This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Royaux, I. E. Articles by Green, E. D. Search for Related Content PubMed PubMed Citation Articles by Royaux, I. E. Articles by Green, E. D.

Pendrin, the Protein Encoded by the Pendred Syndrome Gene (PDS), Is an Apical Porter of Iodide in the Thyroid and Is Regulated by Thyroglobulin in FRTL-5 Cells

Genome Technology Branch, National Human Genome Research Institute (I.E.R., L.A.E., E.D.G.), and the Metabolic Diseases Branch, National Institute of Diabetes and Digestive and Kidney Diseases (K.S., A.M., L.D.K.), National Institutes of Health, Bethesda, Maryland 20892; and the Department of Pathology, Yamanashi Medical University School of Medicine (R.K.), Tamaho, Japan 409-38

Address all correspondence and requests for reprints to: Dr. Eric Green, Genome Technology Branch, National Human Genome Research Institute, National Institutes of Health, 49 Convent Drive, Building 49, Room 2A08, Bethesda, Maryland 20892. E-mail: egreen{at}nhgri.nih.gov

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Pendred syndrome is an autosomal recessive disorder characterized by congenital deafness and thyroid goiter. The thyroid disease typically develops around puberty and is associated with a mild organification defect, characterized by an inappropriate discharge of iodide upon perchlorate stimulation (a positive perchlorate discharge test). The gene (PDS) mutated in Pendred syndrome is expressed in thyroid and encodes a 780-amino acid protein (pendrin) that has recently been shown to function as an iodide/chloride transporter. We sought to establish the location of pendrin in the thyroid and to examine the regulatory network controlling its synthesis. Using peptide-specific antibodies for immunolocalization studies, pendrin was detected in a limited subset of cells within the thyroid follicles, exclusively at the apical membrane of the follicular epithelium. Interestingly, significantly greater amounts of pendrin were encountered in thyroid tissue from patients with Graves’ disease. Using a cultured rat thyroid cell line (FRTL-5), PDS expression was found to be significantly induced by low concentrations of thyroglobulin (TG),but not by TSH, sodium iodide, or insulin. This is different fromthe established effect of TG, more typically a potent suppressor of thyroid-specific gene expression. Together, these results suggest that pendrin is an apical porter of iodide in the thyroid and that the expression and function of both the apical and basal iodide porters are coordinately regulated by follicular TG.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
PENDRED SYNDROME is a genetic disorder associated with profound sensorineural hearing loss and goiter (1, 2, 3, 4). Affected individuals typically have structural anomalies of the inner ear: Mondini malformation (5, 6, 7), dilated vestibular aqueducts (8, 9, 10), and, in some cases, vestibular dysfunction (7). The goiter in Pendred syndrome is variable in its expression. When present, it is multinodular and develops around puberty. Pendred syndrome is almost always associated with a positive perchlorate discharge test, whereby iodide is inappropriately discharged from the thyroid upon stimulation with perchlorate (or thiocyanate) (2, 3). This suggests that the underlying defect affects the transport of iodide across the apical membrane or the incorporation of iodide into thyroglobulin (TG; i.e. an organification defect). In addition, patients often have high serum TG levels.

In 1997, the Pendred syndrome gene (PDS) was identified by a positional cloning strategy (11). The approximately 5-kb PDS transcript shows striking tissue-specific expression, being highly expressed in human thyroid and expressed at much lower amounts in adult and fetal kidney as demonstrated by Northern analysis. RNA in situ hybridization studies have recently shown that the gene is also expressed within highly delimited regions of the mouse inner ear (12).

The predicted protein (pendrin) contains 780 amino acids (predicted to be 86 kDa) and is a member of a large family of anion transporters (13). Pendrin’s closest mammalian relatives include the proteins encoded by CLD (14), DTDST (15), and sat-1 (16); the first two of these genes are defective in congenital chloride diarrhea (17) and diastrophic dysplasia (15), respectively. Computer modeling predicts that pendrin is a transmembrane glycoprotein containing 11 or 12 transmembrane domains. Using two different expression systems, Xenopus laevis ooctyes and Sf9 insect cells, Scott et al. (18) demonstrated that pendrin can transport iodide and chloride, but not sulfate, in a sodium-independent fashion that is not affected by the anion transporter inhibitor 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid.

Despite the thyroid pathology seen in Pendred syndrome and the relatively high levels of PDS messenger RNA (mRNA) in this tissue, little is known about the characteristics of pendrin in the thyroid or the regulation of PDS expression. These issues become particularly important in light of the data implicating pendrin with iodide transport (18). We thus sought to establish the site(s) of pendrin localization in the thyroid as well as to investigate the factors that influence PDS expression. Here we report the initial results of our studies, which include both immunohistochemical analyses using newly developed pendrin-specific antibodies as well as studies of PDS expression in a functioning thyrocyte cell line widely used to study iodide transport (19, 20, 21). Together, our results strongly suggest an important and central role for pendrin in the thyroid.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Generation of pendrin peptide-specific antibodies
Rabbit antipeptide antibodies were raised against the following peptides corresponding to rat or human pendrin (Zymed Laboratories, Inc., South San Francisco, CA): QQQHERRKQERK [amino acids 34–44 in human pendrin (GenBank AF030880)], PTKEIEIQVDWNSE [amino acids 630–643 in human pendrin; same sequence in rat pendrin (GenBank AF167412)], and NNAFEPDEDVEEPE (amino acids 612–625 in rat pendrin). The resulting polyclonal antibodies were purified by affinity chromatography with Sepharose CL4B coupled with the synthetic peptide (Zymed Laboratories, Inc.).

Expression of recombinant PDS
The human PDS open reading frame, cloned into the vector pGEMHE (18), was transferred into the pcDNA3.1-mycHis expression vector (Invitrogen) such that the 3'-end of the PDS mRNA was in-frame with the myc epitope and His tag (details available on request). The sequence of the insert in the resulting plasmid (pcDNA3.1-hPDS-mycHis) was determined to verify its integrity.

Cell culture and DNA transfection
All cells were grown at 37 C in a humidified atmosphere with 5% CO₂. In all cases, the medium was changed every other day, and cells were passaged every 6–8 days. Human thyroid cancer cell lines used in this study (WRO-82 and NPA-87) were gifts from Dr. Jun Saito (University of Chiba Medical School, Chiba, Japan). Cells were grown in DMEM supplemented with 5% FCS. Cultures of primary human thyrocytes were gifts from Dr. Mathew Ringel and Ken Burman (Medstar Research Institute and Washington Hospital Center, Washington, DC). Rat medullary carcinoma cells [rMTC6–23; American Type Culture Collection (Manassas, VA) CRL-1607] were maintained in DMEM plus 10% heat-inactivated horse serum.

FRTL-5 (American Type Culture Collection CRL-8305) and FRT rat thyroid cells were used as previously described (22) and were provided by the Interthyr Research Foundation (Baltimore, MD). FRTL-5 cells were diploid and between their 5th and 25th passage. The medium for both was Coon’s modified Ham’s F-12 supplemented with 5% calf serum (Life Technologies, Inc./BRL, Gaithersburg, MD) and 1 mM nonessential amino acids (Microbiological Associates, Bethesda, MD). The medium for FRTL-5 cells also included a six-hormone mixture (6H medium), containing bovine TSH (1 x 10^-10 M), insulin (10 µg/ml), cortisol (0.4 ng/ml), transferrin (5 µg/ml), glycyl-L-histidyl-L-lysine acetate (10 ng/ml), and somatostatin (10 ng/ml). In some experiments, medium lacking TSH (termed 5H medium) or medium lacking TSH and insulin with 0.2% serum rather than 5% serum (termed 4H medium) was used.

Human embryonic kidney cells (HEK293; American Type Culture Collection CRL-1573) were grown in Eagle’s Modified MEM (DMEM; Life Technologies, Inc./BRL) supplemented with 10% FBS and 2 mM glutamine in a humidified atmosphere containing 5% CO₂ at 37 C. Cells were grown to 60–70% confluence and then transfected using the nonliposomic reagent FuGENE (Roche Molecular Biochemicals, Indianapolis, IN). Cells were harvested by trypsinization 2 days after transfection and homogenized in 50 mM sucrose-10 mM Tris containing COMPLETE cocktail protease inhibitors (Roche Molecular Biochemicals). After centrifugation at 700 x g, the resulting supernatant was centrifuged at 100,000 x g for 1 h. The pellet was then resuspended in the same buffer and analyzed by Western blotting.

Western blotting
Approximately 30 µg of protein preparations were separated on premade SDS-denaturing 8% polyacrylamide gels (NOVEX, San Diego, CA) and transferred to Protran nitrocellulose (Schleicher & Schuell, Inc., Keene, NH). Protein transfer was verified by Ponceau S staining of the gel. After overnight blocking in Tris-buffered saline supplemented with 0.1% (vol/vol) polyoxyethylene sorbitan monolaurate (Tween-20; Sigma, St. Louis, MO) and 5% nonfat dry milk, nitrocellulose blots were incubated for 2 h with antipendrin antibodies. After washing in Tris-buffered saline-Tween-20 (0.1%), blots were incubated with donkey antirabbit secondary Ig conjugated to horseradish peroxidase (diluted 1:25,000 in blocking solution; Pierce Chemical Co., Rockford, IL). The binding of primary antibodies was then revealed by enhanced chemiluminescence (Supersignal, Pierce Chemical Co.).

Immunohistochemical detection
Immunohistochemistry was performed essentially as previously described (23, 24). Briefly, approximately 5-µm sections were prepared from formalin-fixed, paraffin-embedded thyroid tissue blocks, deparaffinized, and dehydrated with xylene and graded alcohol. Microwave/pressure cooker pretreatment (two cycles of 10 min each) was performed in 10 mM citrate buffer (pH 6.0). Nonspecific binding sites were blocked by applying 5% normal goat serum diluted in PBS-Tween-20 (0.05%) and incubated at room temperature for 30 min. Primary antibody (h34–44) diluted 1:500 in 1% normal goat serum-PBS was added, and slides were incubated for 60 min at room temperature. After three 5-min washes in PBS, sections were incubated with biotinylated swine antirabbit IgG (DAKO Corp., Carpenteria, CA) at a 1:200 dilution. After 1 h, sections were subjected to three 5-min washes in PBS. Peroxidase activity was detected with 3,3'-diaminobenzidine solution containing 0.003% H₂O₂, washed, slightly counterstained with Gill’s formula hematoxylin, dehydrated, and mounted.

Northern blot analysis
Total RNA was prepared using a Total RNA Isolation Kit (5 Prime, 3 Prime, Inc., Boulder City, CO) with minor modifications to the manufacturer’s protocol: a 10-cm dish of cultured cells was used and volumes were doubled. Northern analyses, radiolabeling, hybridization, and washing procedures have been described previously (22). Quantitation of the resulting signal was performed with a BAS-1500 Bioimaging Analyzer (Fuji Photo Film Co., Ltd., Tokyo, Japan). The probe for TG (TG) was described previously (22). The sodium iodide symporter (NIS) probe was prepared by RT-PCR using FRTL-5 cell polyadenylated RNA and primers 5'AAGTTCCTGTGGATGTGCG3' and 5'TCACACCGTACATGGAGAGC3' (yielding a 529-bp fragment) (19, 22). The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probe was derived from pTR1-GAPDH-Rat template (Ambion, Inc., Austin, TX) and subcloned into pBluescript SK⁺ (Stratagene, La Jolla, CA). The PDS-specific probe was a mixture of three PCR products that together cover most of the PDS-coding region (GenBank AF030880). These products were generated with the following pairs of primers: 5'TGCTGACTTCATTGCTGGGTTAC3' and 5'AATCCAGAGAAGACGTTGCTTATCC3', 5'TACCACTGCTCTGTCTCGAACGG3' and 5'GCCATTCCACGAAGGGAACTG3', and 5'TGAAGATCCTGAGATTTTCCAGTCC3' and 5'TGTGGATTGGCACCTTCGG3'.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Development and characterization of antipendrin antibodies
Rabbit polyclonal antibodies were raised to three pendrin-specific synthetic peptides. The latter correspond to domains within the amino- or carboxyl-termini of the predicted protein. Using a recombinant protein consisting of human pendrin fused to a myc epitope and 6xHis tag (expressed in HEK293 cells) as a positive control, each of the antibodies was tested by Western blotting. When transiently expressed in HEK293 cells, a 95- to 100-kDa protein was detected with all three antibodies (Fig. 1); note that the predicted size of the unmodified fusion protein was approximately 91 kDa. In all cases, incubation with preimmune serum yielded no signal at 95–100 kDa, and preabsorption of the antibody with an excess of the peptide used for immunization abolished the signal (data not shown).

View larger version (35K): [in this window] [in a new window]   Figure 1. Western blot analysis with pendrin-specific antibodies. The approximate positions of the corresponding peptides used for generating the h34–44, r612–625, and h630–643 antibodies are shown relative to a schematic representation of the pendrin protein and its predicted transmembrane domains (11 ). Western blot analysis was performed using each antibody. Specifically, total membrane fractions (containing 30 µg protein) from HEK293 cells transfected with pcDNA3.1-hPDS-mycHis (lane 1) or nontransfected HEK293 cells (lane 2) were electrophoresed on SDS-denaturing polyacrylamide gels, and the separated proteins were transferred to nitrocellulose by Western blotting. The blots were then incubated with the indicated antibodies (diluted 1:5000). Arrows indicate the band corresponding to the recombinant pendrin. Note that an anti-myc antibody detects the identical band (data not shown). The positions of protein mol wt markers are indicated on the right.

View larger version (140K): [in this window] [in a new window]   Figure 2. Immunohistochemical analysis of thyroid tissue with an antipendrin antibody. Immunohistochemical staining of normal human (A; magnification, x100) and thyroid tissue from a patient with Graves’ disease [B (magnification, x100) and C (magnification, x400)] was performed using antibody h34–44. In A, arrowheads point to several representative areas of staining.

View larger version (50K): [in this window] [in a new window]   Figure 3. Northern blot analysis of rat and human thyroid-derived cell lines for PDS expression. Purified polyadenylated mRNA (10 µg each) from rat FRTL-5 cells, rat C cells (rMTC), rat FRT cells, normal primary human thyroid cells (NTP), human anaplastic thyroid carcinoma cells (ARO), human follicular thyroid carcinoma cells (WRO), and human papillary thyroid carcinoma cells (NPA) were subjected to Northern blot analysis. Blots were hybridized with a PDS- or GAPDH-specific probe and subjected to autoradiography.

View larger version (25K): [in this window] [in a new window]   Figure 4. Northern blot analysis of FRTL-5 cells under different growth conditions. Purified total mRNA (10 µg each) from FRTL-5 cells cultured in the indicated fashion was subjected to Northern analysis, with the resulting blots hybridized with PDS-, NIS-, TG-, or GAPDH-specific probes (as indicated) and subjected to autoradiography. In A, 4H, 5H, or 6H medium was used (see Materials and Methods for details) containing 0.2% or 5% serum. Thus, 4H0.2 corresponds to 4H medium containing 0.2% serum. In lane 3, cells were grown in 4H medium (devoid of TSH and insulin) containing 0.2% serum for 8 days and then exposed to TSH (10 mU/ml) for 48 h, at which time RNA was isolated. In lanes 8–10, cells were grown in 6H medium containing 5% serum for 8 days and then exposed to methimazole (MMI; 5 mM), TG (1 mg/ml), or interferon- (IFN-; 100 U/ml), respectively, for 48 h, at which time RNA was isolated. In B, FRTL-5 cells in 6H medium were incubated in serum-free medium containing 0.1, 1, or 10 mg/ml TG (lanes 2, 3, and 4, respectively); 0.1, 1, or 10 mg/ml BSA (lanes 5, 6, and 7, respectively); and 0.1 or 10 mg/ml mannitol (lanes 8 and 9, respectively), and RNA was extracted 48 h later. In C, FRTL-5 cells in 6H medium were incubated in serum-free medium containing TG (1 mg/ml; lane 2), T3 (10-8, 10-7, or 10-6 M; lanes 3, 4, and 5, respectively), T4 (10-7, 10-6, or 10-5 M; lanes 6, 7, and 8, respectively), and NaI (10-4, 10-3, or 10-2 M; lanes 9, 10, and 11, respectively). In D, FRTL-5 cells in 6H medium were incubated in serum-free medium containing 1 mg/ml TG for the indicated periods of time, and then RNA was extracted.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
The unusual combination of deafness and goiter encountered in Pendred syndrome raises some interesting questions about how defects in the same protein (pendrin) lead to the distinct and tissue-specific effects. To gain insight about such issues, we are studying PDS expression and pendrin subcellular localization in various tissues. For example, we recently examined the expression of the mouse ortholog (Pds) in the developing inner ear; Pds mRNA was detected in highly discrete, nonsensory regions at specific developmental stages (12). The latter results, in conjunction with the profound deafness associated with PDS mutations, point to a direct and critical role for pendrin in inner ear development and function.

In the present study, we focused on PDS and pendrin in the thyroid. Using peptide-specific antibodies and immunohistochemical techniques, we demonstrated that pendrin is limited to the apical membrane of human and rat thyrocytes lining the follicular lumen. In normal thyroid tissue, the staining is notably heterogeneous, as is follicular function; in thyroid from a patient with Graves’ disease, significantly greater amounts of pendrin were detected in a larger fraction of cells. Thus, pendrin production appears to correlate with the functional status of the thyroid follicles, at least in the case of Graves’ disease; that is, pendrin is produced at higher levels when iodide transport, organification, TG turnover, and thyroid hormone formation are high.

With the biochemical evidence that pendrin transports iodide and chloride (18) and now our immunohistochemical results, it seems plausible to postulate that pendrin functions as an apical porter of iodide in the thyrocyte, serving to transport intracellular iodide into the follicular lumen. In this regard, pendrin may work in partnership with NIS, the classic iodide transporter localized within the basolateral membrane that is responsible for the transfer of iodide from the bloodstream into the thyrocyte. Previous studies have indicated the presence of an apical iodide channel responsible for iodide efflux into the colloid (20, 32, 33, 34). Such a channel should be TSH regulated (35, 36) and should be highly permeable and specific for iodide, with a K_m of 70 µM (34, 37). As PDS expression does not appear to be affected by TSH, perhaps pendrin acts as an additional apical porter of iodide. Moreover, other studies (20, 36) have found less specificity for iodide and showed that the TSH-regulated function occurs through a calcium/inositol phosphate/arachadonic acid pathway rather than regulation at the RNA level (38).

The detection of pendrin in a subset of follicles and in a subset of thyrocytes within individual follicles is consistent with the observation that thyroid follicles are not synchronized (30). Rather, they are heterogeneous in shape, size, colloid density, iodide uptake, and, as it turns out, production of pendrin. The latter is similar to NIS in the basolateral membrane, which is typically detected in approximately 20% of the thyrocytes (39). An open question is whether the same or distinct sets of thyrocytes express both pendrin and NIS.

Prompted by the knowledge that pendrin is an apical iodide porter, we initiated studies to examine PDS expression in a system conducive to experimental manipulation. Several cell lines derived from normal and malignant thyroid tissue were analyzed by Northern analysis. Only primary human thyroid cells and rat FRTL-5 cells were found to express significant amounts of PDS mRNA. FRTL-5 is a stable thyroid cell line derived from thyroid glands of Fischer rats under defined culture conditions. This cell line has been widely adopted as a model system for the study of thyroid cell function and for bioassays (27). The FRT cell line displays no features reminiscent of functional thyroid cells (e.g. lack of iodide uptake or TG synthesis due to the absence of TTF-1). FRT cells were not found to express PDS.

Various growth factors and hormones were tested for their effect on PDS expression in FRTL-5 cells. TSH is the classic hormone known to regulate thyroid function. Whereas TSH enhances NIS expression, it has no effect on PDS expression. Indeed, of the agents tested, only TG was found to markedly increase the levels of PDS mRNA. TG, the major secretory product of the thyroid, is the protein precursor for thyroid hormones. It is a large 330-kDa glycoprotein that undergoes homodimerization in the endoplasmic reticulum and other posttranslational modifications (e.g. phosphorylation, N- and O-glycosylation, sulfation, and iodination) (40). TG mRNA production is regulated by TSH as well as insulin and insulin-like growth factor I. TSH also stimulates the reabsorption of TG from the colloid. TG becomes a potent feedback regulator of follicular function as its synthesis and secretion into the follicular lumen occurs. It suppresses multiple thyroid-specific transcription factors (e.g. TTF-1, Pax-8, and TTF-2) (22), thereby decreasing the expression of TG, TPO, TSHR, and NIS as well as iodide uptake in the thyroid. This is in contrast to the TG-induced increase in expression of genes encoding class I molecules (22) and pendrin (this study). TG is known to bind the asialoglycoprotein receptor in the apical membrane (41), although the subsequent intracellular signaling pathway remains to be established. Of note, TG with a low iodide and immature carbohydrate content binds better to the asialoglycoprotein receptor (42, 43).

One possible explanation for TG-enhanced PDS expression is that pendrin is necessary for ensuring that a sufficient amount of iodide gets into the follicle when a critical amount of TG has accumulated, ready for iodination. In Graves’ disease, the thyroid TG concentration is lower than normal (so-called empty follicles). The latter is thought to occur due to an overstimulation of the TSH receptor by autoantibodies, leading to intensive synthesis and reabsorption of TG. We found pendrin to be more abundant in Graves’ disease thyroid than in normal thyroid, possibly because the recently synthesized TG binds better to the asialoglycoprotein receptor and enhances the TG signal. Interestingly, NIS is also more abundant in Graves’ disease thyroid, but, unlike pendrin, is decreased by TG. Thus, NIS and pendrin appear to be controlled by distinct regulatory mechanisms.

The results obtained with TG-induced stimulation of pendrin production suggest a potential local role for follicular TG in the regulation of iodide metabolism. Genes essential for iodide organification and thyroid hormone biosynthesis (e.g. TG, TPO, and NIS) are constitutively expressed in thyroid cells by the constant stimulation of TSH, unless suppression by follicular TG overcomes the TSH stimulation. In a follicle in which TG levels are low, expression of these genes is maximal. As a result, newly synthesized TG begins to accumulate, and PDS expression, initially low in an almost empty follicle, becomes enhanced. When the TG concentration reaches an even higher level, PDS expression returns to its lower constitutive levels, and NIS expression is suppressed. The synthetic process is ended, but any iodide taken into the cells can be extruded by pendrin into the follicular lumen and coupled to TG.

In summary, we developed antibodies to pendrin and provided the first insight into the subcellular localization of the protein in the thyroid, which points to its likely role as an apical porter of iodide. Characterization of PDS expression in FRTL-5 cells has revealed an expanded role for TG in regulating the biosynthesis of proteins central to iodide transport and thyroid hormone production. Together, these studies contribute to the complex network of proteins involved in the regulation and biosynthesis of thyroid hormones.

	Acknowledgments

 
We thank Jean-Claude Zenklusen, Siradanahalli Guru, and Luca Ulianich for helpful discussions.

	Footnotes

 
¹ I.E.R. and K.S. contributed equally to this work.

Received September 7, 1999.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Pendred V 1896 Deaf mutism and goitre. Lancet 11:532
2. Reardon W, Trembath RC 1996 Pendred syndrome. J Med Genet 33:1037–1040[Medline]
3. Reardon W, Coffey R, Phelps PD, Luxon LM, Stephens D, Kendall TP, Britton KE, Grossman A, Trembath R 1997 Pendred syndrome–100 years of underascertainment? Q J Med 90:443–447[Abstract/Free Full Text]
4. Fraser GR 1965 Association of congenital deafness with goitre (Pendred’s syndrome): a study of 207 families. Ann Hum Genet 28:201–249[Medline]
5. Mondini C 1791 Anatpmoa sirdo mat sectop. De Boroniensi scientarium et artium instituto atque acedemia commnet. Bononiae 7:419–431
6. Johnsen T, Jorgensen MB, Johnsen S 1986 Mondini cochlea in Pendred’s syndrome. A histological study. Acta Otolaryngol (Stockh) 102:239–247[Medline]
7. Johnsen T, Larsen C, Friis J, Hougaard-Jensen F 1987 Pendred’s syndrome. Acoustic, vestibular and radiological findings in 17 unrelated patients. J Laryngol Otol 101:1187–1192[Medline]
8. Phelps PD, Coffey RA, Trembath RC, Luxon LM, Grossman AB, Britton KE, Kendall-Taylor P, Graham JM, Cadge BC, Stephens SG, Pembrey ME, Reardon W 1998 Radiological malformations of the ear in Pendred syndrome. Clin Radiol 53:268–273[CrossRef][Medline]
9. Cremers CW, Admiraal RJ, Huygen PL, Bolder C, Everett LA, Joosten FB, Green ED, van CG, Otten BJ 1998 Progressive hearing loss, hypoplasia of the cochlea and widened vestibular aqueducts are very common features in Pendred’s syndrome. Int J Pediatr Otorhinolaryngol 45:113–123[CrossRef][Medline]
10. Cremers WR, Bolder C, Admiraal RJ, Everett LA, Joosten FB, van HP, Green ED, Otten BJ 1998 Progressive sensorineural hearing loss and a widened vestibular aqueduct in Pendred syndrome. Arch Otolaryngol Head Neck Surg 124:501–505
11. Everett LA, Glaser B, Beck JC, Idol JR, Buchs A, Heyman M, Adawi F, Hazani E, Nassir E, Baxevanis AD, Sheffield VC, Green ED 1997 Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nat Genet 17:411–422[CrossRef][Medline]
12. Everett LA, Morsli H, Wu DK, Green ED 1999 Expression pattern of the mouse ortholog of the Pendred’s syndrome gene (Pds) suggests a key role for pendrin in the inner ear. Proc Natl Acad Sci USA 96:9727–9732[Abstract/Free Full Text]
13. Everett LA, Green ED 1999 A family of mammalian anion transporters and their involvement in human genetic diseases. Hum Mol Genet 8:1883–1891[Abstract/Free Full Text]
14. Schweinfest CW, Henderson KW, Suster S, Kondoh N, Papas TS 1993 Identification of a colon mucosa gene that is down-regulated in colon adenomas and adenocarcinomas. Proc Natl Acad Sci USA 90:4166–4170[Abstract/Free Full Text]
15. Hastbacka J, de la Chapelle A, Mahtani MM, Clines G, Reeve-Daly MP, Daly M, Hamilton BA, Kusumi K, Trivedi B, Weaver A, Coloma A, Lovett M, Buckler A, Kaitila I, Lander ES 1994 The diastrophic dysplasia gene encodes a novel sulfate transporter: positional cloning by fine-structure linkage disequilibrium mapping. Cell 78:1073–1087[CrossRef][Medline]
16. Bissig M, Hagenbuch B, Stieger B, Koller T, Meier PJ 1994 Functional expression cloning of the canalicular sulfate transport system of rat hepatocytes. J Biol Chem 269:3017–3021[Abstract/Free Full Text]
17. Hoglund P, Haila S, Socha J, Tomaszewski L, Saarialho-Kere U, Karjalainen-Lindsberg ML, Airola K, Holmberg C, de la Chapelle A, Kere J 1996 Mutations of the Down-regulated in adenoma (DRA) gene cause congenital chloride diarrhoea. Nat Genet 14:316–319[CrossRef][Medline]
18. Scott DA, Wang R, Kreman TM, Sheffield VC, Karniski LP 1999 The Pendred syndrome gene encodes a chloride-iodide transport protein. Nat Genet 21:440–443[CrossRef][Medline]
19. Dai G, Levy O, Carrasco N 1996 Cloning and characterization of the thyroid iodide transporter. Nature 379:458–460[CrossRef][Medline]
20. Grollman EF, Smolar A, Ommaya A, Tombaccini D, Santisteban P 1986 Iodine suppression of iodide uptake in FRTL-5 thyroid cells. Endocrinology 118:2477–2482[Abstract]
21. Weiss SJ, Philp NJ, Grollman EF 1984 Iodide transport in a continuous line of cultured cells from rat thyroid. Endocrinology 114:1090–1098[Abstract]
22. Suzuki K, Lavaroni S, Mori A, Ohta M, Saito J, Pietrarelli M, Singer DS, Kimura S, Katoh R, Kawaoi A, Kohn LD 1998 Autoregulation of thyroid-specific gene transcription by thyroglobulin. Proc Natl Acad Sci USA 95:8251–8256[Abstract/Free Full Text]
23. Shi SR, Key ME, Kalra KL 1991 Antigen retrieval in formalin-fixed, paraffin-embedded tissues: an enhancement method for immunohistochemical staining based on microwave oven heating of tissue sections. J Histochem Cytochem 39:741–748[Abstract]
24. Suzuki K, Lavaroni S, Mori A, Okajima F, Kimura S, Katoh R, Kawaoi A, Kohn LD 1998 Thyroid transcription factor 1 is calcium modulated and coordinately regulates genes involved in calcium homeostasis in C cells. Mol Cell Biol 18:7410–7422[Abstract/Free Full Text]
25. Suzuki K, Mori A, Lavaroni S, Miyagi E, Ulianich L, Katoh R, Kawaoi A, Kohn LD 1999 In vivo expression of thyroid transcription factor-1 RNA and its relation to thyroid function and follicular heterogeneity: identification of follicular thyroglobulin as a feedback suppressor of thyroid transcription factor-1 RNA levels and thyroglobulin synthesis. Thyroid 9:319–331[Medline]
26. Ambesi-Impiombato FS 1986 Fast-growing thyroid cell strain. US Patent 4,608,341
27. Ambesi-Impiombato FS, Perrild H 1989 FRTL-5 Today. Int Congr Ser 818, Excerpta Medica, Amsterdam
28. Carrasco N 1993 Iodide transport in the thyroid gland. Biochim Biophys Acta 1154:65–82[Medline]
29. Ekholm R, Kohn LD, Wollman S 1989 Control of the thyroid gland: regulation of its normal function, and growth. Adv Exp Med Biol 261:1–403
30. Suzuki K, Mori A, Lavaroni S, Ulianich L, Miyagi E, Saito J, Nakazato M, Pietrarelli M, Shafran N, Grassadonia A, Kim WB, Consiglio E, Formisano S, Kohn LD 1999 Thyroglobulin regulates follicular function and heterogeneity by suppressing thyroid-specific gene expression. Biochimie 81:329–340[Medline]
31. Salabe GB, Corvo L, Lotz H 1996 Thyroglobulin determined in thyroid fine needle aspiration biopsies by radial immunodiffusion and electroimmunodiffusion. Eur J Clin Chem Clin Biochem 34:43–47[Medline]
32. Golstein PE, Sener A, Beauwens R 1995 The iodide channel of the thyroid. II. Selective iodide conductance inserted into liposomes. Cell Physiol 37:C111–C118
33. Golstein PE, Sener A, Colin F, Beauwens R 1999 Iodide channel of the thyroid: reconstitution of iodide conductance in proteoliposomes. Methods Enzymol 294:304–319[CrossRef][Medline]
34. Nilson MU, Bjorkman R, Ekholm R, Ericson LE 1992 Polarized efflux in porcine thyrocytes occurs via a cAMP-regulated iodide channel in the apical plasma membrane. Acta Endocrinol (Copenh) 126:67–74[Medline]
35. Yoshida A, Sasaki N, Mori A, Taniguchi S, Mitani Y, Ueta Y, Hattori K, Sato R, Hisatome I, Mori T, Shigemasa C, Kosugi S 1997 Different electrophysiological character of I^-, ClO₄^-, and SCN^- in the transport by Na⁺/I^- symporter. Biochem Biophys Res Commun 231:731–734[CrossRef][Medline]
36. Yoshida A, Sasaki N, Mori A, Taniguchi S, Ueta Y, Hattori K, Tanaka Y, Igawa O, Tsuboi M, Sugawa H, Sato R, Hisatome I, Shigemasa C, Grollman EF, Kosugi S 1998 Differences in the electrophysiological response to I^- and the inhibitory anions SCN^- and ClO₄^-, studied in FRTL-5 cells. Biochim Biophys Acta 1414:231–237[Medline]
37. Golstein P, Abramow M, Dumont JE, Beauwens R 1992 The iodide channel of the thyroid: a plasma membrane vesicle study. Am J Physiol 263:C590–C597
38. Weiss SJ, Philp NJ, Ambesi-Impiombato FS, Grollman EF 1984 Thyrotropin-stimulated iodide transport mediated by adenosine 3',5'-monophosphate and dependent on protein synthesis. Endocrinology 114:1099–1107[Abstract]
39. Caillou B, Troalen F, Baudin E, Talbot M, Filetti S, Schlumberger M, Bidart JM 1998 Na⁺/I^- symporter distribution in human thyroid tissues: an immunohistochemical study. J Clin Endocrinol Metab 83:4102–4106[Abstract/Free Full Text]
40. Deshpande V, Venkatesh SG 1999 Thyroglobulin, the prothyroid hormone: chemistry, synthesis and degradation. Biochim Biophys Acta 1430:157–178[CrossRef][Medline]
41. Ulianich L, Suzuki K, Mori A, Nakazato M, Pietrarelli M, Goldsmith P, Pacifico F, Consiglio E, Formisano S, Kohn LD 1999 Follicular thyroglobulin (TG) suppression of thyroid-restricted genes involves the apical membrane asialoglycoprotein receptor and TG phosphorylation. J Biol Chem 274:25099–25107[Abstract/Free Full Text]
42. Consiglio E, Salvatore G, Rall JE, Kohn LD 1979 Thyroglobulin interactions with thyroid plasma membranes. The existence of specific receptors and their potential role. J Biol Chem 254:5065–5076[Abstract/Free Full Text]
43. Pacifico F, Liguoro D, Ulianich L, Montuori N, Cali G, Nitsch L, Kohn LD, Formisano S, Consiglio E 1999 Expression and localization of the RHL-1 subunit of the asialoglycoprotein receptor on thyroid cells: a receptor for thyroglobulin endocytosis? J Biol Chem 274:25099–25107

This article has been cited by other articles:

				I. Nakao, S. Kanaji, S. Ohta, H. Matsushita, K. Arima, N. Yuyama, M. Yamaya, K. Nakayama, H. Kubo, M. Watanabe, et al. Identification of Pendrin as a Common Mediator for Mucus Production in Bronchial Asthma and Chronic Obstructive Pulmonary Disease J. Immunol., May 1, 2008; 180(9): 6262 - 6269. [Abstract] [Full Text] [PDF]

				L. Adler, E. Efrati, and I. Zelikovic Molecular mechanisms of epithelial cell-specific expression and regulation of the human anion exchanger (pendrin) gene Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1261 - C1276. [Abstract] [Full Text] [PDF]

				M. R. Dorwart, N. Shcheynikov, D. Yang, and S. Muallem The Solute Carrier 26 Family of Proteins in Epithelial Ion Transport Physiology, April 1, 2008; 23(2): 104 - 114. [Abstract] [Full Text] [PDF]

				Z. N. Brownstein, A. A. Dror, D. Gilony, L. Migirov, K. Hirschberg, and K. B. Avraham A Novel SLC26A4 (PDS) Deafness Mutation Retained in the Endoplasmic Reticulum Arch Otolaryngol Head Neck Surg, April 1, 2008; 134(4): 403 - 407. [Abstract] [Full Text] [PDF]

				Y. Kurita, T. Nakada, A. Kato, H. Doi, A. C. Mistry, M.-H. Chang, M. F. Romero, and S. Hirose Identification of intestinal bicarbonate transporters involved in formation of carbonate precipitates to stimulate water absorption in marine teleost fish Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2008; 294(4): R1402 - R1412. [Abstract] [Full Text] [PDF]

				M. R. Dorwart, N. Shcheynikov, J. M. R. Baker, J. D. Forman-Kay, S. Muallem, and P. J. Thomas Congenital Chloride-losing Diarrhea Causing Mutations in the STAS Domain Result in Misfolding and Mistrafficking of SLC26A3 J. Biol. Chem., March 28, 2008; 283(13): 8711 - 8722. [Abstract] [Full Text] [PDF]

				M. G. P Ginabreda, L. C Cardoso, F. M Nobrega, A. C F Ferreira, M. D. C Goncalves, M. Vaisman, and D. P Carvalho Negative correlation between thyroperoxidase and dual oxidase H2O2-generating activities in thyroid nodular lesions Eur. J. Endocrinol., February 1, 2008; 158(2): 223 - 227. [Abstract] [Full Text] [PDF]

				F. Palos, M. E. R. Garcia-Rendueles, D. Araujo-Vilar, M. J. Obregon, R. M. Calvo, J. Cameselle-Teijeiro, S. B. Bravo, O. Perez-Guerra, L. Loidi, B. Czarnocka, et al. Pendred Syndrome in Two Galician Families: Insights into Clinical Phenotypes through Cellular, Genetic, and Molecular Studies J. Clin. Endocrinol. Metab., January 1, 2008; 93(1): 267 - 277. [Abstract] [Full Text] [PDF]

				L. Fugazzola, V. Cirello, S. Dossena, S. Rodighiero, M. Muzza, P. Castorina, F. Lalatta, U. Ambrosetti, P. Beck-Peccoz, G. Botta, et al. High phenotypic intrafamilial variability in patients with Pendred syndrome and a novel duplication in the SLC26A4 gene: clinical characterization and functional studies of the mutated SLC26A4 protein Eur. J. Endocrinol., September 1, 2007; 157(3): 331 - 338. [Abstract] [Full Text] [PDF]

				H. S. Li and G. Carayanniotis Induction of Goitrous Hypothyroidism by Dietary Iodide in SJL Mice Endocrinology, June 1, 2007; 148(6): 2747 - 2752. [Abstract] [Full Text] [PDF]

				P. Wangemann, K. Nakaya, T. Wu, R. J. Maganti, E. M. Itza, J. D. Sanneman, D. G. Harbidge, S. Billings, and D. C. Marcus Loss of cochlear HCO3- secretion causes deafness via endolymphatic acidification and inhibition of Ca2+ reabsorption in a Pendred syndrome mouse model Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1345 - F1353. [Abstract] [Full Text] [PDF]

				N. Pedemonte, E. Caci, E. Sondo, A. Caputo, K. Rhoden, U. Pfeffer, M. Di Candia, R. Bandettini, R. Ravazzolo, O. Zegarra-Moran, et al. Thiocyanate Transport in Resting and IL-4-Stimulated Human Bronchial Epithelial Cells: Role of Pendrin and Anion Channels J. Immunol., April 15, 2007; 178(8): 5144 - 5153. [Abstract] [Full Text] [PDF]

				K. J. Rhoden, S. Cianchetta, V. Stivani, C. Portulano, L. J. V. Galietta, and G. Romeo Cell-based imaging of sodium iodide symporter activity with the yellow fluorescent protein variant YFP-H148Q/I152L Am J Physiol Cell Physiol, February 1, 2007; 292(2): C814 - C823. [Abstract] [Full Text] [PDF]

				O Arroyo-Helguera, B Anguiano, G Delgado, and C Aceves Uptake and antiproliferative effect of molecular iodine in the MCF-7 breast cancer cell line Endocr. Relat. Cancer, December 1, 2006; 13(4): 1147 - 1158. [Abstract] [Full Text] [PDF]

				T Kogai, K Taki, and G A Brent Enhancement of sodium/iodide symporter expression in thyroid and breast cancer. Endocr. Relat. Cancer, September 1, 2006; 13(3): 797 - 826. [Abstract] [Full Text] [PDF]

				R. Elisei, A. Vivaldi, R. Ciampi, P. Faviana, F. Basolo, F. Santini, C. Traino, F. Pacini, and A. Pinchera Treatment with Drugs Able to Reduce Iodine Efflux Significantly Increases the Intracellular Retention Time in Thyroid Cancer Cells Stably Transfected with Sodium Iodide Symporter Complementary Deoxyribonucleic Acid J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2389 - 2395. [Abstract] [Full Text] [PDF]

				K. Suzuki and L. D Kohn Differential regulation of apical and basal iodide transporters in the thyroid by thyroglobulin. J. Endocrinol., May 1, 2006; 189(2): 247 - 255. [Abstract] [Full Text] [PDF]

				M. Josefsson, L. Evilevitch, B. Westrom, T. Grunditz, and E. Ekblad Sodium-iodide symporter mediates iodide secretion in rat gastric mucosa in vitro. Experimental Biology and Medicine, March 1, 2006; 231(3): 277 - 281. [Abstract] [Full Text] [PDF]

				M.-F. van den Hove, K. Croizet-Berger, F. Jouret, S. E. Guggino, W. B. Guggino, O. Devuyst, and P. J. Courtoy The Loss of the Chloride Channel, ClC-5, Delays Apical Iodide Efflux and Induces a Euthyroid Goiter in the Mouse Thyroid Gland Endocrinology, March 1, 2006; 147(3): 1287 - 1296. [Abstract] [Full Text] [PDF]

				M. Dentice, C. Luongo, A. Elefante, R. Ambrosio, S. Salzano, M. Zannini, R. Nitsch, R. Di Lauro, G. Rossi, G. Fenzi, et al. Pendrin Is a Novel In Vivo Downstream Target Gene of the TTF-1/Nkx-2.1 Homeodomain Transcription Factor in Differentiated Thyroid Cells Mol. Cell. Biol., November 15, 2005; 25(22): 10171 - 10182. [Abstract] [Full Text] [PDF]

				S. Dossena, A. Maccagni, V. Vezzoli, C. Bazzini, M. L. Garavaglia, G. Meyer, J. Furst, M. Ritter, L. Fugazzola, L. Persani, et al. The expression of wild-type pendrin (SLC26A4) in human embryonic kidney (HEK 293 Phoenix) cells leads to the activation of cationic currents Eur. J. Endocrinol., November 1, 2005; 153(5): 693 - 699. [Abstract] [Full Text] [PDF]

				R. Bruno, E. Ferretti, E. Tosi, F. Arturi, P. Giannasio, T. Mattei, A. Scipioni, I. Presta, R. Morisi, A. Gulino, et al. Modulation of Thyroid-Specific Gene Expression in Normal and Nodular Human Thyroid Tissues from Adults: An in Vivo Effect of Thyrotropin J. Clin. Endocrinol. Metab., October 1, 2005; 90(10): 5692 - 5697. [Abstract] [Full Text] [PDF]

				J. Zheng, G.-G. Du, K. Matsuda, A. Orem, S. Aguinaga, L. Deak, E. Navarrete, L. D. Madison, and P. Dallos The C-terminus of prestin influences nonlinear capacitance and plasma membrane targeting J. Cell Sci., July 1, 2005; 118(13): 2987 - 2996. [Abstract] [Full Text] [PDF]

V. Porra, C. Ferraro-Peyret, C. Durand, S. Selmi-Ruby, H. Giroud, N. Berger-Dutrieux, M. Decaussin, J.-L. Peix, C. Bournaud, J. Orgiazzi, et al. Silencing of the Tumor Suppressor Gene SLC5A8 Is Associated with BRAF Mutations in Classical Papillary Thyroid Carcinomas J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3028 - 3035. [Abstract] [Full Text]