help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Magoulas, C.
Right arrow Articles by Robinson, I. C. A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Magoulas, C.
Right arrow Articles by Robinson, I. C. A. F.
Endocrinology Vol. 141, No. 12 4681-4689
Copyright © 2000 by The Endocrine Society


ARTICLES

A Secreted Fluorescent Reporter Targeted to Pituitary Growth Hormone Cells in Transgenic Mice

C. Magoulas1, L. McGuinness, N. Balthasar, D. F. Carmignac, A. K. Sesay, K. E. Mathers, H. Christian, L. Candeil, X. Bonnefont, P. Mollard and I. C. A. F. Robinson

Division of Neurophysiology (C.M., L.M., N.B., D.F.C., A.K.S., K.E.M., I.C.A.F.R.), National Institute for Medical Research Mill Hill, London NW7 1AA, United Kingdom; Department of Human Anatomy and Genetics (H.C.), University of Oxford, Oxford OX1 3QX, United Kingdom; and INSERM U-469 (L.C., X.B., P.M.), Montpellier 34094, Cedex 5, France

Address all correspondence and requests for reprints to: Professor Iain C. A. F. Robinson, Division of Neurophysiology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, United Kingdom. E-mail: irobins{at}nimr.mrc.ac.uk


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In stable transfection experiments in the GH-producing GC cell line, a construct containing the entire signal peptide and the first 22 residues of human GH linked in frame with enhanced green fluorescent protein (eGFP), produced brightly fluorescent cells with a granular distribution of eGFP. This eGFP reporter was then inserted into a 40-kb cosmid transgene containing the locus control region for the hGH gene and used to generate transgenic mice. Anterior pituitaries from these GH-eGFP transgenic mice showed numerous clusters of strongly fluorescent cells, which were also immunopositive for GH, and which could be isolated and enriched by fluorescence-activated cell sorting. Confocal scanning microscopy of pituitary GH cells from GH-eGFP transgenic mice showed a markedly granular appearance of fluorescence. Immunogold electron microscopy and RIA confirmed that the eGFP product was packaged in the dense cored secretory vesicles of somatotrophs and was secreted in parallel with GH in response to stimulation by GRF. Using eGFP fluorescence, it was possible to identify clusters of GH cells in acute pituitary slices and to observe spontaneous transient rises in their intracellular Ca2+ concentrations after loading with Ca2+ sensitive dyes. This transgenic approach opens the way to direct visualization of spontaneous and secretagogue-induced secretory mechanisms in identified GH cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SOMATOTROPHS constitute the major endocrine cell type in the anterior pituitary gland, in which all the processes of hormone production, storage, stimulus/secretion coupling and release mechanisms may be studied. In vivo, GH release is usually highly pulsatile involving large amplitude bursts of secretion, and this probably requires the coordinated activation of many GH cells (1, 2). Studies of living populations of primary pituitary GH cells would be greatly facilitated by the ability to visualize secretory processes directly in identified cells.

One way to achieve this is to use the intrinsically fluorescent reporter molecule, green fluorescent protein (GFP) (3), which when expressed from cell-specific promoters in transgenic animals, can identify specific cell types in situ (4, 5, 6, 7) and provides a fluorescent tag for their isolation and analysis, using fluorescence-activated cell sorting (FACS) techniques (8, 9). Because GFP fluorescence is often unaffected by fusion to other sequences, intracellular distribution and secretion events can also be visualized by tagging GFP with sequences that target it to different subcellular compartments (10, 11, 12).

In this study, we have targeted enhanced GFP (eGFP) to the secretory vesicles of pituitary GH cells in transgenic mice. By combining RIA with fluorescence and immuno-electronmicroscopic imaging of eGFP and performing calcium imaging in pituitary slices in situ (13), secretory processes may be now be studied in GH cell populations, at the single GH cell level and even at a subcellular level of resolution. Some of these results have been presented in preliminary form (14).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Construction of hGH-eGFP plasmids for transfection of GC cells
Two different lengths of the 5' coding sequence of the human GH gene (15) were fused in frame with an enhanced variant of GFP (eGFP). The longer version of the hGH-eGFP fusion construct (p48GH-eGFP), contains a genomic sequence encoding the first 48 amino acids of the hGH gene product (signal peptide and N-terminal 22 residues of hGH) fused in frame via a 15mer oligonucleotide linker to the coding sequence of eGFP. Briefly, an XmaI-NotI fragment (750 bp) of the pEGFP-N3 CMV expression plasmid (CLONTECH Laboratories, Inc., Palo Alto, CA), was blunt ended by Klenow and ligated into the PvuII sites of an hGH genomic clone (16) containing 5'- and 3' untranslated hGH sequences flanked by an MluI linker. This MluI fragment was then cloned into a version of the pEGFP-N3 expression plasmid (pN3/M), modified by insertion of a MluI cloning site in place of its XmaI-NotI fragment (see Fig. 1bGo).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. hGH-eGFP constructs. Two plasmid constructs (a and b) and a cosmid construct (c) were engineered. a, Mammalian expression plasmid containing a CMV promoter driving 5'and 3' sequences of the hGH gene (shaded bars), with sequences corresponding to the first 8 amino acids of the signal peptide of hGH linked in frame with eGFP. b, The same plasmid, but with the eGFP linked to a longer 5' hGH sequence encoding the entire 26 residue signal peptide plus the first 22 amino acids of hGH. c, A transgene cosmid containing the longer hGH-eGFP fusion sequences under the transcriptional control of the 40kB hGH locus control region. Shaded bars indicate hGH genomic sequences; exonic sequences shown by black or white bars. Hatched bars correspond to vector sequence. Restriction sites shown are: M MluI; B BamHIII; N NotI; Sp SpI. M* indicates position of the novel MluI site engineered into the hGH cosmid (see text).

 
A shorter version of the hGH-eGFP construct (p8GH-eGFP) was derived from p48GH-GFP and contained genomic sequence encoding only the first 8 amino acids of the hGH signal peptide linked in frame with eGFP as described above. This was engineered by a PCR strategy based on p48GH-eGFP as a template. The forward primer was a 5' vector sequence which introduced multiple cloning sites upstream of the amplified hGH sequence. The reverse primer (5'GCGGGATCCGGACGTCCGGGAGCCTGGGGAGAA3') was designed to recognize the hGH coding sequence at codon 8, flanked by a BamHI cloning site. The PCR product of this reaction was then inserted in place of the EcoRI-BamHI fragment of the p48GH-eGFP plasmid construct (Fig. 1aGo).

Construction of a GH-eGFP cosmid for generating transgenic animals
A 40 kb (K2B) cosmid (15), containing the locus control region (LCR) for the human GH gene was a generous gift from Professor Nancy Cooke (Pennsylvania University). After reversing the orientation of the insert of this cosmid (B2K), a unique MluI site was introduced upstream of the coding region of the hGH gene by PCR site-directed mutagenesis to alter the sequence at -326 bp from 5'-CCACGT-3' to 5'-ACGCGT-3'. The hGH gene sequences of this cosmid (cosGH.M) could then be excised as a single MluI fragment (Fig. 1cGo) and replaced with the MluI-linked GH-eGFP sequence to give cosGH-eGFP. The final cosmid thus contained an approximately 40 kb insert containing the LCR, 5'and 3'untranslated sequences for the hGH gene driving expression of the GH-eGFP fusion protein described above in p48GH-eGFP. Note that intact hGH cannot be generated from this construct.

Cell cultures and production of stable GC cell lines
Reagents were from Sigma unless otherwise stated. GC cells (17) were maintained in a complete medium consisting of D-MEM, 15% horse serum, 2.5% FCS (PAA, Weiner Strasse, Austria), 2 mM L-glutamine, supplemented with penicillin, streptomycin and amphotericin. GC cells (200,000 in a 60-mm culture dish) were transfected with 2 µg plasmid DNA using Lipofectamine, (Life Technologies, Inc.) following the protocols supplied by the manufacturer. Stably transfected cells were selected for neomycin resistance by addition of G-418, 250 µg/ml, for 21 days. Strongly eGFP-positive cells were readily apparent under low power fluorescence microscopy.

Generation of transgenic animals
DNA of the cosGH-eGFP construct was digested with NotI, the 40-kb insert purified by ultracentrifugation in a 5–20% salt gradient (18), and brought to a concentration of 1–5 ng/µl with 0.5 mM EDTA, 1 mM Tris-HCl, pH 7.5. Transgenic mice were generated by pronuclear microinjection of fertilized oocytes of superovulated (CBa/Ca x C57Bl/10) mice followed by oviductal transfer into pseudopregnant recipients (19).

DNA and RNA analysis of transgenic animals
Genomic DNA from tail biopsies was analyzed for transgene DNA by standard Southern and PCR procedures. A PCR assay for the first intron of hGH sequence present in the transgene was developed, using exonic primers: forward: 5'-ACCACTCAGGGTCCTGTGGACAG.3' reverse: 5'-CCTCTTGAAGCCAGGGCAGGCAGAGCAGGC.3'), which amplified across the intron. Thirty cycles of amplification were performed under the following conditions: 94 C for 1 min, 60 C for 30 sec, and 72 C for 90 sec per cycle.

Total RNA from pituitaries was isolated by using the Trizol reagent as described by the manufacturer (Life Technologies, Inc.). For Northern analysis, RNA was electrophoresed in a 1.2% agarose gel containing 8% formaldehyde, blotted onto a N+ membrane (Amersham Pharmacia Biotech) and hybridized at 45 C in 5xSSC, 5x Denhardt’s solution, 50 mM phosphate buffer, pH 6.5, 0.1% SDS, salmon sperm DNA (250 mg/ml) and 50% formamide. Membranes were washed with 0.1 x SSC and 0.1% SDS at 65 C. A 700-bp XmaI-NotI fragment of pEGFP-N3 vector was radiolabeled by random priming (Prime-a Gene, Promega Corp.) and used as a hybridization probe for eGFP sequences.

Immunocytochemistry
Mouse pituitaries were fixed in 4% paraformaldehyde for 12 h, washed in acetone for 2 h, and embedded in paraffin wax. Tissue sections (6 µm) were dewaxed in histoclear (National Diagnostics, GA), taken through 100%, 70%, and 30% acetone for 20 sec each, and then washed in distilled water. After incubation in a blocking solution (20% normal goat serum, 5% BSA in Tris/HCl saline buffer) for 30 min at room temperature, they were exposed to a monkey anti-rGH serum (NIDDK, 1:2000 dilution) overnight at 4 C. Sections were washed and then incubated with biotinylated goat antihuman antiserum (NIDDK, 1:200 dilution) for 30 min at room temperature. After washing, sections were incubated with TRITC-avidin (Sigma, 1:1000) for 30 min at room temperature. Finally, DAPI (Molecular Probes, Inc., 1 µg/ml) was added for 2 min to stain cell nuclei.

Electron microscopy
After initial fixation (2.5% glutaraldehyde in phosphate buffer for 2 h then 0.25% overnight), pituitary segments were postfixed in osmium tetroxide (1% wt/vol in 0.1 M phosphate buffer) stained with uranyl acetate (2% wt/vol in distilled water), dehydrated through increasing concentrations of ethanol (70–100%) and embedded in LR Gold (London Resin Co., Reading, UK) or Spurr resin. Ultrathin sections (50–80nm) were incubated at room temperature with a polyclonal anti-GFP (1:300) followed by Protein A linked to 15 nm gold (British Biocell, Cardiff, UK). Primary antibody incubations were for 2 h and secondary antibody incubations for 1 h and all antisera were diluted in 0.1 M phosphate buffer containing 0.1% egg albumin. For control sections, the primary antibody was replaced by an unrelated polyclonal antibody. After immunolabeling, sections were lightly counterstained with lead citrate and uranyl acetate and examined with a transmission electron microscope (JEM-1010, JEOL, Peabody, MA).

FACS analysis
Ten pituitaries from GH-eGFP transgenic mice were gently minced and then treated with collagenase (0.1 mg/ml) for 15 min at 37 C. DNase (50 µg/ml) was added and incubated for a further 45 min. Dispersed cells were pelleted by centrifugation and resuspended in FACS buffer (10 g NaCl, 0.25 g KCl, 1.37 g Na2HPO4, 0.25 g KH2PO4, 1 g BSA, per liter, pH 7.3), layered onto 4% BSA in FACS buffer in a 15-ml tube and centrifuged for 5 min at 100 x g to remove cell debris. Cells were gently resuspended in 0.5 ml of FACS buffer and analyzed on a FACS Star Plus machine (Becton-Dickinson and Co., San Jose, CA) with WinMDI software, using the FITC channel to gate for eGFP fluorescence. Aliquots of the starting cell suspension, and cell pools sorted by eGFP fluorescence intensity were collected and assayed for mouse GH (mGH) content.

GH release studies
Freshly dissected pituitary glands were placed in 2 ml Eagle’s medium without glutamine, rinsed several times and then incubated for 2 h at 37 C with medium changed every 30 min. Following this washout period, the pituitaries were incubated in 0.5 ml aliquots of medium and exposed to 1 µg/ml hGRF 1–29 NH2(Bachem, Inc.), and after a further 90-min recovery period, to 5 µg/ml hGRF 1–29 NH2. The medium was collected and assayed for GH and eGFP contents by RIA (see below).

RIA
Mouse GH in pituitary or cell extracts was assayed by RIA as previously described for the rat (20), using mouse reagents kindly provided by NIDDK (Bethesda, MD). For eGFP a new RIA was developed as follows: recombinant eGFP (CLONTECH Laboratories, Inc.), 5 µg, was radioiodinated with NaI125 using the Iodogen method as previously described (21), and purified by Sephadex G75 chromatography. For assay, 100 µl of iodinated eGFP (5–7000 cpm) were mixed with 100 µl of tissue extract or standards (0.01–10 ng) of recombinant eGFP and 100 µl polyclonal antibody against GFP (Molecular Probes, Inc., Eugene, OR) at a dilution of 1:500,000 for 16 h at room temperature. Bound and free fractions were separated by addition of 2 vol 18% polyethylene glycol, followed after 30 min by centrifugation. Radioactivity in the pellets was determined by {gamma} counting. The assay sensitivity was 10 pg eGFP.

Cytosolic calcium imaging of pituitary tissue
The procedure was essentially as previously described (13, 22), but adapted for the mouse. Briefly, anterior pituitary slices (150 µm) were prepared from 7- to 9-week-old male mice. Because of the small size of the mouse pituitary gland, the tissue was immobilized within a droplet of ultra-low temperature gelling agarose (type IX-A, Sigma, St. Louis, MO) before cutting with a vibrating blade microtome (Leica Corp. VT 1000S, Leica Corp., Nussloch, Germany). Before recording, slices were incubated with Ringer’s saline supplemented with essential amino acids for 1–8 h in a humidified incubator (5% CO2-95% O2). For fluorometric calcium recordings, slices were loaded with the membrane-permeable form of fura-2 (fura-2 AM, Molecular Probes, Inc.). An FITC cube was used to demarcate the boundaries of eGFP-positive cells and thus generate a map of GH cells within each field. A combination of a 380-nm excitation filter, a 430-nm dichroic mirror, and a 480-nm barrier filter (Nikon, Paris, France) was then used to monitor fura-2 emission. Only cells showing both eGFP and fura-2 emission fluorescences were recorded. Fluorescent images were taken with an intensified cooled charge-coupled device camera (PentaMAX Gen Iv; Princeton Instruments, Trenton, NJ). Camera acquisition rate was 20–100 msec per frame, and each pixel was digitized at 12 bits. Images were acquired with Metafluor (Universal Imaging Corp., West Chester, PA), and analyzed with Igor Pro 3.16 software (Wavemetrics, Inc., Lake Oswego, OR). [Ca2+]i changes were expressed as an –F/F0 ratio, where F0 was the minimum fluorescence intensity measured after off-line correction of the basal level and data inversion (13).

Data analysis
Unless otherwise stated, data are shown as mean ± SEM. Differences between groups were analyzed by Student’s t test, with P < 0.05 taken as significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids containing eGFP sequences fused to sequences encoding two different lengths of the amino terminus of hGH (Fig. 1Go, a and b) were transfected into the GH-producing GC cell lines, and several stable lines were established. Expression of eGFP in these cells was examined by confocal microscopy. Both constructs produced brightly fluorescent cells, but with a markedly different distribution of fluorescence (Fig. 2Go). The shorter construct, expressing eGFP with only 8 amino acids of the GH signal peptide showed a relatively uniform distribution of fluorescence throughout the cells, whereas the longer construct expressing the entire signal peptide and the first 22 residues of hGH fused to eGFP gave a punctate distribution of fluorescence, consistent with a granular targeting of this product.



View larger version (138K):
[in this window]
[in a new window]
 
Figure 2. Expression of eGFP in GC cell lines. GH-producing GC cells were transfected with CMV promoter plasmids containing the reporter constructs shown in Fig. 1Go, a and b, and stable cell lines were generated. Living cells in culture were examined by confocal microscopy. Left panels (A, C), eGFP fluorescence. Right panels (B, D), phase contrast image. (A) The construct containing sequences corresponding to 8 amino acids of the GH signal peptide fused to eGFP expressed a product, which showed an intense, evenly distributed fluorescence (C) The construct containing sequences corresponding to the entire hGH signal peptide and part of the amino terminus of hGH fused to eGFP expressed a product which gave an intense, punctate distribution of fluorescence. Scale bar, 10 µm.

 
Next, transgenic mice were generated using the longer version of the eGFP construct, driven by the hGH LCR cosmid. Three founders were obtained that incorporated the transgene as assessed by Southern blots and PCR. All three founders were bred and gave positive progeny which showed strong eGFP expression in the anterior pituitary. One of these lines, termed GH-eGFP, was chosen for further study.

Northern analysis of pituitary RNA with an eGFP probe showed a single abundant transcript of the expected size in the transgenic but not wild-type mice (Fig. 3Go, A and B). RIA showed that eGFP-immunoreactive protein was readily detectable in extracts of pituitary glands from transgenic but not wild-type animals (Fig. 3CGo). No eGFP expression was detected in other tissues examined such as brain, kidney, spleen (not shown). Measurements of pituitary mGH content in transgenic and wild-type mice showed a significant reduction in GH stores in both male and female transgenic animals compared with wild-type littermates, but this did not affect their growth rates (Table 1Go), and the transgenic animals appeared phenotypically normal.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 3. Analysis of eGFP expression in transgenic GH-eGFP mice. A, Mice carrying a GH-eGFP transgene could be identified by PCR analysis of tail DNA. Primers were chosen to span the first intron of the GH gene and amplified a 382-bp product from the transgene as well as a smaller 290-bp product from the endogenous mouse GH gene. (-) wild-type animals; (+) transgenic animals. B, Northern blot analysis of RNA from wild-type (-) and transgenic (+) mice showed a strong band hybridizing with a probe corresponding to the eGFP coding region in transgenic progeny only. C, GFP content was assayed by RIA in pituitary extracts from wild-type (-) and transgenic (+) mice.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Pituitary GH content and body weights in GH-eGFP transgenic mice

 
Fluorescence microscopy showed a major population of the anterior pituitary cells strongly fluorescent for eGFP, whereas there was no expression in the posterior pituitary (Fig. 4AGo). As was observed in GC cells transfected with the same construct, individual pituitary GH cells from GH-eGFP transgenic mice showed a punctate distribution of eGFP fluorescence when examined by scanning confocal microscopy (Fig. 4BGo). The cells showing eGFP fluorescence were compared with those expressing GH, as identified by immunocytochemistry. Figure 4Go shows three-color confocal microscopy of a section of a GH-eGFP mouse anterior pituitary (Fig. 4CGo) stained with an antibody to GH and visualized with TRITC (Fig. 4DGo), and also stained with DAPI (Fig. 4EGo) to visualize all cell nuclei. About half of the cells showed eGFP fluorescence, and virtually all of these colocalized with GH immunoreactivity, (Fig. 4FGo).



View larger version (51K):
[in this window]
[in a new window]
 
Figure 4. Fig. 4. eGFP localization in pituitary GH cells from transgenic mice. A, Strong eGFP fluorescence is observed in many cells of the anterior pituitary (AP) of GH-eGFP transgenic mice. Note the absence of eGFP fluorescence in the posterior pituitary (PP). B, Confocal scanning image through a single eGFP-positive GH cell showing a highly granular distribution of eGFP. C, Confocal microscopy of eGFP in a section of anterior pituitary from a GH-eGFP transgenic mouse. D, The same section after immunostaining for mGH followed by a second antibody tagged with TRITC. E, The same section stained with DAPI to visualize all cell nuclei and this image superimposed with that in (C). F, An overlay of the images in D and C to show colocalization of eGFP with GH. Scale bars, 10 µm.

 
To investigate the punctate localization, sections of pituitary from GH-eGFP transgenic mice were processed for eGFP immunogold electron microscopy. The ultrastructural morphology of somatotrophs from GH-eGFP transgenic mice was indistinguishable from that in nontransgenic animals and showed numerous large dense cored GH secretory vesicles. These secretory granules showed specific immunogold labeling with an anti-GFP antibody (Fig 5Go), and no specific labeling of any other structure was apparent.



View larger version (156K):
[in this window]
[in a new window]
 
Figure 5. Immunoelectron microscopy of eGFP in GH-eGFP transgenic mouse pituitary cells. Ultrathin pituitary sections from GH-eGFP transgenic mice were processed for immunogold electronmicroscopy. Numerous dense-cored secretory vesicles could be seen in somatotrophs. Immunogold labeling, performed using a primary antibody against GFP showed the GH-eGFP product clearly localized to these secretory vesicles (large black grains, inset). No specific labeling of any other structure was observed, and no labeling was seen in sections from wild-type mice (not shown). Magnification, 10,000x.

 
As the GH-eGFP protein product was packaged in the secretory vesicles, it should be released in response to specific GH secretagogues. To test this, pituitary glands from GH-eGFP transgenic mice were incubated in vitro before and after challenge with 1 and 5 µg/ml hGRF1–29NH2. The release of GH and eGFP into the incubate was measured by specific RIAs for these proteins and the results are shown in Fig. 6Go. Both eGFP and GH were released in a highly parallel, dose-dependent manner in response to this GH secretagogue.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 6. eGFP is secreted from GH cells in GH-GFP transgenic mice. Pituitary glands were removed from groups of normal (n = 6) and GH-eGFP (n = 4) transgenic mice and incubated in vitro in a succession of 30 min incubations, after which the media were collected and replaced by fresh media. After 90 min, and again after 210 min, hGRF1–29NH2 (GRF) 1 µg or 5 µg/ml was added to the media. The media concentrations of mouse GH (open bars) and eGFP (closed bars) were measured by RIA. Data shown are mean ± SEM * P < 0.05; ** P < 0.01 vs. sample immediately before stimulation.

 
The endogenous GFP fluorescence could be used to analyze and enrich populations of GH cells from transgenic pituitary isolates by FACS. Figure 7Go illustrates the results from an experiment in which pituitaries from a group of 10 GH-eGFP mice were isolated, the cells dissociated, and subjected to FACS. Strongly fluorescing eGFP-containing cells could readily be separated, counted and collected (Fig. 7AGo). Measurement of GH by RIA showed the strongly fluorescent population (Fraction II) to be markedly enriched in GH content compared with the unsorted cell suspension, whereas the remaining cells (Fraction I) were depleted in GH (Fig. 7BGo).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 7. FACS of eGFP positive pituitary cells from GH-eGFP transgenic mice. A, Pituitary cells were isolated and dispersed from 10 GH-eGFP transgenic mice and analyzed by FACS. A strongly fluorescent subpopulation of cells could be identified (Fraction II), which in this experiment corresponded to 22% of the cells analyzed (B). This cell population shows a marked enrichment in GH content measured by RIA (open bar) when compared with that of the original isolate (shaded bar), and with the eGFP-negative Fraction I, which was depleted in GH (solid bar) relative to the unsorted starting material.

 
The eGFP transgene product also provided a means of identifying multiple somatotrophs in living pituitary slices in situ, so that physiological responses may be monitored in several cells simultaneously. Figure 8Go illustrates the results of such an experiment in which spontaneous changes of intracellular calcium concentration ([Ca2+]i) were recorded from three fura-2-loaded cells identified as GH cells by their eGFP fluorescence. Mouse GH cells showed spontaneous fast transient rises in [Ca2+]i (time to peak = 210 ± 29 msec, n = 24). All the GH-eGFP cells displayed [Ca2+]i bursts, but with different patterns. In some cells, bursts displayed a stepwise onset followed by a high frequency spiking plateau phase (Fig. 8Go, cells labeled 2 and 3) whereas in others, they showed an incremental rising phase due to the summation of high frequency, low amplitude [Ca2+]i transients (Fig. 8Go, cell labeled 1). All these patterns of [Ca2+]i transients in GH-eGFP cells were reversibly suppressed upon local application of a Ringer’s saline containing 500 µM Cd2+ ions (n = 13), suggesting that the [Ca2+]i transients were due to spontaneous Ca2+-dependent action potentials (22).



View larger version (68K):
[in this window]
[in a new window]
 
Figure 8. Patterns of spontaneous [Ca2+]i transients in GH-GFP cells. Upper left panel, Field of GH cells expressing eGFP. Upper right panel, Same field loaded with fura-2. The white circles highlight the area of three eGFP-positive cells in which changes in fura-2 fluorescence, reflecting [Ca2+]i levels, were monitored. Lower panel, Changes in fura-2 emission, normalized to baseline fluorescence (-F/F0), for the cells identified in the panels above. The bottom trace illustrates spontaneous [Ca2+]i transients monitored in cell #3 on a 4-fold expanded scale. Stars indicate [Ca2+]i bursts.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GFP has been used widely in cell biology to visualize and study cellular processes in real time (3). Most studies have used transfection to express GFP, fused to a variety of different proteins in cell lines, but GFP has also been expressed as a transgene, either ubiquitously (23) or under a variety of cell specific promoters. This is the first report to describe the generation and characterization of transgenic mice that express the enhanced variant of GFP specifically in pituitary GH cells. Although GFP has recently been expressed in neuroendocrine neurones by transgenesis (6, 7, 24), we are not aware of any reports of mammalian pituitary endocrine cells targeted in vivo in this way to date.

When expressed alone or with minimal N-terminal peptide extensions, eGFP pervades throughout the cytoplasm. However, targeting signals may be fused to GFP that direct localization of the fluorescent product to specific subcellular structures (10, 25, 26). In particular, GFP variants targeted to secretory vesicles have been used to follow the genesis, trafficking and regulated release from these organelles in endocrine cell lines (12, 27, 28). The hGH signal peptide (29) is sufficient to enable heterologous reporter sequences to be processed through the secretory pathway in cell cultures (30, 31). We fused eGFP sequences with those encoding the signal peptide and an additional portion of the N terminus of hGH, and found that the resulting fluorescent product was targeted to GH secretory vesicles, not only in cell lines but also in transgenic animals.

The inclusion of the additional N-terminal peptide was determined by several factors. With both constructs, the first intron of the hGH gene was included because this contains enhancer sequences that could be important for efficient transgene expression (32). This intron begins after the sequences encoding the first 3 residues of the hGH signal peptide, and to preserve the nucleotide sequence around the splice acceptor site, we also included sequences encoding the next 5 residues of the signal peptide from exon 2 before linking with eGFP sequences. We felt it unlikely that this short N-terminal octapeptide extension would alter the cytoplasmic fate of eGFP and so it proved when this was expressed in GC cells.

The construct that targeted eGFP to secretory vesicles included sequences encoding the entire hGH signal peptide and the first 22 residues of the N-terminal sequence of hGH. This was chosen as the product would include the two N-terminal histidine residues of hGH (18His and 21His), which contribute significant Zn2+ binding activity to hGH and which may be important for packaging of GH dimers and oligomers into secretory granules (33). Our data do not show whether these residues were important for granule packaging of eGFP or merely fortuitous, and a further series of constructs will be required to address this issue. One possibility is that the N-terminal GH sequences in this eGFP product interacted with rat or mouse GH sequences which facilitated copackaging in GC cells or in mouse somatotrophs. However, this cannot be the only explanation because the same product also gave granular staining when expressed in other secretory cell types (PC12 cells, unpublished results, hypothalamic GRF neurones (14)] that do not express endogenous GH.

Although minimal GH promoter sequences can express transgene reporters in somatotrophs, the intensity of expression is often low and variable. We used a much larger promoter including the entire LCR of hGH that reliably directs position-independent copy-number-dependent expression in the pituitaries of transgenic mice (15). This LCR contains several DNA elements, which are necessary for somatotroph specific expression (34, 35), so we made minimal changes to this cosmid, mutating 2 bp to generate a unique site into which the hGH-eGFP reporter could be cloned. As expected, this transgene achieved high-level specific eGFP transgene expression in pituitary GH cells, with no detectable expression in other pituitary cell types or in other tissues examined. Because a B-cell receptor subunit gene (CD79b) was recently discovered to be present within this hGH LCR (36), and thus present in our transgene, we specifically examined lymphocytes from GH-eGFP mice. No eGFP fluorescence was detected in B cells isolated from these transgenic animals, and FACS analysis showed no changes in their lymphocyte population (unpublished results).

Confocal and EM immunogold studies confirmed that the eGFP was localized in the large dense-cored granules in somatotrophs. Expression of eGFP was accompanied by a significant reduction in the total amount of GH stored in the pituitaries of transgenic animals but did not otherwise disrupt the normal morphology or function of somatotrophs. The reduced pituitary GH reserve was clearly sufficient to maintain an adequate output of GH in transgenic mice because their growth was unaffected. This reduction in GH stores could reflect competition between the GH-eGFP product and endogenous mGH for granule packaging although there was much less eGFP than mouse GH stored in the pituitary. Because eGFP RNA transcripts were abundant, we suspect that the subsequent packaging or storage mechanisms are less efficient for the GH-eGFP product than for mouse GH. The aggregation and packaging of proteins in dense-cored granules probably involves specific interfacial features of protein structure favoring oligomerization (33), and it is known that sequences in addition to the signal peptide are also required for efficient packaging of GH (37, 38, 39, 40).

The eGFP product was clearly targeted to the regulated secretory pathway because it was released in response to the specific GH secretagogue, GRF. Initial attempts to quantify this by measuring eGFP fluorescence in the media were unsuccessful due to the large dilution involved in incubation studies. However, development of a sensitive RIA for eGFP enabled us to show directly that the transgene product was secreted in response to GRF in a dose-dependent fashion, closely paralleling GH release from the same tissues.

FACS analysis and sorting of live or fixed pituitary cell types has been described previously, using antibodies to the specific hormones released (41, 42). The eGFP in transgenic pituitary cell isolates provided a strong endogenous signal for FACS sorting of live cells, and a population of strongly eGFP-positive GH cells could be isolated without the need for pretreatment of the cells with antibodies or permeabilizing agents. This provides a convenient method for rapidly estimating the number of GH producing cells in individual pituitaries, and for isolating viable populations of somatotrophs that can be studied in vitro, free from paracrine interactions with other hormone-producing cell types.

GH cells are excitable and show spontaneous [Ca2+]i transients that correlate with secretion, but the study of this is labor intensive because the individual responding cells must be identified and characterized, usually by immunocytochemistry, post hoc (13, 22). We show here that intracellular calcium can readily be monitored simultaneously in several preidentified GH cells, using dual wavelength imaging for eGFP and fura-2, and observed the rapid short-lived increases in [Ca2+]i that reflect the outcome of transient calcium entry during action potentials in these cells. Furthermore, this is the first report that mouse GH cells display spontaneous rhythmic bursts of [Ca2+]i similar to those that have recently been characterized in postimmunoidentified GH cells in rat pituitary slices (22). Previous studies have recorded from single neuronal cells identified by GFP expression (7, 24). However, multicell imaging is possible in acute pituitary slices from GH-eGFP mice, and we are using this approach to study the GH cell populations in different pituitary subregions in situ and whether they coordinate the timing of their responses to the entry or exit of secretagogues or inhibitors, to or from the glandular parenchyma.

Although not addressed in this study, the eGFP transgene product could also be used to monitor GH gene expression in vivo, assuming that the hGH LCR sequences respond to those physiological signals that regulate mouse GH. Quantitative imaging of GFP at the subcellular level in single cells is clearly possible (28), but there are some kinetic limitations to using this approach due to the time taken for newly synthesized GFP to fold into a fluorophore conformation, its half-life and its sensitivity to photobleaching. Newer variants of GFP, with a shorter half-life, or sensitive to calcium (43), membrane potential (44) or pH changes (45), are useful probes of many aspects of cell physiology. Combining these with the transgenic approach we describe opens the way for direct studies of these processes not only in single GH cells, but also in GH cell populations, following their responses to physiological signals in the whole animal.


    Acknowledgments
 
We are grateful to Nancy Cooke for providing us with the hGH LCR cosmid, to S. Pagakis for assistance with confocal microscopy, to Chris Atkins for help with FACS, and to James De Jersey for help with the B cell analysis. We thank Emma Sparks and Audrey Creff for excellent technical assistance.


    Footnotes
 
1 Present address: Neuroscience Section, Division of Medical Sciences, Queen Mary & Westfield College, London, United Kingdom. Back

Received July 20, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Robinson ICAF, Hindmarsh PC 1999 The importance of the secretory pattern of growth hormone for statural growth. In: Kostyo JL (ed) American Handbook of Physiology. Oxford University Press, New York, vol 5:329–395
  2. Robinson ICAF 2000 Control of growth hormone (GH) release by GH secretagogueues. Novartis Foundation Symposium 227:206–220[Medline]
  3. Tsien RY 1998 The green fluorescent protein. Annu Rev Biochem 67:509–544[CrossRef][Medline]
  4. Srinivas S, Goldberg MR, Watanabe T, D’Agati V, al-Awqati Q, Costantini F 1999 Expression of green fluorescent protein in the ureteric bud of transgenic mice: a new tool for the analysis of ureteric bud morphogenesis. Dev Genet 24:241–251[CrossRef][Medline]
  5. Chiocchetti A, Tolosano E, Hirsch E, Silengo L, Altruda F 1997 Green fluorescent protein as a reporter of gene expression in transgenic mice. Biochim Biophys Acta 1352:193–202[Medline]
  6. Young III WS, Iacangelo A, Luo XZ, King C, Duncan K, Ginns EI 1999 Transgenic expression of green fluorescent protein in mouse oxytocin neurones. J Neuroendocrinol 11:935–939[CrossRef][Medline]
  7. Spergel DJ, Kruth U, Hanley DF, Sprengel R, Seeburg PH 1999 GABA- and glutamate-activated channels in green fluorescent protein-tagged gonadotropin-releasing hormone neurons in transgenic mice. J Neurosci 19:2037–2050[Abstract/Free Full Text]
  8. Manjunath N, Shankar P, Stockton B, Dubey PD, Lieberman J, von Andrian UH 1999 A transgenic mouse model to analyze CD8(+) effector T cell differentiation in vivo. Proc Natl Acad Sci USA 96:13932–13937[Abstract/Free Full Text]
  9. Kawakami N, Sakane N, Nishizawa F, Iwao M, Fukada SI, Tsujikawa K, Kohama Y, Ikawa M, Okabe M, Yamamoto H 1999 Green fluorescent protein-transgenic mice: immune functions and their application to studies of lymphocyte development. Immunol Lett 70:165–171[CrossRef][Medline]
  10. Lim CS, Baumann CT, Htun H, Xian W, Irie M, Smith CL, Hager GL 1999 Differential localization and activity of the A- and B-forms of the human progesterone receptor using green fluorescent protein chimeras. Mol Endocrinol 13:366–375[Abstract/Free Full Text]
  11. Steyer JA, Almers W 1999 Tracking single secretory granules in live chromaffin cells by evanescent-field fluorescence microscopy. Biophys J 76:2262–2271[Medline]
  12. Steyer JA, Horstmann H, Almers W 1997 Transport, docking and exocytosis of single secretory granules in live chromaffin cells. Nature 388:474–478[CrossRef][Medline]
  13. Guerineau NC, Bonnefont X, Stoeckel L, Mollard P 1998 Synchronized spontaneous Ca2+ transients in acute anterior pituitary slices. J Biol Chem 273:10389–10395[Abstract/Free Full Text]
  14. McGuiness LM, Balthasar N, Sesay AK, Mathers K, Magoulas C, Robinson ICAF Targeting fluorescent reporters to the hypothalamo-pituitary GH axis in transgenic mice. Program of the 81st Annual Meeting of The Endocrine Society, San Diego, CA, 1999, OR18–6
  15. Jones BK, Monks BR, Liebhaber SA, Cooke NE 1995 The human growth hormone gene is regulated by a multicomponent locus control region. Mol Cell Biol 15:7010–7021[Abstract]
  16. Flavell DM, Wells T, Wells SE, Carmignac DF, Thomas GB, Robinson ICAF 1996 Dominant dwarfism in transgenic rats by targeting human growth hormone (GH) expression to hypothalamic GH-releasing factor neurons. EMBO J 15:3871–3879[Medline]
  17. Pellegrini E, Carmignac DF, Bluet-Pajot MT, Mounier F, Bennett P, Epelbaum J, Robinson ICAF 1997 Intrahypothalamic growth hormone feedback: from dwarfism to acromegaly in the rat. Endocrinology 138:4543–4551[Abstract/Free Full Text]
  18. Dillon N, Grosveld F 1993 In: Hames BD, Higgins SJ (eds) Gene Transcription—A Practical Approach. IRL Press at O.U.P., Oxford
  19. Hogan BLH, Constantini F, Lacy E 1986 Manipulating the Mouse Embryo. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  20. Carmignac DF, Robinson ICAF 1990 Growth hormone (GH) secretion in the dwarf rat: release, clearance and responsiveness to GH-releasing factor and somatostatin. J Endocrinol 127:69–75[Abstract/Free Full Text]
  21. Robinson ICAF 1980 The development and evaluation of a sensitive and specific radioimmunoassay for oxytocin in unextracted plasma. J Immunoassay 1:323–347[Medline]
  22. Bonnefont X, Fiekers J, Creff A, Mollard P 2000 Rhythmic bursts of calcium transients in acute anterior pituitary slices. Endocrinology 141:868–875[Abstract/Free Full Text]
  23. Okabe M, Ikawa M, Kominami K, Nakanishi T, Nishimune Y 1997 ’Green mice’ as a source of ubiquitous green cells. FEBS Lett 407:313–319[CrossRef][Medline]
  24. Suter KJ, Song WJ, Sampson TL, Wuarin JP, Saunders JT, Dudek FE, Moenter SM 2000 Genetic targeting of green fluorescent protein to gonadotropin-releasing hormone neurons: characterization of whole-cell electrophysiological properties and morphology. Endocrinology 141:412–419[Abstract/Free Full Text]
  25. Herrington J, Rui L, Luo G, Yu-Lee LY, Carter-Su C 1999 A functional DNA binding domain is required for growth hormone-induced nuclear accumulation of Stat5B. J Biol Chem 274:5138–5145[Abstract/Free Full Text]
  26. Vallentin A, Prevostel C, Fauquier T, Bonnefont X, Joubert D 2000 Membrane targeting and cytoplasmic sequestration in the spatiotemporal localization of human protein kinase C alpha. J Biol Chem 275:6014–6021[Abstract/Free Full Text]
  27. Kaether C, Salm T, Glombik M, Almers W, Gerdes HH 1997 Targeting of green fluorescent protein to neuroendocrine secretory granules: a new tool for real time studies of regulated protein secretion. Eur J Cell Biol 74:133–142[Medline]
  28. Lang T, Wacker I, Wunderlich I, Rohrbach A, Giese G, Soldati T, Almers W 2000 Role of actin cortex in the subplasmalemmal transport of secretory granules in PC-12 Cells. Biophys J 78:2863–2877[Medline]
  29. Martial JA, Hallewell RA, Baxter JD, Goodman HM 1979 Human growth hormone: complementary DNA cloning and expression in bacteria. Science 205: 602–607
  30. Pecceu F, Dousset P, Shire D, Cavrois E, Marchese E, Ferrara P, Kaghad M, Dumont X, Lupker J 1991 Human interleukin 1ß fused to the human growth hormone signal peptide is N-glycosylated and secreted by Chinese hamster ovary cells. Gene 97:253–258[CrossRef][Medline]
  31. Blam SB, Mitchell R, Tischer E, Rubin JS, Silva M, Silver S, Fiddes JC, Abraham JA, Aaronson SA 1988 Addition of growth hormone secretion signal to basic fibroblast growth factor results in cell transformation and secretion of aberrant forms of the protein. Oncogene 3:129–136[Medline]
  32. Brinster RL, Allen JM, Behringer RR, Gelinas RE, Palmiter RD 1988 Introns increase transcriptional efficiency in transgenic mice. Proc Natl Acad Sci USA 85:836–840[Abstract/Free Full Text]
  33. Cunningham BC, Mulkerrin MG, Wells JA 1991 Dimerization of human growth hormone by zinc. Science 253:545–548[Abstract/Free Full Text]
  34. Bennani-Baiti IM, Asa SL, Song D, Iratni R, Liebhaber SA, Cooke NE 1998 DNase I-hypersensitive sites I and II of the human growth hormone locus control region are a major developmental activator of somatotrope gene expression. Proc Natl Acad Sci USA 95:10655–10660[Abstract/Free Full Text]
  35. Shewchuk BM, Asa SL, Cooke NE, Liebhaber SA 1999 Pit-1 binding sites at the somatotrope-specific DNase I hypersensitive sites I, II of the human growth hormone locus control region are essential for in vivo hGH-N gene activation. J Biol Chem 274:35725–35733[Abstract/Free Full Text]
  36. Bennani-Baiti IM, Cooke NE, Liebhaber SA 1998 Physical linkage of the human growth hormone gene cluster and the CD79b (Ig ß/B29) gene. Genomics 48:258–264[CrossRef][Medline]
  37. McAndrew SJ, Chen NY, Wiehl P, DiCaprio L, Yun J, Wagner TE, Okada S, Kopchick JJ 1991 Expression of truncated forms of the bovine growth hormone gene in cultured mouse cells. J Biol Chem 266:20965–20969[Abstract/Free Full Text]
  38. Chen WY, Wight DC, Chen NY, Coleman TA, Wagner TE, Kopchick JJ 1991 Mutations in the third {alpha}-helix of bovine growth hormone dramatically affect its intracellular distribution in vitro and growth enhancement in transgenic mice. J Biol Chem 266:2252–2258[Abstract/Free Full Text]
  39. Liebhaber SA, Ray J, Cooke NE 1986 Synthesis of growth hormone-prolactin chimeric proteins and processing mutants by the exchange and deletion of genomic exons. J Biol Chem 261:14301–14306[Abstract/Free Full Text]
  40. Moore HH, Kelly RB 1986 Re-routing of a secretory protein by fusion with human growth hormone sequences. Nature 321:443–446[CrossRef][Medline]
  41. Wynick D, Critchley R, Venetikou MS, Burrin JM, Bloom SR 1990 Purification of functional lactotrophs and somatotrophs from female rats using fluorescence-activated cell sorting. J Endocrinol 126:269–274[Abstract/Free Full Text]
  42. Wynick D, Venetikou MS, Critchley R, Burrin JM, Bloom SR 1990 Flow cytometric analysis of functional anterior pituitary cells from female rats. J Endocrinol 126:261–268[Abstract/Free Full Text]
  43. Emmanouilidou E, Teschemacher AG, Pouli AE, Nicholls LI, Seward EP, Rutter GA 1999 Imaging Ca2+ concentration changes at the secretory vesicle surface with a recombinant targeted cameleon. Curr Biol 9:915–918[CrossRef][Medline]
  44. Cacciatore TW, Brodfuehrer PD, Gonzalez JE, Jiang T, Adams SR, Tsien RY, Kristan Jr WB, Kleinfeld D 1999 Identification of neural circuits by imaging coherent electrical activity with FRET-based dyes. Neuron 23:449–459[CrossRef][Medline]
  45. Llopis J, McCaffery JM, Miyawaki A, Farquhar MG, Tsien RY 1998 Measurement of cytosolic, mitochondrial, and Golgi pH in single living cells with green fluorescent proteins. Proc Natl Acad Sci USA 95:6803–6808[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J EndocrinolHome page
N. Chauvet, T. El-Yandouzi, M.-N. Mathieu, A. Schlernitzauer, E. Galibert, C. Lafont, P. Le Tissier, I. C Robinson, P. Mollard, and N. Coutry
Characterization of adherens junction protein expression and localization in pituitary cell networks
J. Endocrinol., September 1, 2009; 202(3): 375 - 387.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S.-K. Yang, K. Wang, H. Parkington, and C. Chen
Involvement of Tetrodotoxin-Resistant Na+ Current and Protein Kinase C in the Action of Growth Hormone (GH)-Releasing Hormone on Primary Cultured Somatotropes from GH-Green Fluorescent Protein Transgenic Mice
Endocrinology, September 1, 2008; 149(9): 4726 - 4735.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
X. Bonnefont, A. Lacampagne, A. Sanchez-Hormigo, E. Fino, A. Creff, M.-N. Mathieu, S. Smallwood, D. Carmignac, P. Fontanaud, P. Travo, et al.
Revealing the large-scale network organization of growth hormone-secreting cells
PNAS, November 15, 2005; 102(46): 16880 - 16885.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
I. Huerta-Ocampo, H. C. Christian, N. M. Thompson, M. M. El-Kasti, and T. Wells
The Intermediate Lactotroph: A Morphologically Distinct, Ghrelin-Responsive Pituitary Cell in the Dwarf (dw/dw) Rat
Endocrinology, November 1, 2005; 146(11): 5012 - 5023.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
A. Matsuno, A. Mizutani, J. Itoh, S. Takekoshi, T. Nagashima, H. Okinaga, K. Takano, and R. Y. Osamura
Establishment of Stable GH3 Cell Line Expressing Enhanced Yellow Fluorescein Protein-Growth Hormone Fusion Protein
J. Histochem. Cytochem., September 1, 2005; 53(9): 1177 - 1180.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
P. R. Le Tissier, D. F. Carmignac, S. Lilley, A. K. Sesay, C. J. Phelps, P. Houston, K. Mathers, C. Magoulas, D. Ogden, and I. C. A. F. Robinson
Hypothalamic Growth Hormone-Releasing Hormone (GHRH) Deficiency: Targeted Ablation of GHRH Neurons in Mice Using a Viral Ion Channel Transgene
Mol. Endocrinol., May 1, 2005; 19(5): 1251 - 1262.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
J S Davies, J L Holter, D Knight, S M Beaucourt, D Murphy, D A Carter, and T Wells
Manipulating sorting signals to generate co-expression of somatostatin and eGFP in the regulated secretory pathway from a monocistronic construct
J. Mol. Endocrinol., October 1, 2004; 33(2): 523 - 532.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. Quittau-Prevostel, N. Delaunay, A. Collazos, A. Vallentin, and D. Joubert
Targeting of PKC{alpha} and {epsilon} in the pituitary: a highly regulated mechanism involving a GD(E)E motif of the V3 region
J. Cell Sci., January 1, 2004; 117(1): 63 - 72.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S. E Wells, D. M Flavell, G. W Bisset, P. A Houston, H. Christian, K. M Fairhall, and I. C A F Robinson
Transgenesis and neuroendocrine physiology: a transgenic rat model expressing growth hormone in vasopressin neurones
J. Physiol., August 15, 2003; 551(1): 323 - 336.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. Balthasar, P.-F. Mery, C. B. Magoulas, K. E. Mathers, A. Martin, P. Mollard, and I. C. A. F. Robinson
Growth Hormone-Releasing Hormone (GHRH) Neurons in GHRH-Enhanced Green Fluorescent Protein Transgenic Mice: A Ventral Hypothalamic Network
Endocrinology, June 1, 2003; 144(6): 2728 - 2740.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. McGuinness, C. Magoulas, A. K. Sesay, K. Mathers, D. Carmignac, J.-B. Manneville, H. Christian, J. A. Phillips III, and I. C. A. F. Robinson
Autosomal Dominant Growth Hormone Deficiency Disrupts Secretory Vesicles in Vitro and in Vivo in Transgenic Mice
Endocrinology, February 1, 2003; 144(2): 720 - 731.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. de Jersey, D. Carmignac, T. Barthlott, I. Robinson, and B. Stockinger
Activation of CD8 T Cells by Antigen Expressed in the Pituitary Gland
J. Immunol., December 15, 2002; 169(12): 6753 - 6759.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Wallenius, K. Sjogren, X.-D. Peng, S. Park, V. Wallenius, J.-L. Liu, M. Umaerus, H. Wennbo, O. Isaksson, L. Frohman, et al.
Liver-Derived IGF-I Regulates GH Secretion at the Pituitary Level in Mice
Endocrinology, November 1, 2001; 142(11): 4762 - 4770.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. V. Childs
Editorial: Green Fluorescent Proteins Light the Way to a Better Understanding of the Function and Regulation of Specific Anterior Pituitary Cells
Endocrinology, December 1, 2000; 141(12): 4331 - 4333.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Magoulas, C.
Right arrow Articles by Robinson, I. C. A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Magoulas, C.
Right arrow Articles by Robinson, I. C. A. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals