help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Majalahti-Palviainen, T.
Right arrow Articles by Vuolteenaho, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Majalahti-Palviainen, T.
Right arrow Articles by Vuolteenaho, O.
Endocrinology Vol. 141, No. 2 731-740
Copyright © 2000 by The Endocrine Society


ARTICLES

Gene Structure of a New Cardiac Peptide Hormone: A Model for Heart-Specific Gene Expression1

Theresa Majalahti-Palviainen, Minna Hirvinen, Virpi Tervonen, Mika Ilves, Heikki Ruskoaho and Olli Vuolteenaho

Departments of Physiology and Pharmacology and Toxicology (H.R.), Biocenter Oulu, University of Oulu, FIN-90220 Oulu, Finland

Address all correspondence and requests for reprints to: Dr. Olli Vuolteenaho, Department of Physiology, University of Oulu, Kajaanintie 52A, FIN-90220 Oulu, Finland. E-mail: olli.vuolteenaho{at}oulu.fi


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Volume excess and mechanical load lead to the induction of the endocrine activity of the heart. The increased production and secretion of A- and B-type natriuretic peptides (ANP and BNP), in turn, unload the heart due to their physiological effects. To find out the mechanisms of cardiac-specific expression and sensitivity to mechanical stimuli of the natriuretic peptide genes, we have used salmon (Salmo salar) as our model organism, because osmoregulating fish have a particularly well developed defense mechanism against volume excess. We have previously cloned a complementary DNA from salmon heart encoding a novel vasorelaxant cardiac hormone, salmon cardiac peptide (sCP). Its production is restricted to the heart, and its release is very sensitive to mechanical load. We have now cloned the gene encoding sCP. The structure of the gene suggests that sCP may represent an ancestral form of the mammalian natriuretic peptides. Remarkably, despite the large phylogenetic distance, the sCP promoter is as effective as mammalian ANP promoters in cultured neonatal rat atrial cardiomyocytes. Therefore, structural and functional comparisons of the promoters of sCP and ANP provide an excellent means of identifying the elements and transcription factors required for atrial-specific gene expression and the regulation of the endocrine function of the heart. Isolation of the protein product of sCP gene from salmon atrium demonstrated that the storage form of sCP is the prohormone of 126 amino acids. The final processing of the prohormone appears to take place during exocytosis of the secretory granules, as the released and circulating form is the biologically active 29-amino acid sCP.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
WELL MAINTAINED fluid balance is essential for normal blood pressure and tissue perfusion. The renin-angiotensin-aldosterone system and antidiuretic hormone help to retain water and sodium and to elevate the blood pressure, whereas excessive extracellular fluid volume leads to increased production of A- and B-type natriuretic peptides (ANP and BNP) in the heart. ANP and BNP, once released into the circulation, cause natriuresis, diuresis, and vasodilation and inhibit the activity of the renin-angiotensin-aldosterone system (1; reviewed in Refs. 2, 3, 4).

The heart reacts to load by increasing the amount of the contractile element. It also activates its own mechanisms that unload the heart. The release of the natriuretic peptides lowers blood pressure and reduces cardiac work load (5, 6, 7). In some pathophysiological situations, such as congestive heart failure, ANP and BNP plasma concentrations are chronically high due to continued volume overload. Measurement of the concentrations are useful in the assessment of cardiac function and diagnosis of congestive heart failure (reviewed in Ref. 8). Identification of details of these mechanisms will help us to understand the pathophysiology of cardiac diseases. One promising approach is to study how the natriuretic peptide genes are regulated.

We have chosen salmon (Salmo salar) as the model organism. Salmon is a teleost species that adapts to both low and high salt environments as a part of its natural life cycle (9). The endocrine defense mechanisms against salt and volume overload are more highly developed in osmoregulating animals than they are in terrestrial animals, which, during their normal life cycle, are challenged principally by the lack, rather than an excess, of salt and water (10). We recently cloned from salmon heart a complementary DNA (cDNA) encoding the novel vasorelaxant cardiac hormone salmon cardiac peptide (sCP) (11). The 29-amino acid mature peptide relaxes vascular smooth muscle. Its release from isolated perfused salmon cardiac ventricle is very sensitive to mechanical load. sCP has homology with previously identified natriuretic peptides, but it cannot unequivocally be placed in any of the previously known natriuretic peptide families.

We have now cloned and sequenced the gene for sCP from a salmon genomic library. Despite common features, the sequence and the overall gene structure of sCP clearly differ from those of other known natriuretic peptide genes. Remarkably, the sCP promoter is as effective as mammalian ANP promoters when tested in primary cultures of rat atrial cardiomyocytes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Sephadex chromatography media, Oligo Labeling Kit, restriction enzymes, and radiochemicals were obtained from Amersham Pharmacia Biotech (Uppsala, Sweden). A few restriction enzymes as well as the cDNA first strand synthesis reagents were purchased from MBI Fermentas (Vilnius, Lithuania). Cloning vectors, luciferase reporter vectors, firefly luciferase enzyme, and the reagents needed for measurements of luciferase activities were obtained from Promega Corp. (Madison, WI). pBluescript SK+ plasmid was purchased from Stratagene (La Jolla, CA). Synthetic oligonucleotide primers for DNA sequencing, primer extension analysis and PCR were obtained from Biocenter Oulu Oligonucleotide Synthesis Service (University of Oulu, Oulu, Finland). Reagents for DNA sequencing (ABI Prism 310) and quantitative PCR (ABI Prism 7700) were purchased from Perkin-Elmer Corp. Nordic (Stockholm, Sweden). DMEM-Ham’s nutrient mix F-12, L-glutamine, and penicillin-streptomycin for cell culture were obtained from Biochrom (Berlin, Germany). Collagenase was purchased from Worthington Biochemical Corp. (Lakewood, NJ). Fugene transfection reagent was purchased from Roche Molecular Biochemicals (Basel, Switzerland). The ß-galactosidase (ß-Gal) enzyme and ß-Gal detection kit were obtained from CLONTECH Laboratories, Inc. (Palo Alto, CA). Blotting membranes were purchased from Schleicher & Schuell, Inc. (Dass, Germany). HPLC columns were obtained from Separations Group (Hesperia, CA) and Waters Corp. (Milford, MA). All other reagents were of analytical grade and were obtained from standard suppliers.

Genomic DNA cloning
Genomic DNA was prepared from salmon liver. DNA partially digested with Sau3A (10–20 kb) was ligated to {lambda} vector EMBL-3 digested with BamHI and EcoRI. DNA was packaged and used to infect Escherichia coli KW251. The library was plated and screened with a [32P]deoxy (d)-CTP-labeled sCP cDNA probe.

Restriction analysis of the genomic clones
The three positive genomic clones hybridizing with the sCP cDNA probe were analyzed by restriction enzyme digestion. The products were separated on 0.7% agarose gels, blotted to nylon membranes, and hybridized overnight with the sCP cDNA probe (11). The membranes were washed for 60 min at 65 C with 0.2 x SSC (standard saline citrate) containing 0.2% SDS. The integrity of the clones was verified with parallel restriction analysis of authentic salmon genomic DNA.

DNA sequencing
The sCP genomic clone 2 was used for sequencing. An 1812-bp Sphl fragment was subcloned into the SphI site of pGEM 3Z- and used as a template for sequencing the coding region of the gene. The flanking sequences of the gene were obtained by subcloning into pBluescript SK II+ a 5-kb EcoRI/XbaI fragment containing the 5'-flank, and a 4-kb XhoI/EcoRI fragment containing the 3'-flank. The sequencing was carried out by the dideoxy method, initially manually and subsequently by automated sequencing using an ABI Prism 310 Genetic Analyzer (PE Applied Biosystems, Foster City, CA). Both strands were sequenced. The sequences were assembled using the software Sequencing Analysis (Perkin-Elmer Corp.) and GeneJockey II (Biosoft, Cambridge, UK), both run on Macintosh personal computers. The 6840-bp nucleotide sequence has been deposited in the EMBL nucleotide sequence databank (accession no. AJ006421).

Primer extension analysis
An antisense primer (3'-GCCACCAGCGTCTGTTGACAAAGCAGGAGC-5') corresponding to nucleotides 74–45 of the published sCP cDNA sequence (11) was end labeled with 5'-[32P]ATP and T4 polynucleotide kinase, purified with Sephadex G-50 gel filtration, and hybridized overnight at room temperature with 9 or 30 µg total RNA isolated from salmon atrium, ventricle, or kidney. After ethanol precipitation and resuspension, avian myeloblastosis virus reverse transcriptase and dNTP were added. The primer extension reaction was carried out at room temperature for 2 h. After incubation for 30 min with deoxyribonuclease-free ribonuclease, the reaction mixture was extracted with phenol/chloroform, precipitated with ethanol, and resuspended in buffered formamide. The reaction products were separated on a 6% acrylamide/urea sequencing gel together with an sCP genomic sequence ladder (12).

Northern blot analysis
Tissue samples were collected from freshly killed salmon, weighed, and stored at -70 C. For RNA isolation, the samples were ground to powder in liquid N2 and homogenized in 9 vol (vol/wet wt) 4 mol/liter guanidine isothiocyanate, 25 mmol/liter sodium citrate (pH 7), 0.1 mol/liter 2-mercaptoethanol, and 0.5% N-lauroylsarcosine. Total RNA was isolated using the acidic phenol method (13). The RNA was size-fractionated on 1% formaldehyde agarose gels and blotted to nylon membrane. The membrane was hybridized overnight with a [32P]dCTP-sCP cDNA probe (11) labeled to a specific activity of more than 108 dpm/µg by random primed labeling and purified by Sephadex G-50 gel filtration. The hybridization membranes were washed with 0.2 x SSC and 0.2% SDS for 60 min at 65 C and used to expose X-Omat films (Eastman Kodak Co., Rochester, NY) with an intensifying screen at -70 C. To control potential differences in the RNA load, a 482-bp cDNA probe, corresponding to the sequence 922-1403 of the rat gene for 18S ribosomal RNA (14), was prepared by RT-PCR, cloned to the EcoRI site of pBluescript SK II+, and sequenced. The insert was labeled and used in the hybridizations as described above for sCP.

Quantitative PCR
The cDNA first strand was synthesized from RNA derived from the different salmon tissues using Moloney murine leukemia virus reverse transcriptase. The quantitative PCR reactions were performed with an ABI 7700 Sequence Detection System using TaqMan chemistry. The forward and reverse primers for sCP messenger RNA (mRNA) detection were CATGGCCACCAGAAGTAAAGCT and TCCCGATGCGGTCCATC, corresponding to nucleotides 5883–5904 and 5944–5928 of the sCP gene sequence, respectively. The 62-bp amplicon was detected using the bifunctional fluorogenic probe 5'-Fam-TGTCCGGGTGCTTCGGAGCC-Tamra-3'. The results were normalized to 18S RNA quantified from the same samples using the forward and reverse primers TGGTTGCAAAGCTGAAACTTAAAG and AGTCAAATTAAGCCGCAGGC, respectively. The probe for the 18S amplicon was 5'-Vic-CCTGG-TGGTGCCCTTCCGTCA-Tamra-3'.

Luciferase reporter gene constructs
The gene constructs were made by subcloning parts of the sCP gene 5'-flanking sequences in pGL3 Basic (Promega Corp.) vector upstream of the firefly (Photinus pyralis) luciferase reporter gene. The longest construct contained 4958 bp of the sCP gene 5'-flanking sequence to nucleotide 31, and the shortest construct contained 321 bp of the sequence to nucleotide 3. The sCP 5'-flanking fragments for these constructs were obtained by PCR using the EcoRI/XbaI fragment of EMBL-3 clone 2 (see above) as the template for the -4958 sCP construct (PCR primers: 3', CGGGATCCGATTCCATTTAGGCTGC including the BamHI linker; 5', GGGGTACCACGCGTGTGGATGTCTCTTAAC including the KpnI linker), and the SphI/SphI fragment as a template for the -321 sCP construct (PCR primers: 3', CGGGATCCGCTAAGGCAAGTTGTTAGCC including the BamHI linker; 5', GGGGTACCCTCAGGCCCCAAAGACCTACC including the KpnI linker). The products were digested with KpnI and BamHI, and the fragments were subcloned to the KpnI/BglII sites in pGL3 Basic. The constructs -1040 sCPluc and -1687 sCPluc were obtained by nested deletion of the -4958 sCPluc construct using the double stranded nested deletion kit (Amersham Pharmacia Biotech) according to the manufacturer’s instructions.

Cell culture and transfection studies
Three-day-old Sprague Dawley rats were killed by cervical dislocation, and the atria and ventricles were dissected. The myocytes were dispersed by collagenase digestion and gentle trituration by repeated aspiration into a Pasteur pipette. The cardiac myocytes were washed twice with DMEM-Ham’s F-12 nutrient mix and preincubated for 30 min to remove most of the contaminating fibroblasts. Cells were plated in 12-well plates with 1 million cells/well or in 24-well plates with 0.5 million cells/well. They were grown in DMEM-Ham’s F-12 supplemented with 10% FBS, 1.28% L-glutamine, and 1% (100 IU) penicillin-streptomycin. The transfections were made 18 h after plating by introducing 1 µg gene construct with 3 µg Fugene transfection reagent per 1 million cells or 0.5 µg gene construct with 1.5 µg Fugene transfection reagent per 0.5 million cells according to the manufacturer’s instructions. All of the gene constructs were cotransfected with Rous sarcoma virus-ß-Gal vector (0.5–1 µg) to control the transfection efficiency. The transfection was allowed to continue for 6 h in DMEM-Ham’s F-12/10% FBS, after which it was stopped by removing the medium. The cells were rinsed twice with DMEM-Ham’s F-12, and complete serum-free medium (1.15% insulin-transferrin-sodium-selenite, 1.28% L-glutamine, 1% penicillin-streptomycin, 1 nmol/liter T3, 2.8 nmol/liter sodium pyruvate, and 0.25% BSA in DMEM-Ham’s F-12) was added. The medium was replaced daily, and the cells were harvested 48 h posttransfection. The cells were washed twice with PBS and lysed in reporter lysis buffer (Promega Corp.). The luciferase and ß-Gal activities of the samples were measured with a Luminoskan luminometer (BioLabs, Surrey, Canada).

Isolation and N-terminal sequence analysis of salmon atrium immunoreactive sCP
The isolation of sCP from cardiac tissue was based on monitoring of purification with a specific RIA. The assay used an antiserum raised in a goat against the 29-amino acid synthetic sCP conjugated to bovine thyroglobulin (11). The antiserum was used at the final dilution of 1:8000. Synthetic sCP-29 was used as a standard. A synthetic analog of sCP-29 with an extra tyrosine at the amino-terminus was radioiodinated with chloramine-T and purified by Sephadex G-25 (Amersham Pharmacia Biotech) followed by reverse phase HPLC using a Vydac C18 column and an acetonitrile gradient in aqueous trifluoroacetic acid. The assay procedure was described previously (15). The sensitivity of the assay was 8 pg/tube, and the intra- and interassay coefficients of variation were less than 10% and less than 15%, respectively. Synthetic rat ANP, porcine BNP, and rat C-type natriuretic peptide (CNP) cross-reacted less than 0.1% in the assay.

A pool of frozen atria (6.7 g) was ground to powder in liquid N2, added to 4.5 vol boiling H2O, and kept in a boiling water bath for 5 min. After being chilled on ice, 4.5 vol cold 2 mol/liter acetic acid and 0.04 mol/liter HCl were added, and the tissue was homogenized with an Ultra-Turrax (Janke & Kunkel, Staufen, Germany). The homogenate was centrifuged for 30 min at 15,000 x g, and the supernatant was lyophilized. The extract was dissolved in 10 ml 1 mol/liter acetic acid and applied to a 2.6 x 71-cm Sephadex G-75 column eluted with the same solvent at 5 C with a flow rate of 1 ml/min. Fractions of 12 ml were collected, and the absorbance at 280 nm was measured with a GeneQuant spectrophotometer (Amersham Pharmacia Biotech). Aliquots of the fractions were diluted for use in the sCP RIA. To simplify further purification, only the fraction with the highest level of immunoreactive sCP in Sephadex G-75 (fraction 15) was used. It was pumped into a 1 x 25-cm Vydac C4 HPLC column eluted at 2 ml/min with a linear 60-min gradient from 10–40% acetonitrile in aqueous 0.1% trifluoroacetic acid. Fractions of 2 ml were collected. Absorbance at 220 nm was measured at each step of HPLC to monitor the purity of the products. Fractions containing immunoreactive sCP, eluting at 55–56 min, were pooled, diluted, and applied into a 0.8 x 10-cm Waters Radio Compression Module (RCM)-phenyl column eluted at 2 ml/min with a 30-min linear gradient from 20–50% acetonitrile in 0.1% aqueous trifluoroacetic acid. Fractions of 2 ml were collected. Fraction 25 with the highest level of immunoreactivity was finally purified in a 0.46 x 15-cm Vydac C4 column eluted at 1 ml/min with a 40-min linear gradient from 16–48% acetonitrile in aqueous 0.1% trifluoroacetic acid. Fractions of 1 ml were collected. Fractions 34 and 37 were dried and subjected to 15 cycles of automated Edman degradation using an ABI 477A gas phase sequencer (PE Applied Biosystems).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To determine the regulation of expression of the novel cardiac peptide hormone sCP, we cloned its gene from a salmon genomic library with the aid of a sCP cDNA probe. Three hybridizing recombinants were characterized by restriction enzyme mapping. Together they spanned approximately 26 kb of genomic DNA and encoded the entire primary transcript of sCP with approximately 10 and 14 kb of 5'- and 3'-flanking sequence, respectively (Fig. 1Go). A 1.8-kb SphI fragment, hybridizing with the sCP cDNA probe, was subcloned into a plasmid vector and sequenced. When compared with the previously published cDNA sequence (11), the sCP gene was found to consist of two exons and a 387-bp intron bounded by consensus splicing donor and acceptor sites (Fig. 2Go). The 3'-sequence contained in the SphI fragment was, however, incomplete when compared with the cDNA. Therefore, and to expand the potentially important regulatory 5'-flanking sequence, two additional fragments of the original {lambda} clones were subcloned into plasmid vectors and sequenced. The sequence of the subclone containing the 3'-region confirmed the structure of the cDNA with a consensus polyadenylation signal 745 bp downstream from the stop codon (Fig. 2Go). The sequence provided no evidence for a second intron, the presence of which was expected on the basis of the known structures of ANP and BNP genes. The 3'-untranslated sequence proved to be AT rich, a feature characteristic of mammalian BNP, but not ANP.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. The organization of the sCP gene. The three EMBL-3 genomic clones (c1–c3) are shown above the schematic illustration of the gene structure.

 




View larger version (138K):
[in this window]
[in a new window]
 
Figure 2. The nucleotide sequence of sCP gene. The exon sequences are underlined. Consensus acceptor and donor splicing sites in the intron sequence are in italics. The transcription start site, the proposed translation start site, the stop codon, and the polyadenylation signal are shown by wavy lines. Selected potential transcription factor binding sites are underlined.

 
To study the 5'-flanking sequence, potentially the most important region with regard to the regulation of the gene expression, we first localized the transcription start site by primer extension analysis (Fig. 3Go). In both salmon atrium and ventricle two adjacent sites were found, located 35 and 34 bp upstream from the proposed translation initiation codon, the former being the dominant one by a ratio of approximately 3:1. This is in accordance with the known predilection of adenine as the starting point of eukaryotic transcription (16). No primer extension signal was detected in the kidney, in keeping with our inability to detect any sCP mRNA in the tissue (see below). Two possible translation initiation codons within 15 bp of the start of transcription were detected, which would result in preprohormones of 152 and 148 amino acids. They both contain a G following the AUG codon, but there is a purine at position -3 upstream from the AUG only in the latter candidate, a feature required for optimal context in the scanning model of translation (16). Therefore, we propose that transcription of the sCP gene starts at -35 bp from the initiation codon and results in a primary transcript of 1612 nucleotides, including a 387-nucleotide intron. The translation product is a preprohormone of 148 amino acids.



View larger version (96K):
[in this window]
[in a new window]
 
Figure 3. Localization of sCP gene transcription start site by primer extension. The transcription start site of the sCP gene was determined by primer extension analysis. The reaction was carried out with isolated RNA from the following salmon tissues: 1) kidney, 30 µg; 2) kidney, 9 µg; 3) ventricle, 30 µg; 4) ventricle, 9 µg; 5) atrium, 30 µg; and 6) atrium 9 µg. The products of the extension reaction were separated on a 6% acrylamide/urea gel together with an sCP genomic sequence ladder. Two transcription start sites were found, with A preferred over G in an ratio of approximately 3:1.

 
Cardiac myocyte primary cell culture is a useful model for studying gene expression with transfection of reporter gene constructs. To test the activity of sCP promoter we subcloned four fragments, from -4958 to 31 bp, -1687 to 31 bp, -1040 to 31 bp, and -321 to 3 bp relative to the transcription start site, in front of the luciferase gene in pGL-3 Basic and transfected the constructs into neonatal rat atrial and ventricular myocytes. The sCP gene constructs were able to drive the atrial gene expression very effectively, surpassing the level of the simian virus 40 (SV-40) promoter used as a positive control (Fig. 4AGo). The sCP promoter was, however, weak in rat ventricular cells; the luciferase expression barely differed from the basal level (Fig. 4BGo). Thus, remarkably, despite the large phylogenetic distance and sequence variance, the sCP gene promoter shows similar basal promoter activity as mammalian ANP promoters in rat atrial myocytes.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. Activity profiles of sCP luciferase gene constructs in neonatal rat atrial and ventricular cardiomyocytes. A, Activity profile of the sCP luciferase constructs in atrial cells. B, Activity profile of the sCP luciferase constructs in ventricular cells. The activities were normalized to Rous sarcoma virus-ß-gal values and presented as a percentage of the SV-40 promoter (pGL3 control) activity. pGL3-Basic (promoterless luciferase gene) reflects the background luciferase activity. The data are the mean ± SEM of 4–10 measurements. Similar results were obtained in three independent experiments.

 
Northern blot analysis was performed to determine the distribution of the expression of the sCP gene in salmon tissues. Using a sCP cDNA probe, a strong 1.3-kb hybridizing signal was detected in the atrium and ventricle; the signal was approximately 3–4 times stronger in the former, but not in any other tissue studied (Fig. 5Go). To obtain a more accurate estimate of the extent of cardiac specificity of expression, the salmon tissue mRNA samples were subjected to quantitative RT-PCR analysis. The sCP mRNA level in the ventricle was 30 ± 4% of that in the atrium, whereas the sCP mRNA level was less than 0.04% of the atrial level in all of the other tissues studied (Fig. 5Go).



View larger version (59K):
[in this window]
[in a new window]
 
Figure 5. Tissue distribution of sCP mRNA. A, Northern blot analysis of RNA extracted from various salmon tissues. A 1.3-kb mRNA band hybridizing with the sCP cDNA probe was found only in atrial and ventricular samples (upper lanes). 18S ribosomal RNA was used to normalize the RNA amounts in different tissues (lower lanes). B, Quantitative RT-PCR analysis of sCP mRNA in various salmon tissues. The values were normalized to 18S ribosomal RNA, measured simultaneously, and presented as a percentage of the average level of sCP mRNA in salmon atrium. The data are the mean ± SEM (n = 9).

 
Isolation of sCP stored in the atrium by gel filtrationand three steps of reverse phase HPLC revealed one major immunoreactive product (Fig. 6Go). It had the NH2-terminal sequence His-Val-Leu-Gly-Arg-Pro-Tyr-Pro-Asp-Ser-Asp-Leu-Ala-Gln-Leu-, which corresponds exactly to residues 23–37 of prepro-sCP as deduced from the nucleotide sequence. The minor peak of immunoreactivity found in the last step of the purification (fraction 37 in Fig. 6DGo) had the same NH2-terminal sequence as the major peak. It probably represents a slight variant with posttranslational modifications or an isolation artifact. Although COOH-terminal sequence analysis was not performed, the facts that the RIA used for monitoring the isolation steps is directed to the COOH-terminus of prepro-sCP and that isolated perfused salmon heart releases the 29-amino acid sCP (11) indicate that the stored peptide possesses an intact COOH-terminus. We, therefore, propose that sCP is stored in the salmon atrium as a 126-amino acid prohormone (prepro-sCP23–148). The NH2-terminal 22 amino acids of prepro-sCP would thus form the signal peptide, a finding in accordance with its high hydrophobicity demonstrated by the Kyte-Doolittle hydropathy plot (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 6. Isolation of immunoreactive sCP from salmon atrium. A pool of salmon atria (6.7 g) was extracted with acetic acid and purified to apparent homogeneity with gel filtration followed by three steps of reverse phase HPLC. Immunoreactive sCP in the fractions is indicated by black dots, absorbance (at 280 in A and 220 nm in B–D) is shown by a continuous line, and the acetonitrile gradient is indicated by a dashed line. A, Sephadex G-75 gel filtration. Fraction 15 was used for further purification. B, Reverse phase HPLC in a semipreparative Vydac C4 column. Fractions 55–56 were pooled for further purification. C, Reverse phase HPLC in a radial compression module phenyl column. Fraction 25 was used for further purification. D, Reverse phase HPLC in an analytical Vydac C4 column. Fractions 34 and 37 were subjected separately to NH2-terminal sequence analysis.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The sequence of the sCP gene was determined from three overlapping {lambda} clones isolated from a salmon genomic library. The finding of only one intron in sCP gene was unexpected, because all ANP and BNP genes known to date have been found to have three exons and two introns (17, 18, 19, 20, 21, 22). In this respect the sCP gene resembles that of CNP, where only the intron close to the 5'-end has been found (23, 24). On the other hand, the biologically active peptide product of the sCP gene clearly differs from CNP and resembles ANP and BNP, having both N- and C-terminal tails to the cysteine ring structure (25, 26, 27). Sequencing of the sCP gene confirmed the novelty of the hormone; it is related to the natriuretic peptides but does not belong to any one of the formerly described natriuretic peptide families. It is possible that sCP represents an ancestral form of mammalian natriuretic peptides.

The entire 6840-bp sCP gene sequence was subjected to an EMBL/GenBank nucleotide database homology search. The 5'-flanking sequences of approximately 2730–2770, 2805–2860, 3500–3541, and 3995–4080 of the sCP gene contain interspersed repetitive sequences found previously in various genes in a large number of species of the salmonid family. An interesting 87.9% homology was found between the 183-bp sequence 2480–2662 of the sCP gene and the sequence 1289–1470 of the Chinook salmon gonadotropin {alpha}-subunit gene (28) (accession no. S77061). Of the elements previously associated with regulation of the natriuretic peptide genes, this sequence contains a conserved E2A-binding site at 2516, but no GATA- or activating protein-1 (AP-1)-binding sites. Interestingly, direct CA repeats were found in both the sCP gene (96 bp) and the Chinook salmon gonadotropin {alpha} gene (70 bp). The sCP repeat was, however, located in the 5'-flanking sequence, whereas the gonadotropin repeat was in the 3'-flanking sequence. The demonstration of a possible functional significance of these similarities requires further study.

Isolation and NH2-terminal sequence analysis of immunoreactive sCP stored in salmon heart confirmed the reading frame deduced from the nucleotide sequence of sCP cDNA and gene. It also revealed that the stored peptide in salmon atrium is the prohormone of 126 amino acids, which appears to be processed to the mature 29-amino acid sCP in conjunction with exocytosis (28A ). The situation is analogous to that with mammalian ANP (29). The processing mechanisms are unknown for sCP, as they are for ANP. Although the size of the mature sCP is longer than that of mammalian ANP by one amino acid, the prohormones have exactly the same length. This conservation of hormone size is interesting considering the very low homology between the amino acid or nucleotide sequences of sCP and mammalian ANP outside the carboxyl-terminal Cys-Cys ring.

The 5-kb 5'-flanking region of sCP sequenced in the present study revealed several interesting features. Instead of the consensus TATA box and differing from all of the natriuretic peptide genes studied to date, an atypical TATTTAA sequence is found 35 bp upstream from the main transcription initiation site. However, according to a recent study this sequence is as effective as the consensus TATA box sequence in driving gene expression (30). The mammalian natriuretic peptide genes studied to date have all been found to contain binding sites for several potentially important transcription factors, such as GATAs and AP-1, at very close proximity to the transcription initiation site (31, 32, 33, 34). The sCP gene, however, contains an approximately 800-bp stretch upstream from the TATTTAA sequence almost devoid of the consensus binding sites, previously detected in natriuretic peptide genes. On the other hand, a remarkably large number of GATA and AP-1 elements can be found further upstream. The 10 GATA (+) sites and 8 AP-1 (+) sites are loosely clustered in two regions of the 5'-flanking sequence, at 5000–4400 and 1500–800 bp upstream from the transcription initiation site. In addition, there are several additional GATA and AP-1 consensus binding sites in the reverse orientation (-). GATA-4 transcription factor has been found to be important in ANP and BNP gene regulation in mammalian cardiomyocytes (35, 36, 37). AP-1 consists of a heterodimer of c-fos and c-jun protooncogene products. The activation of c-fos and c-jun as well as other immediate early genes, is a main consequence of cardiac overload. This has raised interest about their possible role in ANP and BNP gene regulation. AP-1 has been implicated in stretch-induced transcriptional activation of ANP (38).

A number of potential CArg- and E2A-binding sites can be found in the 5'-flanking sequence of the sCP gene. They have previously been suggested to have a role in the regulation of natriuretic peptide genes in different mammalian species (39, 40). Additional elements of potential importance, found previously in the promoters of some natriuretic peptide genes, can be found closer to the transcription start site of the sCP gene. These include an MEF-2 site (CTATTTAT) and an M-CAT-like sequence (CATTCCC) at -606 and -351 relative to the main transcription start site, respectively. Moreover, as mentioned above, the 5'-sequence of sCP gene contains a 96-bp direct CA repeat at -197–292 (Fig. 2Go). The repeat can adopt the Z-configuration with potential regulatory function. Shorter CA repeats in the 5'-regulatory regions have been detected in the genes of rat ANP and mouse CNP. An element binding Nkx-2.5 (NKE) has recently been linked to ANP and BNP gene regulation (41, 42, 43). An NKE-like element can be found in the sCP gene at -117 upstream from the transcription start site, although the sCP sequence differs in 6 positions from the 16-nucleotide NKE element found in mammalian ANP and BNP genes.

The main rationale of our present research was to use sCP as a new model by which to define the elements responsible for cardiac specificity of hormone gene expression and, in future studies, the sensitivity to mechanical stimuli of the natriuretic peptide genes. We believe that sCP is an exceptionally suitable model for these studies because of the extreme cardiac specificity of its expression. We found the level of sCP mRNA to be less than 1/2500th of the cardiac level in all of the extracardiac tissues studied, far surpassing the cardiac specificity of natriuretic peptides in mammals (44). To perform promoter analysis we cloned fragments containing the 5'-flanking region of the sCP gene in front of the luciferase reporter gene and tested their ability to drive luciferase expression in neonatal rat cardiac myocytes. We also have a number of mammalian ANP and BNP luciferase gene constructs to use for comparison in our studies.

The 5'-fragments of the sCP gene were remarkably strong promoters in neonatal rat atrial cells despite the very large phylogenetic distance between salmon and rat. This indicates that although the apparent homology of the sCP 5'-flanking sequence is very low when compared with the corresponding regions of mammalian ANP or BNP genes, the sCP gene nevertheless contains elements that are crucial to high basal cardiac gene expression in the mammalian atrium. Promoter analysis of the sCP gene, therefore, provides an excellent means to identify the general mechanisms of gene regulation resulting in cardiac-specific and, more specifically, atrial-specific hormone gene expression. The clear tissue specificity, with regard to atrial and ventricular cardiomyocytes, of the promoter activity was not completely unexpected, as we recently demonstrated that salmon ventricle produces and releases sCP in a manner resembling the production of ANP and BNP in mammalian atrium rather than ventricle, including storage in cytoplasmic granules and regulated release of the peptide (28A ).

The activity profile of the sCP constructs transfected into neonatal rat atrial and ventricular cells resembles that of corresponding bovine and fin whale ANP gene 5'-regulatory luciferase constructs (Taskinen, T., and O. Vuolteenaho, unpublished findings). The difference in expression levels between the atrial and ventricular cells is not quite so large with the mammalian constructs as it is with the sCP constructs. Sequence comparison of the 5'-regulatory regions of different natriuretic peptide genes is the first approach we are using to determine the important transcription factors conferring tissue specificity and inducibility by mechanical stimuli of these cardiac genes.

Our transfection results for the activity of sCP promoter in rat atrial cells are not inconsistent with the idea that the GATA and AP-1 sites are important for effective function of the promoter, as suggested previously (38, 45). The shortest construct (-321 to 3 bp), lacking the GATA (+) and AP-1 elements, had weaker activity than the longer constructs (-1687 to 31 bp and -1040 to 31 bp), containing 4 and 1 GATA (+) elements and 4 and 2 AP-1 (+) elements, respectively. In view of the presumed importance of the GATA and AP-1 elements, it is surprising that the efficacy of the promoter did not depend on the number of these sites. The activity of the longest construct (-4958 to 31 bp), containing 10 GATA (+) and 8 AP-1(+) elements, was lower than that of the -1040 sCP construct, with only 1 potential GATA (+) and 2 AP-1(+) sites. The possible presence of inhibitory elements in the long construct could explain this finding. The promoter activity of the -1040 sCP construct, however, is so high, exceeding that of the SV-40 (control) promoter, that it is difficult to see how the distal GATA and AP-1 elements could appreciably enhance the activity of the promoter. On the other hand, there most certainly are other elements, in addition to GATA and AP-1, that are important for the high promoter activity in rat atrial cells.

The much lower promoter activity in ventricular cells of the same constructs that were highly active in atrial cells demonstrates that the elements are not fully used in ventricular cells under basal conditions. Potential load-inducible genetic elements, important especially in the ventricles, may have mechanisms in common with the high basal atrial gene expression, which is remarkably well conserved in evolution, as described in the present study. The similarity in the transcriptional activity of the salmon, bovine, and fin whale genes in rat atrial cells and the strong conservation of ANP genes among different species indicates that these regulatory elements are shared by organisms expressing A-type or related natriuretic peptide genes. Therefore, we believe that the sCP gene, in conjunction with mammalian natriuretic peptide genes, is an excellent model for defining the cardiac load-inducible promoter elements and transcription factors involved in activation of the endocrine function of the heart. It also provides novel insights into the pathophysiology of cardiac failure and hypertrophy.


    Footnotes
 
1 This work was supported by grants from Academy of Finland, the Sigrid Juselius Foundation, and the Finnish Heart Research Foundation. Back

Received August 16, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. De Bold AJ 1985 Atrial natriuretic factor: a hormone produced by the heart. Science 230:767–770[Abstract/Free Full Text]
  2. Inagami T 1994 Atrial natriuretic factor as a volume regulator. J Clin Pharmacol 34:424–426[Abstract]
  3. Ruskoaho H, Leskinen H, Magga J, Taskinen P, Mäntymaa P, Vuolteenaho O, Leppäluoto J 1997 Mechanisms of mechanical load-induced atrial natriuretic peptide secretion: role of endothelin, nitric oxide and angiotensin II. J Mol Med 75:876–885[CrossRef][Medline]
  4. Ruskoaho H 1992 Atrial natriuretic peptide: synthesis, release and metabolism. Pharmacol Rev 44:479–602[Medline]
  5. Kinnunen P, Vuolteenaho O, Ruskoaho H 1993 Mechanisms of atrial and brain natriuretic peptide release from rat ventricular myocardium: effect of stretching. Endocrinology 132:1961–1970[Abstract/Free Full Text]
  6. Ruskoaho H, Lang RE, Toth M, Ganten D, Unger T 1987 Release and regulation of atrial natriuretic peptide (ANP). Eur Heart J [Suppl B] 8:99–109
  7. Lang RE, Unger T, Ganten D 1987 Atrial natriuretic peptide: a new factor in blood pressure control. J Hypertens 5:255–271[CrossRef][Medline]
  8. Sagnella GA 1998 Measurement and significance of circulating natriuretic peptides in cardiovascular disease. Clin Sci (Colch) 95:519–529[Medline]
  9. Evans DH 1993 Osmotic regulation. In: Evans DH (ed) The Physiology of Fishes. CRC Press, Boca Raton, vol 1:315–341
  10. Schmidt-Nielsen K 1975 Water and osmotic regulation. In: Schmidt-Nielsen K (ed) Animal Physiology. Cambridge University Press, Cambridge, vol 1:371–495
  11. Tervonen V, Arjamaa O, Kokkonen K, Ruskoaho H, Vuolteenaho O 1998 A novel cardiac hormone related to A-, B-, and C-type natriuretic peptides. Endocrinology 139:4021–4025[Abstract/Free Full Text]
  12. Sambrook J, Fritsch EF, Maniatis T 1989 Analysis of RNA by primer extension. In: Nolan C (ed) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, vol 2:7.79–7.83
  13. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  14. Torczynski RM, Bollon AP, Fuke M 1983 The complete nucleotide sequence of the rat 18S ribosomal RNA gene and comparison with the respective yeast and frog genes. Nucleic Acids Res 11:4879–4890[Abstract/Free Full Text]
  15. Vuolteenaho O, Koistinen P, Martikkala V, Takala T, Leppäluoto J 1992 Effect of physical exercise in hypobaric conditions on atrial natriuretic peptide secretion. Am J Physiol 263:R647–R652
  16. Lewin B 1997 Initiation of transcription. In: Lewin B (ed) Genes. Oxford University Press, New York, vol 6:811–864
  17. Roy RN, Flynn TG 1990 Organization of the gene for iso-ANP, a rat B-type natriuretic peptide. Biochem Biophys Res Commun 171:416–423[CrossRef][Medline]
  18. Ogawa Y, Itoh H, Nakao K 1995 Molecular biology and biochemistry of natriuretic peptide family. Clin Exp Pharmacol Physiol 22:49–53[Medline]
  19. Seilhamer JJ, Arfsten A, Miller JA, Lundquist P, Scarborough RM, Lewicki JA, Porter JG 1989 Human and canine gene homologs of porcine brain natriuretic peptide. Biochem Biophys Res Commun 165:650–658[CrossRef][Medline]
  20. Chiang FT, Tseng YZ, Tseng CD, Lo HM, Hsu KL, Wu TL, Lee SC 1991 Molecular cloning of complementary deoxyribonucleic acid (cDNA) for the rat atrial natriuretic peptide. J Formos Med Assoc 90:1137–1142[Medline]
  21. Ogawa Y, Itoh H, Tamura N, Suga S, Yoshimasa T, Uehira M, Matsuda S, Shiono S, Nishimoto H, Nakao K 1994 Molecular cloning of the complementary DNA and gene that encode mouse brain natriuretic peptide and generation of transgenic mice that overexpress the brain natriuretic peptide gene. J Clin Invest 93:1911–1921
  22. Argentin S, Nemer M, Drouin J, Scott GK, Kennedy BP, Davies PL 1985 The gene for rat atrial natriuretic factor. J Biol Chem 260:4568–4571[Abstract/Free Full Text]
  23. Huang H, Acuff CG, Steinhelper ME 1996 Isolation, mapping and regulated expression of the gene encoding mouse C-type natriuretic peptide. Am J Physiol 271:H1565–H1575
  24. Ogawa Y, Itoh H, Yoshitake Y, Inoue M, Yoshimasa T, Serikawa T, Nakao K 1994 Molecular cloning and chromosomal assignment of the mouse C-type natriuretic peptide (CNP) gene (NppC): comparison with the human CNP gene (NPPC). Genomics 24:383–287[CrossRef][Medline]
  25. Kambayashi Y, Nakao K, Mukoyama M, Saito Y, Ogawa Y, Shiono S, Inouye K, Yoshida, N, Imura H 1990 Isolation and sequence determination of human brain natriuretic peptide in human atrium. FEBS Lett 259:341–345[CrossRef][Medline]
  26. Nakao K, Itoh H, Kambayashi Y, Hosoda K, Saito Y, Yamada T, Mukoyama M, Arai H, Shirakami G, Suga S 1990 Rat brain natriuretic peptide. Isolation from rat heart and tissue distribution. Hypertension 15:774–778[Abstract/Free Full Text]
  27. Saito Y, Nakao K, Itoh H, Yamada T, Mukoyama M, Arai H, Hosoda K, Shirakami G, Suga S, Minamino N 1989 Brain natriuretic peptide is a novel cardiac hormone. Biochem Biophys Res Commun 158:360–368[CrossRef][Medline]
  28. Suzuki K, Liu D, Hew CL 1995 A gene encoding chinook salmon (Onchorhynchus tschawytscha) gonadotropin alpha subunit: gene structure and promoter analysis in primary pituitary cells. Mol Mar Biol Biotech 4:10–19[Medline]
  29. Kokkonen K, Vierimaa H, Bergström S, Tervonen V, Arjaman O, Ruskoaho H, Järvilehto M, Vuolteenaho O Novel salmon cardiac peptide hormone is released from the ventricle by regulated secretory pathway. Am J Physiol, in press
  30. Vuolteenaho O, Arjamaa O, Ling N 1985 Atrial natriuretic polypeptides (ANP): rat atria store high molecular weight precursor but secrete processed peptides of 25–35 amino acids. Biochem Biophys Res Commun 129:82–88[CrossRef][Medline]
  31. Hoopes BC, LeBlanc JF, Hawley DK 1998 Contribution of the TATA-box sequence to rate-limiting steps in transcription initiation by RNA polymerase II. J Mol Biol 277:1015–1031[CrossRef][Medline]
  32. Rosenzweig A, Halazonetis TD, Seidman JG, Seidman CE 1991 Proximal regulatory domains of rat atrial natriuretic factor gene. Circulation 84:1256–1265[Abstract/Free Full Text]
  33. Wu JP, Kovacic-Milivojevic B, Lapointe MC, Nakamura K, Gardner DG 1991 cis-active determinants of cardiac-specific expression in the human atrial natriuretic peptide gene. Mol Endocrinol 5:1311–1322[Abstract/Free Full Text]
  34. Seidman CE, Wong DW, Jarcho JA, Bloch KD, Seidman JG 1988 cis-acting sequences that modulate atrial natriuretic factor gene expression. Proc Natl Acad Sci USA 85:4104–4108[Abstract/Free Full Text]
  35. Wu J, LaPointe MC, West BL, Gardner DG 1989 Tissue-specific determinants of human atrial natriuretic factor gene expression in cardiac tissue. J Biol Chem 264:6472–6479[Abstract/Free Full Text]
  36. Durocher D, Grepin C, Nemer M 1998 Regulation of gene expression in the endocrine heart. Recent Prog Horm Res 53:7–23.
  37. Durocher D, Nemer M 1998 Combinatorial interactions regulating cardiac transcription. Dev Genet 22:250–262[CrossRef][Medline]
  38. Thuerauf DJ, Hanford DS, Glembotski CC 1994 Regulation of rat brain natriuretic peptide transcription. A potential role for GATA-related transcription factors in myocardial cell gene expression. J Biol Chem 269:17772–17775[Abstract/Free Full Text]
  39. Von Harsdorf R, Edwards JG, Shen Y-T, Kudej RK, Dietz R, Leinwand LA, Nadal-Ginard B, Vatner SF 1997 Identification of cis-acting regulatory element conferring inducibility of the atrial natriuretic factor gene in acute pressure overload. J Clin Invest 100:1294–1304[Medline]
  40. Garami M, Gardner DG 1996 An E-box motif conveys inhibitory activity on the atrial natriuretic peptide gene. Hypertension 28:315–319[Abstract/Free Full Text]
  41. Argentin S, Ardati A, Tremblay S, Lihrmann I, Robitaille L, Drouin J, Nemer M 1994 Developmental stage-specific regulation of atrial natriuretic factor gene transcription in cardiac cells. Mol Cell Biol 14:777–790[Abstract/Free Full Text]
  42. Searcy RD, Vincent EB, Liberatore CM, Yutzey KE 1998 A GATA-dependent Nkx-2.5 regulatory element activates early cardiac gene expression in transgenic mice. Development 125:4461–4470[Abstract]
  43. Sepulveda JL, Belaguli N, Nigam V, Chen CY, Nemer M, Schwartz RJ 1998 GATA-4 and NKx-2.5 coactivate Nkx-2 DNA binding targets: role for regulating early cardiac gene expression. Mol Cell Biol 18:3405–3415[Abstract/Free Full Text]
  44. Durocher D, Charron F, Warren R, Schwartz RJ, Nemer M 1997 The cardiactranscription factors Nkx-2.5 and GATA-4 are mutual cofactors. EMBO J 16:5687–5696[CrossRef][Medline]
  45. Minamino N, Aburaya M, Masayasu K, Miyamoto K, Kangawa K, Matsuo H 1993 Distribution of C-type natriuretic peptide and its messenger RNA in rat central nervous system and peripheral tissue. Biochem Biophys Res Commun 197:326–335[CrossRef][Medline]
  46. Grepin C, Dagnino L, Robitaille L, Haberstroh L, Antakly T, Nemer M 1994 A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription. Mol Cell Biol 14:3115–3129[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
CirculationHome page
T. O. Peltonen, P. Taskinen, Y. Soini, J. Rysa, J. Ronkainen, P. Ohtonen, J. Satta, T. Juvonen, H. Ruskoaho, and H. Leskinen
Distinct Downregulation of C-Type Natriuretic Peptide System in Human Aortic Valve Stenosis
Circulation, September 11, 2007; 116(11): 1283 - 1289.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A.-M. Moilanen, J. Hakkola, M. H. Vaarala, S. Kauppila, P. Hirvikoski, J. T. Vuoristo, R. J. Edwards, and T. K. Paavonen
Characterization of androgen-regulated expression of CYP3A5 in human prostate
Carcinogenesis, May 1, 2007; 28(5): 916 - 921.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
O. Tenhunen, Y. Soini, M. Ilves, J. Rysa, J. Tuukkanen, R. Serpi, H. Pennanen, H. Ruskoaho, and H. Leskinen
p38 Kinase rescues failing myocardium after myocardial infarction: evidence for angiogenic and anti-apoptotic mechanisms
FASEB J, September 1, 2006; 20(11): 1907 - 1909.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
H. Vierimaa, J. Ronkainen, H. Ruskoaho, and O. Vuolteenaho
Synergistic activation of salmon cardiac function by endothelin and beta-adrenergic stimulation
Am J Physiol Heart Circ Physiol, September 1, 2006; 291(3): H1360 - H1370.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
G. Foldes, S. Vajda, Z. Lako-Futo, B. Sarman, R. Skoumal, M. Ilves, R. deChatel, I. Karadi, M. Toth, H. Ruskoaho, et al.
Distinct modulation of angiotensin II-induced early left ventricular hypertrophic gene programming by dietary fat type
J. Lipid Res., June 1, 2006; 47(6): 1219 - 1226.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. Savolainen, T. J. Kotti, W. Schmitz, T. I. Savolainen, R. T. Sormunen, M. Ilves, S. J. Vainio, E. Conzelmann, and J. K. Hiltunen
A mouse model for {alpha}-methylacyl-CoA racemase deficiency: adjustment of bile acid synthesis and intolerance to dietary methyl-branched lipids
Hum. Mol. Genet., May 1, 2004; 13(9): 955 - 965.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
P. Tavi, S. Pikkarainen, J. Ronkainen, P. Niemela, M. Ilves, M. Weckstrom, O. Vuolteenaho, J. Bruton, H. Westerblad, and H. Ruskoaho
Pacing-induced calcineurin activation controls cardiac Ca2+ signalling and gene expression
J. Physiol., January 15, 2004; 554(2): 309 - 320.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Z. Lako-Futo, I. Szokodi, B. Sarman, G. Foldes, H. Tokola, M. Ilves, H. Leskinen, O. Vuolteenaho, R. Skoumal, R. deChatel, et al.
Evidence for a Functional Role of Angiotensin II Type 2 Receptor in the Cardiac Hypertrophic Process In Vivo in the Rat Heart
Circulation, November 11, 2003; 108(19): 2414 - 2422.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. Backlund, E. Palojoki, A. Saraste, T. Gronholm, A. Eriksson, P. Lakkisto, O. Vuolteenaho, M. S Nieminen, L.-M. Voipio-Pulkki, M. Laine, et al.
Effect of vasopeptidase inhibitor omapatrilat on cardiomyocyte apoptosis and ventricular remodeling in rat myocardial infarction
Cardiovasc Res, March 1, 2003; 57(3): 727 - 737.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. Piuhola, I. Szokodi, P. Kinnunen, M. Ilves, R. deChatel, O. Vuolteenaho, and H. Ruskoaho
Endothelin-1 Contributes to the Frank-Starling Response in Hypertrophic Rat Hearts
Hypertension, January 1, 2003; 41(1): 93 - 98.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Heikkila, H. Peltoketo, J. Leppaluoto, M. Ilves, O. Vuolteenaho, and S. Vainio
Wnt-4 Deficiency Alters Mouse Adrenal Cortex Function, Reducing Aldosterone Production
Endocrinology, November 1, 2002; 143(11): 4358 - 4365.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
I. Szokodi, P. Tavi, G. Foldes, S. Voutilainen-Myllyla, M. Ilves, H. Tokola, S. Pikkarainen, J. Piuhola, J. Rysa, M. Toth, et al.
Apelin, the Novel Endogenous Ligand of the Orphan Receptor APJ, Regulates Cardiac Contractility
Circ. Res., September 6, 2002; 91(5): 434 - 440.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
V. Tervonen, H. Ruskoaho, T. Lecklin, M. Ilves, and O. Vuolteenaho
Salmon cardiac natriuretic peptide is a volume-regulating hormone
Am J Physiol Endocrinol Metab, August 1, 2002; 283(2): E353 - E361.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
V Tervonen, K Kokkonen, H Vierimaa, H Ruskoaho, and O Vuolteenaho
Temperature has a major influence on cardiac natriuretic peptide in salmon
J. Physiol., October 1, 2001; 536(1): 199 - 209.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A.-P. Kvist, A. Latvanlehto, M. Sund, L. Eklund, T. Vaisanen, P. Hagg, R. Sormunen, J. Komulainen, R. Fassler, and T. Pihlajaniemi
Lack of Cytosolic and Transmembrane Domains of Type XIII Collagen Results in Progressive Myopathy
Am. J. Pathol., October 1, 2001; 159(4): 1581 - 1592.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. Piuhola, A. Hammes, K. Schuh, L. Neyses, O. Vuolteenaho, and H. Ruskoaho
Overexpression of sarcolemmal calcium pump attenuates induction of cardiac gene expression in response to ET-1
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2001; 281(3): R699 - R705.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Eklund, J. Piuhola, J. Komulainen, R. Sormunen, C. Ongvarrasopone, R. Fassler, A. Muona, M. Ilves, H. Ruskoaho, T. E. S. Takala, et al.
Lack of type XV collagen causes a skeletal myopathy and cardiovascular defects in mice
PNAS, January 30, 2001; 98(3): 1194 - 1199.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
H. Vierimaa, M. Hirvinen, V. Tervonen, O. Arjamaa, H. Ruskoaho, and O. Vuolteenaho
Pronatriuretic peptide is a sensitive marker of the endocrine function of teleost heart
Am J Physiol Endocrinol Metab, April 1, 2002; 282(4): E843 - E850.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Majalahti-Palviainen, T.
Right arrow Articles by Vuolteenaho, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Majalahti-Palviainen, T.
Right arrow Articles by Vuolteenaho, O.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals