Endocrinology Vol. 141, No. 12 4681-4689
Copyright © 2000 by The Endocrine Society
A Secreted Fluorescent Reporter Targeted to Pituitary Growth Hormone Cells in Transgenic Mice
C. Magoulas1,
L. McGuinness,
N. Balthasar,
D. F. Carmignac,
A. K. Sesay,
K. E. Mathers,
H. Christian,
L. Candeil,
X. Bonnefont,
P. Mollard and
I. C. A. F. Robinson
Division of Neurophysiology (C.M., L.M., N.B., D.F.C., A.K.S.,
K.E.M., I.C.A.F.R.), National Institute for Medical Research Mill Hill,
London NW7 1AA, United Kingdom; Department of Human Anatomy and
Genetics (H.C.), University of Oxford, Oxford OX1 3QX, United Kingdom;
and INSERM U-469 (L.C., X.B., P.M.), Montpellier 34094, Cedex 5,
France
Address all correspondence and requests for reprints to: Professor Iain C. A. F. Robinson, Division of Neurophysiology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, United Kingdom. E-mail: irobins{at}nimr.mrc.ac.uk
 |
Abstract
|
|---|
In stable transfection experiments in the GH-producing GC cell line, a
construct containing the entire signal peptide and the first 22
residues of human GH linked in frame with enhanced green fluorescent
protein (eGFP), produced brightly fluorescent cells with a granular
distribution of eGFP. This eGFP reporter was then inserted into a 40-kb
cosmid transgene containing the locus control region for the hGH gene
and used to generate transgenic mice. Anterior pituitaries from these
GH-eGFP transgenic mice showed numerous clusters of strongly
fluorescent cells, which were also immunopositive for GH, and which
could be isolated and enriched by fluorescence-activated cell sorting.
Confocal scanning microscopy of pituitary GH cells from GH-eGFP
transgenic mice showed a markedly granular appearance of fluorescence.
Immunogold electron microscopy and RIA confirmed that the eGFP product
was packaged in the dense cored secretory vesicles of somatotrophs and
was secreted in parallel with GH in response to stimulation by GRF.
Using eGFP fluorescence, it was possible to identify clusters of GH
cells in acute pituitary slices and to observe spontaneous transient
rises in their intracellular Ca2+ concentrations after
loading with Ca2+ sensitive dyes. This transgenic approach
opens the way to direct visualization of spontaneous and
secretagogue-induced secretory mechanisms in identified GH cells.
 |
Introduction
|
|---|
SOMATOTROPHS constitute the major endocrine
cell type in the anterior pituitary gland, in which all the processes
of hormone production, storage, stimulus/secretion coupling and release
mechanisms may be studied. In vivo, GH release is usually
highly pulsatile involving large amplitude bursts of secretion, and
this probably requires the coordinated activation of many GH cells
(1, 2). Studies of living populations of primary pituitary
GH cells would be greatly facilitated by the ability to visualize
secretory processes directly in identified cells.
One way to achieve this is to use the intrinsically fluorescent
reporter molecule, green fluorescent protein (GFP) (3),
which when expressed from cell-specific promoters in transgenic
animals, can identify specific cell types in situ
(4, 5, 6, 7) and provides a fluorescent tag for their isolation
and analysis, using fluorescence-activated cell sorting (FACS)
techniques (8, 9). Because GFP fluorescence is often
unaffected by fusion to other sequences, intracellular distribution and
secretion events can also be visualized by tagging GFP with sequences
that target it to different subcellular compartments
(10, 11, 12).
In this study, we have targeted enhanced GFP (eGFP) to the
secretory vesicles of pituitary GH cells in transgenic mice. By
combining RIA with fluorescence and immuno-electronmicroscopic imaging
of eGFP and performing calcium imaging in pituitary slices in
situ (13), secretory processes may be now be studied
in GH cell populations, at the single GH cell level and even at a
subcellular level of resolution. Some of these results have been
presented in preliminary form (14).
 |
Materials and Methods
|
|---|
Construction of hGH-eGFP plasmids for transfection of GC
cells
Two different lengths of the 5' coding sequence of the human GH
gene (15) were fused in frame with an enhanced variant of
GFP (eGFP). The longer version of the hGH-eGFP fusion construct
(p48GH-eGFP), contains a genomic sequence encoding the first 48 amino
acids of the hGH gene product (signal peptide and N-terminal 22
residues of hGH) fused in frame via a 15mer oligonucleotide linker to
the coding sequence of eGFP. Briefly, an
XmaI-NotI fragment (750 bp) of the pEGFP-N3 CMV
expression plasmid (CLONTECH Laboratories, Inc., Palo Alto, CA), was blunt ended by Klenow and ligated into the
PvuII sites of an hGH genomic clone (16)
containing 5'- and 3' untranslated hGH sequences flanked by an
MluI linker. This MluI fragment was then cloned
into a version of the pEGFP-N3 expression plasmid (pN3/M), modified by
insertion of a MluI cloning site in place of its
XmaI-NotI fragment (see Fig. 1b
).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 1. hGH-eGFP constructs. Two plasmid constructs (a and
b) and a cosmid construct (c) were engineered. a, Mammalian expression
plasmid containing a CMV promoter driving 5'and 3' sequences of the hGH
gene (shaded bars), with sequences corresponding to the
first 8 amino acids of the signal peptide of hGH linked in frame with
eGFP. b, The same plasmid, but with the eGFP linked to a longer 5' hGH
sequence encoding the entire 26 residue signal peptide plus the first
22 amino acids of hGH. c, A transgene cosmid containing the longer
hGH-eGFP fusion sequences under the transcriptional control of the 40kB
hGH locus control region. Shaded bars indicate hGH
genomic sequences; exonic sequences shown by black or
white bars. Hatched bars correspond to
vector sequence. Restriction sites shown are: M
MluI; B BamHIII; N
NotI; Sp SpI. M* indicates position of
the novel MluI site engineered into the hGH cosmid (see
text).
|
|
A shorter version of the hGH-eGFP construct (p8GH-eGFP) was derived
from p48GH-GFP and contained genomic sequence encoding only the first 8
amino acids of the hGH signal peptide linked in frame with eGFP as
described above. This was engineered by a PCR strategy based on
p48GH-eGFP as a template. The forward primer was a 5' vector sequence
which introduced multiple cloning sites upstream of the amplified hGH
sequence. The reverse primer (5'GCGGGATCCGGACGTCCGGGAGCCTGGGGAGAA3')
was designed to recognize the hGH coding sequence at codon 8, flanked
by a BamHI cloning site. The PCR product of this reaction
was then inserted in place of the EcoRI-BamHI
fragment of the p48GH-eGFP plasmid construct (Fig. 1a
).
Construction of a GH-eGFP cosmid for generating transgenic
animals
A 40 kb (K2B) cosmid (15), containing the locus
control region (LCR) for the human GH gene was a generous gift from
Professor Nancy Cooke (Pennsylvania University). After reversing the
orientation of the insert of this cosmid (B2K), a unique
MluI site was introduced upstream of the coding region of
the hGH gene by PCR site-directed mutagenesis to alter the sequence at
-326 bp from 5'-CCACGT-3' to 5'-ACGCGT-3'. The
hGH gene sequences of this cosmid (cosGH.M) could then be excised as a
single MluI fragment (Fig. 1c
) and replaced with the
MluI-linked GH-eGFP sequence to give cosGH-eGFP. The final
cosmid thus contained an approximately 40 kb insert containing the LCR,
5'and 3'untranslated sequences for the hGH gene driving expression of
the GH-eGFP fusion protein described above in p48GH-eGFP. Note that
intact hGH cannot be generated from this construct.
Cell cultures and production of stable GC cell lines
Reagents were from Sigma unless otherwise stated.
GC cells (17) were maintained in a complete medium
consisting of D-MEM, 15% horse serum, 2.5% FCS (PAA,
Weiner Strasse, Austria), 2 mM L-glutamine,
supplemented with penicillin, streptomycin and amphotericin. GC cells
(200,000 in a 60-mm culture dish) were transfected with 2 µg plasmid
DNA using Lipofectamine, (Life Technologies, Inc.)
following the protocols supplied by the manufacturer. Stably
transfected cells were selected for neomycin resistance by addition of
G-418, 250 µg/ml, for 21 days. Strongly eGFP-positive cells were
readily apparent under low power fluorescence microscopy.
Generation of transgenic animals
DNA of the cosGH-eGFP construct was digested with
NotI, the 40-kb insert purified by ultracentrifugation in a
520% salt gradient (18), and brought to a concentration
of 15 ng/µl with 0.5 mM EDTA, 1
mM Tris-HCl, pH 7.5. Transgenic mice were
generated by pronuclear microinjection of fertilized oocytes of
superovulated (CBa/Ca x C57Bl/10) mice followed by oviductal
transfer into pseudopregnant recipients (19).
DNA and RNA analysis of transgenic animals
Genomic DNA from tail biopsies was analyzed for transgene DNA by
standard Southern and PCR procedures. A PCR assay for the first intron
of hGH sequence present in the transgene was developed, using exonic
primers: forward: 5'-ACCACTCAGGGTCCTGTGGACAG.3' reverse:
5'-CCTCTTGAAGCCAGGGCAGGCAGAGCAGGC.3'), which amplified across the
intron. Thirty cycles of amplification were performed under the
following conditions: 94 C for 1 min, 60 C for 30 sec, and 72 C for 90
sec per cycle.
Total RNA from pituitaries was isolated by using the Trizol reagent as
described by the manufacturer (Life Technologies, Inc.).
For Northern analysis, RNA was electrophoresed in a 1.2% agarose gel
containing 8% formaldehyde, blotted onto a N+
membrane (Amersham Pharmacia Biotech) and hybridized at 45
C in 5xSSC, 5x Denhardts solution, 50 mM phosphate
buffer, pH 6.5, 0.1% SDS, salmon sperm DNA (250 mg/ml) and 50%
formamide. Membranes were washed with 0.1 x SSC and 0.1% SDS at
65 C. A 700-bp XmaI-NotI fragment of pEGFP-N3
vector was radiolabeled by random priming (Prime-a Gene, Promega Corp.) and used as a hybridization probe for eGFP sequences.
Immunocytochemistry
Mouse pituitaries were fixed in 4% paraformaldehyde for 12
h, washed in acetone for 2 h, and embedded in paraffin wax. Tissue
sections (6 µm) were dewaxed in histoclear (National Diagnostics,
GA), taken through 100%, 70%, and 30% acetone for 20 sec each, and
then washed in distilled water. After incubation in a blocking solution
(20% normal goat serum, 5% BSA in Tris/HCl saline buffer) for 30 min
at room temperature, they were exposed to a monkey anti-rGH serum
(NIDDK, 1:2000 dilution) overnight at 4 C. Sections were washed and
then incubated with biotinylated goat antihuman antiserum (NIDDK, 1:200
dilution) for 30 min at room temperature. After washing, sections were
incubated with TRITC-avidin (Sigma, 1:1000) for 30 min at
room temperature. Finally, DAPI (Molecular Probes, Inc., 1
µg/ml) was added for 2 min to stain cell nuclei.
Electron microscopy
After initial fixation (2.5% glutaraldehyde in phosphate buffer
for 2 h then 0.25% overnight), pituitary segments were postfixed
in osmium tetroxide (1% wt/vol in 0.1 M phosphate buffer)
stained with uranyl acetate (2% wt/vol in distilled water), dehydrated
through increasing concentrations of ethanol (70100%) and embedded
in LR Gold (London Resin Co., Reading, UK) or Spurr resin. Ultrathin
sections (5080nm) were incubated at room temperature with a
polyclonal anti-GFP (1:300) followed by Protein A linked to 15 nm gold
(British Biocell, Cardiff, UK). Primary antibody incubations were for
2 h and secondary antibody incubations for 1 h and all
antisera were diluted in 0.1 M phosphate buffer containing
0.1% egg albumin. For control sections, the primary antibody was
replaced by an unrelated polyclonal antibody. After immunolabeling,
sections were lightly counterstained with lead citrate and uranyl
acetate and examined with a transmission electron microscope (JEM-1010,
JEOL, Peabody, MA).
FACS analysis
Ten pituitaries from GH-eGFP transgenic mice were gently minced
and then treated with collagenase (0.1 mg/ml) for 15 min at 37 C. DNase
(50 µg/ml) was added and incubated for a further 45 min. Dispersed
cells were pelleted by centrifugation and resuspended in FACS buffer
(10 g NaCl, 0.25 g KCl, 1.37 g
Na2HPO4, 0.25 g
KH2PO4, 1 g BSA, per
liter, pH 7.3), layered onto 4% BSA in FACS buffer in a 15-ml tube and
centrifuged for 5 min at 100 x g to remove cell
debris. Cells were gently resuspended in 0.5 ml of FACS buffer and
analyzed on a FACS Star Plus machine (Becton-Dickinson and Co., San Jose, CA) with WinMDI software, using the FITC
channel to gate for eGFP fluorescence. Aliquots of the starting cell
suspension, and cell pools sorted by eGFP fluorescence intensity were
collected and assayed for mouse GH (mGH) content.
GH release studies
Freshly dissected pituitary glands were placed in 2 ml Eagles
medium without glutamine, rinsed several times and then incubated for
2 h at 37 C with medium changed every 30 min. Following this
washout period, the pituitaries were incubated in 0.5 ml aliquots of
medium and exposed to 1 µg/ml hGRF 129
NH2(Bachem, Inc.), and after a
further 90-min recovery period, to 5 µg/ml hGRF 129
NH2. The medium was collected and assayed for GH
and eGFP contents by RIA (see below).
RIA
Mouse GH in pituitary or cell extracts was assayed by RIA as
previously described for the rat (20), using mouse
reagents kindly provided by NIDDK (Bethesda, MD). For eGFP a new RIA
was developed as follows: recombinant eGFP (CLONTECH Laboratories, Inc.), 5 µg, was radioiodinated with
NaI125 using the Iodogen method as previously
described (21), and purified by Sephadex G75
chromatography. For assay, 100 µl of iodinated eGFP (57000 cpm)
were mixed with 100 µl of tissue extract or standards (0.0110 ng)
of recombinant eGFP and 100 µl polyclonal antibody against GFP
(Molecular Probes, Inc., Eugene, OR) at a dilution
of 1:500,000 for 16 h at room temperature. Bound and free
fractions were separated by addition of 2 vol 18% polyethylene glycol,
followed after 30 min by centrifugation. Radioactivity in the pellets
was determined by
counting. The assay sensitivity was 10 pg
eGFP.
Cytosolic calcium imaging of pituitary tissue
The procedure was essentially as previously described (13, 22), but adapted for the mouse. Briefly, anterior pituitary
slices (150 µm) were prepared from 7- to 9-week-old male mice.
Because of the small size of the mouse pituitary gland, the tissue was
immobilized within a droplet of ultra-low temperature gelling agarose
(type IX-A, Sigma, St. Louis, MO) before cutting with a
vibrating blade microtome (Leica Corp. VT 1000S,
Leica Corp., Nussloch, Germany). Before recording, slices
were incubated with Ringers saline supplemented with essential amino
acids for 18 h in a humidified incubator (5%
CO2-95% O2). For
fluorometric calcium recordings, slices were loaded with the
membrane-permeable form of fura-2 (fura-2 AM, Molecular Probes, Inc.). An FITC cube was used to demarcate the boundaries of
eGFP-positive cells and thus generate a map of GH cells within each
field. A combination of a 380-nm excitation filter, a 430-nm dichroic
mirror, and a 480-nm barrier filter (Nikon, Paris, France)
was then used to monitor fura-2 emission. Only cells showing both eGFP
and fura-2 emission fluorescences were recorded. Fluorescent images
were taken with an intensified cooled charge-coupled device camera
(PentaMAX Gen Iv; Princeton Instruments, Trenton, NJ).
Camera acquisition rate was 20100 msec per frame, and each pixel was
digitized at 12 bits. Images were acquired with Metafluor (Universal
Imaging Corp., West Chester, PA), and analyzed with Igor Pro 3.16
software (Wavemetrics, Inc., Lake Oswego, OR).
[Ca2+]i changes were
expressed as an F/F0 ratio, where
F0 was the minimum fluorescence intensity
measured after off-line correction of the basal level and data
inversion (13).
Data analysis
Unless otherwise stated, data are shown as mean ±
SEM. Differences between groups were analyzed by Students
t test, with P < 0.05 taken as
significant.
 |
Results
|
|---|
Plasmids containing eGFP sequences fused to sequences encoding two
different lengths of the amino terminus of hGH (Fig. 1
, a and b) were
transfected into the GH-producing GC cell lines, and several stable
lines were established. Expression of eGFP in these cells was examined
by confocal microscopy. Both constructs produced brightly fluorescent
cells, but with a markedly different distribution of fluorescence (Fig. 2
). The shorter construct, expressing
eGFP with only 8 amino acids of the GH signal peptide showed a
relatively uniform distribution of fluorescence throughout the cells,
whereas the longer construct expressing the entire signal peptide and
the first 22 residues of hGH fused to eGFP gave a punctate distribution
of fluorescence, consistent with a granular targeting of this
product.

View larger version (138K):
[in this window]
[in a new window]
|
Figure 2. Expression of eGFP in GC cell lines. GH-producing
GC cells were transfected with CMV promoter plasmids containing the
reporter constructs shown in Fig. 1 , a and b, and stable cell lines
were generated. Living cells in culture were examined by confocal
microscopy. Left panels (A, C), eGFP fluorescence.
Right panels (B, D), phase contrast image. (A) The
construct containing sequences corresponding to 8 amino acids of the GH
signal peptide fused to eGFP expressed a product, which showed an
intense, evenly distributed fluorescence (C) The construct containing
sequences corresponding to the entire hGH signal peptide and part of
the amino terminus of hGH fused to eGFP expressed a product which gave
an intense, punctate distribution of fluorescence. Scale
bar, 10 µm.
|
|
Next, transgenic mice were generated using the longer version of the
eGFP construct, driven by the hGH LCR cosmid. Three founders were
obtained that incorporated the transgene as assessed by Southern blots
and PCR. All three founders were bred and gave positive progeny which
showed strong eGFP expression in the anterior pituitary. One of these
lines, termed GH-eGFP, was chosen for further study.
Northern analysis of pituitary RNA with an eGFP probe showed a single
abundant transcript of the expected size in the transgenic but not
wild-type mice (Fig. 3
, A and B). RIA
showed that eGFP-immunoreactive protein was readily detectable in
extracts of pituitary glands from transgenic but not wild-type animals
(Fig. 3C
). No eGFP expression was detected in other tissues examined
such as brain, kidney, spleen (not shown). Measurements of pituitary
mGH content in transgenic and wild-type mice showed a significant
reduction in GH stores in both male and female transgenic animals
compared with wild-type littermates, but this did not affect their
growth rates (Table 1
), and the
transgenic animals appeared phenotypically normal.

View larger version (65K):
[in this window]
[in a new window]
|
Figure 3. Analysis of eGFP expression in transgenic GH-eGFP
mice. A, Mice carrying a GH-eGFP transgene could be identified by PCR
analysis of tail DNA. Primers were chosen to span the first intron of
the GH gene and amplified a 382-bp product from the transgene as well
as a smaller 290-bp product from the endogenous mouse GH gene. (-)
wild-type animals; (+) transgenic animals. B, Northern blot analysis of
RNA from wild-type (-) and transgenic (+) mice showed a strong band
hybridizing with a probe corresponding to the eGFP coding region in
transgenic progeny only. C, GFP content was assayed by RIA in pituitary
extracts from wild-type (-) and transgenic (+) mice.
|
|
Fluorescence microscopy showed a major population of the anterior
pituitary cells strongly fluorescent for eGFP, whereas there was no
expression in the posterior pituitary (Fig. 4A
). As was observed in GC cells
transfected with the same construct, individual pituitary GH cells from
GH-eGFP transgenic mice showed a punctate distribution of eGFP
fluorescence when examined by scanning confocal microscopy (Fig. 4B
). The cells showing eGFP fluorescence were compared with those
expressing GH, as identified by immunocytochemistry. Figure 4
shows
three-color confocal microscopy of a section of a GH-eGFP mouse
anterior pituitary (Fig. 4C
) stained with an antibody to GH and
visualized with TRITC (Fig. 4D
), and also stained with DAPI (Fig. 4E
)
to visualize all cell nuclei. About half of the cells showed eGFP
fluorescence, and virtually all of these colocalized with GH
immunoreactivity, (Fig. 4F
).

View larger version (51K):
[in this window]
[in a new window]
|
Figure 4. Fig. 4. eGFP localization in pituitary GH cells from
transgenic mice. A, Strong eGFP fluorescence is observed in many cells
of the anterior pituitary (AP) of GH-eGFP transgenic mice. Note the
absence of eGFP fluorescence in the posterior pituitary (PP). B,
Confocal scanning image through a single eGFP-positive GH cell showing
a highly granular distribution of eGFP. C, Confocal microscopy of eGFP
in a section of anterior pituitary from a GH-eGFP transgenic mouse. D,
The same section after immunostaining for mGH followed by a second
antibody tagged with TRITC. E, The same section stained with DAPI to
visualize all cell nuclei and this image superimposed with that in (C).
F, An overlay of the images in D and C to show colocalization of eGFP
with GH. Scale bars, 10 µm.
|
|
To investigate the punctate localization, sections of pituitary from
GH-eGFP transgenic mice were processed for eGFP immunogold electron
microscopy. The ultrastructural morphology of somatotrophs from GH-eGFP
transgenic mice was indistinguishable from that in nontransgenic
animals and showed numerous large dense cored GH secretory vesicles.
These secretory granules showed specific immunogold labeling with an
anti-GFP antibody (Fig 5
), and no
specific labeling of any other structure was apparent.

View larger version (156K):
[in this window]
[in a new window]
|
Figure 5. Immunoelectron microscopy of eGFP in GH-eGFP
transgenic mouse pituitary cells. Ultrathin pituitary sections from
GH-eGFP transgenic mice were processed for immunogold
electronmicroscopy. Numerous dense-cored secretory vesicles could be
seen in somatotrophs. Immunogold labeling, performed using a primary
antibody against GFP showed the GH-eGFP product clearly localized to
these secretory vesicles (large black grains, inset). No
specific labeling of any other structure was observed, and no labeling
was seen in sections from wild-type mice (not shown). Magnification,
10,000x.
|
|
As the GH-eGFP protein product was packaged in the secretory vesicles,
it should be released in response to specific GH secretagogues. To test
this, pituitary glands from GH-eGFP transgenic mice were incubated
in vitro before and after challenge with 1 and 5 µg/ml
hGRF129NH2. The release of GH and eGFP into the
incubate was measured by specific RIAs for these proteins and the
results are shown in Fig. 6
. Both eGFP
and GH were released in a highly parallel, dose-dependent manner in
response to this GH secretagogue.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 6. eGFP is secreted from GH cells in GH-GFP
transgenic mice. Pituitary glands were removed from groups of normal
(n = 6) and GH-eGFP (n = 4) transgenic mice and incubated
in vitro in a succession of 30 min incubations, after
which the media were collected and replaced by fresh media. After 90
min, and again after 210 min, hGRF129NH2 (GRF) 1 µg or
5 µg/ml was added to the media. The media concentrations of mouse GH
(open bars) and eGFP (closed bars) were
measured by RIA. Data shown are mean ± SEM *
P < 0.05; ** P < 0.01
vs. sample immediately before stimulation.
|
|
The endogenous GFP fluorescence could be used to analyze and enrich
populations of GH cells from transgenic pituitary isolates by FACS.
Figure 7
illustrates the results from an
experiment in which pituitaries from a group of 10 GH-eGFP mice were
isolated, the cells dissociated, and subjected to FACS. Strongly
fluorescing eGFP-containing cells could readily be separated, counted
and collected (Fig. 7A
). Measurement of GH by RIA showed the strongly
fluorescent population (Fraction II) to be markedly enriched in GH
content compared with the unsorted cell suspension, whereas the
remaining cells (Fraction I) were depleted in GH (Fig. 7B
).

View larger version (17K):
[in this window]
[in a new window]
|
Figure 7. FACS of eGFP positive pituitary cells from GH-eGFP
transgenic mice. A, Pituitary cells were isolated and dispersed from 10
GH-eGFP transgenic mice and analyzed by FACS. A strongly fluorescent
subpopulation of cells could be identified (Fraction II), which in this
experiment corresponded to 22% of the cells analyzed (B). This cell
population shows a marked enrichment in GH content measured by RIA
(open bar) when compared with that of the original
isolate (shaded bar), and with the eGFP-negative
Fraction I, which was depleted in GH (solid bar)
relative to the unsorted starting material.
|
|
The eGFP transgene product also provided a means of identifying
multiple somatotrophs in living pituitary slices in situ, so
that physiological responses may be monitored in several cells
simultaneously. Figure 8
illustrates the
results of such an experiment in which spontaneous changes of
intracellular calcium concentration
([Ca2+]i) were recorded
from three fura-2-loaded cells identified as GH cells by their eGFP
fluorescence. Mouse GH cells showed spontaneous fast transient rises in
[Ca2+]i (time to
peak = 210 ± 29 msec, n = 24). All the GH-eGFP cells
displayed [Ca2+]i bursts,
but with different patterns. In some cells, bursts displayed a stepwise
onset followed by a high frequency spiking plateau phase (Fig. 8
, cells
labeled 2 and 3) whereas in others, they showed an incremental rising
phase due to the summation of high frequency, low amplitude
[Ca2+]i transients (Fig. 8
, cell labeled 1). All these patterns of
[Ca2+]i transients in
GH-eGFP cells were reversibly suppressed upon local application of a
Ringers saline containing 500 µM
Cd2+ ions (n = 13), suggesting that the
[Ca2+]i transients were
due to spontaneous Ca2+-dependent action
potentials (22).

View larger version (68K):
[in this window]
[in a new window]
|
Figure 8. Patterns of spontaneous
[Ca2+]i transients in GH-GFP cells.
Upper left panel, Field of GH cells expressing eGFP.
Upper right panel, Same field loaded with fura-2. The
white circles highlight the area of three eGFP-positive
cells in which changes in fura-2 fluorescence, reflecting
[Ca2+]i levels, were monitored. Lower
panel, Changes in fura-2 emission, normalized to baseline
fluorescence (-F/F0), for the cells identified in the
panels above. The bottom trace illustrates spontaneous
[Ca2+]i transients monitored in cell #3 on a
4-fold expanded scale. Stars indicate
[Ca2+]i bursts.
|
|
 |
Discussion
|
|---|
GFP has been used widely in cell biology to visualize and study
cellular processes in real time (3). Most studies have
used transfection to express GFP, fused to a variety of different
proteins in cell lines, but GFP has also been expressed as a transgene,
either ubiquitously (23) or under a variety of cell
specific promoters. This is the first report to describe the generation
and characterization of transgenic mice that express the enhanced
variant of GFP specifically in pituitary GH cells. Although GFP has
recently been expressed in neuroendocrine neurones by transgenesis
(6, 7, 24), we are not aware of any reports of mammalian
pituitary endocrine cells targeted in vivo in this way to
date.
When expressed alone or with minimal N-terminal peptide extensions,
eGFP pervades throughout the cytoplasm. However, targeting signals may
be fused to GFP that direct localization of the fluorescent product to
specific subcellular structures (10, 25, 26). In
particular, GFP variants targeted to secretory vesicles have been used
to follow the genesis, trafficking and regulated release from these
organelles in endocrine cell lines (12, 27, 28). The hGH
signal peptide (29) is sufficient to enable heterologous
reporter sequences to be processed through the secretory pathway in
cell cultures (30, 31). We fused eGFP sequences with those
encoding the signal peptide and an additional portion of the N terminus
of hGH, and found that the resulting fluorescent product was targeted
to GH secretory vesicles, not only in cell lines but also in transgenic
animals.
The inclusion of the additional N-terminal peptide was determined by
several factors. With both constructs, the first intron of the hGH gene
was included because this contains enhancer sequences that could be
important for efficient transgene expression (32). This
intron begins after the sequences encoding the first 3 residues of the
hGH signal peptide, and to preserve the nucleotide sequence around the
splice acceptor site, we also included sequences encoding the next 5
residues of the signal peptide from exon 2 before linking with eGFP
sequences. We felt it unlikely that this short N-terminal octapeptide
extension would alter the cytoplasmic fate of eGFP and so it proved
when this was expressed in GC cells.
The construct that targeted eGFP to secretory vesicles included
sequences encoding the entire hGH signal peptide and the first 22
residues of the N-terminal sequence of hGH. This was chosen as the
product would include the two N-terminal histidine residues of hGH
(18His and 21His), which
contribute significant Zn2+ binding activity to
hGH and which may be important for packaging of GH dimers and oligomers
into secretory granules (33). Our data do not show whether
these residues were important for granule packaging of eGFP or merely
fortuitous, and a further series of constructs will be required to
address this issue. One possibility is that the N-terminal GH sequences
in this eGFP product interacted with rat or mouse GH sequences which
facilitated copackaging in GC cells or in mouse somatotrophs. However,
this cannot be the only explanation because the same product also gave
granular staining when expressed in other secretory cell types (PC12
cells, unpublished results, hypothalamic GRF neurones
(14)] that do not express endogenous GH.
Although minimal GH promoter sequences can express transgene reporters
in somatotrophs, the intensity of expression is often low and variable.
We used a much larger promoter including the entire LCR of hGH that
reliably directs position-independent copy-number-dependent expression
in the pituitaries of transgenic mice (15). This LCR
contains several DNA elements, which are necessary for somatotroph
specific expression (34, 35), so we made minimal changes
to this cosmid, mutating 2 bp to generate a unique site into which the
hGH-eGFP reporter could be cloned. As expected, this transgene achieved
high-level specific eGFP transgene expression in pituitary GH cells,
with no detectable expression in other pituitary cell types or in other
tissues examined. Because a B-cell receptor subunit gene (CD79b) was
recently discovered to be present within this hGH LCR
(36), and thus present in our transgene, we specifically
examined lymphocytes from GH-eGFP mice. No eGFP fluorescence was
detected in B cells isolated from these transgenic animals, and FACS
analysis showed no changes in their lymphocyte population (unpublished
results).
Confocal and EM immunogold studies confirmed that the eGFP was
localized in the large dense-cored granules in somatotrophs. Expression
of eGFP was accompanied by a significant reduction in the total amount
of GH stored in the pituitaries of transgenic animals but did not
otherwise disrupt the normal morphology or function of somatotrophs.
The reduced pituitary GH reserve was clearly sufficient to maintain an
adequate output of GH in transgenic mice because their growth was
unaffected. This reduction in GH stores could reflect competition
between the GH-eGFP product and endogenous mGH for granule packaging
although there was much less eGFP than mouse GH stored in the
pituitary. Because eGFP RNA transcripts were abundant, we suspect that
the subsequent packaging or storage mechanisms are less efficient for
the GH-eGFP product than for mouse GH. The aggregation and packaging of
proteins in dense-cored granules probably involves specific interfacial
features of protein structure favoring oligomerization
(33), and it is known that sequences in addition to the
signal peptide are also required for efficient packaging of GH
(37, 38, 39, 40).
The eGFP product was clearly targeted to the regulated secretory
pathway because it was released in response to the specific GH
secretagogue, GRF. Initial attempts to quantify this by measuring eGFP
fluorescence in the media were unsuccessful due to the large dilution
involved in incubation studies. However, development of a sensitive RIA
for eGFP enabled us to show directly that the transgene product was
secreted in response to GRF in a dose-dependent fashion, closely
paralleling GH release from the same tissues.
FACS analysis and sorting of live or fixed pituitary cell types has
been described previously, using antibodies to the specific hormones
released (41, 42). The eGFP in transgenic pituitary cell
isolates provided a strong endogenous signal for FACS sorting of live
cells, and a population of strongly eGFP-positive GH cells could be
isolated without the need for pretreatment of the cells with antibodies
or permeabilizing agents. This provides a convenient method for rapidly
estimating the number of GH producing cells in individual pituitaries,
and for isolating viable populations of somatotrophs that can be
studied in vitro, free from paracrine interactions with
other hormone-producing cell types.
GH cells are excitable and show spontaneous
[Ca2+]i transients
that correlate with secretion, but the study of this is labor intensive
because the individual responding cells must be identified and
characterized, usually by immunocytochemistry, post hoc (13, 22). We show here that intracellular calcium can readily be
monitored simultaneously in several preidentified GH cells, using dual
wavelength imaging for eGFP and fura-2, and observed the rapid
short-lived increases in
[Ca2+]i that reflect the
outcome of transient calcium entry during action potentials in these
cells. Furthermore, this is the first report that mouse GH cells
display spontaneous rhythmic bursts of
[Ca2+]i similar to those
that have recently been characterized in postimmunoidentified GH cells
in rat pituitary slices (22). Previous studies have
recorded from single neuronal cells identified by GFP expression
(7, 24). However, multicell imaging is possible in acute
pituitary slices from GH-eGFP mice, and we are using this approach to
study the GH cell populations in different pituitary subregions
in situ and whether they coordinate the timing of their
responses to the entry or exit of secretagogues or inhibitors, to or
from the glandular parenchyma.
Although not addressed in this study, the eGFP transgene product could
also be used to monitor GH gene expression in vivo, assuming
that the hGH LCR sequences respond to those physiological signals that
regulate mouse GH. Quantitative imaging of GFP at the subcellular level
in single cells is clearly possible (28), but there are
some kinetic limitations to using this approach due to the time taken
for newly synthesized GFP to fold into a fluorophore conformation, its
half-life and its sensitivity to photobleaching. Newer variants of GFP,
with a shorter half-life, or sensitive to calcium (43),
membrane potential (44) or pH changes (45),
are useful probes of many aspects of cell physiology. Combining these
with the transgenic approach we describe opens the way for direct
studies of these processes not only in single GH cells, but also in GH
cell populations, following their responses to physiological signals in
the whole animal.
 |
Acknowledgments
|
|---|
We are grateful to Nancy Cooke for providing us with the hGH LCR
cosmid, to S. Pagakis for assistance with confocal microscopy, to Chris
Atkins for help with FACS, and to James De Jersey for help with the B
cell analysis. We thank Emma Sparks and Audrey Creff for excellent
technical assistance.
 |
Footnotes
|
|---|
1 Present address: Neuroscience Section, Division of Medical Sciences,
Queen Mary & Westfield College, London, United Kingdom. 
Received July 20, 2000.
 |
References
|
|---|
-
Robinson ICAF, Hindmarsh PC 1999 The
importance of the secretory pattern of growth hormone for statural
growth. In: Kostyo JL (ed) American Handbook of Physiology. Oxford
University Press, New York, vol 5:329395
-
Robinson ICAF 2000 Control of growth hormone
(GH) release by GH secretagogueues. Novartis Foundation Symposium 227:206220[Medline]
-
Tsien RY 1998 The green fluorescent protein. Annu
Rev Biochem 67:509544[CrossRef][Medline]
-
Srinivas S, Goldberg MR, Watanabe T, DAgati V,
al-Awqati Q, Costantini F 1999 Expression of green fluorescent
protein in the ureteric bud of transgenic mice: a new tool for the
analysis of ureteric bud morphogenesis. Dev Genet 24:241251[CrossRef][Medline]
-
Chiocchetti A, Tolosano E, Hirsch E, Silengo L, Altruda
F 1997 Green fluorescent protein as a reporter of gene expression
in transgenic mice. Biochim Biophys Acta 1352:193202[Medline]
-
Young III WS, Iacangelo A, Luo XZ, King C, Duncan K,
Ginns EI 1999 Transgenic expression of green fluorescent protein
in mouse oxytocin neurones. J Neuroendocrinol 11:935939[CrossRef][Medline]
-
Spergel DJ, Kruth U, Hanley DF, Sprengel R, Seeburg
PH 1999 GABA- and glutamate-activated channels in green
fluorescent protein-tagged gonadotropin-releasing hormone neurons in
transgenic mice. J Neurosci 19:20372050[Abstract/Free Full Text]
-
Manjunath N, Shankar P, Stockton B, Dubey PD, Lieberman
J, von Andrian UH 1999 A transgenic mouse model to analyze CD8(+)
effector T cell differentiation in vivo. Proc Natl Acad Sci
USA 96:1393213937[Abstract/Free Full Text]
-
Kawakami N, Sakane N, Nishizawa F, Iwao M, Fukada SI,
Tsujikawa K, Kohama Y, Ikawa M, Okabe M, Yamamoto H 1999 Green
fluorescent protein-transgenic mice: immune functions and their
application to studies of lymphocyte development. Immunol Lett 70:165171[CrossRef][Medline]
-
Lim CS, Baumann CT, Htun H, Xian W, Irie M, Smith CL,
Hager GL 1999 Differential localization and activity of the A- and
B-forms of the human progesterone receptor using green fluorescent
protein chimeras. Mol Endocrinol 13:366375[Abstract/Free Full Text]
-
Steyer JA, Almers W 1999 Tracking single secretory
granules in live chromaffin cells by evanescent-field fluorescence
microscopy. Biophys J 76:22622271[Abstract/Free Full Text]
-
Steyer JA, Horstmann H, Almers W 1997 Transport,
docking and exocytosis of single secretory granules in live chromaffin
cells. Nature 388:474478[CrossRef][Medline]
-
Guerineau NC, Bonnefont X, Stoeckel L, Mollard P 1998 Synchronized spontaneous Ca2+ transients in acute anterior
pituitary slices. J Biol Chem 273:1038910395[Abstract/Free Full Text]
-
McGuiness LM, Balthasar N, Sesay AK, Mathers K, Magoulas
C, Robinson ICAF Targeting fluorescent reporters to the
hypothalamo-pituitary GH axis in transgenic mice. Program of the 81st
Annual Meeting of The Endocrine Society, San Diego, CA, 1999,
OR186
-
Jones BK, Monks BR, Liebhaber SA, Cooke NE 1995 The
human growth hormone gene is regulated by a multicomponent locus
control region. Mol Cell Biol 15:70107021[Abstract]
-
Flavell DM, Wells T, Wells SE, Carmignac DF, Thomas GB,
Robinson ICAF 1996 Dominant dwarfism in transgenic rats by
targeting human growth hormone (GH) expression to hypothalamic
GH-releasing factor neurons. EMBO J 15:38713879[Medline]
-
Pellegrini E, Carmignac DF, Bluet-Pajot MT, Mounier F,
Bennett P, Epelbaum J, Robinson ICAF 1997 Intrahypothalamic growth
hormone feedback: from dwarfism to acromegaly in the rat. Endocrinology 138:45434551[Abstract/Free Full Text]
-
Dillon N, Grosveld F 1993 In: Hames BD,
Higgins SJ (eds) Gene TranscriptionA Practical Approach. IRL Press at
O.U.P., Oxford
-
Hogan BLH, Constantini F, Lacy E 1986 Manipulating
the Mouse Embryo. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY
-
Carmignac DF, Robinson ICAF 1990 Growth hormone
(GH) secretion in the dwarf rat: release, clearance and responsiveness
to GH-releasing factor and somatostatin. J Endocrinol 127:6975[Abstract]
-
Robinson ICAF 1980 The development and evaluation
of a sensitive and specific radioimmunoassay for oxytocin in
unextracted plasma. J Immunoassay 1:323347[Medline]
-
Bonnefont X, Fiekers J, Creff A, Mollard P 2000 Rhythmic bursts of calcium transients in acute anterior pituitary
slices. Endocrinology 141:868875[Abstract/Free Full Text]
-
Okabe M, Ikawa M, Kominami K, Nakanishi T, Nishimune
Y 1997 Green mice as a source of ubiquitous green cells. FEBS
Lett 407:313319[CrossRef][Medline]
-
Suter KJ, Song WJ, Sampson TL, Wuarin JP, Saunders JT,
Dudek FE, Moenter SM 2000 Genetic targeting of green
fluorescent protein to gonadotropin-releasing hormone neurons:
characterization of whole-cell electrophysiological properties and
morphology. Endocrinology 141:412419[Abstract/Free Full Text]
-
Herrington J, Rui L, Luo G, Yu-Lee LY, Carter-Su C 1999 A functional DNA binding domain is required for growth
hormone-induced nuclear accumulation of Stat5B. J Biol Chem 274:51385145[Abstract/Free Full Text]
-
Vallentin A, Prevostel C, Fauquier T, Bonnefont X,
Joubert D 2000 Membrane targeting and cytoplasmic sequestration in
the spatiotemporal localization of human protein kinase C alpha. J
Biol Chem 275:60146021[Abstract/Free Full Text]
-
Kaether C, Salm T, Glombik M, Almers W, Gerdes HH 1997 Targeting of green fluorescent protein to neuroendocrine secretory
granules: a new tool for real time studies of regulated protein
secretion. Eur J Cell Biol 74:133142[Medline]
-
Lang T, Wacker I, Wunderlich I, Rohrbach A, Giese G,
Soldati T, Almers W 2000 Role of actin cortex in the
subplasmalemmal transport of secretory granules in PC-12 Cells. Biophys
J 78:28632877[Abstract/Free Full Text]
-
Martial JA, Hallewell RA, Baxter JD, Goodman HM 1979 Human growth hormone: complementary DNA cloning and expression in
bacteria. Science 205: 602607
-
Pecceu F, Dousset P, Shire D, Cavrois E, Marchese E,
Ferrara P, Kaghad M, Dumont X, Lupker J 1991 Human interleukin
1ß fused to the human growth hormone signal peptide is
N-glycosylated and secreted by Chinese hamster ovary cells.
Gene 97:253258[CrossRef][Medline]
-
Blam SB, Mitchell R, Tischer E, Rubin JS, Silva M,
Silver S, Fiddes JC, Abraham JA, Aaronson SA 1988 Addition of
growth hormone secretion signal to basic fibroblast growth factor
results in cell transformation and secretion of aberrant forms of the
protein. Oncogene 3:129136[Medline]
-
Brinster RL, Allen JM, Behringer RR, Gelinas RE,
Palmiter RD 1988 Introns increase transcriptional efficiency in
transgenic mice. Proc Natl Acad Sci USA 85:836840[Abstract/Free Full Text]
-
Cunningham BC, Mulkerrin MG, Wells JA 1991 Dimerization of human growth hormone by zinc. Science 253:545548[Abstract/Free Full Text]
-
Bennani-Baiti IM, Asa SL, Song D, Iratni R, Liebhaber
SA, Cooke NE 1998 DNase I-hypersensitive sites I and II of the
human growth hormone locus control region are a major developmental
activator of somatotrope gene expression. Proc Natl Acad Sci USA 95:1065510660[Abstract/Free Full Text]
-
Shewchuk BM, Asa SL, Cooke NE, Liebhaber SA 1999 Pit-1 binding sites at the somatotrope-specific DNase I hypersensitive
sites I, II of the human growth hormone locus control region are
essential for in vivo hGH-N gene activation. J Biol
Chem 274:3572535733[Abstract/Free Full Text]
-
Bennani-Baiti IM, Cooke NE, Liebhaber SA 1998 Physical linkage of the human growth hormone gene cluster and the CD79b
(Ig ß/B29) gene. Genomics 48:258264[CrossRef][Medline]
-
McAndrew SJ, Chen NY, Wiehl P, DiCaprio L, Yun J, Wagner
TE, Okada S, Kopchick JJ 1991 Expression of truncated forms of the
bovine growth hormone gene in cultured mouse cells. J Biol Chem 266:2096520969[Abstract/Free Full Text]
-
Chen WY, Wight DC, Chen NY, Coleman TA, Wagner TE,
Kopchick JJ 1991 Mutations in the third
-helix of bovine growth
hormone dramatically affect its intracellular distribution in vitro and
growth enhancement in transgenic mice. J Biol Chem 266:22522258[Abstract/Free Full Text]
-
Liebhaber SA, Ray J, Cooke NE 1986 Synthesis of
growth hormone-prolactin chimeric proteins and processing mutants by
the exchange and deletion of genomic exons. J Biol Chem 261:1430114306[Abstract/Free Full Text]
-
Moore HH, Kelly RB 1986 Re-routing of a secretory
protein by fusion with human growth hormone sequences. Nature 321:443446[CrossRef][Medline]
-
Wynick D, Critchley R, Venetikou MS, Burrin JM, Bloom
SR 1990 Purification of functional lactotrophs and somatotrophs
from female rats using fluorescence-activated cell sorting. J
Endocrinol 126:269274[Abstract]
-
Wynick D, Venetikou MS, Critchley R, Burrin JM, Bloom
SR 1990 Flow cytometric analysis of functional anterior pituitary
cells from female rats. J Endocrinol 126:261268[Abstract]
-
Emmanouilidou E, Teschemacher AG, Pouli AE, Nicholls LI,
Seward EP, Rutter GA 1999 Imaging Ca2+
concentration changes at the secretory vesicle surface with a
recombinant targeted cameleon. Curr Biol 9:915918[CrossRef][Medline]
-
Cacciatore TW, Brodfuehrer PD, Gonzalez JE, Jiang T,
Adams SR, Tsien RY, Kristan Jr WB, Kleinfeld D 1999 Identification
of neural circuits by imaging coherent electrical activity with
FRET-based dyes. Neuron 23:449459[CrossRef][Medline]
-
Llopis J, McCaffery JM, Miyawaki A, Farquhar MG, Tsien
RY 1998 Measurement of cytosolic, mitochondrial, and Golgi pH in
single living cells with green fluorescent proteins. Proc Natl Acad Sci
USA 95:68036808[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
D. A. Lepore, G. P. L. Thomas, K. R. Knight, A. J. Hussey, T. Callahan, J. Wagner, W. A. Morrison, and P. Q. Thomas
Survival and Differentiation of Pituitary Colony-Forming Cells In Vivo
Stem Cells,
July 1, 2007;
25(7):
1730 - 1736.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Bonnefont, A. Lacampagne, A. Sanchez-Hormigo, E. Fino, A. Creff, M.-N. Mathieu, S. Smallwood, D. Carmignac, P. Fontanaud, P. Travo, et al.
Revealing the large-scale network organization of growth hormone-secreting cells
PNAS,
November 15, 2005;
102(46):
16880 - 16885.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Huerta-Ocampo, H. C. Christian, N. M. Thompson, M. M. El-Kasti, and T. Wells
The Intermediate Lactotroph: A Morphologically Distinct, Ghrelin-Responsive Pituitary Cell in the Dwarf (dw/dw) Rat
Endocrinology,
November 1, 2005;
146(11):
5012 - 5023.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Matsuno, A. Mizutani, J. Itoh, S. Takekoshi, T. Nagashima, H. Okinaga, K. Takano, and R. Y. Osamura
Establishment of Stable GH3 Cell Line Expressing Enhanced Yellow Fluorescein Protein-Growth Hormone Fusion Protein
J. Histochem. Cytochem.,
September 1, 2005;
53(9):
1177 - 1180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. R. Le Tissier, D. F. Carmignac, S. Lilley, A. K. Sesay, C. J. Phelps, P. Houston, K. Mathers, C. Magoulas, D. Ogden, and I. C. A. F. Robinson
Hypothalamic Growth Hormone-Releasing Hormone (GHRH) Deficiency: Targeted Ablation of GHRH Neurons in Mice Using a Viral Ion Channel Transgene
Mol. Endocrinol.,
May 1, 2005;
19(5):
1251 - 1262.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J S Davies, J L Holter, D Knight, S M Beaucourt, D Murphy, D A Carter, and T Wells
Manipulating sorting signals to generate co-expression of somatostatin and eGFP in the regulated secretory pathway from a monocistronic construct
J. Mol. Endocrinol.,
October 1, 2004;
33(2):
523 - 532.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Quittau-Prevostel, N. Delaunay, A. Collazos, A. Vallentin, and D. Joubert
Targeting of PKC{alpha} and {epsilon} in the pituitary: a highly regulated mechanism involving a GD(E)E motif of the V3 region
J. Cell Sci.,
January 1, 2004;
117(1):
63 - 72.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Balthasar, P.-F. Mery, C. B. Magoulas, K. E. Mathers, A. Martin, P. Mollard, and I. C. A. F. Robinson
Growth Hormone-Releasing Hormone (GHRH) Neurons in GHRH-Enhanced Green Fluorescent Protein Transgenic Mice: A Ventral Hypothalamic Network
Endocrinology,
June 1, 2003;
144(6):
2728 - 2740.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. McGuinness, C. Magoulas, A. K. Sesay, K. Mathers, D. Carmignac, J.-B. Manneville, H. Christian, J. A. Phillips III, and I. C. A. F. Robinson
Autosomal Dominant Growth Hormone Deficiency Disrupts Secretory Vesicles in Vitro and in Vivo in Transgenic Mice
Endocrinology,
February 1, 2003;
144(2):
720 - 731.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. de Jersey, D. Carmignac, T. Barthlott, I. Robinson, and B. Stockinger
Activation of CD8 T Cells by Antigen Expressed in the Pituitary Gland
J. Immunol.,
December 15, 2002;
169(12):
6753 - 6759.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Wallenius, K. Sjogren, X.-D. Peng, S. Park, V. Wallenius, J.-L. Liu, M. Umaerus, H. Wennbo, O. Isaksson, L. Frohman, et al.
Liver-Derived IGF-I Regulates GH Secretion at the Pituitary Level in Mice
Endocrinology,
November 1, 2001;
142(11):
4762 - 4770.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. V. Childs
Editorial: Green Fluorescent Proteins Light the Way to a Better Understanding of the Function and Regulation of Specific Anterior Pituitary Cells
Endocrinology,
December 1, 2000;
141(12):
4331 - 4333.
[Full Text]
[PDF]
|
 |
|