Endocrinology Vol. 141, No. 3 1142-1150
Copyright © 2000 by The Endocrine Society
Impaired Basal and Restraint-Induced Epinephrine Secretion in Corticotropin-Releasing Hormone- Deficient Mice1
Kyeong-Hoon Jeong2,
Lauren Jacobson,
Karel Pacák,
Eric P. Widmaier,
David S. Goldstein and
Joseph A. Majzoub
Division of Endocrinology (K.-H.J., L.J., J.A.M.), Childrens
Hospital, Harvard Medical School, Boston, Massachusetts 02115; Clinical
Neuroscience Branch, NINDS (K.P., D.S.G.) and Developmental
Endocrinology Branch, NICHD (K.P.), NIH, Bethesda, Maryland 20892; and
Department of Biology (E.P.W.), Boston University, Boston,
Massachusetts 02215
Address all correspondence and requests for reprints to: Joseph A. Majzoub, Division of Endocrinology, Childrens Hospital, Harvard Medical School, 300 Longwood Avenue, Boston, Massachusetts 02115. E-mail: majzoub{at}a1.tch.harvard.edu
 |
Abstract
|
|---|
CRH is thought to play a role in responses of the adrenocortical and
adrenomedullary systems during stress. To investigate the role of CRH
in stress-induced secretions of corticosterone and epinephrine, we
subjected wild-type (WT) and CRH-deficient (knockout, KO) mice to
restraint, and analyzed plasma corticosterone, plasma catecholamines,
and adrenal phenylethanolamine N-methyltransferase
(PNMT) gene expression and activity before and during 3 h of
restraint. Plasma corticosterone increased over 40-fold in WT mice, but
minimally in CRH KO mice. Adrenal corticosterone content tended to
increase in CRH KO mice, although to levels 5-fold lower than that in
WT mice. CRH KO mice had significantly lower plasma epinephrine and
higher norepinephrine than WT mice at baseline, and delayed epinephrine
secretion during restraint. Adrenal PNMT messenger RNA content in CRH
KO mice tended to be lower than that in WT mice, though the degree of
induction was similar in both genotypes. PNMT enzyme activity was
significantly lower in CRH KO mice. Pharmacological adrenalectomy
abolished restraint-induced corticosterone secretion and PNMT gene
expression in WT mice, consistent with an absolute requirement of
glucocorticoids for PNMT gene expression. We conclude that
glucocorticoid insufficiency in CRH KO mice leads to decreased basal
and restraint-induced plasma epinephrine and adrenal PNMT gene
expression and enzyme activity.
 |
Introduction
|
|---|
MANY STRESSORS, such as insulin-induced
hypoglycemia (1, 2) and immobilization (3, 4, 5), increase the secretion
of catecholamines, including epinephrine and norepinephrine, from the
adrenal medulla and sympathetic nerve terminals. Such stressors also
potentiate the secretion of the hypothalamic-pituitary-adrenocortical
(HPA) axis hormones, ACTH from the anterior pituitary and
glucocorticoids such as cortisol (in humans) or corticosterone (in
rodents) from the adrenal cortex (6, 7) via stimulation by the
hypothalamic neuropeptide, CRH (8).
In chromaffin cells of the adrenal medulla, stressor-induced gene
expression of phenylethanolamine N-methyltransferase (PNMT),
which converts norepinephrine to epinephrine, requires normal HPA axis
activity, but not intact sympathetic input in rats (9), implying a role
for glucocorticoids in PNMT gene expression and action. Consistent with
this are reports of the existence of a glucocorticoid responsive
cis-element (GRE) in the 5'-promoter region of the rat PNMT
gene (10, 11) and of a delay in the rise in stressor-induced PNMT
activity after suppression of endogenous corticosterone synthesis (12).
By contrast, the expression of the adrenomedullary tyrosine
hydroxylase, the rate-limiting enzyme that catalyzes the first step of
catecholamine biosynthesis, is primarily controlled by cholinergic
sympathetic input from splanchnic nerves (13, 14, 15, 16, 17). Tyrosine hydroxylase
activity and gene expression are also increased following stressors
such as insulin-induced hypoglycemia (18) and immobilization (19, 20)
in rats.
The hypothalamic CRH system and the sympathetic nervous system are
postulated to be functionally related to each other, and to regulate
reciprocally each others functions within the central nervous system
(21). For example, CRH-containing hypothalamic paraventricular nuclei
(PVN) parvocellular neurons are anatomically and functionally connected
to locus coeruleus A6 catecholaminergic neurons
in the brain stem in rats (22, 23). Central CRH administration
increases neuronal discharge in the locus coeruleus in a dose-dependent
manner (24) as well as hypothalamic norepinephrine secretion (25).
Immobilization (4) or central injection of CRH (26) also increases
tyrosine hydroxylase gene expression in the locus coeruleus, whereas
central administration of CRH antagonist blocks stressor-induced
tyrosine hydroxylase production (26). Moreover, chronic antidepressant
treatment reduces tyrosine hydroxylase messenger RNA (mRNA) level in
the locus coeruleus as well as CRH mRNA in the PVN in rats (27),
suggesting a possible stimulatory action of CRH on central
catecholaminergic neurons. A retrograde tracer study using a
transneuronal labeling method suggests possible connections between the
sympatho-adrenomedullary catecholaminergic system and PVN neurons,
including oxytocin secreting cells (28), and possibly CRH or arginine
vasopressin expressing neurons, through the spinal cord and splanchnic
nerves. It is therefore possible that CRH contributes to the regulation
of the adrenomedullary catecholaminergic system under stressful
conditions through both the HPA axis and the sympathetic nervous
system.
To determine the physiological significance and relative contributions
of CRH and glucocorticoids to the regulation of the adrenomedullary
catecholaminergic system, we compared basal and restraint-induced
changes of plasma corticosterone and catecholamines, adrenal PNMT and
tyrosine hydroxylase mRNAs, and PNMT activity in CRH-deficient
(knockout, KO) (29) with wild-type (WT) mice.
 |
Materials and Methods
|
|---|
Animal husbandry
Male WT and CRH KO littermates were bred in a mixed C57B6/129
background and maintained on a 12-h light, 12-h dark or 14-h light,
10-h dark cycle with lights-on at 0700 h. For the pharmacological
adrenalectomy (PxADX) experiment, C57B6 WT male mice were purchased
from Charles River Laboratories, Inc. (Wilmington, MA).
All mice were given ad libitum access to food and drinking
water, and singly housed for 35 days before experimentation.
Individual housing of adult mice allowed us to remove individual
animals for experimentation without disturbing other mice. All studies
were performed in a quiet room under conditions made as constant as
possible from day to day to avoid variation in the environment which
might have affected the adrenocortical and adrenomedullary systems. All
experiments were begun at 0700 h, when corticosterone levels are
at their nadir. Adult WT and CRH KO male mice were subjected to
restraint in ventilated 50 ml tubes for up to 3 h starting
immediately after lights-on. Tubes were designed to be small enough to
restrain a mouse so that it was able to breathe but unable to move
freely. Control mice that were left unhandled for up to 3 h were
unstressed as judged by their low, basal plasma corticosterone levels.
Many previous studies have used immobilization rather than restraint
for catecholaminergic activation (3, 4, 5). However, we have found that
restraint, although a more mild stimulus than immobilization, results
in marked activation of the HPA and catecholaminergic axes (29, and
results contained herein), and was judged to be a more humane stimulus
than immobilization by the Childrens Hospital Animal Care and Use
Committee, which approved all animal experiments.
Pharmacological adrenalectomy
PxADX was performed using a modification of previously reported
methods (30, 31). Adult (23 months old) WT male mice were injected ip
with 200 mg/kg of 2-methyl-1,2-di-3-pyridyl-1-propanone (metyrapone;
Sigma, St. Louis, MO), dissolved in 10%
dimethylsulfoxide-saline (vehicle), twice daily for 5 days (PxADX
group). Control (no restraint) and vehicle group mice were injected
with identical volumes of vehicle only. A 100 mg/kg injection of
aminoglutethimide (Sigma) was combined with metyrapone in
the last two injections of the experimental PxADX group. Once
injections were begun, all mice were allowed to drink a 5% dextrose
solution in 0.9% saline, in addition to regular drinking water and
food. Vehicle and PxADX group mice were subjected to restraint on the
morning of day 6 of drug treatment.
Sample collection
Blood sampling for plasma hormone (corticosterone, ACTH, and
catecholamines) measurements was performed without anesthesia by
retro-orbital sinus phlebotomy using heparinized capillary tubes. Only
one blood sample was collected from each mouse. In some cases,
phlebotomy was immediately followed by decapitation to collect adrenal
glands for PNMT and tyrosine hydroxylase mRNA analysis, PNMT activity,
or corticosterone content measurements. The time from touching a cage
to phlebotomy or decapitation was less than 1 min. Collected blood
samples were kept on ice until plasma separation. Plasma was separated
from cells by centrifugation at 4 C, and stored at -80 C in aliquots
until assayed. Left adrenal glands were immediately frozen in liquid
N2 and stored at -80 C until homogenization.
Right adrenal glands were immediately embedded in OCT compound (Sakura
Finetek, Torrance, CA), rapidly frozen in liquid
N2, and stored at -80 C until cryostat
sectioning. For the control groups, animals were killed concurrently
without prior restraint.
In situ hybridization
PNMT and tyrosine hydroxylase mRNA levels in the adrenal medulla
were measured using in situ hybridization. Other methods,
such as Northern blot analysis or RNase protection assay performed on
total adrenal RNA, could not be used due to the marked difference in
the sizes of the adrenal cortices in CRH KO mice compared with WT mice
(29). This size variation is due entirely to differences in the mass of
the adrenal cortex, and not adrenal medulla (29). Because PNMT and
tyrosine hydroxylase mRNAs are expressed exclusively in the latter
location, analysis of equal amounts of RNA from WT and CRH KO adrenals
by Northern blot or RNase protection would necessarily result in a
higher percentage of medullary RNA from CRH KO mice than from WT mice
being compared. Realizing this, we tried to normalize the relative
amounts of WT and CRH KO medullary RNA being compared with the use of a
medulla-specific mRNA encoding synaptophysin, a chromaffin
granule-specific protein (32), but the level of synaptophysin mRNA was
altered following restraint (data not shown). For these reasons, we
used in situ hybridization to measure relative levels of
PNMT and tyrosine hydroxylase mRNAs in WT and CRH KO mice in our
studies.
The in situ hybridization procedure was based on previously
reported methods (33, 34, 35), as modified by us (36). Right adrenal glands
were serial-sectioned at a thickness of 10 µm with a cryostat (Jung
2045C; Leica Corp., Deerfield, IL), postfixed with 4%
paraformaldehyde in PBS at 4 C for 10 min, and subjected to sequential
prehybridization treatment (33). Sectioned tissues on slides were
stored at -20 C with desiccant until in situ hybridization.
Rat PNMT (rPNMT) and tyrosine hydroxylase (rTH) complementary DNA
(cDNA) plasmids were kindly provided by Drs. Marian Evinger (SUNY,
Stony Brook, NY) and Tong Joh (Cornell Medical College, White Plains,
NY). A HindIII restriction fragment of the rPNMT cDNA insert
spanning +193 to +1200 of rPNMT gene (405 bp length, with exclusion of
the 603 bp intron) (11) or an EcoRI/KpnI
restriction fragment of the rTH cDNA insert spanning +1138 to +1520 of
rTH cDNA (383 bp) (37) was subcloned into the HindIII or
EcoRI/KpnI sites, respectively, of the cloning
vector pBluescriptIISK(+) (Stratagene, La Jolla, CA), and
used to make 35S-labeled complementary RNA
probes. DNA sequence identities between mouse and rat PNMT and tyrosine
hydroxylase cDNA in the regions of the probes are 91% and 95%,
respectively. Slides were hybridized at 50 C for 16 h in a chamber
saturated with 50% deionized formamide and 0.5 M
NaCl. Adjacent sections were hybridized for PNMT and tyrosine
hydroxylase mRNA analysis. After hybridization, slides were washed,
dehydrated, dipped in emulsion (NTB-2; Kodak, Rochester,
NY), developed, and counter-stained. Silver grain signals from each
probed slide section were visualized under dark-field microscope
illumination (Eclipse E800; Nikon, Melville, NY) at 40x
magnification, and the images were captured through a CCD camera
(RC300; Dage-MTI, Michigan City, IN) using the Scion Image program
(version 1.60c). Quantitation of the mean density was performed using
the NIH Image program (version 1.60). Three sections from the largest,
middle portion of the adrenal gland from each slide for each adrenal
were quantified and averaged after the background (adrenal cortex)
densities were subtracted for each section.
RT-PCR for adrenal PNMT mRNA
RT-PCR of adrenal PNMT mRNA was performed with total RNA
purified from left adrenal glands using TRI reagent (Molecular Research Center, Inc., Cincinnati, OH). Total RNA (500 ng) was
reverse-transcribed with 2.5 µM oligo
d(T)16 primer (PE Biosystems, Foster
City, CA) and 200 U Moloney murine leukemia virus (M-MuLV) RTase
(Life Technologies, Inc., Grand Island, NY) under the
following conditions. First strand synthesis: annealing, room
temperature, 10 min; RT, 42 C, 15 min; denaturation, 99 C, 5 min. PCR:
first strand cDNA products were amplified using murine PNMT cDNA
(38)-specific primers (5' to 3'): sense GTGAAGCGAGTCCTGCCTATC,
antisense AAGATGCCTTTGACATCATCTACC. These primers span the 3'-end of
the PNMT open reading frame +2491 to +2858, and produce a 368 bp PCR
fragment. PCR conditions used were: annealing, 55 C, 1 min; extension,
72 C, 4 min; denaturation, 95 C, 1 min. After 20 cycles of PCR
amplification, 20 µl of PCR products were separated by
electrophoresis in a 1% agarose gel.
Radioenzymatic assay for adrenal PNMT activity
Left adrenal glands were homogenized in about 1,000 volumes
(final) of 0.1 M Tris-HCl (pH 7.4), centrifuged, and the
supernatants were stored at -80 C until use. Adrenal PNMT activity was
analyzed by a radioenzymatic method (39). Briefly, 50 µl of
supernatant was incubated at 25 C for 2 h with 50 µl of a
solution containing 3H-labeled
S-adenosylmethionine (SAM; Sigma) and norepinephrine (RBI,
Natick, MA). 3H-labeled epinephrine was detected
by scintillation counter after extraction. A PNMT inhibitor, SKF29661,
was added in a parallel incubation to allow for subtraction of any
possible nonspecific N-methyltransferase activity (40).
There was no detectable nonspecific N-methyltransferase
activity in CRH KO adrenal tissues. SKF29661 was kindly provided by Dr.
J. Paul Hieble (SmithKline Beecham, Swedeland, PA).
Hormone analysis
Immunoreactive corticosterone (ICN Biomedicals, Inc., Orangeburg, NY) and ACTH (INCSTAR Corp.,
Stillwater, MN) were measured by commercial RIA kits according to the
manufacturers instructions. Adrenal content of corticosterone was
measured using supernatants from homogenized left adrenal glands in
about 100 volumes of 0.1 M Tris-HCl (pH 7.4), and
normalized to adrenal protein concentration. Catecholamine analysis was
performed using HPLC with C-18 reverse phase column in combination with
an electrochemical detector (7).
Protein assay
Total protein concentration of adrenal glands was measured to
normalize adrenal corticosterone content. Protein assay was performed
based on the Bradford dye-binding procedure using commercial reagents
(Bio-Rad Laboratories, Inc., Hercules, CA) with BSA as a
standard. Optical density was measured by spectrophotometry at 595
nm.
Data analysis
Results were analyzed by two-way ANOVA followed by posthoc
comparisons with Fishers protected least significant difference
(PLSD) test. When appropriate, the unpaired t test was
performed for the comparison of mean differences between two different
groups. A P value less than 0.05 was considered
statistically significant. All data are presented as the mean ±
SEM.
 |
Results
|
|---|
Effect of restraint on plasma corticosterone and catecholamines in
CRH KO mice
Plasma corticosterone and ACTH rose markedly in WT mice following
restraint (Fig. 1
). Although 0 time basal
levels of corticosterone and ACTH were similar in both genotypes, the
increases in plasma corticosterone (Fig. 1A
) and ACTH (Fig. 1B
) during
restraint in CRH KO mice were significantly blunted compared with those
in WT mice. There were no changes in plasma corticosterone or ACTH in
control (unhandled) mice of either genotype during the 3-h period of
study (Fig. 1A
).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 1. Changes in plasma corticosterone and ACTH during
restraint. WT and CRH KO mice were subjected to restraint for up to
3 h starting immediately after lights-on in the morning. Plasma
was analyzed by RIA for (A) corticosterone and (B) ACTH. n =
415/group. Results were analyzed by two-way ANOVA followed by posthoc
comparisons with Fishers PLSD test. *, Significant difference
vs. WT 0 time; #, significant difference
vs. CRH KO 0 time; **, significant difference between
genotypes at same time point; B, corticosterone; Control, unhandled
time control.
|
|
Basal plasma epinephrine in CRH KO mice was significantly lower than
that in WT mice (Fig. 2A
). While WT mice
showed a significant increase at 40 min compared with the basal level,
the increase in plasma epinephrine during restraint in CRH KO mice was
delayed, not rising above the CRH KO basal level until 110 min. On the
other hand, basal plasma norepinephrine in CRH KO mice was
significantly higher than that in WT mice, and further increased during
restraint, with a peak at 110 min, whereas WT mice exhibited no change
of norepinephrine over time (Fig. 2B
). In all cases, epinephrine and
norepinephrine levels in unhandled control groups did not change over
time and did not differ from 0 time levels in either genotype (data not
shown).

View larger version (17K):
[in this window]
[in a new window]
|
Figure 2. Changes in plasma epinephrine and norepinephrine
during restraint. WT and CRH KO mice were subjected to restraint as in
Fig. 1 . Plasma was analyzed by HPLC for (A) epinephrine and (B)
norepinephrine. n = 415/group. Results were analyzed by two-way
ANOVA followed by posthoc comparisons with Fishers PLSD test. *,
Significant difference vs. WT 0 time; #, significant
difference vs. CRH KO 0 time; **, Significant difference
between genotypes at same time point; EPI, epinephrine; NE,
norepinephrine.
|
|
Changes in adrenal PNMT mRNA, enzyme activity, and corticosterone
content during restraint in CRH KO mice
To test the hypothesis that the reduced epinephrine secretion in
CRH KO mice during restraint is due to a blunted increase in adrenal
PNMT gene expression and/or enzyme activity, changes in adrenal PNMT
mRNA and enzyme activity during restraint were analyzed (Fig. 3
). We first measured
PNMT mRNA content after a 3-h period of either restraint (restraint
group, Fig. 3A
) or no handling (control group, Fig. 3A
). Although not
significantly different, PNMT mRNA content in unhandled control CRH KO
adrenal tended to be lower than that in WT control adrenals. Restraint
clearly increased PNMT gene expression in both genotypes, with the
increase in CRH KO mice about 50% that seen in WT mice. We next
measured the time course of gene expressions of PNMT (Fig. 3
, B and C)
and tyrosine hydroxylase (Fig. 3
, B and E). As in unhandled control
mice, the 0 time basal PNMT mRNA level in CRH KO mice tended to be
lower (although not significantly) than that in WT mice (Fig. 3C
). One
and 3 h after the onset of restraint, PNMT gene expression was
significantly lower in CRH KO mice compared with that in WT, though the
degree of induction above basal levels was similar in both genotypes.
The enzyme activity of PNMT in CRH KO mice was about 50% that in WT
mice at all time points during restraint, and was not significantly
induced in either genotype (Fig. 3D
). Tyrosine hydroxylase mRNA
increased to the same extent in both genotypes, during the first hour
of restraint, but rose thereafter to a greater degree in WT mice (Fig. 3E
).

View larger version (37K):
[in this window]
[in a new window]
|
Figure 3. Changes in adrenal PNMT and tyrosine hydroxylase
mRNAs, and PNMT activity during restraint. WT and CRH KO mice were
subjected to restraint as in Fig. 1 . Right adrenal glands were
sectioned for in situ hybridization, and left adrenals
were homogenized for PNMT activity. A, PNMT mRNA was quantitated in WT
and CRH KO mice after 3 h of restraint (restraint group) or no
handling (control group). B, Representative in situ
hybridization data of time course (0, 1, 2, and 3 h) of changes in
PNMT and tyrosine hydroxylase mRNAs during restraint. Pictures were taken under bright-field
illumination, and positive signal is denoted by black grains
in the region of the adrenal medulla. Bar, 1 mm. C,
Quantitation of PNMT mRNA content by in situ
hybridization. Data from (B) were quantified as mean densities using
the NIH Image program. D, PNMT activity was determined using a
radioenzymatic assay. E, Quantitation of tyrosine hydroxylase mRNA
content by in situ hybridization. Data from (B) were
quantified as mean densities. n = 45/group. For (A), (C), (D),
and (E), results were analyzed by two-way ANOVA followed by posthoc
comparisons with Fishers PLSD test. *, Significant difference
vs. WT 0 time or WT control; #, significant difference
vs. CRH KO 0 time or CRH KO control; **, significant
difference between genotypes at same time point or treatment; TH,
tyrosine hydroxylase; Control, unhandled time control.
|
|
Because glucocorticoids are thought to induce PNMT (9, 41), we tested
whether an increase in adrenal corticosterone content accompanied the
increase in PNMT gene expression following restraint in CRH KO mice. In
restrained WT mice, the rise in plasma corticosterone (Fig. 4A
) was accompanied by a marked rise in
adrenal corticosterone content (Fig. 4B
). In restrained CRH KO mice,
despite a minimal rise in plasma corticosterone (Fig. 4A
), adrenal
corticosterone content tended to increase (Fig. 4B
), although to a much
lesser extent than that seen in WT mice.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 4. Changes in plasma and adrenal corticosterone
during restraint. WT and CRH KO mice were subjected to restraint as in
Fig. 1 . Plasma and left adrenal glands were analyzed by RIA for (A)
plasma and (B) adrenal corticosterone. n = 46/group. Results
were analyzed by two-way ANOVA followed by posthoc comparisons with
Fishers PLSD test. *, Significant difference vs. WT 0
time; **, significant difference between genotypes at same time point;
B, corticosterone.
|
|
Effect of PxADX on restraint-induced plasma corticosterone and
adrenal PNMT mRNA levels in WT mice
To further explore the hypothesis that corticosterone is a
necessary factor for basal and restraint-induced adrenal PNMT gene
expression, PxADX was performed in WT mice. As shown in Fig. 5A
, 5
days of
metyrapone/aminoglutethimide treatment completely abolished the plasma
corticosterone response following 3 h of restraint, with the
plasma corticosterone level in the restrained PxADX group (0.12 ±
0.02 µg/dl) significantly lower than that in unrestrained, intact
controls (0.36 ± 0.01 µg/dl). As expected, plasma ACTH was
elevated in the PxADX/restraint group relative to the control or
vehicle/restraint group (Fig. 5B
). In situ hybridization
analysis revealed reduced adrenal PNMT gene expression following
restraint in PxADX group compared with that in vehicle-treated groups
(Fig. 5
, C and D). While an increase in PNMT gene expression was again
seen in the vehicle/restraint group relative to the unrestrained,
intact control group, no PNMT mRNA was detected by in situ
hybridization in the PxADX/restraint group. Using RT-PCR, PNMT mRNA was
detected in adrenal glands of PxADX/restraint animals, but at a much
lower level of abundance compared with that in vehicle-treated animals
(Fig. 5E
). A PCR-amplified PNMT cDNA
fragment was barely detected at 20 cycles in the PxADX animals, at a
time when a robust signal was present in control and vehicle-treated
animals.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 5. Effect of PxADX on restraint-induced plasma
corticosterone, ACTH, and PNMT mRNA in WT male mice. WT mice were
subjected to restraint for 3 h starting immediately after
lights-on in the morning with 5 days of prior PxADX or vehicle
treatment. Plasma was collected after restraint, and analyzed by RIA
for (A) corticosterone and (B) ACTH. Right adrenal glands were
sectioned for in situ hybridization, and left adrenals
were homogenized for RT-PCR. (C), PNMT mRNA was detected by in
situ hybridization. Bar, 1 mm. (D), Data from (C) were
quantified as mean densities. n = 34/group. For (A), (B), and
(D), results were analyzed by unpaired t tests. *,
Significant difference vs. control; **, significant
difference between vehicle and PxADX; B, corticosterone; Control,
unrestrained mice with 5 days of prior vehicle treatment. (E), RT-PCR
for PNMT gene expression was performed with total RNA purified from
left adrenal glands. Three or 4 RNA samples from different adrenals in
each group were subjected to RT-PCR. M, DNA size marker (100 bp DNA
Ladder; New England Biolabs, Inc., Beverly, MA); *, no DNA
template; arrowheads, PNMT RT-PCR product (368 bp).
|
|
 |
Discussion
|
|---|
CRH is thought to be important for the function of the
adrenomedullary catecholaminergic system, both via actions within the
brain as well as by activation of the HPA axis. Hypophysectomy prevents
the immobilization-induced increase in adrenal PNMT gene expression (9, 41), and central CRH antagonist administration blocks the increase in
plasma epinephrine induced by central CRH injection in rats (1),
suggesting a specific role for CRH in adrenal epinephrine synthesis and
secretion. In addition, CRH mRNA (42) and peptide (43, 44) are found in
the adrenal medulla. This local synthesis of CRH in the adrenal medulla
can contribute to adrenal catecholamine regulation in vitro
(45), although this effect has not been clearly shown in
vivo (46).
Glucocorticoids have also been suggested to regulate both central and
peripheral catecholaminergic systems. Adrenalectomy potentiates
immobilization-induced norepinephrine secretion in the PVN (47) and
periphery (3). Chronic cortisol treatment attenuates
immobilization-induced (7) and
2-adrenoceptor
antagonist-induced (48) increases of plasma or hypothalamic
norepinephrine in rats, implying an inhibitory effect of
glucocorticoids on the sympathoneural system. On the other hand,
adrenomedullary PNMT gene expression requires intact adrenocortical
function (9, 41, 49), and glucocorticoids may act through a GRE in the
PNMT gene promoter region (10, 11) in rats, to induce PNMT expression
and activity (12). Taken together, these observations suggest that
glucocorticoids may stimulate peripheral epinephrine secretion.
The results of the present study show a clear attenuation in plasma
epinephrine levels in CRH KO mice compared with those in WT mice. Basal
and restraint-induced increases in plasma epinephrine were impaired in
CRH KO mice, which had significantly lower basal epinephrine levels and
delayed increases during restraint. The lower epinephrine production in
CRH KO mice suggests that PNMT gene expression and/or enzyme activity
is impaired. Supporting this hypothesis, basal and restraint-induced
adrenal PNMT mRNA and enzyme activity levels in CRH KO mice were lower
than those in WT mice. CRH KO mice also exhibited impaired
corticosterone secretion during restraint, consistent with previous
reports (29, 50, 51). Our findings are in agreement with other reports
(9, 41, 49) showing that hypophysectomy-induced depletion of
corticosterone causes blunted adrenal PNMT gene expression and activity
in rats. Taken together with data in pharmacologically adrenalectomized
mice, our results demonstrate that CRH deficiency leads to impaired
PNMT gene expression and enzyme activity levels, and to impaired
epinephrine synthesis and secretion in the adrenal medulla, possibly
due to impaired adrenocortical corticosterone production.
We observed, however, a discrepancy between PNMT gene expression and
enzyme activity, with a 4- to 5-fold induction in PNMT gene expression
unaccompanied by any increase in enzyme activity during restraint in
either genotype. Perhaps a time longer than 3 h is required for
the increase in PNMT mRNA levels to be reflected in increased enzyme
activity. Supporting this possibility, previous reports have shown that
PNMT activity rises slowly, lagging up to 18 h behind the rise in
PNMT mRNA, following either restraint (12) or glucocorticoid treatments
(52, 53) in rats. The greater secretion of epinephrine following
restraint in WT vs. CRH KO mice probably reflects the higher
basal PNMT activity in WT mice. These data suggest that acute
modulation of epinephrine action is controlled by regulation of the
release of stored hormone, whereas over the longer term, epinephrine
stores are regulated by changes in PNMT gene expression, as ultimately
reflected in PNMT enzymatic activity.
In contrast to plasma corticosterone, which did not increase over basal
levels in CRH KO mice, adrenal corticosterone content in CRH KO mice
tended to rise during restraint, albeit to level much below that seen
in WT mice. Considering that adrenomedullary cells are exposed to high
levels of corticosterone (54), this increase in adrenal corticosterone
content in CRH KO mice is likely responsible for the reduced but
detectable induction of adrenal PNMT gene expression during restraint
in this genotype. PxADX completely abolished corticosterone secretion
as well as restraint-induced adrenal PNMT gene expression in WT mice,
suggesting that PNMT gene expression absolutely requires stimulation by
corticosterone.
We found basal and restraint-induced plasma norepinephrine levels in
CRH KO mice to be significantly higher than those in WT mice. However,
we did not determine whether these higher plasma norepinephrine levels
originated from the sympathetic nerve terminals or the adrenal medulla.
Because glucocorticoids are thought to have an inhibitory effect on
norepinephrine secretion from the sympathetic nerve terminals (5), and
CRH KO mice exhibit blunted glucocorticoid production, some fraction of
the elevated plasma norepinephrine may arise from secretion by nerve
terminals of the sympathetic nervous system. It is also possible that
the adrenal medulla could contribute to the elevation of plasma
norepinephrine because the accumulation of adrenal norepinephrine, the
substrate for PNMT, might occur due to chronically impaired conversion
of norepinephrine to epinephrine in CRH KO mice. Further studies of
adrenalectomized WT and CRH KO mice, including the clamping of
corticosterone at similar levels in both genotypes, would help to
determine the origin of the elevated plasma norepinephrine in CRH KO
mice.
Compared with other species (3) or anesthetized mice (55), basal plasma
catecholamine levels in our studies may have been elevated due to the
handling necessary to obtain blood samples in conscious mice. Because
plasma norepinephrine in WT mice did not change during restraint, we
cannot rule out the possibility that such an initial elevation might
have masked a rise in norepinephrine secretion during restraint in WT
mice. However, it is not clear whether plasma catecholamine levels
reported in anesthetized mice (55) reflect the true basal levels in
conscious mice, since some anesthetics are known to suppress
catecholamine secretion (56, 57).
To test a possible direct role of CRH on the sympathetic input to the
adrenal medulla, adrenal tyrosine hydroxylase gene expression was
measured. In both genotypes, basal and restraint-induced tyrosine
hydroxylase mRNA levels were similar, suggesting that sympathetic input
to the adrenal medulla might be intact in CRH KO mice. However, we
cannot rule out the existence of possible compensatory pathways that
regulate adrenal tyrosine hydroxylase expression in CRH deficiency.
Moreover, in some studies (12, 58), denervation of adrenal gland does
not affect the induction of tyrosine hydroxylase activity by stressors,
in contrast to other reports (13, 14, 15, 16, 17), which show a requirement of
intact sympathetic input. Future studies should use adrenal denervation
in CRH KO mice to further address this issue.
 |
Acknowledgments
|
|---|
We thank Louis J. Muglia for generation of CRH-deficient mice
and helpful discussions, Marian Evinger and Tong Joh for rat PNMT and
tyrosine hydroxylase cDNA plasmids, J. Paul Hieble for the PNMT
inhibitor, Brian Kennedy for the PNMT activity protocol, and Alan Watts
for helpful discussions regarding in situ hybridization
procedures.
 |
Footnotes
|
|---|
1 This study was supported in part by NIH Grants RO1-DK-50511 (to
J.A.M.), DK-49333, and National Association for Research on
Schizophrenia and Depression (to L.J.), and NSF Grant IBN-9513926
(to E.P.W.). 
2 Present address: Division of Genetics, Brigham and Womens
Hospital, Harvard Medical School, 20 Shattuck Street, Boston,
Massachusetts 02115. 
Received October 12, 1999.
 |
References
|
|---|
-
Goldstein DS, Garty M, Bagdy G, Szemeredi K,
Sternberg EM, Listwak S, Pacák K, Deka-Starosta A, Hoffman A,
Chang PC, Stull R, Gold PW, Kopin IJ 1993 Role of CRH in
glucopenia-induced adrenomedullary activation in rats. J
Neuroendocrinol 5:475486[CrossRef][Medline]
-
Lamarche L, Yamaguchi N, Péronnet F 1995 Hepatic denervation reduces adrenal catecholamine secretion during
insulin-induced hypoglycemia. Am J Physiol 268:R50R57
-
Kvetñansky R, Fukuhara K, Pacák K, Cizza G,
Goldstein DS, Kopin IJ 1993 Endogenous glucocorticoids restrain
catecholamine synthesis and release at rest and during immobilization
stress in rats. Endocrinology 133:14111419[Abstract/Free Full Text]
-
Cizza G, Pacák K, Kvetñansky R, Palkovits
M, Goldstein DS, Brady LS, Fukuhara K, Bergamini E, Kopin IJ, Blackman
MR, Chrousos GP, Gold PW 1995 Decreased stress responsivity of
central and peripheral catecholaminergic systems in aged 344/N Fischer
rats. J Clin Invest 95:12171224
-
Pacák K, McCarty R, Palkovits M, Cizza G, Kopin
IJ, Goldstein DS, Chrousos GP 1995 Decreased central and
peripheral catecholaminergic activation in obese Zucker rats.
Endocrinology 136:43604367[Abstract]
-
Dallman MF, Akana SF, Cascio CS, Darlington DN,
Jacobson L, Levin N 1987 Regulation of ACTH secretion: variations
on a theme of B. Recent Prog Horm Res 43:113173
-
Pacák K, Palkovits M, Kvetñansky R, Matern
P, Hart C, Kopin IJ, Goldstein DS 1995 Catecholaminergic
inhibition by hypercortisolemia in the paraventricular nucleus of
conscious rats. Endocrinology 136:48144819[Abstract]
-
Vale W, Rivier C, Brown MR, Spiess J, Koob G, Swanson
L, Bilezikjian L, Bloom F, Rivier J 1983 Chemical and biological
characterization of corticotropin releasing factor. Recent Prog Horm
Res 39:245270
-
Viskupic E, Kvetñansky R, Sabban EL, Fukuhara K,
Weise VK, Kopin IJ, Schwartz JP 1994 Increase in rat adrenal
phenylethanolamine N-methyltransferase mRNA level caused by
immobilization stress depends on intact pituitary-adrenocortical axis.
J Neurochem 63:808814[Medline]
-
Ebert SN, Balt SL, Hunter JPB, Gashler A, Sukhatme V,
Wong DL 1994 Egr-1 activation of rat adrenal phenylethanolamine
N-methyltransferase gene. J Biol Chem 269:2088520898[Abstract/Free Full Text]
-
Suh Y-H, Chun Y-S, Lee IS, Kim S-S, Choi W, Chong YH,
Hong L, Kim S-H, Park C-W, Kim C-G 1994 Complete nucleotide
sequence and tissue-specific expression of the rat phenylethanolamine
N-methyltransferase gene. J Neurochem 63:16031608[Medline]
-
Betito K, Mitchell JB, Bhatnagar S, Boksa P, Meaney
MJ 1994 Regulation of the adrenomedullary catecholaminergic system
after mild, acute stress. Am J Physiol 267:R212R220
-
Nagatsu T 1991 Genes for human
catecholamine-synthesizing enzymes. Neurosci Res 12:315345[CrossRef][Medline]
-
Kilbourne EJ, Nankova BB, Lewis EJ, McMahon A, Osaka H,
Sabban DB, Sabban EL 1992 Regulated expression of the tyrosine
hydroxylase gene by membrane depolarization. Identification of the
responsive element and possible second messengers. J Biol Chem 267:75637569[Abstract/Free Full Text]
-
Hiremagalur B, Nankova B, Nitahara J, Zeman R, Sabban
EL 1993 Nicotine increases expression of tyrosine hydroxylase
gene. Involvement of protein kinase A-mediated pathway. J Biol
Chem 268:2370423711[Abstract/Free Full Text]
-
Vietor I, Rusnak M, Viskupic E, Blazicek P, Sabban EL,
Kvetñansky R 1996 Glucoprivation by insulin leads to
trans-synaptic increase in rat adrenal tyrosine hydroxylase mRNA
levels. Eur J Pharmacol 313:119127[CrossRef][Medline]
-
Jahng JW, Houpt TA, Joh TH, Wessel TC 1997 Expression of catecholamine-synthesizing enzymes, peptidylglycine
-amidating monooxygenase, and neuropeptide Y mRNA in the rat adrenal
medulla after acute systemic nicotine. J Mol Neurosci 8:4552[Medline]
-
DeCristofaro JD, LaGamma EF 1994 Neonatal stress:
effects of hypoglycemia and hypoxia on adrenal tyrosine hydroxylase
gene expression. Pediatr Res 36:719723[Medline]
-
Nankova B, Kvetñansky R, McMahon A, Viskupic E,
Hiremagalur B, Frankle G, Fukuhara K, Kopin IJ, Sabban EL 1994 Induction of tyrosine hydroxylase gene expression by a nonneuronal
nonpituitary-mediated mechanism in immobilization stress. Proc Natl
Acad Sci USA 91:59375941[Abstract/Free Full Text]
-
Nankova B, Kvetñansky R, Hiremagalur B, Sabban B,
Rusnak M, Sabban EL 1996 Immobilization stress elevates gene
expression for catecholamine biosynthetic enzymes and some
neuropeptides in rat sympathetic ganglia: effects of
adrenocorticotropin and glucocorticoids. Endocrinology 137:55975604[Abstract]
-
Pacák K, Palkovits M, Kopin IJ, Goldstein DS 1995 Stress-induced norepinephrine release in the hypothalamic
paraventricular nucleus and pituitary-adrenocortical and
sympathoadrenal activity: in vivo microdialysis studies.
Front Neuroendocrinol 16:89150[CrossRef][Medline]
-
Valentino RJ, Page M, Van Bockstaele E, Aston-Jones
G 1992 Corticotropin-releasing factor innervation of the locus
coeruleus region: distribution of fibers and sources of input.
Neuroscience 48:689705[CrossRef][Medline]
-
Koegler-Muly SM, Owens MJ, Ervin GN, Kilts CD, Nemeroff
CB 1993 Potential corticotropin-releasing factor pathways in the
rat brain as determined by bilateral electrolytic lesions of the
central amygdaloid nucleus and the paraventricular nucleus of the
hypothalamus. J Neuroendocrinol 5:9598[CrossRef][Medline]
-
Pavcovich LA, Valentino RJ 1997 Regulation of a
putative neurotransmitter effect of corticotropin-releasing factor:
effects of adrenalectomy. J Neurosci 17:401408[Abstract/Free Full Text]
-
Lavicky J, Dunn AJ 1993 Corticotropin-releasing
factor stimulates catecholamine release in hypothalamus and prefrontal
cortex in freely moving rats as assessed by microdialysis. J
Neurochem 60:602612[CrossRef][Medline]
-
Melia KR, Duman RS 1991 Involvement of
corticotropin-releasing factor in chronic stress regulation of the
brain noradrenergic system. Proc Natl Acad Sci USA 88:83828386[Abstract/Free Full Text]
-
Brady LS, Whitfield Jr HJ, Fox RJ, Gold PW, Herkenham
M 1991 Long-term antidepressant administration alters
corticotropin-releasing hormone, tyrosine hydroxylase, and
mineralocorticoid receptor gene expression in rat brain. Therapeutic
implications. J Clin Invest 87:831837
-
Jansen ASP, Nguyen XV, Karpitskiy V, Mettenleiter TC,
Loewy AD 1995 Central command neurons of the sympathetic nervous
system: basis of the fight-or-flight response. Science 270:644646[Abstract/Free Full Text]
-
Muglia L, Jacobson L, Dikkes P, Majzoub JA 1995 Corticotropin-releasing hormone deficiency reveals major fetal but not
adult glucocorticoid need. Nature 373:427432[CrossRef][Medline]
-
Sosenko IRS, Lewis PL, Frank L 1986 Metyrapone
delays surfactant and antioxidant enzyme maturation in developing rat
lung. Pediatr Res 20:672675[Medline]
-
Plotsky PM, Sawchenko PE 1987 Hypophysial-portal
plasma levels, median eminence content, and immunohistochemical
staining of corticotropin-releasing factor, arginine vasopressin, and
oxytocin after pharmacological adrenalectomy. Endocrinology 120:13611369[Abstract/Free Full Text]
-
Laslop A, Tschernitz C 1992 Effects of nerve growth
factor on the biosynthesis of chromogranin A and B, secretogranin II
and carboxypeptidase H in rat PC12 cells. Neuroscience 49:443450[CrossRef][Medline]
-
Simmons DM, Arriza JL, Swanson LW 1989 A complete
protocol for in situ hybridization of messenger RNAs in brain and other
tissues with radio-labeled single-stranded RNA probes. J
Histotechnol 12:169181
-
Yamada K, Sakai M, Okamura H, Ibata Y, Nagatsu I 1992 Detection of tyrosine hydroxylase and
phenylethanolamine-N-methyltransferase messenger RNAs in the mouse
adrenal gland and the brain by in situ hybridization. Histochemistry 97:201206[CrossRef][Medline]
-
Keeney DS, Jenkins CM, Waterman MR 1995 Developmentally regulated expression of adrenal 17
-hydroxylase
cytochrome P450 in the mouse embryo. Endocrinology 136:48724879[Abstract]
-
Weninger SC, Dunn AJ, Muglia LJ, Dikkes P, Miczek KA,
Swiergiel AH, Berridge CW, Majzoub JA 1999 Stress-induced
behaviors require the corticotropin-releasing hormone (CRH) receptor,
but not CRH. Proc Natl Acad Sci USA 96:82838288[Abstract/Free Full Text]
-
Grima B, Lamouroux A, Blanot F, Biguet NF, Mallet J 1985 Complete coding sequence of rat tyrosine hydroxylase mRNA. Proc
Natl Acad Sci USA 82:617621[Abstract/Free Full Text]
-
Quaife CJ, Hoyle GW, Froelick GJ, Findley SD, Baetge EE,
Behringer RR, Hammang JP, Brinster RL, Palmiter RD 1994 Visualization and ablation of phenylethanolamine
N-methyltransferase producing cells in transgenic mice.
Transgenic Res 3:388400[CrossRef][Medline]
-
Ziegler MG, Kennedy B, Elayan H 1988 A sensitive
radioenzymatic assay for epinephrine forming enzymes. Life Sci 43:21172122[CrossRef][Medline]
-
Kennedy B, Bigby TD, Ziegler MG 1995 Nonadrenal
epinephrine-forming enzymes in humans. Characteristics, distribution,
regulation, and relationship to epinephrine levels. J Clin Invest 95:28962902
-
Kvetñansky R, Pacák K, Fukuhara K, Viskupic
E, Hiremagalur B, Nankova B, Goldstein DS, Sabban EL, Kopin IJ 1995 Sympathoadrenal system in stress. Interaction with the
hypothalamic-pituitary-adrenocortical system. Ann NY Acad Sci 771:131158[Medline]
-
Thompson RC, Seasholtz AF, Herbert E 1987 Rat
corticotropin-releasing hormone gene: sequence and tissue-specific
expression. Mol Endocrinol 1:363370[Abstract/Free Full Text]
-
Udelsman R, Harwood JP, Millan MA, Chrousos GP,
Goldstein DS, Zimlichman R, Catt KJ, Aguilera G 1986 Functional
corticotropin releasing factor receptors in the primate peripheral
sympathetic nervous system. Nature 319:147150[CrossRef][Medline]
-
Bruhn TO, Engeland WC, Anthony EL, Gann DS, Jackson
IM 1987 Corticotropin-releasing factor in the dog adrenal medulla
is secreted in response to hemorrhage. Endocrinology 120:2533[Abstract/Free Full Text]
-
Venihaki M, Gravanis A, Margioris AN 1997 Comparative study between normal rat chromaffin and PC12 rat
pheochromocytoma cells: production and effects of
corticotropin-releasing hormone. Endocrinology 138:698704[Abstract/Free Full Text]
-
Engeland WC, Lilly MP, Bruhn TO, Gann DS 1987 Comparison of corticotropin-releasing factor and acetylcholine on
catecholamine secretion in dogs. Am J Physiol 253:R209R215
-
Pacák K, Kvetñansky R, Palkovits M, Fukuhara
K, Yadid G, Kopin IJ, Goldstein DS 1993 Adrenalectomy augments
in vivo release of norepinephrine in the paraventricular
nucleus during immobilization stress. Endocrinology 133:14041410[Abstract/Free Full Text]
-
Pacák K, Armando I, Komoly S, Fukuhara K, Weise
VK, Holmes C, Kopin IJ, Goldstein DS 1992 Hypercortisolemia
inhibits yohimbine-induced release of norepinephrine in the
posterolateral hypothalamus of conscious rats. Endocrinology 131:13691376[Abstract/Free Full Text]
-
Jiang W, Uht R, Bohn MC 1989 Regulation of
phenylethanolamine N-methyltransferase (PNMT) mRNA in the
rat adrenal medulla by corticosterone. Int J Dev Neurosci 7:513520[CrossRef][Medline]
-
Muglia LJ, Jacobson L, Weninger SC, Luedke CE, Bae DS,
Jeong K-H, Majzoub JA 1997 Impaired diurnal adrenal rhythmicity
restored by constant infusion of corticotropin-releasing hormone in
corticotropin-releasing hormone-deficient mice. J Clin Invest 99:29232929[Medline]
-
Jeong K-H, Jacobson L, Widmaier EP, Majzoub JA 1999 Normal suppression of the reproductive axis following stress in
corticotropin-releasing hormone-deficient mice. Endocrinology 140:17021708[Abstract/Free Full Text]
-
Wong DL, Lesage A, Siddall B, Funder JW 1992 Glucocorticoid regulation of phenylethanolamine
N-methyltransferase in vivo. FASEB J 6:33103315[Abstract]
-
Wong DL, Siddall B, Wang W 1995 Hormonal control of
rat adrenal phenylethanolamine N-methyltransferase. Enzyme
activity, the final critical pathway. Neuropsychopharmacology 13:223234[CrossRef][Medline]
-
Dalle M, Giry J, Gay M, Delost P 1978 Perinatal
changes in plasma and adrenal corticosterone and aldosterone
concentrations in the mouse. J Endocrinol 76:303309[Abstract/Free Full Text]
-
Kobayashi K, Ota A, Togari A, Morita S, Mizuguchi T,
Sawada H, Yamada K, Nagatsu I, Matsumoto S, Fujita K, Nagatsu T 1995 Alteration of catecholamine phenotype in transgenic mice
influences expression of adrenergic receptor subtypes. J Neurochem 65:492501[Medline]
-
Pan WH, Lai YJ, Chen NH 1995 Differential effects
of chloral hydrate and pentobarbital sodium on a cocaine level and its
catecholamine response in the medial prefrontal cortex: a comparison
with conscious rats. J Neurochem 64:26532659[Medline]
-
Irifune M, Fukuda T, Nomoto M, Sato T, Kamata Y,
Nishikawa T, Mietani W, Yokoyama K, Sugiyama K, Kawahara M 1997 Effects of ketamine on dopamine metabolism during anesthesia in
discrete brain regions in mice: comparison with the effects during the
recovery and subanesthetic phases. Brain Res 763:281284[CrossRef][Medline]
-
Kvetñansky R, Nankova B, Hiremagalur B, Viskupic
E, Vietor I, Rusnak M, McMahon A, Kopin IJ, Sabban EL 1996 Induction of adrenal tyrosine hydroxylase mRNA by single immobilization
stress occurs even after splanchnic transection and in the presence of
cholinergic antagonists. J Neurochem 66:138146[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
H. Cheng, L. Zhou, W. Zhu, A. Wang, C. Tang, O. Chan, R. S. Sherwin, and R. J. McCrimmon
Type 1 corticotropin-releasing factor receptors in the ventromedial hypothalamus promote hypoglycemia-induced hormonal counterregulation
Am J Physiol Endocrinol Metab,
September 1, 2007;
293(3):
E705 - E712.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Jacobson, T. Ansari, J. Potts, and O. P. McGuinness
Glucocorticoid-deficient corticotropin-releasing hormone knockout mice maintain glucose requirements but not autonomic responses during repeated hypoglycemia
Am J Physiol Endocrinol Metab,
July 1, 2006;
291(1):
E15 - E22.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Itoh, S. Yamada, T. Mori, T. Miwa, K. Tottori, Y. Uwahodo, Y. Yamamura, M. Fukuda, K. Yamamoto, A. Tanoue, et al.
Attenuated stress-induced catecholamine release in mice lacking the vasopressin V1b receptor
Am J Physiol Endocrinol Metab,
July 1, 2006;
291(1):
E147 - E151.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-H. Jeong, S. Sakihara, E. P. Widmaier, and J. A. Majzoub
Impaired Leptin Expression and Abnormal Response to Fasting in Corticotropin-Releasing Hormone-Deficient Mice
Endocrinology,
July 1, 2004;
145(7):
3174 - 3181.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.'e. Hochberg, K. Pacak, and G. P. Chrousos
Endocrine Withdrawal Syndromes
Endocr. Rev.,
August 1, 2003;
24(4):
523 - 538.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. A. Tjurmina, I. Armando, J. M. Saavedra, D. S. Goldstein, and D. L. Murphy
Exaggerated Adrenomedullary Response to Immobilization in Mice with Targeted Disruption of the Serotonin Transporter Gene
Endocrinology,
December 1, 2002;
143(12):
4520 - 4526.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Bland, C. A. M. Jamieson, S. F. Akana, S. R. Bornstein, G. Eisenhofer, M. F. Dallman, and H. A. Ingraham
Haploinsufficiency of steroidogenic factor-1 in mice disrupts adrenal development leading to an impaired stress response
PNAS,
December 19, 2000;
97(26):
14488 - 14493.
[Abstract]
[Full Text]
[PDF]
|
 |
|