| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
INSERM U.435, Groupe dEtude de la Reproduction Mâle, Université de Rennes I, Rennes cedex 35042, France
Address all correspondence and requests for reprints to: Claire Piquet-Pellorce, INSERM U.435, Campus Beaulieu, 35042 Rennes cedex, Bretagne, France. E-mail: Claire.Piquet-Pellorce{at}rennes.inserm.fr
| Abstract |
|---|
|
|
|---|
further increased this production in peritubular and Sertoli
cells, and human CG enhanced Leydig cell LIF production. In conclusion,
peritubular cells are the principal source of testicular LIF, probably
accounting for its high concentration in the lymph. Given the
proliferative effect of LIF on immature germ cells, we suggest that
peritubular LIF plays an important role in the regulation of testicular
function. | Introduction |
|---|
|
|
|---|
LIF is a highly pleiotropic cytokine (6, 7), the effects of which are mediated by binding to a heterodimeric receptor composed of the LIF-specific binding subunit (gp190) and the transmembrane signal transducing subunit (gp130), which is shared by several receptors of cytokines related to IL-6 (8). LIF was first identified through its ability to maintain murine embryonic stem cells in an undifferentiated totipotent state, as it promotes their proliferation (9). In addition to its action on hematopoietic stem cells, LIF has also been shown to promote the proliferation of the murine primordial germ cells (PGC) (10) and their survival, by preventing their apoptosis (11). Other evidence for a direct action of LIF on PGC has been obtained in studies demonstrating that the LIF receptor (LIF-R) expressed by PGC is required for the survival of these cells in vitro (12, 13). LIF has also been found to promote the survival of rat neonatal stem germ cells (gonocytes) in a Sertoli cell-gonocyte coculture system (14). These previous findings led us to investigate the possibility of LIF production within the testis and to determine the distribution of LIF synthesis in this organ and its regulation.
LIF production was studied in seven highly purified populations of testicular cells, at both the RNA and protein levels. These populations were the four major testicular somatic cell types (Sertoli cells, Leydig cells, peritubular cells, and macrophages) and three germ cell populations corresponding to the major stages of germ line development: spermatogonia, tetraploid primary spermatocytes, and haploid early spermatids. We found that LIF was chiefly produced by peritubular cells located between the seminiferous tubules and the interstitial compartment. This strategic position of the LIF-producing cells suggests that LIF may be a paracrine regulator of both compartments and their interaction.
| Materials and Methods |
|---|
|
|
|---|
was a gift from Dr. P. H. Van
der Meide (Biomedical Primate Research Center TNO, Rijswijk, The
Netherlands). Human recombinant (hr) IL-1, hr IL-6, hr NGFß, hr bFGF,
hr PDGF, hr transforming growth factor (TGF)
, hr SCF, hr TNF
as
well as goat anti-mr LIF antibody (AB-449-NA) were purchased from R&D
Systems (Abingdon, UK). Ovine FSH was obtained through the
National Institute of Diabetes and Digestive and Kidney Diseases
program of distribution of pituitary hormones (Bethesda, MD).
lipopolysaccharide (LPS) from Escherichia coli,
oxytocin, human CG (hCG), and testosterone were supplied by
Sigma (St. Louis, MO).
Testicular lymph collection
Testes from adult rats were dissected out, washed with PBS and
the tunicae albuginae was incised on less than 5 mm. Each
testis was then placed on the top of a test tube, overnight, at 4 C, to
allow the drainage of 2050 µl lymph. The lymph from four testes
(two rats) was pooled to make sufficient for the sample to be tested in
the HILDA bioassay (see below). Seven different of such samples have
been assayed.
Sertoli cell and peritubular cell isolation and culture
The isolation of Sertoli and peritubular cells from 20-day-old
rats was carried out using the method of Skinner and Fritz (16)
modified by Toebosch et al. (17). One million Sertoli cells,
containing less than 1% of peritubular cells and less than 0.1% germ
cells (<0.1%), were seeded in six-well plates (Nunc, Roskilde,
Denmark) in 1.5 ml of Hams F12-DMEM (vol/vol; Life Technologies, Inc., Cergy-Pontoise, France) supplemented
with insulin (10 µg/ml; Sigma), transferrin (5 µg/ml,
Sigma) and gentamicin (50 µg/ml, Life Technologies, Inc.) and incubated at 32 C in a humidified
atmosphere with 5% CO2 and 95% air. After 4
days of culture with daily changes of medium, Sertoli cells were
incubated for a further 24 h in the presence or absence of FCS
(Costar) combined or not to various factors (see
Treatment conditions . . .), cells and supernatants
were then collected separately.
Peritubular cells were cultured at 32 C in the same medium as the Sertoli cells were, but supplemented with 10% FCS. Confluence was reached after 8 days of culture with daily changes of medium. After trypsinization, peritubular cells were seeded at a density of 2 x 105 cells/well in six-well plates in the presence of 10% FCS. After 3 days culture, confluent cells were washed with a serum-free medium and deprived of serum overnight. They were then further incubated for 24 h in presence or absence of FCS combined or not to different factors (see Treatment conditions . . .); cells and supernatants were then collected separately. The population was at least 96% peritubular cells as assessed by alkaline phosphatase staining (18), and no contamination by germ cells, Sertoli cells, Leydig cells, or macrophages were detected.
Leydig cell and testicular macrophage isolation and culture
Highly enriched populations of Leydig cells and testicular
macrophages were prepared from adult rat testes according to a
procedure which included testicular perfusion, enzymatic dissociation,
centrifugal elutriation, and density Percoll gradient centrifugation
(19). The Percoll gradient was divided into a fraction lighter than
1.068 g/ml in which a dense ring of cells contains mainly macrophages
and germ cells and a fraction heavier than 1.068 g/ml which contained
Leydig cells.
The macrophage-containing cell fraction was seeded at 5 x
106 cells/well in Hams F12-DMEM supplemented
with gentamycin (50 µg/ml) and 10% FCS in six-well plates. After 15
min of incubation, extensive washing was performed to remove germ
cells, the remaining adherent cells were macrophages (
94%) as
visualized by nonspecific esterase-positive staining, ED2 antibody
(Serotec Ltd., Oxford, UK) specific labeling, and
negative 3ß-hydroxysteroid dehydrogenase (3ß-HSD) staining.
The Leydig cell preparation was seeded at 1.2
x106 cells/ml in Hams F12-DMEM supplemented
with gentamycin (50 µg/ml) and 10% FCS in 24-well plates. After an
overnight incubation, the few nonadherent cells were removed. The
adherent cells were Leydig cells (
94%) as assessed by 3ß-HSD
staining, the main contaminant being testicular macrophages
(<4%).
Both cell types were cultured for 24 h in presence or in absence of FCS combined or not to hCG to collect separately the cells and the conditioned medium (CM).
Germ cell preparation and culture
Testes from 90-day-old rats were trypsinized and differentially
sedimented according to the method described by Meistrich et
al. (20). The first fraction, containing all the types of germ
cells (refereed to as total germ cells), was then fractionated by
centrifugal elutriation into highly enriched cell populations of
primary pachytene spermatocytes (PS,
95% purity) and early
spermatids (ES,
90% purity) (21). These cells were incubated at
2.5 x 106 cells/well for PS, and 8 x
106 cells/well for ES, in 1 ml of PBS
complemented with CaCl2 (0.88
mM), MgCl2 (0.5
mM), lactate (6 mM),
glucose (5.6 mM), BSA (0.4%; Biosepra Inc.,
Villeneuve La Garenne, France) and gentamicin (50 µg/ml) for 24
h at 32 C, before separation of cells and medium by centrifugation.
Spermatogonia were purified from 9-day-old rat testes using the method
originally described by Bellvé et al. (22) as modified
by Dym et al. (23). Briefly, the decapsulated testes were
sequentially dissociated with various enzymes before sedimentation on a
24% BSA gradient. A final differential adhesion step allowed the
removal of the few remaining contaminating somatic cells and enabled us
to obtain a highly enriched population of spermatogonia (purity
94%,
using morphological criteria). These cells were cultured for 24 h
at 32 C at a density of 1.4 x 106 cells/ml
in 24-well plates (0.7 ml/well) in Hams F12-DMEM in the presence or
absence of FCS combined or not to various factors (see paragraph below)
before recovery of their CM.
Treatment conditions of the different testicular cell
populations
Various factors have been assessed for their ability to modulate
LIF production in spermatogonia, peritubular cells, Sertoli cells, and
Leydig cells. The different testicular cell populations, prepared and
cultured in appropriate conditions, as described above, have been
treated for 24 h with different concentrations of serum or with
various hormones and cytokines, in the presence of suboptimal FCS
quantity (5%). Optimal concentrations have been chosen for each factor
according to each factor specific bioassay and are listed herein: IL-1
(1 ng/ml), IL-6 (10 ng/ml), bFGF (10 ng/ml), PDGF (10 ng/ml), SCF(10
ng/ml), TGF
(10 ng/ml), IFN
(100 U/ml), TNF
(1000 U/ml), LPS
(5 to 20 µg/ml), oxytocin (100 nM), FSH (100 ng/ml), NGF
(100 ng/ml), hCG (5 mUI/ml), and testosterone (10 pM).
LIF bioassay and neutralization procedure
LIF was measured using the Human Interleukin for DA cells
(HILDA) bioassay based on a growth factor-dependent cell line, the
DA1-a cell line, that requires LIF to proliferate (24). Briefly, the
cells were maintained in RPMI 1640 supplemented with glutamine,
gentamicin, 8% FCS, and mr LIF at a final concentration of 100 U/ml.
Before the assay, the cells were washed four times with a large volume
of LIF-free medium. The cells were then cultured for 72 h at
105 cells/ml in the presence of the samples in
96-well flat bottom microtiter plates (Nunc) and assessed for their
proliferation by MTT staining. To determine the HILDA activity for each
sample, a dose-response analysis was performed in duplicate culture in
2 independent assays. The HILDA activity was quantified by defining as
1 U the amount of factor per ml inducing half-maximal proliferation of
DA1-a cells and the results were expressed as HILDA
U/106 cells. A minimum of three independent cell
preparations were assayed for each testicular cell type.
Neutralization experiments were performed by preincubating each samples for 4 h with the goat anti-mr LIF antiserum at concentrations ranging from 50 to 0.3 µg/ml for peritubular CM and 20 and 2 µg/ml for Sertoli and Leydig cell CM. Control incubation were performed using appropriate protein-A-purified goat Ig (Sigma).
Embryonic stem cell differentiation assay, which has been used for confirmatory experiments, has been performed using the E14 cell line as previously described by Piquet-Pellorce et al. (25).
RNA extraction and RT-PCR analysis
Total RNAs were extracted from the whole testis and the
different cell preparations using guanidium thiocyanate and
centrifugation on a cesium chloride cushion (26). Complementary DNAs
were prepared from 10 µg of RNA, in presence of 200 ng of random
hexanucleotides (Amersham Pharmacia Biotech, Piscataway,
NJ), using 200 U of Moloney Murine Leukemia Virus-Reverse
Transcriptase (M-MLV-RT) (Promega Corp., Madison,
WI) according to the manufacturers procedure. A negative
control for each sample was performed in parallel using the same
reaction mixture without M-MLV-RT to check for possible contamination
by DNA. Actin amplification was performed as a control for RNA quality,
amount estimation and good RT. PCR was carried out as recommended by
Perkin-Elmer Corp. starting with 100 ng complementary DNA
as template (in equivalent RNA starting material). The sequence of the
oligonucleotides primers used to amplify rat LIF were respectively;
sense LIF: 5'TGCCCCTACTGCTCATTCTG3'; antisense
LIF: 5'GACACAGGGCACATCCACAT 3'. These primers allowed the
amplification of a 482 bp LIF fragment (30 cycles, annealing
temperature 63 C), which was directly sequenced and shown to be 100%
identical to the published rat LIF sequence (27). RNA samples obtained
from three to eight independent cell preparations for each cell type
were analyzed by RT-PCR for LIF expression.
Statistical analysis
Results are expressed as means ± SEM. Each
experiment was performed independently at least three times, and for
every experiment each condition was tested on two dishes. Differences
in means were analyzed by an unpaired two-tailed Students
t test. Significance was defined as P <
0.05.
| Results |
|---|
|
|
|---|
|
LIF production by the various types of testicular cell
Very high levels of LIF/HILDA-bioactivity were detected in media
conditioned by peritubular cells cultured in the presence of FCS, but
only low levels of activity were detected in the absence of FCS (Fig. 2
). Similar results were obtained if an
embryonic stem cell line (E14) was used to measure LIF instead of the
HILDA bioassay (data not shown). Consistent with the results obtained
by PCR, LIF was detected in media conditioned by Leydig cells, Sertoli
cells, macrophages, and spermatogonia in the presence of FCS, whereas
no such bioactivity was ever detected in CM from total germ cells,
spermatocytes, or spermatids. The amount of LIF measured in peritubular
cell-CM was 50 to 100 times higher than that detected in CM from other
diploid testicular cell types. Furthermore, high levels of bioactive
LIF were found in the testicular lymph, demonstrating that LIF is
present within the intact rat testis (Fig. 2
).
|
|
significantly increased LIF synthesis by peritubular cells, whereas
other proinflammatory cytokines such as IL-1, IL-6, and IFN
did not
(Fig. 4A
,
SCF, and PDGF (data not shown) did not affect peritubular cell LIF
generation. Sertoli cell LIF production was also increased by LPS and
TNF
(Fig. 4B
(Fig. 4B
, SCF, PDGF, and oxytocin (data not
shown) did not affect LIF secretion by these cells. hCG, which, like
LH, is known to be a major regulator of testosterone production,
significantly increased spontaneous and serum-induced LIF productions
by Leydig cells. Neither SCF nor bFGF, both of which have been shown to
regulate stem germ cells (28), had an effect on the weak serum-induced
LIF production of spermatogonia (data not shown). No other factors were
tested on Leydig cells and spermatogonia due to the limited size of
populations highly enriched in these cells that can be obtained.
|
| Discussion |
|---|
|
|
|---|
Little evidence has been provided for the production of paracrine regulators by peritubular cells despite the strategic position of these cells within the testis. They are thought to provide structural integrity for the tubule itself and to be a key component of the blood-testis barrier system (36). They have regulatory interactions with Sertoli cells and partly mediate the Leydig cell androgen action on the seminiferous tubules. A few years ago, evidence was provided that peritubular cells produce a factor that stimulates Sertoli cell functions in response to testosterone, this factor was therefore named "peritubular modulating substance" [PmodS: (37)]. However, recent data have suggested that PModS activity probably result from the action of a mixture of cytokines including IL-1 and IL-6 (38). On the basis of the present study, it is possible that LIF, a member of the IL-6 family, will be also part of the PModS activity but further experiments are required to confirm this.
The ability of LPS and TNF
to increase peritubular cell LIF
production suggests that LIF is involved in the local development of
the inflammatory reaction as it is in other organs [liver, joints . .
. (39, 40, 41)]. Indeed, testicular macrophages have been shown to produce
TNF
in response to LPS (42). In contrast, the ability of TNF
to
increase Sertoli cell LIF production may indicate the existence of an
intratubular communication system because TNF
has been shown to be
synthesized by postmeiotic germ cells (43). Sertoli cells are able to
respond to LIF (35), and therefore the TNF
produced by spermatids
may induce, through LIF production and action, a specific signal
involved in their own development.
Interestingly, hCG was found to stimulate Leydig cell LIF production. However, the LIF/HILDA bioactivity secreted by these cells could not be entirely attributed to LIF. Clearly, another LIF-like factor is synthesized by this cell type. Oncostatin M (OSM) appears to be a good candidate because De Miguel et al. (34, 44) have shown by immunohistochemistry that Leydig cells produce OSM in fetal, maturing, and adult testes both in rats and humans. This hypothesis could not be confirmed because neither of the two antihuman OSM antibodies commercially available, one of which has been successfully used in immunohistochemistry in rats, neutralized Leydig cell culture supernatants (data not shown). However, rat OSM has not yet been characterized and therefore, these antibodies ability to neutralize rat OSM could not be established and no specific neutralizing antibody could be generated.
It has been shown that two different forms of murine LIF result from the differential splicing of the LIF mRNA at the first exon, encoding the signal sequence. The two forms are identical in sequence and biological function in vitro but exhibit a different tissue distributions: one is associated with the extracellular matrix (ECM) (matrix LIF), whereas the other is soluble (diffusible LIF) (15). Differential expression of these two forms has been shown in various cell types and organs and is believed to be functionally relevant, because LIF transgenic mice embryo behave differently according to whether the matrix or diffusible form of LIF is overexpressed (45). Moreover, Méreau et al. (46) provided evidence for a matrix receptor able to store biologically active LIF in the ECM, as has been demonstrated for other growth factors such as bFGF and TGFß. These data are therefore consistent with ECM being a regulator of LIF action. Given that peritubular cells are the main producers of both LIF and the ECM components that constitute the basal laminae of the tubules and are known to be essential for the maintenance of tubular cell functions and spermatogenesis, LIF storage in the ECM may be a way of modulating the effects of LIF action on seminiferous tubule cell components.
The involvement of LIF in the control of male reproduction has been
suggested by in vivo studies of mice overexpressing LIF.
Indeed, a spermatogenesis defect was reported in mice engrafted with
FDCP-1 cells producing LIF (47), in transgenic male mice overexpressing
LIF in T cells (48), and in transgenic mice expressing LIF under the
control of the pituitary glycoprotein hormone
-subunit promoter
(49). LIF knockout does not affect survival or male fertility in mice
(50). However, redundancy of action, which is known to occur in the
LIF/IL-6 family (51) may explain this lack of phenotype. LIF-R knockout
leads to death shortly after birth (52, 53), therefore providing us
with little information about LIF requirement in testicular function.
However, in vitro experiments have demonstrated that LIF
promotes the survival and proliferation of immature germ cell
precursors such as PGC and gonocytes (10, 11, 12, 13, 14). Our data showing that
LIF is expressed within the testis from very early in fetal development
and then continuously thereafter, demonstrate that LIF is available for
the control of stem germ cells from the beginning of testicular
ontogenesis onwards. Our results also clearly identify peritubular
cells as the principal producers of LIF within the adult testis. As
this cell population is located in very close proximity to
spermatogonia and Sertoli cells, LIF is available to these tubule cell
components and may therefore be an important regulator of
spermatogenesis.
Received November 18, 1999.
| References |
|---|
|
|
|---|
- and ß-subunit mRNA levels
and inhibin secretion. Mol Cell Endocrinol 55:101105[CrossRef][Medline]
This article has been cited by other articles:
![]() |
H. Lin, R.-S. Ge, G.-R. Chen, G.-X. Hu, L. Dong, Q.-Q. Lian, D. O. Hardy, C. M. Sottas, X.-K. Li, and M. P. Hardy Involvement of testicular growth factors in fetal Leydig cell aggregation after exposure to phthalate in utero PNAS, May 20, 2008; 105(20): 7218 - 7222. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schell, M. Albrecht, C. Mayer, J. U. Schwarzer, M. B. Frungieri, and A. Mayerhofer Exploring Human Testicular Peritubular Cells: Identification of Secretory Products and Regulation by Tumor Necrosis Factor-{alpha} Endocrinology, April 1, 2008; 149(4): 1678 - 1686. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Magni, E. Dozio, M. Ruscica, H. Watanobe, A. Cariboni, R. Zaninetti, M. Motta, and R. Maggi Leukemia Inhibitory Factor Induces the Chemomigration of Immortalized Gonadotropin-Releasing Hormone Neurons through the Independent Activation of the Janus Kinase/Signal Transducer and Activator of Transcription 3, Mitogen-Activated Protein Kinase/Extracellularly Regulated Kinase 1/2, and Phosphatidylinositol 3-Kinase/Akt Signaling Pathways Mol. Endocrinol., May 1, 2007; 21(5): 1163 - 1174. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.-S. Ge, Q. Dong, C. M. Sottas, V. Papadopoulos, B. R. Zirkin, and M. P. Hardy In search of rat stem Leydig cells: Identification, isolation, and lineage-specific development PNAS, February 21, 2006; 103(8): 2719 - 2724. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Lacham-Kaplan, H. Chy, and A. Trounson Testicular Cell Conditioned Medium Supports Differentiation of Embryonic Stem Cells into Ovarian Structures Containing Oocytes Stem Cells, February 1, 2006; 24(2): 266 - 273. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Dorval-Coiffec, J.-G. Delcros, H. Hakovirta, J. Toppari, B. Jegou, and C. Piquet-Pellorce Identification of the Leukemia Inhibitory Factor Cell Targets Within the Rat Testis Biol Reprod, March 1, 2005; 72(3): 602 - 611. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Hofmann, K. S. Van Der Wee, J. L. Dargart, G. Dirami, L. Dettin, and M. Dym Establishment and Characterization of Neonatal Mouse Sertoli Cell Lines J Androl, January 1, 2003; 24(1): 120 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Metcalf The Unsolved Enigmas of Leukemia Inhibitory Factor Stem Cells, January 1, 2003; 21(1): 5 - 14. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Habasque, F. Aubry, B. Jegou, and M. Samson Study of the HIV-1 receptors CD4, CXCR4, CCR5 and CCR3 in the human and rat testis Mol. Hum. Reprod., May 1, 2002; 8(5): 419 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Vicari and A.E. Calogero Effects of treatment with carnitines in infertile patients with prostato-vesiculo-epididymitis Hum. Reprod., November 1, 2001; 16(11): 2338 - 2342. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Mauduit, I. Goddard, V. Besset, E. Tabone, C. Rey, F. Gasnier, F. Dacheux, and M. Benahmed Leukemia Inhibitory Factor Antagonizes Gonadotropin Induced-Testosterone Synthesis in Cultured Porcine Leydig Cells: Sites of Action Endocrinology, June 1, 2001; 142(6): 2509 - 2520. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |