylated DNA will be completely
digested by HpaII and will not be amplified by PCR. Thus,
PCR will provide a reliable quantitation of DNA methylation in a
designated specific region (18). PCR conditions for DNA
methylation quantitation were the same as for the quantitation of
Igf2r allelic histone acetylation. After PCR, the amplified
DNAs were electrophoresed on 5% polyacrylamide-urea gel and were
exposed to the screen of a PhosphorImager Scanner (Molecular Dynamics, Inc., Sunnyvale, CA) for quantitation.
As a PCR control, we also used the MspI restriction enzyme to digest genomic DNA. MspI is a DNA methylation-insensitive restriction enzyme, and it will digest DNA whether it is methylated or unmethylated. Furthermore, we also used a set of PCR primers that amplify a DNA region that does not contain any HpaII sites (CCpGG). This pair of PCR primers will give an amplified PCR band whether genomic DNA is digested by HpaII or not.
The oligonucleotide primers used for Igf2r sense RNA promoter were: no. 6194 (5'-primer): GTCCACCAGTCACCTTACATGCTGTA and no. 8–41 (3'-primer); 2) Igf2r antisense RNA promoter: no. 6647 (5'-primer) and no. 6460 (3'-primer); 3) Non-CCpGG PCR primers: no. 3302 (5'-primer): GGCCAAACGTCATCGTCCCCTGAT, no. 3303 (3'-primer): CTGTCCCGCTCAAGAGGAGGTCA. Primer set for Igf2r antisense RNA promoter (nos. 6647 and 6460) covers one HapII site (CCpGG) located between the allele-discrimination signal and the de novo methylation signal in the imprinting box, which is critical for the establishment of Igf2r genomic imprinting (19).
Primers (nos. 6647, 6194, and 3302) in the PCR amplification were
end-labeled with [32P-]ATP by T4
polynucleotide kinase (New England Biolabs, Inc.). The
conditions for PCR amplification were the same as those used for
examining genomic imprinting as described above.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Acetyl-H4 antiserum-immunoprecipitated DNA was amplified with PCR
primers that are specific to Igf2r sense and antisense
promoter regions (Fig. 1
). The DNA was then digested with restriction
enzymes which cut in sites that are polymorphic in C57BL/6 x
M. spretus interspecific mice. As seen in Fig. 2A, in normal genomic DNA, PCR
amplification yields equal amounts of the two parental Igf2r
sense alleles (lane 4). However, when oligonucleosomes were
immunoprecipitated with varying amounts of acetyl-histone H4 antiserum,
Igf2r sense PCR products were shown to be derived primarily
from the expressed maternal (M. spretus) allele (lanes
5–8). The paternal allele, which is transcriptionally suppressed, only
accounts for a small portion of the genomic DNA that is associated with
the acetylated histones. Thus, histone H4 is relatively hyperacetylated
in the region of the expressed maternal allele, and is hypoacetylated
in the region of the suppressed paternal allele.
|
) and Fok1 digests only the M. spretus allele
(Fig. 2C). After PCR amplification and restriction enzyme digestion,
allelic histone acetylation in the Igf2r antisense promoter
region can be easily visualized in polyacrylamide-urea gel. Histones
are highly acetylated in the C57BL/6 allele (lanes 5–8, Fig. 2, B and
C), which represents the expressed paternal allele (13).
Similar results were obtained using either Fok1 or XhoI
polymorphic restriction enzymes. Histones associated with the imprinted
maternal (M. spretus) allele are hypoacetylated. Thus,
histone hyperacetylation is highly associated with the expressed
alleles of Igf2r sense and antisense, whereas histone
under-acetylation is associated with the imprinted alleles, suggesting
that histone acetylation is intimately involved in the regulation of
Igf2r imprinting.
Relaxation of Igf2r imprinting following TSA treatment
To further assess the importance of histone acetylation in
Igf2r imprinting, we treated two interspecific F1 mouse
fibroblast cell lines (C8W and C6W) with the histone deacetylase
inhibitor trichostatin A (TSA). Igf2r sense mRNA is derived
from the maternal allele in all tissues except brain (13).
In cultured mouse fibroblasts, the maternal imprinting of
Igf2r sense mRNA is fully maintained (Fig. 3A, lanes 4 and 5). TSA treatment
releases the imprinting of Igf2r sense mRNA transcripts to a
small degree, but with much less efficacy than the from antisense RNA
promoter (Fig. 3B and 3C, lanes 6–11).
|
, B and C, lanes 2 and 3). After TSA treatment, however, the imprinted
Igf2r antisense allele becomes expressed, although the loss
of imprinting is not complete.
Alteration of DNA methylation after treatment with histone
deacetylase inhibitor
To examine the interactions of histone acetylation and DNA
methylation, we also examined the extent of DNA methylation in
fibroblasts that were treated with the histone deacetylase inhibitor
TSA. DNA extracted from fibroblasts treated with varying concentrations
of TSA were digested with the DNA methylation-sensitive restriction
enzyme HpaII and the DNA methylation-insensitive restriction
enzyme MspI.
Methylated DNA cannot be digested by HpaII and thus can be amplified by PCR primers that encompass the regions of Igf2r sense and antisense RNA promoters. Unmethylated DNA will be digested, and will not be amplified in the PCR.
In control samples, PCR primers amplified a 402-bp band from the
Igf2r sense promoter region (Fig. 4A, lane 2) and a 169-bp band
from Igf2r antisense RNA promoter region (Fig. 4B, lane 2).
However, after fibroblasts were treated with TSA, the density of the
PCR bands decreased in a dose-dependent manner (lanes 3–5), indicating
a decrease in DNA methylation in that region. These results indicate
that inhibition of histone deacetylase partially induces DNA
demethylation in both Igf2r sense and antisense RNA promoter
regions.
|
). There were no significant changes in the density of
PCR bands between control and TSA-treated samples. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
When cells are cultured in the presence of the histone deacetylase inhibitor trichostatin A, the pattern of Igf2r gene expression changes, as the relative concentration of acetylated histones increases. TSA treatment causes an increase in Igf2r antisense expression from the normally imprinted paternal allele. Although the expression of the imprinted Igf2r sense paternal allele is also increased by TSA, the relaxation of imprinting from the sense allele is far less extensive than is the loss of imprinting of Igf2r antisense. However, TSA treatment did not lead to total relaxation of genomic imprinting. It is likely that TSA exposure does not lead to complete histone acetylation, and it is probable that mechanisms other than histone acetylation and DNA methylation play an important role in maintaining suppression of the imprinted allele.
We have previously shown that, whereas TSA treatment of cultured human cells leads to the loss of IGF2 imprinting (9), H19 imprinting remains intact (unpublished data), without any relaxation and expression of the paternal allele. These data indicate that altering the acetylation status of core histones has differential, gene-specific and transcript-specific effects, suggesting that the expression of some transcripts are more tightly controlled by chromatin structure than are others. Pedone et al. (21) showed that in the mouse, TSA had no effect on H19 imprinting, whereas it did lead to biallelic expression of Igf2. Moreover, they demonstrated that treatment with both TSA and the DNA methylation inhibitor 5-aza-2-deoxycytidine did lead to loss of H19 imprinting.
Although Trichostatin A can reactivate some of the suppressed methylated genes in Neurospora, other methylated regions remain suppressed. In examining the synergy of DNA demethylation and histone deacetylase inhibition in the reexpression of genes silenced in cancer, Cameron and colleagues (22) showed that some hypermethylated genes cannot be transcriptionally reactivated with TSA alone. Following incubation with a low dose 5-aza-2-deoxycytidine that did not significantly result in demethylation, TSA treatment resulted in the expression of each repressed gene. However, TSA induced no further change in the methylation status of these newly expressed genes.
The interrelationship between DNA methylation and histone acetylation has proven to be extremely intimate. The ability of methylated DNA to bind to methyl-CpG-binding proteins (MeCP), which then recruit histone deacetylases has been demonstrated in several systems. MeCP2 possesses a transcriptional repressor domain that binds the corepressor mSin3A, which is associated with histone deacetylases (HDAC) (7). HDAC1 binds to Dnmt1, the enzyme responsible for CpG methylation, suggesting that the modifications of DNA and histones are very tightly linked (23). In our study, we incubated cells with TSA and then estimated the amount of DNA methylation using methylation-sensitive restriction enzymes. We show that TSA led to the demethylation of Igf2r DNA, providing further proof of the interdependence of DNA methylation and histone acetylation. Selker (24) also demonstrated in Neurospora crassa that TSA treatment selectively demethylated and thus reactivated several genes that were originally suppressed by DNA hypermethylation.
Despite the fact that TSA led to equivalent demethylation of the Igf2r sense and antisense alleles, the histone deacetylase inhibitor had significantly different effects on the expression of the sense and antisense transcripts in the same cell, stimulating the relaxation of antisense imprinting to a far greater extent than the relaxation of sense transcript imprinting. This phenomenon suggests that factors other than DNA methylation and histone acetylation regulate the transcription of the imprinted allele. It is likely in this case that the TSA-induced expression of the Igf2r maternal antisense transcript itself inhibited the relaxation of maternal Igf2r sense imprinting, in accordance with the antisense regulation of imprinting reported by Barlow and colleagues (12, 25).
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received July 13, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  L.-P. Wu, X. Wang, L. Li, Y. Zhao, S. Lu, Y. Yu, W. Zhou, X. Liu, J. Yang, Z. Zheng, et al. Histone Deacetylase Inhibitor Depsipeptide Activates Silenced Genes through Decreasing both CpG and H3K9 Methylation on the Promoter Mol. Cell. Biol., May 15, 2008; 28(10): 3219 - 3235. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Wee, J.-J. Shim, D.-B. Koo, J.-I. Chae, K.-K. Lee, and Y.-M. Han Epigenetic alteration of the donor cells does not recapitulate the reprogramming of DNA methylation in cloned embryos Reproduction, December 1, 2007; 134(6): 781 - 787. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Royo, E. Basyuk, V. Marty, M. Marques, E. Bertrand, and J. Cavaille Bsr, a Nuclear-retained RNA with Monoallelic Expression Mol. Biol. Cell, August 1, 2007; 18(8): 2817 - 2827. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Price, S. K. Murphy, and E. V. Younglai Perspectives: The Possible Influence of Assisted Reproductive Technologies on Transgenerational Reproductive Effects of Environmental Endocrine Disruptors Toxicol. Sci., April 1, 2007; 96(2): 218 - 226. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Wee, D.-B. Koo, B.-S. Song, J.-S. Kim, M.-J. Kang, S.-J. Moon, Y.-K. Kang, K.-K. Lee, and Y.-M. Han Inheritable Histone H4 Acetylation of Somatic Chromatins in Cloned Embryos J. Biol. Chem., March 3, 2006; 281(9): 6048 - 6057. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Xiong, S. C. Dowdy, K. C. Podratz, F. Jin, J. R. Attewell, N. L. Eberhardt, and S.-W. Jiang Histone Deacetylase Inhibitors Decrease DNA Methyltransferase-3B Messenger RNA Stability and Down-regulate De novo DNA Methyltransferase Activity in Human Endometrial Cells Cancer Res., April 1, 2005; 65(7): 2684 - 2689. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. H. Vu, T. Li, and A. R. Hoffman Promoter-restricted histone code, not the differentially methylated DNA regions or antisense transcripts, marks the imprinting status of IGF2R in human and mouse Hum. Mol. Genet., October 1, 2004; 13(19): 2233 - 2245. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Lucifero, M. R.W. Mann, M. S. Bartolomei, and J. M. Trasler Gene-specific timing and epigenetic memory in oocyte imprinting Hum. Mol. Genet., April 15, 2004; 13(8): 839 - 849. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Li, T. H. Vu, G. A. Ulaner, Y. Yang, J.-F. Hu, and A. R. Hoffman Activating and silencing histone modifications form independent allelic switch regions in the imprinted Gnas gene Hum. Mol. Genet., April 1, 2004; 13(7): 741 - 750. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Lucifero, J.R. Chaillet, and J. M. Trasler Potential significance of genomic imprinting defects for reproduction and assisted reproductive technology Hum. Reprod. Update, January 1, 2004; 10(1): 3 - 18. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Yang, T. Li, T. H. Vu, G. A. Ulaner, J.-F. Hu, and A. R. Hoffman The Histone Code Regulating Expression of the Imprinted Mouse Igf2r Gene Endocrinology, December 1, 2003; 144(12): 5658 - 5670. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Sato, A. Maitra, N. Fukushima, N. T. van Heek, H. Matsubayashi, C. A. Iacobuzio-Donahue, C. Rosty, and M. Goggins Frequent Hypomethylation of Multiple Genes Overexpressed in Pancreatic Ductal Adenocarcinoma Cancer Res., July 15, 2003; 63(14): 4158 - 4166. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. VERMA Viral Genes and Methylation Ann. N.Y. Acad. Sci., March 1, 2003; 983(1): 170 - 180. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. B. Hassan Keys to the Hidden Treasures of the Mannose 6-Phosphate/Insulin-Like Growth Factor 2 Receptor Am. J. Pathol., January 1, 2003; 162(1): 3 - 6. [Full Text] [PDF]
|
|
|
|
|
|
R. I. Gregory, L. P. O'Neill, T. E. Randall, C. Fournier, S. Khosla, B. M. Turner, and R. Feil Inhibition of Histone Deacetylases Alters Allelic Chromatin Conformation at the Imprinted U2af1-rs1 Locus in Mouse Embryonic Stem Cells J. Biol. Chem., March 29, 2002; 277(14): 11728 - 11734. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. I. Gregory, T. E. Randall, C. A. Johnson, S. Khosla, I. Hatada, L. P. O'Neill, B. M. Turner, and R. Feil DNA Methylation Is Linked to Deacetylation of Histone H3, but Not H4, on the Imprinted Genes Snrpn and U2af1-rs1 Mol. Cell. Biol., August 15, 2001; 21(16): 5426 - 5436. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. B. Fulmer-Smentek and U. Francke Association of acetylated histones with paternally expressed genes in the Prader-Willi deletion region Hum. Mol. Genet., March 1, 2001; 10(6): 645 - 652. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Cervoni and M. Szyf Demethylase Activity Is Directed by Histone Acetylation J. Biol. Chem., October 26, 2001; 276(44): 40778 - 40787. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology |
