| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Division of Endocrinology (K.-H.J., L.J., J.A.M.), Children’s Hospital, Harvard Medical School, Boston, Massachusetts 02115; Clinical Neuroscience Branch, NINDS (K.P., D.S.G.) and Developmental Endocrinology Branch, NICHD (K.P.), NIH, Bethesda, Maryland 20892; and Department of Biology (E.P.W.), Boston University, Boston, Massachusetts 02215
Address all correspondence and requests for reprints to: Joseph A. Majzoub, Division of Endocrinology, Children’s Hospital, Harvard Medical School, 300 Longwood Avenue, Boston, Massachusetts 02115. E-mail: majzoub{at}a1.tch.harvard.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In chromaffin cells of the adrenal medulla, stressor-induced gene expression of phenylethanolamine N-methyltransferase (PNMT), which converts norepinephrine to epinephrine, requires normal HPA axis activity, but not intact sympathetic input in rats (9), implying a role for glucocorticoids in PNMT gene expression and action. Consistent with this are reports of the existence of a glucocorticoid responsive cis-element (GRE) in the 5'-promoter region of the rat PNMT gene (10, 11) and of a delay in the rise in stressor-induced PNMT activity after suppression of endogenous corticosterone synthesis (12). By contrast, the expression of the adrenomedullary tyrosine hydroxylase, the rate-limiting enzyme that catalyzes the first step of catecholamine biosynthesis, is primarily controlled by cholinergic sympathetic input from splanchnic nerves (13, 14, 15, 16, 17). Tyrosine hydroxylase activity and gene expression are also increased following stressors such as insulin-induced hypoglycemia (18) and immobilization (19, 20) in rats.
The hypothalamic CRH system and the sympathetic nervous system are postulated to be functionally related to each other, and to regulate reciprocally each others’ functions within the central nervous system (21). For example, CRH-containing hypothalamic paraventricular nuclei (PVN) parvocellular neurons are anatomically and functionally connected to locus coeruleus A6 catecholaminergic neurons in the brain stem in rats (22, 23). Central CRH administration increases neuronal discharge in the locus coeruleus in a dose-dependent manner (24) as well as hypothalamic norepinephrine secretion (25). Immobilization (4) or central injection of CRH (26) also increases tyrosine hydroxylase gene expression in the locus coeruleus, whereas central administration of CRH antagonist blocks stressor-induced tyrosine hydroxylase production (26). Moreover, chronic antidepressant treatment reduces tyrosine hydroxylase messenger RNA (mRNA) level in the locus coeruleus as well as CRH mRNA in the PVN in rats (27), suggesting a possible stimulatory action of CRH on central catecholaminergic neurons. A retrograde tracer study using a transneuronal labeling method suggests possible connections between the sympatho-adrenomedullary catecholaminergic system and PVN neurons, including oxytocin secreting cells (28), and possibly CRH or arginine vasopressin expressing neurons, through the spinal cord and splanchnic nerves. It is therefore possible that CRH contributes to the regulation of the adrenomedullary catecholaminergic system under stressful conditions through both the HPA axis and the sympathetic nervous system.
To determine the physiological significance and relative contributions of CRH and glucocorticoids to the regulation of the adrenomedullary catecholaminergic system, we compared basal and restraint-induced changes of plasma corticosterone and catecholamines, adrenal PNMT and tyrosine hydroxylase mRNAs, and PNMT activity in CRH-deficient (knockout, KO) (29) with wild-type (WT) mice.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Individual housing of adult mice allowed us to remove individual animals for experimentation without disturbing other mice. All studies were performed in a quiet room under conditions made as constant as possible from day to day to avoid variation in the environment which might have affected the adrenocortical and adrenomedullary systems. All experiments were begun at 0700 h, when corticosterone levels are at their nadir. Adult WT and CRH KO male mice were subjected to restraint in ventilated 50 ml tubes for up to 3 h starting immediately after lights-on. Tubes were designed to be small enough to restrain a mouse so that it was able to breathe but unable to move freely. Control mice that were left unhandled for up to 3 h were unstressed as judged by their low, basal plasma corticosterone levels. Many previous studies have used immobilization rather than restraint for catecholaminergic activation (3, 4, 5). However, we have found that restraint, although a more mild stimulus than immobilization, results in marked activation of the HPA and catecholaminergic axes (29, and results contained herein), and was judged to be a more humane stimulus than immobilization by the Children’s Hospital Animal Care and Use Committee, which approved all animal experiments.
Pharmacological adrenalectomy
PxADX was performed using a modification of previously reported
methods (30, 31). Adult (2–3 months old) WT male mice were injected ip
with 200 mg/kg of 2-methyl-1,2-di-3-pyridyl-1-propanone (metyrapone;
Sigma, St. Louis, MO), dissolved in 10%
dimethylsulfoxide-saline (vehicle), twice daily for 5 days (PxADX
group). Control (no restraint) and vehicle group mice were injected
with identical volumes of vehicle only. A 100 mg/kg injection of
aminoglutethimide (Sigma) was combined with metyrapone in
the last two injections of the experimental PxADX group. Once
injections were begun, all mice were allowed to drink a 5% dextrose
solution in 0.9% saline, in addition to regular drinking water and
food. Vehicle and PxADX group mice were subjected to restraint on the
morning of day 6 of drug treatment.
Sample collection
Blood sampling for plasma hormone (corticosterone, ACTH, and
catecholamines) measurements was performed without anesthesia by
retro-orbital sinus phlebotomy using heparinized capillary tubes. Only
one blood sample was collected from each mouse. In some cases,
phlebotomy was immediately followed by decapitation to collect adrenal
glands for PNMT and tyrosine hydroxylase mRNA analysis, PNMT activity,
or corticosterone content measurements. The time from touching a cage
to phlebotomy or decapitation was less than 1 min. Collected blood
samples were kept on ice until plasma separation. Plasma was separated
from cells by centrifugation at 4 C, and stored at -80 C in aliquots
until assayed. Left adrenal glands were immediately frozen in liquid
N2 and stored at -80 C until homogenization.
Right adrenal glands were immediately embedded in OCT compound (Sakura
Finetek, Torrance, CA), rapidly frozen in liquid
N2, and stored at -80 C until cryostat
sectioning. For the control groups, animals were killed concurrently
without prior restraint.
In situ hybridization
PNMT and tyrosine hydroxylase mRNA levels in the adrenal medulla
were measured using in situ hybridization. Other methods,
such as Northern blot analysis or RNase protection assay performed on
total adrenal RNA, could not be used due to the marked difference in
the sizes of the adrenal cortices in CRH KO mice compared with WT mice
(29). This size variation is due entirely to differences in the mass of
the adrenal cortex, and not adrenal medulla (29). Because PNMT and
tyrosine hydroxylase mRNAs are expressed exclusively in the latter
location, analysis of equal amounts of RNA from WT and CRH KO adrenals
by Northern blot or RNase protection would necessarily result in a
higher percentage of medullary RNA from CRH KO mice than from WT mice
being compared. Realizing this, we tried to normalize the relative
amounts of WT and CRH KO medullary RNA being compared with the use of a
medulla-specific mRNA encoding synaptophysin, a chromaffin
granule-specific protein (32), but the level of synaptophysin mRNA was
altered following restraint (data not shown). For these reasons, we
used in situ hybridization to measure relative levels of
PNMT and tyrosine hydroxylase mRNAs in WT and CRH KO mice in our
studies.
The in situ hybridization procedure was based on previously reported methods (33, 34, 35), as modified by us (36). Right adrenal glands were serial-sectioned at a thickness of 10 µm with a cryostat (Jung 2045C; Leica Corp., Deerfield, IL), postfixed with 4% paraformaldehyde in PBS at 4 C for 10 min, and subjected to sequential prehybridization treatment (33). Sectioned tissues on slides were stored at -20 C with desiccant until in situ hybridization. Rat PNMT (rPNMT) and tyrosine hydroxylase (rTH) complementary DNA (cDNA) plasmids were kindly provided by Drs. Marian Evinger (SUNY, Stony Brook, NY) and Tong Joh (Cornell Medical College, White Plains, NY). A HindIII restriction fragment of the rPNMT cDNA insert spanning +193 to +1200 of rPNMT gene (405 bp length, with exclusion of the 603 bp intron) (11) or an EcoRI/KpnI restriction fragment of the rTH cDNA insert spanning +1138 to +1520 of rTH cDNA (383 bp) (37) was subcloned into the HindIII or EcoRI/KpnI sites, respectively, of the cloning vector pBluescriptIISK(+) (Stratagene, La Jolla, CA), and used to make 35S-labeled complementary RNA probes. DNA sequence identities between mouse and rat PNMT and tyrosine hydroxylase cDNA in the regions of the probes are 91% and 95%, respectively. Slides were hybridized at 50 C for 16 h in a chamber saturated with 50% deionized formamide and 0.5 M NaCl. Adjacent sections were hybridized for PNMT and tyrosine hydroxylase mRNA analysis. After hybridization, slides were washed, dehydrated, dipped in emulsion (NTB-2; Kodak, Rochester, NY), developed, and counter-stained. Silver grain signals from each probed slide section were visualized under dark-field microscope illumination (Eclipse E800; Nikon, Melville, NY) at 40x magnification, and the images were captured through a CCD camera (RC300; Dage-MTI, Michigan City, IN) using the Scion Image program (version 1.60c). Quantitation of the mean density was performed using the NIH Image program (version 1.60). Three sections from the largest, middle portion of the adrenal gland from each slide for each adrenal were quantified and averaged after the background (adrenal cortex) densities were subtracted for each section.
RT-PCR for adrenal PNMT mRNA
RT-PCR of adrenal PNMT mRNA was performed with total RNA
purified from left adrenal glands using TRI reagent (Molecular Research Center, Inc., Cincinnati, OH). Total RNA (500 ng) was
reverse-transcribed with 2.5 µM oligo
d(T)16 primer (PE Biosystems, Foster
City, CA) and 200 U Moloney murine leukemia virus (M-MuLV) RTase
(Life Technologies, Inc., Grand Island, NY) under the
following conditions. First strand synthesis: annealing, room
temperature, 10 min; RT, 42 C, 15 min; denaturation, 99 C, 5 min. PCR:
first strand cDNA products were amplified using murine PNMT cDNA
(38)-specific primers (5' to 3'): sense GTGAAGCGAGTCCTGCCTATC,
antisense AAGATGCCTTTGACATCATCTACC. These primers span the 3'-end of
the PNMT open reading frame +2491 to +2858, and produce a 368 bp PCR
fragment. PCR conditions used were: annealing, 55 C, 1 min; extension,
72 C, 4 min; denaturation, 95 C, 1 min. After 20 cycles of PCR
amplification, 20 µl of PCR products were separated by
electrophoresis in a 1% agarose gel.
Radioenzymatic assay for adrenal PNMT activity
Left adrenal glands were homogenized in about 1,000 volumes
(final) of 0.1 M Tris-HCl (pH 7.4), centrifuged, and the
supernatants were stored at -80 C until use. Adrenal PNMT activity was
analyzed by a radioenzymatic method (39). Briefly, 50 µl of
supernatant was incubated at 25 C for 2 h with 50 µl of a
solution containing 3H-labeled
S-adenosylmethionine (SAM; Sigma) and norepinephrine (RBI,
Natick, MA). 3H-labeled epinephrine was detected
by scintillation counter after extraction. A PNMT inhibitor, SKF29661,
was added in a parallel incubation to allow for subtraction of any
possible nonspecific N-methyltransferase activity (40).
There was no detectable nonspecific N-methyltransferase
activity in CRH KO adrenal tissues. SKF29661 was kindly provided by Dr.
J. Paul Hieble (SmithKline Beecham, Swedeland, PA).
Hormone analysis
Immunoreactive corticosterone (ICN Biomedicals, Inc., Orangeburg, NY) and ACTH (INCSTAR Corp.,
Stillwater, MN) were measured by commercial RIA kits according to the
manufacturers’ instructions. Adrenal content of corticosterone was
measured using supernatants from homogenized left adrenal glands in
about 100 volumes of 0.1 M Tris-HCl (pH 7.4), and
normalized to adrenal protein concentration. Catecholamine analysis was
performed using HPLC with C-18 reverse phase column in combination with
an electrochemical detector (7).
Protein assay
Total protein concentration of adrenal glands was measured to
normalize adrenal corticosterone content. Protein assay was performed
based on the Bradford dye-binding procedure using commercial reagents
(Bio-Rad Laboratories, Inc., Hercules, CA) with BSA as a
standard. Optical density was measured by spectrophotometry at 595
nm.
Data analysis
Results were analyzed by two-way ANOVA followed by posthoc
comparisons with Fisher’s protected least significant difference
(PLSD) test. When appropriate, the unpaired t test was
performed for the comparison of mean differences between two different
groups. A P value less than 0.05 was considered
statistically significant. All data are presented as the mean ±
SEM.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Although 0 time basal
levels of corticosterone and ACTH were similar in both genotypes, the
increases in plasma corticosterone (Fig. 1A) and ACTH (Fig. 1B) during
restraint in CRH KO mice were significantly blunted compared with those
in WT mice. There were no changes in plasma corticosterone or ACTH in
control (unhandled) mice of either genotype during the 3-h period of
study (Fig. 1A).
|
). While WT mice
showed a significant increase at 40 min compared with the basal level,
the increase in plasma epinephrine during restraint in CRH KO mice was
delayed, not rising above the CRH KO basal level until 110 min. On the
other hand, basal plasma norepinephrine in CRH KO mice was
significantly higher than that in WT mice, and further increased during
restraint, with a peak at 110 min, whereas WT mice exhibited no change
of norepinephrine over time (Fig. 2B). In all cases, epinephrine and
norepinephrine levels in unhandled control groups did not change over
time and did not differ from 0 time levels in either genotype (data not
shown).
|
). We first measured
PNMT mRNA content after a 3-h period of either restraint (restraint
group, Fig. 3A) or no handling (control group, Fig. 3A). Although not
significantly different, PNMT mRNA content in unhandled control CRH KO
adrenal tended to be lower than that in WT control adrenals. Restraint
clearly increased PNMT gene expression in both genotypes, with the
increase in CRH KO mice about 50% that seen in WT mice. We next
measured the time course of gene expressions of PNMT (Fig. 3, B and C)
and tyrosine hydroxylase (Fig. 3, B and E). As in unhandled control
mice, the 0 time basal PNMT mRNA level in CRH KO mice tended to be
lower (although not significantly) than that in WT mice (Fig. 3C). One
and 3 h after the onset of restraint, PNMT gene expression was
significantly lower in CRH KO mice compared with that in WT, though the
degree of induction above basal levels was similar in both genotypes.
The enzyme activity of PNMT in CRH KO mice was about 50% that in WT
mice at all time points during restraint, and was not significantly
induced in either genotype (Fig. 3D). Tyrosine hydroxylase mRNA
increased to the same extent in both genotypes, during the first hour
of restraint, but rose thereafter to a greater degree in WT mice (Fig. 3E).
|
) was accompanied by a marked rise in
adrenal corticosterone content (Fig. 4B). In restrained CRH KO mice,
despite a minimal rise in plasma corticosterone (Fig. 4A), adrenal
corticosterone content tended to increase (Fig. 4B), although to a much
lesser extent than that seen in WT mice.
|
, 5 days of
metyrapone/aminoglutethimide treatment completely abolished the plasma
corticosterone response following 3 h of restraint, with the
plasma corticosterone level in the restrained PxADX group (0.12 ±
0.02 µg/dl) significantly lower than that in unrestrained, intact
controls (0.36 ± 0.01 µg/dl). As expected, plasma ACTH was
elevated in the PxADX/restraint group relative to the control or
vehicle/restraint group (Fig. 5B). In situ hybridization
analysis revealed reduced adrenal PNMT gene expression following
restraint in PxADX group compared with that in vehicle-treated groups
(Fig. 5, C and D). While an increase in PNMT gene expression was again
seen in the vehicle/restraint group relative to the unrestrained,
intact control group, no PNMT mRNA was detected by in situ
hybridization in the PxADX/restraint group. Using RT-PCR, PNMT mRNA was
detected in adrenal glands of PxADX/restraint animals, but at a much
lower level of abundance compared with that in vehicle-treated animals
(Fig. 5E). A PCR-amplified PNMT cDNA
fragment was barely detected at 20 cycles in the PxADX animals, at a
time when a robust signal was present in control and vehicle-treated
animals.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Glucocorticoids have also been suggested to regulate both central and
peripheral catecholaminergic systems. Adrenalectomy potentiates
immobilization-induced norepinephrine secretion in the PVN (47) and
periphery (3). Chronic cortisol treatment attenuates
immobilization-induced (7) and 
2-adrenoceptor
antagonist-induced (48) increases of plasma or hypothalamic
norepinephrine in rats, implying an inhibitory effect of
glucocorticoids on the sympathoneural system. On the other hand,
adrenomedullary PNMT gene expression requires intact adrenocortical
function (9, 41, 49), and glucocorticoids may act through a GRE in the
PNMT gene promoter region (10, 11) in rats, to induce PNMT expression
and activity (12). Taken together, these observations suggest that
glucocorticoids may stimulate peripheral epinephrine secretion.
The results of the present study show a clear attenuation in plasma epinephrine levels in CRH KO mice compared with those in WT mice. Basal and restraint-induced increases in plasma epinephrine were impaired in CRH KO mice, which had significantly lower basal epinephrine levels and delayed increases during restraint. The lower epinephrine production in CRH KO mice suggests that PNMT gene expression and/or enzyme activity is impaired. Supporting this hypothesis, basal and restraint-induced adrenal PNMT mRNA and enzyme activity levels in CRH KO mice were lower than those in WT mice. CRH KO mice also exhibited impaired corticosterone secretion during restraint, consistent with previous reports (29, 50, 51). Our findings are in agreement with other reports (9, 41, 49) showing that hypophysectomy-induced depletion of corticosterone causes blunted adrenal PNMT gene expression and activity in rats. Taken together with data in pharmacologically adrenalectomized mice, our results demonstrate that CRH deficiency leads to impaired PNMT gene expression and enzyme activity levels, and to impaired epinephrine synthesis and secretion in the adrenal medulla, possibly due to impaired adrenocortical corticosterone production.
We observed, however, a discrepancy between PNMT gene expression and enzyme activity, with a 4- to 5-fold induction in PNMT gene expression unaccompanied by any increase in enzyme activity during restraint in either genotype. Perhaps a time longer than 3 h is required for the increase in PNMT mRNA levels to be reflected in increased enzyme activity. Supporting this possibility, previous reports have shown that PNMT activity rises slowly, lagging up to 18 h behind the rise in PNMT mRNA, following either restraint (12) or glucocorticoid treatments (52, 53) in rats. The greater secretion of epinephrine following restraint in WT vs. CRH KO mice probably reflects the higher basal PNMT activity in WT mice. These data suggest that acute modulation of epinephrine action is controlled by regulation of the release of stored hormone, whereas over the longer term, epinephrine stores are regulated by changes in PNMT gene expression, as ultimately reflected in PNMT enzymatic activity.
In contrast to plasma corticosterone, which did not increase over basal levels in CRH KO mice, adrenal corticosterone content in CRH KO mice tended to rise during restraint, albeit to level much below that seen in WT mice. Considering that adrenomedullary cells are exposed to high levels of corticosterone (54), this increase in adrenal corticosterone content in CRH KO mice is likely responsible for the reduced but detectable induction of adrenal PNMT gene expression during restraint in this genotype. PxADX completely abolished corticosterone secretion as well as restraint-induced adrenal PNMT gene expression in WT mice, suggesting that PNMT gene expression absolutely requires stimulation by corticosterone.
We found basal and restraint-induced plasma norepinephrine levels in CRH KO mice to be significantly higher than those in WT mice. However, we did not determine whether these higher plasma norepinephrine levels originated from the sympathetic nerve terminals or the adrenal medulla. Because glucocorticoids are thought to have an inhibitory effect on norepinephrine secretion from the sympathetic nerve terminals (5), and CRH KO mice exhibit blunted glucocorticoid production, some fraction of the elevated plasma norepinephrine may arise from secretion by nerve terminals of the sympathetic nervous system. It is also possible that the adrenal medulla could contribute to the elevation of plasma norepinephrine because the accumulation of adrenal norepinephrine, the substrate for PNMT, might occur due to chronically impaired conversion of norepinephrine to epinephrine in CRH KO mice. Further studies of adrenalectomized WT and CRH KO mice, including the clamping of corticosterone at similar levels in both genotypes, would help to determine the origin of the elevated plasma norepinephrine in CRH KO mice.
Compared with other species (3) or anesthetized mice (55), basal plasma catecholamine levels in our studies may have been elevated due to the handling necessary to obtain blood samples in conscious mice. Because plasma norepinephrine in WT mice did not change during restraint, we cannot rule out the possibility that such an initial elevation might have masked a rise in norepinephrine secretion during restraint in WT mice. However, it is not clear whether plasma catecholamine levels reported in anesthetized mice (55) reflect the true basal levels in conscious mice, since some anesthetics are known to suppress catecholamine secretion (56, 57).
To test a possible direct role of CRH on the sympathetic input to the adrenal medulla, adrenal tyrosine hydroxylase gene expression was measured. In both genotypes, basal and restraint-induced tyrosine hydroxylase mRNA levels were similar, suggesting that sympathetic input to the adrenal medulla might be intact in CRH KO mice. However, we cannot rule out the existence of possible compensatory pathways that regulate adrenal tyrosine hydroxylase expression in CRH deficiency. Moreover, in some studies (12, 58), denervation of adrenal gland does not affect the induction of tyrosine hydroxylase activity by stressors, in contrast to other reports (13, 14, 15, 16, 17), which show a requirement of intact sympathetic input. Future studies should use adrenal denervation in CRH KO mice to further address this issue.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Present address: Division of Genetics, Brigham and Women’s
Hospital, Harvard Medical School, 20 Shattuck Street, Boston,
Massachusetts 02115.
Received October 12, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-amidating monooxygenase, and neuropeptide Y mRNA in the rat adrenal
medulla after acute systemic nicotine. J Mol Neurosci 8:45–52[Medline]
-hydroxylase
cytochrome P450 in the mouse embryo. Endocrinology 136:4872–4879[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  H. Cheng, L. Zhou, W. Zhu, A. Wang, C. Tang, O. Chan, R. S. Sherwin, and R. J. McCrimmon Type 1 corticotropin-releasing factor receptors in the ventromedial hypothalamus promote hypoglycemia-induced hormonal counterregulation Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E705 - E712. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Jacobson, T. Ansari, J. Potts, and O. P. McGuinness Glucocorticoid-deficient corticotropin-releasing hormone knockout mice maintain glucose requirements but not autonomic responses during repeated hypoglycemia Am J Physiol Endocrinol Metab, July 1, 2006; 291(1): E15 - E22. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Itoh, S. Yamada, T. Mori, T. Miwa, K. Tottori, Y. Uwahodo, Y. Yamamura, M. Fukuda, K. Yamamoto, A. Tanoue, et al. Attenuated stress-induced catecholamine release in mice lacking the vasopressin V1b receptor Am J Physiol Endocrinol Metab, July 1, 2006; 291(1): E147 - E151. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-H. Jeong, S. Sakihara, E. P. Widmaier, and J. A. Majzoub Impaired Leptin Expression and Abnormal Response to Fasting in Corticotropin-Releasing Hormone-Deficient Mice Endocrinology, July 1, 2004; 145(7): 3174 - 3181. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. KVETNANSKY, L. MICUTKOVA, L. KUBOVCAKOVA, E. L. SABBAN, M. PALKOVITS, and O. KRIZANOVA Localization and Regulation of Phenylethanolamine N-Methyltransferase Gene Expression in the Heart of Rats and Mice during Stress Ann. N.Y. Acad. Sci., June 1, 2004; 1018(1): 405 - 417. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z.'e. Hochberg, K. Pacak, and G. P. Chrousos Endocrine Withdrawal Syndromes Endocr. Rev., August 1, 2003; 24(4): 523 - 538. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. A. Tjurmina, I. Armando, J. M. Saavedra, D. S. Goldstein, and D. L. Murphy Exaggerated Adrenomedullary Response to Immobilization in Mice with Targeted Disruption of the Serotonin Transporter Gene Endocrinology, December 1, 2002; 143(12): 4520 - 4526. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. Bland, C. A. M. Jamieson, S. F. Akana, S. R. Bornstein, G. Eisenhofer, M. F. Dallman, and H. A. Ingraham Haploinsufficiency of steroidogenic factor-1 in mice disrupts adrenal development leading to an impaired stress response PNAS, December 19, 2000; 97(26): 14488 - 14493. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
