| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Departments of Physiology and Pharmacology and Toxicology (H.R.), Biocenter Oulu, University of Oulu, FIN-90220 Oulu, Finland
Address all correspondence and requests for reprints to: Dr. Olli Vuolteenaho, Department of Physiology, University of Oulu, Kajaanintie 52A, FIN-90220 Oulu, Finland. E-mail: olli.vuolteenaho{at}oulu.fi
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The heart reacts to load by increasing the amount of the contractile element. It also activates its own mechanisms that unload the heart. The release of the natriuretic peptides lowers blood pressure and reduces cardiac work load (5, 6, 7). In some pathophysiological situations, such as congestive heart failure, ANP and BNP plasma concentrations are chronically high due to continued volume overload. Measurement of the concentrations are useful in the assessment of cardiac function and diagnosis of congestive heart failure (reviewed in Ref. 8). Identification of details of these mechanisms will help us to understand the pathophysiology of cardiac diseases. One promising approach is to study how the natriuretic peptide genes are regulated.
We have chosen salmon (Salmo salar) as the model organism. Salmon is a teleost species that adapts to both low and high salt environments as a part of its natural life cycle (9). The endocrine defense mechanisms against salt and volume overload are more highly developed in osmoregulating animals than they are in terrestrial animals, which, during their normal life cycle, are challenged principally by the lack, rather than an excess, of salt and water (10). We recently cloned from salmon heart a complementary DNA (cDNA) encoding the novel vasorelaxant cardiac hormone salmon cardiac peptide (sCP) (11). The 29-amino acid mature peptide relaxes vascular smooth muscle. Its release from isolated perfused salmon cardiac ventricle is very sensitive to mechanical load. sCP has homology with previously identified natriuretic peptides, but it cannot unequivocally be placed in any of the previously known natriuretic peptide families.
We have now cloned and sequenced the gene for sCP from a salmon genomic library. Despite common features, the sequence and the overall gene structure of sCP clearly differ from those of other known natriuretic peptide genes. Remarkably, the sCP promoter is as effective as mammalian ANP promoters when tested in primary cultures of rat atrial cardiomyocytes.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Genomic DNA cloning
Genomic DNA was prepared from salmon liver. DNA partially
digested with Sau3A (10–20 kb) was ligated to 
vector
EMBL-3 digested with BamHI and EcoRI. DNA was
packaged and used to infect Escherichia coli KW251. The
library was plated and screened with a
[32P]deoxy (d)-CTP-labeled sCP cDNA probe.
Restriction analysis of the genomic clones
The three positive genomic clones hybridizing with the sCP cDNA
probe were analyzed by restriction enzyme digestion. The products were
separated on 0.7% agarose gels, blotted to nylon membranes, and
hybridized overnight with the sCP cDNA probe (11). The membranes were
washed for 60 min at 65 C with 0.2 x SSC (standard saline
citrate) containing 0.2% SDS. The integrity of the clones was verified
with parallel restriction analysis of authentic salmon genomic DNA.
DNA sequencing
The sCP genomic clone 2 was used for sequencing. An 1812-bp
Sphl fragment was subcloned into the SphI site of
pGEM 3Z- and used as a template for sequencing the coding region of the
gene. The flanking sequences of the gene were obtained by subcloning
into pBluescript SK II+ a 5-kb
EcoRI/XbaI fragment containing the 5'-flank, and
a 4-kb XhoI/EcoRI fragment containing the
3'-flank. The sequencing was carried out by the dideoxy method,
initially manually and subsequently by automated sequencing using an
ABI Prism 310 Genetic Analyzer (PE Applied Biosystems,
Foster City, CA). Both strands were sequenced. The sequences were
assembled using the software Sequencing Analysis
(Perkin-Elmer Corp.) and GeneJockey II
(Biosoft, Cambridge, UK), both run on Macintosh personal
computers. The 6840-bp nucleotide sequence has been deposited in
the EMBL nucleotide sequence databank (accession no. AJ006421).
Primer extension analysis
An antisense primer (3'-GCCACCAGCGTCTGTTGACAAAGCAGGAGC-5')
corresponding to nucleotides 74–45 of the published sCP cDNA sequence
(11) was end labeled with 5'-[32P]ATP and T4
polynucleotide kinase, purified with Sephadex G-50 gel filtration, and
hybridized overnight at room temperature with 9 or 30 µg total RNA
isolated from salmon atrium, ventricle, or kidney. After ethanol
precipitation and resuspension, avian myeloblastosis virus reverse
transcriptase and dNTP were added. The primer extension reaction was
carried out at room temperature for 2 h. After incubation for 30
min with deoxyribonuclease-free ribonuclease, the reaction mixture was
extracted with phenol/chloroform, precipitated with ethanol, and
resuspended in buffered formamide. The reaction products were separated
on a 6% acrylamide/urea sequencing gel together with an sCP genomic
sequence ladder (12).
Northern blot analysis
Tissue samples were collected from freshly killed salmon,
weighed, and stored at -70 C. For RNA isolation, the samples were
ground to powder in liquid N2 and homogenized in
9 vol (vol/wet wt) 4 mol/liter guanidine isothiocyanate, 25 mmol/liter
sodium citrate (pH 7), 0.1 mol/liter 2-mercaptoethanol, and 0.5%
N-lauroylsarcosine. Total RNA was isolated using the acidic
phenol method (13). The RNA was size-fractionated on 1% formaldehyde
agarose gels and blotted to nylon membrane. The membrane was hybridized
overnight with a [32P]dCTP-sCP cDNA probe (11)
labeled to a specific activity of more than 108
dpm/µg by random primed labeling and purified by Sephadex G-50 gel
filtration. The hybridization membranes were washed with 0.2 x
SSC and 0.2% SDS for 60 min at 65 C and used to expose X-Omat films
(Eastman Kodak Co., Rochester, NY) with an intensifying
screen at -70 C. To control potential differences in the RNA load, a
482-bp cDNA probe, corresponding to the sequence 922-1403 of the rat
gene for 18S ribosomal RNA (14), was prepared by RT-PCR, cloned to the
EcoRI site of pBluescript SK II+, and
sequenced. The insert was labeled and used in the hybridizations as
described above for sCP.
Quantitative PCR
The cDNA first strand was synthesized from RNA derived from the
different salmon tissues using Moloney murine leukemia virus reverse
transcriptase. The quantitative PCR reactions were performed with an
ABI 7700 Sequence Detection System using TaqMan chemistry. The forward
and reverse primers for sCP messenger RNA (mRNA) detection were
CATGGCCACCAGAAGTAAAGCT and TCCCGATGCGGTCCATC, corresponding to
nucleotides 5883–5904 and 5944–5928 of the sCP gene sequence,
respectively. The 62-bp amplicon was detected using the bifunctional
fluorogenic probe 5'-Fam-TGTCCGGGTGCTTCGGAGCC-Tamra-3'. The results
were normalized to 18S RNA quantified from the same samples using
the forward and reverse primers TGGTTGCAAAGCTGAAACTTAAAG and
AGTCAAATTAAGCCGCAGGC, respectively. The probe for the 18S amplicon was
5'-Vic-CCTGG-TGGTGCCCTTCCGTCA-Tamra-3'.
Luciferase reporter gene constructs
The gene constructs were made by subcloning parts of the sCP
gene 5'-flanking sequences in pGL3 Basic (Promega Corp.)
vector upstream of the firefly (Photinus pyralis) luciferase
reporter gene. The longest construct contained 4958 bp of the sCP gene
5'-flanking sequence to nucleotide 31, and the shortest construct
contained 321 bp of the sequence to nucleotide 3. The sCP 5'-flanking
fragments for these constructs were obtained by PCR using the
EcoRI/XbaI fragment of EMBL-3 clone 2 (see above)
as the template for the -4958 sCP construct (PCR primers: 3',
CGGGATCCGATTCCATTTAGGCTGC including the BamHI linker; 5',
GGGGTACCACGCGTGTGGATGTCTCTTAAC including the KpnI linker),
and the SphI/SphI fragment as a template for the
-321 sCP construct (PCR primers: 3', CGGGATCCGCTAAGGCAAGTTGTTAGCC
including the BamHI linker; 5',
GGGGTACCCTCAGGCCCCAAAGACCTACC including the KpnI linker).
The products were digested with KpnI and BamHI,
and the fragments were subcloned to the
KpnI/BglII sites in pGL3 Basic. The constructs
-1040 sCPluc and -1687 sCPluc were obtained by nested deletion of the
-4958 sCPluc construct using the double stranded nested deletion kit
(Amersham Pharmacia Biotech) according to the
manufacturer’s instructions.
Cell culture and transfection studies
Three-day-old Sprague Dawley rats were killed by cervical
dislocation, and the atria and ventricles were dissected. The myocytes
were dispersed by collagenase digestion and gentle trituration by
repeated aspiration into a Pasteur pipette. The cardiac myocytes were
washed twice with DMEM-Ham’s F-12 nutrient mix and preincubated for 30
min to remove most of the contaminating fibroblasts. Cells were plated
in 12-well plates with 1 million cells/well or in 24-well plates with
0.5 million cells/well. They were grown in DMEM-Ham’s F-12
supplemented with 10% FBS, 1.28% L-glutamine, and 1%
(100 IU) penicillin-streptomycin. The transfections were made 18 h
after plating by introducing 1 µg gene construct with 3 µg Fugene
transfection reagent per 1 million cells or 0.5 µg gene construct
with 1.5 µg Fugene transfection reagent per 0.5 million cells
according to the manufacturer’s instructions. All of the gene
constructs were cotransfected with Rous sarcoma virus-ß-Gal vector
(0.5–1 µg) to control the transfection efficiency. The transfection
was allowed to continue for 6 h in DMEM-Ham’s F-12/10% FBS,
after which it was stopped by removing the medium. The cells were
rinsed twice with DMEM-Ham’s F-12, and complete serum-free medium
(1.15% insulin-transferrin-sodium-selenite, 1.28%
L-glutamine, 1% penicillin-streptomycin, 1 nmol/liter
T3, 2.8 nmol/liter sodium pyruvate, and 0.25%
BSA in DMEM-Ham’s F-12) was added. The medium was replaced daily, and
the cells were harvested 48 h posttransfection. The cells were
washed twice with PBS and lysed in reporter lysis buffer (Promega Corp.). The luciferase and ß-Gal activities of the samples
were measured with a Luminoskan luminometer (BioLabs, Surrey,
Canada).
Isolation and N-terminal sequence analysis of salmon atrium
immunoreactive sCP
The isolation of sCP from cardiac tissue was based on monitoring
of purification with a specific RIA. The assay used an antiserum raised
in a goat against the 29-amino acid synthetic sCP conjugated to bovine
thyroglobulin (11). The antiserum was used at the final dilution of
1:8000. Synthetic sCP-29 was used as a standard. A synthetic analog of
sCP-29 with an extra tyrosine at the amino-terminus was radioiodinated
with chloramine-T and purified by Sephadex G-25 (Amersham Pharmacia Biotech) followed by reverse phase HPLC using a Vydac
C18 column and an acetonitrile gradient in
aqueous trifluoroacetic acid. The assay procedure was described
previously (15). The sensitivity of the assay was 8 pg/tube, and the
intra- and interassay coefficients of variation were less than 10% and
less than 15%, respectively. Synthetic rat ANP, porcine BNP, and rat
C-type natriuretic peptide (CNP) cross-reacted less than 0.1% in the
assay.
A pool of frozen atria (6.7 g) was ground to powder in liquid N2, added to 4.5 vol boiling H2O, and kept in a boiling water bath for 5 min. After being chilled on ice, 4.5 vol cold 2 mol/liter acetic acid and 0.04 mol/liter HCl were added, and the tissue was homogenized with an Ultra-Turrax (Janke & Kunkel, Staufen, Germany). The homogenate was centrifuged for 30 min at 15,000 x g, and the supernatant was lyophilized. The extract was dissolved in 10 ml 1 mol/liter acetic acid and applied to a 2.6 x 71-cm Sephadex G-75 column eluted with the same solvent at 5 C with a flow rate of 1 ml/min. Fractions of 12 ml were collected, and the absorbance at 280 nm was measured with a GeneQuant spectrophotometer (Amersham Pharmacia Biotech). Aliquots of the fractions were diluted for use in the sCP RIA. To simplify further purification, only the fraction with the highest level of immunoreactive sCP in Sephadex G-75 (fraction 15) was used. It was pumped into a 1 x 25-cm Vydac C4 HPLC column eluted at 2 ml/min with a linear 60-min gradient from 10–40% acetonitrile in aqueous 0.1% trifluoroacetic acid. Fractions of 2 ml were collected. Absorbance at 220 nm was measured at each step of HPLC to monitor the purity of the products. Fractions containing immunoreactive sCP, eluting at 55–56 min, were pooled, diluted, and applied into a 0.8 x 10-cm Waters Radio Compression Module (RCM)-phenyl column eluted at 2 ml/min with a 30-min linear gradient from 20–50% acetonitrile in 0.1% aqueous trifluoroacetic acid. Fractions of 2 ml were collected. Fraction 25 with the highest level of immunoreactivity was finally purified in a 0.46 x 15-cm Vydac C4 column eluted at 1 ml/min with a 40-min linear gradient from 16–48% acetonitrile in aqueous 0.1% trifluoroacetic acid. Fractions of 1 ml were collected. Fractions 34 and 37 were dried and subjected to 15 cycles of automated Edman degradation using an ABI 477A gas phase sequencer (PE Applied Biosystems).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). A 1.8-kb SphI fragment,
hybridizing with the sCP cDNA probe, was subcloned into a plasmid
vector and sequenced. When compared with the previously published cDNA
sequence (11), the sCP gene was found to consist of two exons and a
387-bp intron bounded by consensus splicing donor and acceptor sites
(Fig. 2). The 3'-sequence contained
in the SphI fragment was, however, incomplete when compared
with the cDNA. Therefore, and to expand the potentially important
regulatory 5'-flanking sequence, two additional fragments of the
original clones were subcloned into plasmid vectors and sequenced.
The sequence of the subclone containing the 3'-region confirmed the
structure of the cDNA with a consensus polyadenylation signal 745 bp
downstream from the stop codon (Fig. 2). The sequence provided no
evidence for a second intron, the presence of which was expected on the
basis of the known structures of ANP and BNP genes. The 3'-untranslated
sequence proved to be AT rich, a feature characteristic of mammalian
BNP, but not ANP.
|
|
). In both salmon atrium and
ventricle two adjacent sites were found, located 35 and 34 bp upstream
from the proposed translation initiation codon, the former being the
dominant one by a ratio of approximately 3:1. This is in accordance
with the known predilection of adenine as the starting point of
eukaryotic transcription (16). No primer extension signal was detected
in the kidney, in keeping with our inability to detect any sCP mRNA in
the tissue (see below). Two possible translation initiation codons
within 15 bp of the start of transcription were detected, which would
result in preprohormones of 152 and 148 amino acids. They both contain
a G following the AUG codon, but there is a purine at position -3
upstream from the AUG only in the latter candidate, a feature required
for optimal context in the scanning model of translation (16).
Therefore, we propose that transcription of the sCP gene starts at -35
bp from the initiation codon and results in a primary transcript of
1612 nucleotides, including a 387-nucleotide intron. The translation
product is a preprohormone of 148 amino acids.
|
). The sCP promoter was, however, weak
in rat ventricular cells; the luciferase expression barely differed
from the basal level (Fig. 4B). Thus, remarkably, despite the large
phylogenetic distance and sequence variance, the sCP gene promoter
shows similar basal promoter activity as mammalian ANP promoters in rat
atrial myocytes.
|
). To obtain a more accurate estimate of
the extent of cardiac specificity of expression, the salmon tissue mRNA
samples were subjected to quantitative RT-PCR analysis. The sCP mRNA
level in the ventricle was 30 ± 4% of that in the atrium,
whereas the sCP mRNA level was less than 0.04% of the atrial level in
all of the other tissues studied (Fig. 5).
|
). It had the
NH2-terminal sequence
His-Val-Leu-Gly-Arg-Pro-Tyr-Pro-Asp-Ser-Asp-Leu-Ala-Gln-Leu-, which
corresponds exactly to residues 23–37 of prepro-sCP as deduced
from the nucleotide sequence. The minor peak of immunoreactivity found
in the last step of the purification (fraction 37 in Fig. 6D) had the
same NH2-terminal sequence as the major peak. It
probably represents a slight variant with posttranslational
modifications or an isolation artifact. Although COOH-terminal sequence
analysis was not performed, the facts that the RIA used for monitoring
the isolation steps is directed to the COOH-terminus of prepro-sCP and
that isolated perfused salmon heart releases the 29-amino acid sCP (11)
indicate that the stored peptide possesses an intact COOH-terminus. We,
therefore, propose that sCP is stored in the salmon atrium as a
126-amino acid prohormone (prepro-sCP23–148).
The NH2-terminal 22 amino acids of prepro-sCP
would thus form the signal peptide, a finding in accordance with its
high hydrophobicity demonstrated by the Kyte-Doolittle hydropathy plot
(data not shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
clones isolated from a salmon genomic library. The finding of only
one intron in sCP gene was unexpected, because all ANP and BNP genes
known to date have been found to have three exons and two introns
(17, 18, 19, 20, 21, 22). In this respect the sCP gene resembles that of CNP, where
only the intron close to the 5'-end has been found (23, 24). On the
other hand, the biologically active peptide product of the sCP gene
clearly differs from CNP and resembles ANP and BNP, having both N- and
C-terminal tails to the cysteine ring structure (25, 26, 27). Sequencing of
the sCP gene confirmed the novelty of the hormone; it is related to the
natriuretic peptides but does not belong to any one of the formerly
described natriuretic peptide families. It is possible that sCP
represents an ancestral form of mammalian natriuretic peptides.
The entire 6840-bp sCP gene sequence was subjected to an EMBL/GenBank
nucleotide database homology search. The 5'-flanking sequences of
approximately 2730–2770, 2805–2860, 3500–3541, and 3995–4080 of the
sCP gene contain interspersed repetitive sequences found previously in
various genes in a large number of species of the salmonid family. An
interesting 87.9% homology was found between the 183-bp sequence
2480–2662 of the sCP gene and the sequence 1289–1470 of the Chinook
salmon gonadotropin 
-subunit gene (28) (accession no. S77061). Of
the elements previously associated with regulation of the natriuretic
peptide genes, this sequence contains a conserved E2A-binding site at
2516, but no GATA- or activating protein-1 (AP-1)-binding sites.
Interestingly, direct CA repeats were found in both the sCP gene (96
bp) and the Chinook salmon gonadotropin gene (70 bp). The sCP
repeat was, however, located in the 5'-flanking sequence, whereas the
gonadotropin repeat was in the 3'-flanking sequence. The demonstration
of a possible functional significance of these similarities requires
further study.
Isolation and NH2-terminal sequence analysis of immunoreactive sCP stored in salmon heart confirmed the reading frame deduced from the nucleotide sequence of sCP cDNA and gene. It also revealed that the stored peptide in salmon atrium is the prohormone of 126 amino acids, which appears to be processed to the mature 29-amino acid sCP in conjunction with exocytosis (28A ). The situation is analogous to that with mammalian ANP (29). The processing mechanisms are unknown for sCP, as they are for ANP. Although the size of the mature sCP is longer than that of mammalian ANP by one amino acid, the prohormones have exactly the same length. This conservation of hormone size is interesting considering the very low homology between the amino acid or nucleotide sequences of sCP and mammalian ANP outside the carboxyl-terminal Cys-Cys ring.
The 5-kb 5'-flanking region of sCP sequenced in the present study revealed several interesting features. Instead of the consensus TATA box and differing from all of the natriuretic peptide genes studied to date, an atypical TATTTAA sequence is found 35 bp upstream from the main transcription initiation site. However, according to a recent study this sequence is as effective as the consensus TATA box sequence in driving gene expression (30). The mammalian natriuretic peptide genes studied to date have all been found to contain binding sites for several potentially important transcription factors, such as GATAs and AP-1, at very close proximity to the transcription initiation site (31, 32, 33, 34). The sCP gene, however, contains an approximately 800-bp stretch upstream from the TATTTAA sequence almost devoid of the consensus binding sites, previously detected in natriuretic peptide genes. On the other hand, a remarkably large number of GATA and AP-1 elements can be found further upstream. The 10 GATA (+) sites and 8 AP-1 (+) sites are loosely clustered in two regions of the 5'-flanking sequence, at 5000–4400 and 1500–800 bp upstream from the transcription initiation site. In addition, there are several additional GATA and AP-1 consensus binding sites in the reverse orientation (-). GATA-4 transcription factor has been found to be important in ANP and BNP gene regulation in mammalian cardiomyocytes (35, 36, 37). AP-1 consists of a heterodimer of c-fos and c-jun protooncogene products. The activation of c-fos and c-jun as well as other immediate early genes, is a main consequence of cardiac overload. This has raised interest about their possible role in ANP and BNP gene regulation. AP-1 has been implicated in stretch-induced transcriptional activation of ANP (38).
A number of potential CArg- and E2A-binding sites can be found in the
5'-flanking sequence of the sCP gene. They have previously been
suggested to have a role in the regulation of natriuretic peptide genes
in different mammalian species (39, 40). Additional elements of
potential importance, found previously in the promoters of some
natriuretic peptide genes, can be found closer to the transcription
start site of the sCP gene. These include an MEF-2 site (CTATTTAT) and
an M-CAT-like sequence (CATTCCC) at -606 and -351 relative to the
main transcription start site, respectively. Moreover, as mentioned
above, the 5'-sequence of sCP gene contains a 96-bp direct CA repeat at
-197–292 (Fig. 2
). The repeat can adopt the Z-configuration with
potential regulatory function. Shorter CA repeats in the 5'-regulatory
regions have been detected in the genes of rat ANP and mouse CNP. An
element binding Nkx-2.5 (NKE) has recently been linked to ANP
and BNP gene regulation (41, 42, 43). An NKE-like element can be found in
the sCP gene at -117 upstream from the transcription start site,
although the sCP sequence differs in 6 positions from the 16-nucleotide
NKE element found in mammalian ANP and BNP genes.
The main rationale of our present research was to use sCP as a new model by which to define the elements responsible for cardiac specificity of hormone gene expression and, in future studies, the sensitivity to mechanical stimuli of the natriuretic peptide genes. We believe that sCP is an exceptionally suitable model for these studies because of the extreme cardiac specificity of its expression. We found the level of sCP mRNA to be less than 1/2500th of the cardiac level in all of the extracardiac tissues studied, far surpassing the cardiac specificity of natriuretic peptides in mammals (44). To perform promoter analysis we cloned fragments containing the 5'-flanking region of the sCP gene in front of the luciferase reporter gene and tested their ability to drive luciferase expression in neonatal rat cardiac myocytes. We also have a number of mammalian ANP and BNP luciferase gene constructs to use for comparison in our studies.
The 5'-fragments of the sCP gene were remarkably strong promoters in neonatal rat atrial cells despite the very large phylogenetic distance between salmon and rat. This indicates that although the apparent homology of the sCP 5'-flanking sequence is very low when compared with the corresponding regions of mammalian ANP or BNP genes, the sCP gene nevertheless contains elements that are crucial to high basal cardiac gene expression in the mammalian atrium. Promoter analysis of the sCP gene, therefore, provides an excellent means to identify the general mechanisms of gene regulation resulting in cardiac-specific and, more specifically, atrial-specific hormone gene expression. The clear tissue specificity, with regard to atrial and ventricular cardiomyocytes, of the promoter activity was not completely unexpected, as we recently demonstrated that salmon ventricle produces and releases sCP in a manner resembling the production of ANP and BNP in mammalian atrium rather than ventricle, including storage in cytoplasmic granules and regulated release of the peptide (28A ).
The activity profile of the sCP constructs transfected into neonatal rat atrial and ventricular cells resembles that of corresponding bovine and fin whale ANP gene 5'-regulatory luciferase constructs (Taskinen, T., and O. Vuolteenaho, unpublished findings). The difference in expression levels between the atrial and ventricular cells is not quite so large with the mammalian constructs as it is with the sCP constructs. Sequence comparison of the 5'-regulatory regions of different natriuretic peptide genes is the first approach we are using to determine the important transcription factors conferring tissue specificity and inducibility by mechanical stimuli of these cardiac genes.
Our transfection results for the activity of sCP promoter in rat atrial cells are not inconsistent with the idea that the GATA and AP-1 sites are important for effective function of the promoter, as suggested previously (38, 45). The shortest construct (-321 to 3 bp), lacking the GATA (+) and AP-1 elements, had weaker activity than the longer constructs (-1687 to 31 bp and -1040 to 31 bp), containing 4 and 1 GATA (+) elements and 4 and 2 AP-1 (+) elements, respectively. In view of the presumed importance of the GATA and AP-1 elements, it is surprising that the efficacy of the promoter did not depend on the number of these sites. The activity of the longest construct (-4958 to 31 bp), containing 10 GATA (+) and 8 AP-1(+) elements, was lower than that of the -1040 sCP construct, with only 1 potential GATA (+) and 2 AP-1(+) sites. The possible presence of inhibitory elements in the long construct could explain this finding. The promoter activity of the -1040 sCP construct, however, is so high, exceeding that of the SV-40 (control) promoter, that it is difficult to see how the distal GATA and AP-1 elements could appreciably enhance the activity of the promoter. On the other hand, there most certainly are other elements, in addition to GATA and AP-1, that are important for the high promoter activity in rat atrial cells.
The much lower promoter activity in ventricular cells of the same constructs that were highly active in atrial cells demonstrates that the elements are not fully used in ventricular cells under basal conditions. Potential load-inducible genetic elements, important especially in the ventricles, may have mechanisms in common with the high basal atrial gene expression, which is remarkably well conserved in evolution, as described in the present study. The similarity in the transcriptional activity of the salmon, bovine, and fin whale genes in rat atrial cells and the strong conservation of ANP genes among different species indicates that these regulatory elements are shared by organisms expressing A-type or related natriuretic peptide genes. Therefore, we believe that the sCP gene, in conjunction with mammalian natriuretic peptide genes, is an excellent model for defining the cardiac load-inducible promoter elements and transcription factors involved in activation of the endocrine function of the heart. It also provides novel insights into the pathophysiology of cardiac failure and hypertrophy.
|
Footnotes |
|---|
Received August 16, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  T. O. Peltonen, P. Taskinen, Y. Soini, J. Rysa, J. Ronkainen, P. Ohtonen, J. Satta, T. Juvonen, H. Ruskoaho, and H. Leskinen Distinct Downregulation of C-Type Natriuretic Peptide System in Human Aortic Valve Stenosis Circulation, September 11, 2007; 116(11): 1283 - 1289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A.-M. Moilanen, J. Hakkola, M. H. Vaarala, S. Kauppila, P. Hirvikoski, J. T. Vuoristo, R. J. Edwards, and T. K. Paavonen Characterization of androgen-regulated expression of CYP3A5 in human prostate Carcinogenesis, May 1, 2007; 28(5): 916 - 921. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Tenhunen, Y. Soini, M. Ilves, J. Rysa, J. Tuukkanen, R. Serpi, H. Pennanen, H. Ruskoaho, and H. Leskinen p38 Kinase rescues failing myocardium after myocardial infarction: evidence for angiogenic and anti-apoptotic mechanisms FASEB J, September 1, 2006; 20(11): 1907 - 1909. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Vierimaa, J. Ronkainen, H. Ruskoaho, and O. Vuolteenaho Synergistic activation of salmon cardiac function by endothelin and beta-adrenergic stimulation Am J Physiol Heart Circ Physiol, September 1, 2006; 291(3): H1360 - H1370. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Foldes, S. Vajda, Z. Lako-Futo, B. Sarman, R. Skoumal, M. Ilves, R. deChatel, I. Karadi, M. Toth, H. Ruskoaho, et al. Distinct modulation of angiotensin II-induced early left ventricular hypertrophic gene programming by dietary fat type J. Lipid Res., June 1, 2006; 47(6): 1219 - 1226. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Savolainen, T. J. Kotti, W. Schmitz, T. I. Savolainen, R. T. Sormunen, M. Ilves, S. J. Vainio, E. Conzelmann, and J. K. Hiltunen A mouse model for {alpha}-methylacyl-CoA racemase deficiency: adjustment of bile acid synthesis and intolerance to dietary methyl-branched lipids Hum. Mol. Genet., May 1, 2004; 13(9): 955 - 965. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Tavi, S. Pikkarainen, J. Ronkainen, P. Niemela, M. Ilves, M. Weckstrom, O. Vuolteenaho, J. Bruton, H. Westerblad, and H. Ruskoaho Pacing-induced calcineurin activation controls cardiac Ca2+ signalling and gene expression J. Physiol., January 15, 2004; 554(2): 309 - 320. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Lako-Futo, I. Szokodi, B. Sarman, G. Foldes, H. Tokola, M. Ilves, H. Leskinen, O. Vuolteenaho, R. Skoumal, R. deChatel, et al. Evidence for a Functional Role of Angiotensin II Type 2 Receptor in the Cardiac Hypertrophic Process In Vivo in the Rat Heart Circulation, November 11, 2003; 108(19): 2414 - 2422. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Backlund, E. Palojoki, A. Saraste, T. Gronholm, A. Eriksson, P. Lakkisto, O. Vuolteenaho, M. S Nieminen, L.-M. Voipio-Pulkki, M. Laine, et al. Effect of vasopeptidase inhibitor omapatrilat on cardiomyocyte apoptosis and ventricular remodeling in rat myocardial infarction Cardiovasc Res, March 1, 2003; 57(3): 727 - 737. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Piuhola, I. Szokodi, P. Kinnunen, M. Ilves, R. deChatel, O. Vuolteenaho, and H. Ruskoaho Endothelin-1 Contributes to the Frank-Starling Response in Hypertrophic Rat Hearts Hypertension, January 1, 2003; 41(1): 93 - 98. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Heikkila, H. Peltoketo, J. Leppaluoto, M. Ilves, O. Vuolteenaho, and S. Vainio Wnt-4 Deficiency Alters Mouse Adrenal Cortex Function, Reducing Aldosterone Production Endocrinology, November 1, 2002; 143(11): 4358 - 4365. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Szokodi, P. Tavi, G. Foldes, S. Voutilainen-Myllyla, M. Ilves, H. Tokola, S. Pikkarainen, J. Piuhola, J. Rysa, M. Toth, et al. Apelin, the Novel Endogenous Ligand of the Orphan Receptor APJ, Regulates Cardiac Contractility Circ. Res., September 6, 2002; 91(5): 434 - 440. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Tervonen, H. Ruskoaho, T. Lecklin, M. Ilves, and O. Vuolteenaho Salmon cardiac natriuretic peptide is a volume-regulating hormone Am J Physiol Endocrinol Metab, August 1, 2002; 283(2): E353 - E361. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A.-P. Kvist, A. Latvanlehto, M. Sund, L. Eklund, T. Vaisanen, P. Hagg, R. Sormunen, J. Komulainen, R. Fassler, and T. Pihlajaniemi Lack of Cytosolic and Transmembrane Domains of Type XIII Collagen Results in Progressive Myopathy Am. J. Pathol., October 1, 2001; 159(4): 1581 - 1592. [Abstract] [Full Text]
|
|
|
|
 |
|
 J. Piuhola, A. Hammes, K. Schuh, L. Neyses, O. Vuolteenaho, and H. Ruskoaho Overexpression of sarcolemmal calcium pump attenuates induction of cardiac gene expression in response to ET-1 Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2001; 281(3): R699 - R705. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Eklund, J. Piuhola, J. Komulainen, R. Sormunen, C. Ongvarrasopone, R. Fässler, A. Muona, M. Ilves, H. Ruskoaho, T. E. S. Takala, et al. Lack of type XV collagen causes a skeletal myopathy and cardiovascular defects in mice PNAS, January 23, 2001; (2001) 31444798. [Abstract] [Full Text]
|
|
|
|
|
|
L. Eklund, J. Piuhola, J. Komulainen, R. Sormunen, C. Ongvarrasopone, R. Fassler, A. Muona, M. Ilves, H. Ruskoaho, T. E. S. Takala, et al. Lack of type XV collagen causes a skeletal myopathy and cardiovascular defects in mice PNAS, January 30, 2001; 98(3): 1194 - 1199. [Abstract] [Full Text] [PDF]
|
|
|
|
