help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jeong, K.-H.
Right arrow Articles by Majzoub, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jeong, K.-H.
Right arrow Articles by Majzoub, J. A.
Endocrinology Vol. 141, No. 3 1142-1150
Copyright © 2000 by The Endocrine Society


ARTICLES

Impaired Basal and Restraint-Induced Epinephrine Secretion in Corticotropin-Releasing Hormone- Deficient Mice1

Kyeong-Hoon Jeong2, Lauren Jacobson, Karel Pacák, Eric P. Widmaier, David S. Goldstein and Joseph A. Majzoub

Division of Endocrinology (K.-H.J., L.J., J.A.M.), Children’s Hospital, Harvard Medical School, Boston, Massachusetts 02115; Clinical Neuroscience Branch, NINDS (K.P., D.S.G.) and Developmental Endocrinology Branch, NICHD (K.P.), NIH, Bethesda, Maryland 20892; and Department of Biology (E.P.W.), Boston University, Boston, Massachusetts 02215

Address all correspondence and requests for reprints to: Joseph A. Majzoub, Division of Endocrinology, Children’s Hospital, Harvard Medical School, 300 Longwood Avenue, Boston, Massachusetts 02115. E-mail: majzoub{at}a1.tch.harvard.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CRH is thought to play a role in responses of the adrenocortical and adrenomedullary systems during stress. To investigate the role of CRH in stress-induced secretions of corticosterone and epinephrine, we subjected wild-type (WT) and CRH-deficient (knockout, KO) mice to restraint, and analyzed plasma corticosterone, plasma catecholamines, and adrenal phenylethanolamine N-methyltransferase (PNMT) gene expression and activity before and during 3 h of restraint. Plasma corticosterone increased over 40-fold in WT mice, but minimally in CRH KO mice. Adrenal corticosterone content tended to increase in CRH KO mice, although to levels 5-fold lower than that in WT mice. CRH KO mice had significantly lower plasma epinephrine and higher norepinephrine than WT mice at baseline, and delayed epinephrine secretion during restraint. Adrenal PNMT messenger RNA content in CRH KO mice tended to be lower than that in WT mice, though the degree of induction was similar in both genotypes. PNMT enzyme activity was significantly lower in CRH KO mice. Pharmacological adrenalectomy abolished restraint-induced corticosterone secretion and PNMT gene expression in WT mice, consistent with an absolute requirement of glucocorticoids for PNMT gene expression. We conclude that glucocorticoid insufficiency in CRH KO mice leads to decreased basal and restraint-induced plasma epinephrine and adrenal PNMT gene expression and enzyme activity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MANY STRESSORS, such as insulin-induced hypoglycemia (1, 2) and immobilization (3, 4, 5), increase the secretion of catecholamines, including epinephrine and norepinephrine, from the adrenal medulla and sympathetic nerve terminals. Such stressors also potentiate the secretion of the hypothalamic-pituitary-adrenocortical (HPA) axis hormones, ACTH from the anterior pituitary and glucocorticoids such as cortisol (in humans) or corticosterone (in rodents) from the adrenal cortex (6, 7) via stimulation by the hypothalamic neuropeptide, CRH (8).

In chromaffin cells of the adrenal medulla, stressor-induced gene expression of phenylethanolamine N-methyltransferase (PNMT), which converts norepinephrine to epinephrine, requires normal HPA axis activity, but not intact sympathetic input in rats (9), implying a role for glucocorticoids in PNMT gene expression and action. Consistent with this are reports of the existence of a glucocorticoid responsive cis-element (GRE) in the 5'-promoter region of the rat PNMT gene (10, 11) and of a delay in the rise in stressor-induced PNMT activity after suppression of endogenous corticosterone synthesis (12). By contrast, the expression of the adrenomedullary tyrosine hydroxylase, the rate-limiting enzyme that catalyzes the first step of catecholamine biosynthesis, is primarily controlled by cholinergic sympathetic input from splanchnic nerves (13, 14, 15, 16, 17). Tyrosine hydroxylase activity and gene expression are also increased following stressors such as insulin-induced hypoglycemia (18) and immobilization (19, 20) in rats.

The hypothalamic CRH system and the sympathetic nervous system are postulated to be functionally related to each other, and to regulate reciprocally each others’ functions within the central nervous system (21). For example, CRH-containing hypothalamic paraventricular nuclei (PVN) parvocellular neurons are anatomically and functionally connected to locus coeruleus A6 catecholaminergic neurons in the brain stem in rats (22, 23). Central CRH administration increases neuronal discharge in the locus coeruleus in a dose-dependent manner (24) as well as hypothalamic norepinephrine secretion (25). Immobilization (4) or central injection of CRH (26) also increases tyrosine hydroxylase gene expression in the locus coeruleus, whereas central administration of CRH antagonist blocks stressor-induced tyrosine hydroxylase production (26). Moreover, chronic antidepressant treatment reduces tyrosine hydroxylase messenger RNA (mRNA) level in the locus coeruleus as well as CRH mRNA in the PVN in rats (27), suggesting a possible stimulatory action of CRH on central catecholaminergic neurons. A retrograde tracer study using a transneuronal labeling method suggests possible connections between the sympatho-adrenomedullary catecholaminergic system and PVN neurons, including oxytocin secreting cells (28), and possibly CRH or arginine vasopressin expressing neurons, through the spinal cord and splanchnic nerves. It is therefore possible that CRH contributes to the regulation of the adrenomedullary catecholaminergic system under stressful conditions through both the HPA axis and the sympathetic nervous system.

To determine the physiological significance and relative contributions of CRH and glucocorticoids to the regulation of the adrenomedullary catecholaminergic system, we compared basal and restraint-induced changes of plasma corticosterone and catecholamines, adrenal PNMT and tyrosine hydroxylase mRNAs, and PNMT activity in CRH-deficient (knockout, KO) (29) with wild-type (WT) mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animal husbandry
Male WT and CRH KO littermates were bred in a mixed C57B6/129 background and maintained on a 12-h light, 12-h dark or 14-h light, 10-h dark cycle with lights-on at 0700 h. For the pharmacological adrenalectomy (PxADX) experiment, C57B6 WT male mice were purchased from Charles River Laboratories, Inc. (Wilmington, MA). All mice were given ad libitum access to food and drinking water, and singly housed for 3–5 days before experimentation.

Individual housing of adult mice allowed us to remove individual animals for experimentation without disturbing other mice. All studies were performed in a quiet room under conditions made as constant as possible from day to day to avoid variation in the environment which might have affected the adrenocortical and adrenomedullary systems. All experiments were begun at 0700 h, when corticosterone levels are at their nadir. Adult WT and CRH KO male mice were subjected to restraint in ventilated 50 ml tubes for up to 3 h starting immediately after lights-on. Tubes were designed to be small enough to restrain a mouse so that it was able to breathe but unable to move freely. Control mice that were left unhandled for up to 3 h were unstressed as judged by their low, basal plasma corticosterone levels. Many previous studies have used immobilization rather than restraint for catecholaminergic activation (3, 4, 5). However, we have found that restraint, although a more mild stimulus than immobilization, results in marked activation of the HPA and catecholaminergic axes (29, and results contained herein), and was judged to be a more humane stimulus than immobilization by the Children’s Hospital Animal Care and Use Committee, which approved all animal experiments.

Pharmacological adrenalectomy
PxADX was performed using a modification of previously reported methods (30, 31). Adult (2–3 months old) WT male mice were injected ip with 200 mg/kg of 2-methyl-1,2-di-3-pyridyl-1-propanone (metyrapone; Sigma, St. Louis, MO), dissolved in 10% dimethylsulfoxide-saline (vehicle), twice daily for 5 days (PxADX group). Control (no restraint) and vehicle group mice were injected with identical volumes of vehicle only. A 100 mg/kg injection of aminoglutethimide (Sigma) was combined with metyrapone in the last two injections of the experimental PxADX group. Once injections were begun, all mice were allowed to drink a 5% dextrose solution in 0.9% saline, in addition to regular drinking water and food. Vehicle and PxADX group mice were subjected to restraint on the morning of day 6 of drug treatment.

Sample collection
Blood sampling for plasma hormone (corticosterone, ACTH, and catecholamines) measurements was performed without anesthesia by retro-orbital sinus phlebotomy using heparinized capillary tubes. Only one blood sample was collected from each mouse. In some cases, phlebotomy was immediately followed by decapitation to collect adrenal glands for PNMT and tyrosine hydroxylase mRNA analysis, PNMT activity, or corticosterone content measurements. The time from touching a cage to phlebotomy or decapitation was less than 1 min. Collected blood samples were kept on ice until plasma separation. Plasma was separated from cells by centrifugation at 4 C, and stored at -80 C in aliquots until assayed. Left adrenal glands were immediately frozen in liquid N2 and stored at -80 C until homogenization. Right adrenal glands were immediately embedded in OCT compound (Sakura Finetek, Torrance, CA), rapidly frozen in liquid N2, and stored at -80 C until cryostat sectioning. For the control groups, animals were killed concurrently without prior restraint.

In situ hybridization
PNMT and tyrosine hydroxylase mRNA levels in the adrenal medulla were measured using in situ hybridization. Other methods, such as Northern blot analysis or RNase protection assay performed on total adrenal RNA, could not be used due to the marked difference in the sizes of the adrenal cortices in CRH KO mice compared with WT mice (29). This size variation is due entirely to differences in the mass of the adrenal cortex, and not adrenal medulla (29). Because PNMT and tyrosine hydroxylase mRNAs are expressed exclusively in the latter location, analysis of equal amounts of RNA from WT and CRH KO adrenals by Northern blot or RNase protection would necessarily result in a higher percentage of medullary RNA from CRH KO mice than from WT mice being compared. Realizing this, we tried to normalize the relative amounts of WT and CRH KO medullary RNA being compared with the use of a medulla-specific mRNA encoding synaptophysin, a chromaffin granule-specific protein (32), but the level of synaptophysin mRNA was altered following restraint (data not shown). For these reasons, we used in situ hybridization to measure relative levels of PNMT and tyrosine hydroxylase mRNAs in WT and CRH KO mice in our studies.

The in situ hybridization procedure was based on previously reported methods (33, 34, 35), as modified by us (36). Right adrenal glands were serial-sectioned at a thickness of 10 µm with a cryostat (Jung 2045C; Leica Corp., Deerfield, IL), postfixed with 4% paraformaldehyde in PBS at 4 C for 10 min, and subjected to sequential prehybridization treatment (33). Sectioned tissues on slides were stored at -20 C with desiccant until in situ hybridization. Rat PNMT (rPNMT) and tyrosine hydroxylase (rTH) complementary DNA (cDNA) plasmids were kindly provided by Drs. Marian Evinger (SUNY, Stony Brook, NY) and Tong Joh (Cornell Medical College, White Plains, NY). A HindIII restriction fragment of the rPNMT cDNA insert spanning +193 to +1200 of rPNMT gene (405 bp length, with exclusion of the 603 bp intron) (11) or an EcoRI/KpnI restriction fragment of the rTH cDNA insert spanning +1138 to +1520 of rTH cDNA (383 bp) (37) was subcloned into the HindIII or EcoRI/KpnI sites, respectively, of the cloning vector pBluescriptIISK(+) (Stratagene, La Jolla, CA), and used to make 35S-labeled complementary RNA probes. DNA sequence identities between mouse and rat PNMT and tyrosine hydroxylase cDNA in the regions of the probes are 91% and 95%, respectively. Slides were hybridized at 50 C for 16 h in a chamber saturated with 50% deionized formamide and 0.5 M NaCl. Adjacent sections were hybridized for PNMT and tyrosine hydroxylase mRNA analysis. After hybridization, slides were washed, dehydrated, dipped in emulsion (NTB-2; Kodak, Rochester, NY), developed, and counter-stained. Silver grain signals from each probed slide section were visualized under dark-field microscope illumination (Eclipse E800; Nikon, Melville, NY) at 40x magnification, and the images were captured through a CCD camera (RC300; Dage-MTI, Michigan City, IN) using the Scion Image program (version 1.60c). Quantitation of the mean density was performed using the NIH Image program (version 1.60). Three sections from the largest, middle portion of the adrenal gland from each slide for each adrenal were quantified and averaged after the background (adrenal cortex) densities were subtracted for each section.

RT-PCR for adrenal PNMT mRNA
RT-PCR of adrenal PNMT mRNA was performed with total RNA purified from left adrenal glands using TRI reagent (Molecular Research Center, Inc., Cincinnati, OH). Total RNA (500 ng) was reverse-transcribed with 2.5 µM oligo d(T)16 primer (PE Biosystems, Foster City, CA) and 200 U Moloney murine leukemia virus (M-MuLV) RTase (Life Technologies, Inc., Grand Island, NY) under the following conditions. First strand synthesis: annealing, room temperature, 10 min; RT, 42 C, 15 min; denaturation, 99 C, 5 min. PCR: first strand cDNA products were amplified using murine PNMT cDNA (38)-specific primers (5' to 3'): sense GTGAAGCGAGTCCTGCCTATC, antisense AAGATGCCTTTGACATCATCTACC. These primers span the 3'-end of the PNMT open reading frame +2491 to +2858, and produce a 368 bp PCR fragment. PCR conditions used were: annealing, 55 C, 1 min; extension, 72 C, 4 min; denaturation, 95 C, 1 min. After 20 cycles of PCR amplification, 20 µl of PCR products were separated by electrophoresis in a 1% agarose gel.

Radioenzymatic assay for adrenal PNMT activity
Left adrenal glands were homogenized in about 1,000 volumes (final) of 0.1 M Tris-HCl (pH 7.4), centrifuged, and the supernatants were stored at -80 C until use. Adrenal PNMT activity was analyzed by a radioenzymatic method (39). Briefly, 50 µl of supernatant was incubated at 25 C for 2 h with 50 µl of a solution containing 3H-labeled S-adenosylmethionine (SAM; Sigma) and norepinephrine (RBI, Natick, MA). 3H-labeled epinephrine was detected by scintillation counter after extraction. A PNMT inhibitor, SKF29661, was added in a parallel incubation to allow for subtraction of any possible nonspecific N-methyltransferase activity (40). There was no detectable nonspecific N-methyltransferase activity in CRH KO adrenal tissues. SKF29661 was kindly provided by Dr. J. Paul Hieble (SmithKline Beecham, Swedeland, PA).

Hormone analysis
Immunoreactive corticosterone (ICN Biomedicals, Inc., Orangeburg, NY) and ACTH (INCSTAR Corp., Stillwater, MN) were measured by commercial RIA kits according to the manufacturers’ instructions. Adrenal content of corticosterone was measured using supernatants from homogenized left adrenal glands in about 100 volumes of 0.1 M Tris-HCl (pH 7.4), and normalized to adrenal protein concentration. Catecholamine analysis was performed using HPLC with C-18 reverse phase column in combination with an electrochemical detector (7).

Protein assay
Total protein concentration of adrenal glands was measured to normalize adrenal corticosterone content. Protein assay was performed based on the Bradford dye-binding procedure using commercial reagents (Bio-Rad Laboratories, Inc., Hercules, CA) with BSA as a standard. Optical density was measured by spectrophotometry at 595 nm.

Data analysis
Results were analyzed by two-way ANOVA followed by posthoc comparisons with Fisher’s protected least significant difference (PLSD) test. When appropriate, the unpaired t test was performed for the comparison of mean differences between two different groups. A P value less than 0.05 was considered statistically significant. All data are presented as the mean ± SEM.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effect of restraint on plasma corticosterone and catecholamines in CRH KO mice
Plasma corticosterone and ACTH rose markedly in WT mice following restraint (Fig. 1Go). Although 0 time basal levels of corticosterone and ACTH were similar in both genotypes, the increases in plasma corticosterone (Fig. 1AGo) and ACTH (Fig. 1BGo) during restraint in CRH KO mice were significantly blunted compared with those in WT mice. There were no changes in plasma corticosterone or ACTH in control (unhandled) mice of either genotype during the 3-h period of study (Fig. 1AGo).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. Changes in plasma corticosterone and ACTH during restraint. WT and CRH KO mice were subjected to restraint for up to 3 h starting immediately after lights-on in the morning. Plasma was analyzed by RIA for (A) corticosterone and (B) ACTH. n = 4–15/group. Results were analyzed by two-way ANOVA followed by posthoc comparisons with Fisher’s PLSD test. *, Significant difference vs. WT 0 time; #, significant difference vs. CRH KO 0 time; **, significant difference between genotypes at same time point; B, corticosterone; Control, unhandled time control.

 
Basal plasma epinephrine in CRH KO mice was significantly lower than that in WT mice (Fig. 2AGo). While WT mice showed a significant increase at 40 min compared with the basal level, the increase in plasma epinephrine during restraint in CRH KO mice was delayed, not rising above the CRH KO basal level until 110 min. On the other hand, basal plasma norepinephrine in CRH KO mice was significantly higher than that in WT mice, and further increased during restraint, with a peak at 110 min, whereas WT mice exhibited no change of norepinephrine over time (Fig. 2BGo). In all cases, epinephrine and norepinephrine levels in unhandled control groups did not change over time and did not differ from 0 time levels in either genotype (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 2. Changes in plasma epinephrine and norepinephrine during restraint. WT and CRH KO mice were subjected to restraint as in Fig. 1Go. Plasma was analyzed by HPLC for (A) epinephrine and (B) norepinephrine. n = 4–15/group. Results were analyzed by two-way ANOVA followed by posthoc comparisons with Fisher’s PLSD test. *, Significant difference vs. WT 0 time; #, significant difference vs. CRH KO 0 time; **, Significant difference between genotypes at same time point; EPI, epinephrine; NE, norepinephrine.

 
Changes in adrenal PNMT mRNA, enzyme activity, and corticosterone content during restraint in CRH KO mice
To test the hypothesis that the reduced epinephrine secretion in CRH KO mice during restraint is due to a blunted increase in adrenal PNMT gene expression and/or enzyme activity, changes in adrenal PNMT mRNA and enzyme activity during restraint were analyzed (Fig. 3Go). We first measured PNMT mRNA content after a 3-h period of either restraint (restraint group, Fig. 3AGo) or no handling (control group, Fig. 3AGo). Although not significantly different, PNMT mRNA content in unhandled control CRH KO adrenal tended to be lower than that in WT control adrenals. Restraint clearly increased PNMT gene expression in both genotypes, with the increase in CRH KO mice about 50% that seen in WT mice. We next measured the time course of gene expressions of PNMT (Fig. 3Go, B and C) and tyrosine hydroxylase (Fig. 3Go, B and E). As in unhandled control mice, the 0 time basal PNMT mRNA level in CRH KO mice tended to be lower (although not significantly) than that in WT mice (Fig. 3CGo). One and 3 h after the onset of restraint, PNMT gene expression was significantly lower in CRH KO mice compared with that in WT, though the degree of induction above basal levels was similar in both genotypes. The enzyme activity of PNMT in CRH KO mice was about 50% that in WT mice at all time points during restraint, and was not significantly induced in either genotype (Fig. 3DGo). Tyrosine hydroxylase mRNA increased to the same extent in both genotypes, during the first hour of restraint, but rose thereafter to a greater degree in WT mice (Fig. 3EGo).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 3. Changes in adrenal PNMT and tyrosine hydroxylase mRNAs, and PNMT activity during restraint. WT and CRH KO mice were subjected to restraint as in Fig. 1Go. Right adrenal glands were sectioned for in situ hybridization, and left adrenals were homogenized for PNMT activity. A, PNMT mRNA was quantitated in WT and CRH KO mice after 3 h of restraint (restraint group) or no handling (control group). B, Representative in situ hybridization data of time course (0, 1, 2, and 3 h) of changes in PNMT and tyrosine hydroxylase mRNAs during restraint. Pictures were taken under bright-field illumination, and positive signal is denoted by black grains in the region of the adrenal medulla. Bar, 1 mm. C, Quantitation of PNMT mRNA content by in situ hybridization. Data from (B) were quantified as mean densities using the NIH Image program. D, PNMT activity was determined using a radioenzymatic assay. E, Quantitation of tyrosine hydroxylase mRNA content by in situ hybridization. Data from (B) were quantified as mean densities. n = 4–5/group. For (A), (C), (D), and (E), results were analyzed by two-way ANOVA followed by posthoc comparisons with Fisher’s PLSD test. *, Significant difference vs. WT 0 time or WT control; #, significant difference vs. CRH KO 0 time or CRH KO control; **, significant difference between genotypes at same time point or treatment; TH, tyrosine hydroxylase; Control, unhandled time control.

 
Because glucocorticoids are thought to induce PNMT (9, 41), we tested whether an increase in adrenal corticosterone content accompanied the increase in PNMT gene expression following restraint in CRH KO mice. In restrained WT mice, the rise in plasma corticosterone (Fig. 4AGo) was accompanied by a marked rise in adrenal corticosterone content (Fig. 4BGo). In restrained CRH KO mice, despite a minimal rise in plasma corticosterone (Fig. 4AGo), adrenal corticosterone content tended to increase (Fig. 4BGo), although to a much lesser extent than that seen in WT mice.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 4. Changes in plasma and adrenal corticosterone during restraint. WT and CRH KO mice were subjected to restraint as in Fig. 1Go. Plasma and left adrenal glands were analyzed by RIA for (A) plasma and (B) adrenal corticosterone. n = 4–6/group. Results were analyzed by two-way ANOVA followed by posthoc comparisons with Fisher’s PLSD test. *, Significant difference vs. WT 0 time; **, significant difference between genotypes at same time point; B, corticosterone.

 
Effect of PxADX on restraint-induced plasma corticosterone and adrenal PNMT mRNA levels in WT mice
To further explore the hypothesis that corticosterone is a necessary factor for basal and restraint-induced adrenal PNMT gene expression, PxADX was performed in WT mice. As shown in Fig. 5AGo, 5Go days of metyrapone/aminoglutethimide treatment completely abolished the plasma corticosterone response following 3 h of restraint, with the plasma corticosterone level in the restrained PxADX group (0.12 ± 0.02 µg/dl) significantly lower than that in unrestrained, intact controls (0.36 ± 0.01 µg/dl). As expected, plasma ACTH was elevated in the PxADX/restraint group relative to the control or vehicle/restraint group (Fig. 5BGo). In situ hybridization analysis revealed reduced adrenal PNMT gene expression following restraint in PxADX group compared with that in vehicle-treated groups (Fig. 5Go, C and D). While an increase in PNMT gene expression was again seen in the vehicle/restraint group relative to the unrestrained, intact control group, no PNMT mRNA was detected by in situ hybridization in the PxADX/restraint group. Using RT-PCR, PNMT mRNA was detected in adrenal glands of PxADX/restraint animals, but at a much lower level of abundance compared with that in vehicle-treated animals (Fig. 5EGo). A PCR-amplified PNMT cDNA fragment was barely detected at 20 cycles in the PxADX animals, at a time when a robust signal was present in control and vehicle-treated animals.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 5. Effect of PxADX on restraint-induced plasma corticosterone, ACTH, and PNMT mRNA in WT male mice. WT mice were subjected to restraint for 3 h starting immediately after lights-on in the morning with 5 days of prior PxADX or vehicle treatment. Plasma was collected after restraint, and analyzed by RIA for (A) corticosterone and (B) ACTH. Right adrenal glands were sectioned for in situ hybridization, and left adrenals were homogenized for RT-PCR. (C), PNMT mRNA was detected by in situ hybridization. Bar, 1 mm. (D), Data from (C) were quantified as mean densities. n = 3–4/group. For (A), (B), and (D), results were analyzed by unpaired t tests. *, Significant difference vs. control; **, significant difference between vehicle and PxADX; B, corticosterone; Control, unrestrained mice with 5 days of prior vehicle treatment. (E), RT-PCR for PNMT gene expression was performed with total RNA purified from left adrenal glands. Three or 4 RNA samples from different adrenals in each group were subjected to RT-PCR. M, DNA size marker (100 bp DNA Ladder; New England Biolabs, Inc., Beverly, MA); *, no DNA template; arrowheads, PNMT RT-PCR product (368 bp).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CRH is thought to be important for the function of the adrenomedullary catecholaminergic system, both via actions within the brain as well as by activation of the HPA axis. Hypophysectomy prevents the immobilization-induced increase in adrenal PNMT gene expression (9, 41), and central CRH antagonist administration blocks the increase in plasma epinephrine induced by central CRH injection in rats (1), suggesting a specific role for CRH in adrenal epinephrine synthesis and secretion. In addition, CRH mRNA (42) and peptide (43, 44) are found in the adrenal medulla. This local synthesis of CRH in the adrenal medulla can contribute to adrenal catecholamine regulation in vitro (45), although this effect has not been clearly shown in vivo (46).

Glucocorticoids have also been suggested to regulate both central and peripheral catecholaminergic systems. Adrenalectomy potentiates immobilization-induced norepinephrine secretion in the PVN (47) and periphery (3). Chronic cortisol treatment attenuates immobilization-induced (7) and {alpha}2-adrenoceptor antagonist-induced (48) increases of plasma or hypothalamic norepinephrine in rats, implying an inhibitory effect of glucocorticoids on the sympathoneural system. On the other hand, adrenomedullary PNMT gene expression requires intact adrenocortical function (9, 41, 49), and glucocorticoids may act through a GRE in the PNMT gene promoter region (10, 11) in rats, to induce PNMT expression and activity (12). Taken together, these observations suggest that glucocorticoids may stimulate peripheral epinephrine secretion.

The results of the present study show a clear attenuation in plasma epinephrine levels in CRH KO mice compared with those in WT mice. Basal and restraint-induced increases in plasma epinephrine were impaired in CRH KO mice, which had significantly lower basal epinephrine levels and delayed increases during restraint. The lower epinephrine production in CRH KO mice suggests that PNMT gene expression and/or enzyme activity is impaired. Supporting this hypothesis, basal and restraint-induced adrenal PNMT mRNA and enzyme activity levels in CRH KO mice were lower than those in WT mice. CRH KO mice also exhibited impaired corticosterone secretion during restraint, consistent with previous reports (29, 50, 51). Our findings are in agreement with other reports (9, 41, 49) showing that hypophysectomy-induced depletion of corticosterone causes blunted adrenal PNMT gene expression and activity in rats. Taken together with data in pharmacologically adrenalectomized mice, our results demonstrate that CRH deficiency leads to impaired PNMT gene expression and enzyme activity levels, and to impaired epinephrine synthesis and secretion in the adrenal medulla, possibly due to impaired adrenocortical corticosterone production.

We observed, however, a discrepancy between PNMT gene expression and enzyme activity, with a 4- to 5-fold induction in PNMT gene expression unaccompanied by any increase in enzyme activity during restraint in either genotype. Perhaps a time longer than 3 h is required for the increase in PNMT mRNA levels to be reflected in increased enzyme activity. Supporting this possibility, previous reports have shown that PNMT activity rises slowly, lagging up to 18 h behind the rise in PNMT mRNA, following either restraint (12) or glucocorticoid treatments (52, 53) in rats. The greater secretion of epinephrine following restraint in WT vs. CRH KO mice probably reflects the higher basal PNMT activity in WT mice. These data suggest that acute modulation of epinephrine action is controlled by regulation of the release of stored hormone, whereas over the longer term, epinephrine stores are regulated by changes in PNMT gene expression, as ultimately reflected in PNMT enzymatic activity.

In contrast to plasma corticosterone, which did not increase over basal levels in CRH KO mice, adrenal corticosterone content in CRH KO mice tended to rise during restraint, albeit to level much below that seen in WT mice. Considering that adrenomedullary cells are exposed to high levels of corticosterone (54), this increase in adrenal corticosterone content in CRH KO mice is likely responsible for the reduced but detectable induction of adrenal PNMT gene expression during restraint in this genotype. PxADX completely abolished corticosterone secretion as well as restraint-induced adrenal PNMT gene expression in WT mice, suggesting that PNMT gene expression absolutely requires stimulation by corticosterone.

We found basal and restraint-induced plasma norepinephrine levels in CRH KO mice to be significantly higher than those in WT mice. However, we did not determine whether these higher plasma norepinephrine levels originated from the sympathetic nerve terminals or the adrenal medulla. Because glucocorticoids are thought to have an inhibitory effect on norepinephrine secretion from the sympathetic nerve terminals (5), and CRH KO mice exhibit blunted glucocorticoid production, some fraction of the elevated plasma norepinephrine may arise from secretion by nerve terminals of the sympathetic nervous system. It is also possible that the adrenal medulla could contribute to the elevation of plasma norepinephrine because the accumulation of adrenal norepinephrine, the substrate for PNMT, might occur due to chronically impaired conversion of norepinephrine to epinephrine in CRH KO mice. Further studies of adrenalectomized WT and CRH KO mice, including the clamping of corticosterone at similar levels in both genotypes, would help to determine the origin of the elevated plasma norepinephrine in CRH KO mice.

Compared with other species (3) or anesthetized mice (55), basal plasma catecholamine levels in our studies may have been elevated due to the handling necessary to obtain blood samples in conscious mice. Because plasma norepinephrine in WT mice did not change during restraint, we cannot rule out the possibility that such an initial elevation might have masked a rise in norepinephrine secretion during restraint in WT mice. However, it is not clear whether plasma catecholamine levels reported in anesthetized mice (55) reflect the true basal levels in conscious mice, since some anesthetics are known to suppress catecholamine secretion (56, 57).

To test a possible direct role of CRH on the sympathetic input to the adrenal medulla, adrenal tyrosine hydroxylase gene expression was measured. In both genotypes, basal and restraint-induced tyrosine hydroxylase mRNA levels were similar, suggesting that sympathetic input to the adrenal medulla might be intact in CRH KO mice. However, we cannot rule out the existence of possible compensatory pathways that regulate adrenal tyrosine hydroxylase expression in CRH deficiency. Moreover, in some studies (12, 58), denervation of adrenal gland does not affect the induction of tyrosine hydroxylase activity by stressors, in contrast to other reports (13, 14, 15, 16, 17), which show a requirement of intact sympathetic input. Future studies should use adrenal denervation in CRH KO mice to further address this issue.


    Acknowledgments
 
We thank Louis J. Muglia for generation of CRH-deficient mice and helpful discussions, Marian Evinger and Tong Joh for rat PNMT and tyrosine hydroxylase cDNA plasmids, J. Paul Hieble for the PNMT inhibitor, Brian Kennedy for the PNMT activity protocol, and Alan Watts for helpful discussions regarding in situ hybridization procedures.


    Footnotes
 
1 This study was supported in part by NIH Grants RO1-DK-50511 (to J.A.M.), DK-49333, and National Association for Research on Schizophrenia and Depression (to L.J.), and NSF Grant IBN-9513926 (to E.P.W.). Back

2 Present address: Division of Genetics, Brigham and Women’s Hospital, Harvard Medical School, 20 Shattuck Street, Boston, Massachusetts 02115. Back

Received October 12, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Goldstein DS, Garty M, Bagdy G, Szemeredi K, Sternberg EM, Listwak S, Pacák K, Deka-Starosta A, Hoffman A, Chang PC, Stull R, Gold PW, Kopin IJ 1993 Role of CRH in glucopenia-induced adrenomedullary activation in rats. J Neuroendocrinol 5:475–486[CrossRef][Medline]
  2. Lamarche L, Yamaguchi N, Péronnet F 1995 Hepatic denervation reduces adrenal catecholamine secretion during insulin-induced hypoglycemia. Am J Physiol 268:R50–R57
  3. Kvetñansky R, Fukuhara K, Pacák K, Cizza G, Goldstein DS, Kopin IJ 1993 Endogenous glucocorticoids restrain catecholamine synthesis and release at rest and during immobilization stress in rats. Endocrinology 133:1411–1419[Abstract]
  4. Cizza G, Pacák K, Kvetñansky R, Palkovits M, Goldstein DS, Brady LS, Fukuhara K, Bergamini E, Kopin IJ, Blackman MR, Chrousos GP, Gold PW 1995 Decreased stress responsivity of central and peripheral catecholaminergic systems in aged 344/N Fischer rats. J Clin Invest 95:1217–1224
  5. Pacák K, McCarty R, Palkovits M, Cizza G, Kopin IJ, Goldstein DS, Chrousos GP 1995 Decreased central and peripheral catecholaminergic activation in obese Zucker rats. Endocrinology 136:4360–4367[Abstract]
  6. Dallman MF, Akana SF, Cascio CS, Darlington DN, Jacobson L, Levin N 1987 Regulation of ACTH secretion: variations on a theme of B. Recent Prog Horm Res 43:113–173
  7. Pacák K, Palkovits M, Kvetñansky R, Matern P, Hart C, Kopin IJ, Goldstein DS 1995 Catecholaminergic inhibition by hypercortisolemia in the paraventricular nucleus of conscious rats. Endocrinology 136:4814–4819[Abstract]
  8. Vale W, Rivier C, Brown MR, Spiess J, Koob G, Swanson L, Bilezikjian L, Bloom F, Rivier J 1983 Chemical and biological characterization of corticotropin releasing factor. Recent Prog Horm Res 39:245–270
  9. Viskupic E, Kvetñansky R, Sabban EL, Fukuhara K, Weise VK, Kopin IJ, Schwartz JP 1994 Increase in rat adrenal phenylethanolamine N-methyltransferase mRNA level caused by immobilization stress depends on intact pituitary-adrenocortical axis. J Neurochem 63:808–814[Medline]
  10. Ebert SN, Balt SL, Hunter JPB, Gashler A, Sukhatme V, Wong DL 1994 Egr-1 activation of rat adrenal phenylethanolamine N-methyltransferase gene. J Biol Chem 269:20885–20898[Abstract/Free Full Text]
  11. Suh Y-H, Chun Y-S, Lee IS, Kim S-S, Choi W, Chong YH, Hong L, Kim S-H, Park C-W, Kim C-G 1994 Complete nucleotide sequence and tissue-specific expression of the rat phenylethanolamine N-methyltransferase gene. J Neurochem 63:1603–1608[Medline]
  12. Betito K, Mitchell JB, Bhatnagar S, Boksa P, Meaney MJ 1994 Regulation of the adrenomedullary catecholaminergic system after mild, acute stress. Am J Physiol 267:R212–R220
  13. Nagatsu T 1991 Genes for human catecholamine-synthesizing enzymes. Neurosci Res 12:315–345[CrossRef][Medline]
  14. Kilbourne EJ, Nankova BB, Lewis EJ, McMahon A, Osaka H, Sabban DB, Sabban EL 1992 Regulated expression of the tyrosine hydroxylase gene by membrane depolarization. Identification of the responsive element and possible second messengers. J Biol Chem 267:7563–7569[Abstract/Free Full Text]
  15. Hiremagalur B, Nankova B, Nitahara J, Zeman R, Sabban EL 1993 Nicotine increases expression of tyrosine hydroxylase gene. Involvement of protein kinase A-mediated pathway. J Biol Chem 268:23704–23711[Abstract/Free Full Text]
  16. Vietor I, Rusnak M, Viskupic E, Blazicek P, Sabban EL, Kvetñansky R 1996 Glucoprivation by insulin leads to trans-synaptic increase in rat adrenal tyrosine hydroxylase mRNA levels. Eur J Pharmacol 313:119–127[CrossRef][Medline]
  17. Jahng JW, Houpt TA, Joh TH, Wessel TC 1997 Expression of catecholamine-synthesizing enzymes, peptidylglycine {alpha}-amidating monooxygenase, and neuropeptide Y mRNA in the rat adrenal medulla after acute systemic nicotine. J Mol Neurosci 8:45–52[Medline]
  18. DeCristofaro JD, LaGamma EF 1994 Neonatal stress: effects of hypoglycemia and hypoxia on adrenal tyrosine hydroxylase gene expression. Pediatr Res 36:719–723[Medline]
  19. Nankova B, Kvetñansky R, McMahon A, Viskupic E, Hiremagalur B, Frankle G, Fukuhara K, Kopin IJ, Sabban EL 1994 Induction of tyrosine hydroxylase gene expression by a nonneuronal nonpituitary-mediated mechanism in immobilization stress. Proc Natl Acad Sci USA 91:5937–5941[Abstract/Free Full Text]
  20. Nankova B, Kvetñansky R, Hiremagalur B, Sabban B, Rusnak M, Sabban EL 1996 Immobilization stress elevates gene expression for catecholamine biosynthetic enzymes and some neuropeptides in rat sympathetic ganglia: effects of adrenocorticotropin and glucocorticoids. Endocrinology 137:5597–5604[Abstract]
  21. Pacák K, Palkovits M, Kopin IJ, Goldstein DS 1995 Stress-induced norepinephrine release in the hypothalamic paraventricular nucleus and pituitary-adrenocortical and sympathoadrenal activity: in vivo microdialysis studies. Front Neuroendocrinol 16:89–150[CrossRef][Medline]
  22. Valentino RJ, Page M, Van Bockstaele E, Aston-Jones G 1992 Corticotropin-releasing factor innervation of the locus coeruleus region: distribution of fibers and sources of input. Neuroscience 48:689–705[CrossRef][Medline]
  23. Koegler-Muly SM, Owens MJ, Ervin GN, Kilts CD, Nemeroff CB 1993 Potential corticotropin-releasing factor pathways in the rat brain as determined by bilateral electrolytic lesions of the central amygdaloid nucleus and the paraventricular nucleus of the hypothalamus. J Neuroendocrinol 5:95–98[CrossRef][Medline]
  24. Pavcovich LA, Valentino RJ 1997 Regulation of a putative neurotransmitter effect of corticotropin-releasing factor: effects of adrenalectomy. J Neurosci 17:401–408[Abstract/Free Full Text]
  25. Lavicky J, Dunn AJ 1993 Corticotropin-releasing factor stimulates catecholamine release in hypothalamus and prefrontal cortex in freely moving rats as assessed by microdialysis. J Neurochem 60:602–612[CrossRef][Medline]
  26. Melia KR, Duman RS 1991 Involvement of corticotropin-releasing factor in chronic stress regulation of the brain noradrenergic system. Proc Natl Acad Sci USA 88:8382–8386[Abstract/Free Full Text]
  27. Brady LS, Whitfield Jr HJ, Fox RJ, Gold PW, Herkenham M 1991 Long-term antidepressant administration alters corticotropin-releasing hormone, tyrosine hydroxylase, and mineralocorticoid receptor gene expression in rat brain. Therapeutic implications. J Clin Invest 87:831–837
  28. Jansen ASP, Nguyen XV, Karpitskiy V, Mettenleiter TC, Loewy AD 1995 Central command neurons of the sympathetic nervous system: basis of the fight-or-flight response. Science 270:644–646[Abstract/Free Full Text]
  29. Muglia L, Jacobson L, Dikkes P, Majzoub JA 1995 Corticotropin-releasing hormone deficiency reveals major fetal but not adult glucocorticoid need. Nature 373:427–432[CrossRef][Medline]
  30. Sosenko IRS, Lewis PL, Frank L 1986 Metyrapone delays surfactant and antioxidant enzyme maturation in developing rat lung. Pediatr Res 20:672–675[Medline]
  31. Plotsky PM, Sawchenko PE 1987 Hypophysial-portal plasma levels, median eminence content, and immunohistochemical staining of corticotropin-releasing factor, arginine vasopressin, and oxytocin after pharmacological adrenalectomy. Endocrinology 120:1361–1369[Abstract]
  32. Laslop A, Tschernitz C 1992 Effects of nerve growth factor on the biosynthesis of chromogranin A and B, secretogranin II and carboxypeptidase H in rat PC12 cells. Neuroscience 49:443–450[CrossRef][Medline]
  33. Simmons DM, Arriza JL, Swanson LW 1989 A complete protocol for in situ hybridization of messenger RNAs in brain and other tissues with radio-labeled single-stranded RNA probes. J Histotechnol 12:169–181
  34. Yamada K, Sakai M, Okamura H, Ibata Y, Nagatsu I 1992 Detection of tyrosine hydroxylase and phenylethanolamine-N-methyltransferase messenger RNAs in the mouse adrenal gland and the brain by in situ hybridization. Histochemistry 97:201–206[CrossRef][Medline]
  35. Keeney DS, Jenkins CM, Waterman MR 1995 Developmentally regulated expression of adrenal 17{alpha}-hydroxylase cytochrome P450 in the mouse embryo. Endocrinology 136:4872–4879[Abstract]
  36. Weninger SC, Dunn AJ, Muglia LJ, Dikkes P, Miczek KA, Swiergiel AH, Berridge CW, Majzoub JA 1999 Stress-induced behaviors require the corticotropin-releasing hormone (CRH) receptor, but not CRH. Proc Natl Acad Sci USA 96:8283–8288[Abstract/Free Full Text]
  37. Grima B, Lamouroux A, Blanot F, Biguet NF, Mallet J 1985 Complete coding sequence of rat tyrosine hydroxylase mRNA. Proc Natl Acad Sci USA 82:617–621[Abstract/Free Full Text]
  38. Quaife CJ, Hoyle GW, Froelick GJ, Findley SD, Baetge EE, Behringer RR, Hammang JP, Brinster RL, Palmiter RD 1994 Visualization and ablation of phenylethanolamine N-methyltransferase producing cells in transgenic mice. Transgenic Res 3:388–400[CrossRef][Medline]
  39. Ziegler MG, Kennedy B, Elayan H 1988 A sensitive radioenzymatic assay for epinephrine forming enzymes. Life Sci 43:2117–2122[CrossRef][Medline]
  40. Kennedy B, Bigby TD, Ziegler MG 1995 Nonadrenal epinephrine-forming enzymes in humans. Characteristics, distribution, regulation, and relationship to epinephrine levels. J Clin Invest 95:2896–2902
  41. Kvetñansky R, Pacák K, Fukuhara K, Viskupic E, Hiremagalur B, Nankova B, Goldstein DS, Sabban EL, Kopin IJ 1995 Sympathoadrenal system in stress. Interaction with the hypothalamic-pituitary-adrenocortical system. Ann NY Acad Sci 771:131–158[Abstract]
  42. Thompson RC, Seasholtz AF, Herbert E 1987 Rat corticotropin-releasing hormone gene: sequence and tissue-specific expression. Mol Endocrinol 1:363–370[Abstract]
  43. Udelsman R, Harwood JP, Millan MA, Chrousos GP, Goldstein DS, Zimlichman R, Catt KJ, Aguilera G 1986 Functional corticotropin releasing factor receptors in the primate peripheral sympathetic nervous system. Nature 319:147–150[CrossRef][Medline]
  44. Bruhn TO, Engeland WC, Anthony EL, Gann DS, Jackson IM 1987 Corticotropin-releasing factor in the dog adrenal medulla is secreted in response to hemorrhage. Endocrinology 120:25–33[Abstract]
  45. Venihaki M, Gravanis A, Margioris AN 1997 Comparative study between normal rat chromaffin and PC12 rat pheochromocytoma cells: production and effects of corticotropin-releasing hormone. Endocrinology 138:698–704[Abstract/Free Full Text]
  46. Engeland WC, Lilly MP, Bruhn TO, Gann DS 1987 Comparison of corticotropin-releasing factor and acetylcholine on catecholamine secretion in dogs. Am J Physiol 253:R209–R215
  47. Pacák K, Kvetñansky R, Palkovits M, Fukuhara K, Yadid G, Kopin IJ, Goldstein DS 1993 Adrenalectomy augments in vivo release of norepinephrine in the paraventricular nucleus during immobilization stress. Endocrinology 133:1404–1410[Abstract]
  48. Pacák K, Armando I, Komoly S, Fukuhara K, Weise VK, Holmes C, Kopin IJ, Goldstein DS 1992 Hypercortisolemia inhibits yohimbine-induced release of norepinephrine in the posterolateral hypothalamus of conscious rats. Endocrinology 131:1369–1376[Abstract]
  49. Jiang W, Uht R, Bohn MC 1989 Regulation of phenylethanolamine N-methyltransferase (PNMT) mRNA in the rat adrenal medulla by corticosterone. Int J Dev Neurosci 7:513–520[CrossRef][Medline]
  50. Muglia LJ, Jacobson L, Weninger SC, Luedke CE, Bae DS, Jeong K-H, Majzoub JA 1997 Impaired diurnal adrenal rhythmicity restored by constant infusion of corticotropin-releasing hormone in corticotropin-releasing hormone-deficient mice. J Clin Invest 99:2923–2929[Medline]
  51. Jeong K-H, Jacobson L, Widmaier EP, Majzoub JA 1999 Normal suppression of the reproductive axis following stress in corticotropin-releasing hormone-deficient mice. Endocrinology 140:1702–1708[Abstract/Free Full Text]
  52. Wong DL, Lesage A, Siddall B, Funder JW 1992 Glucocorticoid regulation of phenylethanolamine N-methyltransferase in vivo. FASEB J 6:3310–3315[Abstract]
  53. Wong DL, Siddall B, Wang W 1995 Hormonal control of rat adrenal phenylethanolamine N-methyltransferase. Enzyme activity, the final critical pathway. Neuropsychopharmacology 13:223–234[CrossRef][Medline]
  54. Dalle M, Giry J, Gay M, Delost P 1978 Perinatal changes in plasma and adrenal corticosterone and aldosterone concentrations in the mouse. J Endocrinol 76:303–309[Abstract]
  55. Kobayashi K, Ota A, Togari A, Morita S, Mizuguchi T, Sawada H, Yamada K, Nagatsu I, Matsumoto S, Fujita K, Nagatsu T 1995 Alteration of catecholamine phenotype in transgenic mice influences expression of adrenergic receptor subtypes. J Neurochem 65:492–501[Medline]
  56. Pan WH, Lai YJ, Chen NH 1995 Differential effects of chloral hydrate and pentobarbital sodium on a cocaine level and its catecholamine response in the medial prefrontal cortex: a comparison with conscious rats. J Neurochem 64:2653–2659[Medline]
  57. Irifune M, Fukuda T, Nomoto M, Sato T, Kamata Y, Nishikawa T, Mietani W, Yokoyama K, Sugiyama K, Kawahara M 1997 Effects of ketamine on dopamine metabolism during anesthesia in discrete brain regions in mice: comparison with the effects during the recovery and subanesthetic phases. Brain Res 763:281–284[CrossRef][Medline]
  58. Kvetñansky R, Nankova B, Hiremagalur B, Viskupic E, Vietor I, Rusnak M, McMahon A, Kopin IJ, Sabban EL 1996 Induction of adrenal tyrosine hydroxylase mRNA by single immobilization stress occurs even after splanchnic transection and in the presence of cholinergic antagonists. J Neurochem 66:138–146[Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
H. Cheng, L. Zhou, W. Zhu, A. Wang, C. Tang, O. Chan, R. S. Sherwin, and R. J. McCrimmon
Type 1 corticotropin-releasing factor receptors in the ventromedial hypothalamus promote hypoglycemia-induced hormonal counterregulation
Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E705 - E712.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. Jacobson, T. Ansari, J. Potts, and O. P. McGuinness
Glucocorticoid-deficient corticotropin-releasing hormone knockout mice maintain glucose requirements but not autonomic responses during repeated hypoglycemia
Am J Physiol Endocrinol Metab, July 1, 2006; 291(1): E15 - E22.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Itoh, S. Yamada, T. Mori, T. Miwa, K. Tottori, Y. Uwahodo, Y. Yamamura, M. Fukuda, K. Yamamoto, A. Tanoue, et al.
Attenuated stress-induced catecholamine release in mice lacking the vasopressin V1b receptor
Am J Physiol Endocrinol Metab, July 1, 2006; 291(1): E147 - E151.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K.-H. Jeong, S. Sakihara, E. P. Widmaier, and J. A. Majzoub
Impaired Leptin Expression and Abnormal Response to Fasting in Corticotropin-Releasing Hormone-Deficient Mice
Endocrinology, July 1, 2004; 145(7): 3174 - 3181.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
R. KVETNANSKY, L. MICUTKOVA, L. KUBOVCAKOVA, E. L. SABBAN, M. PALKOVITS, and O. KRIZANOVA
Localization and Regulation of Phenylethanolamine N-Methyltransferase Gene Expression in the Heart of Rats and Mice during Stress
Ann. N.Y. Acad. Sci., June 1, 2004; 1018(1): 405 - 417.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
Z.'e. Hochberg, K. Pacak, and G. P. Chrousos
Endocrine Withdrawal Syndromes
Endocr. Rev., August 1, 2003; 24(4): 523 - 538.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
O. A. Tjurmina, I. Armando, J. M. Saavedra, D. S. Goldstein, and D. L. Murphy
Exaggerated Adrenomedullary Response to Immobilization in Mice with Targeted Disruption of the Serotonin Transporter Gene
Endocrinology, December 1, 2002; 143(12): 4520 - 4526.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. L. Bland, C. A. M. Jamieson, S. F. Akana, S. R. Bornstein, G. Eisenhofer, M. F. Dallman, and H. A. Ingraham
Haploinsufficiency of steroidogenic factor-1 in mice disrupts adrenal development leading to an impaired stress response
PNAS, December 19, 2000; 97(26): 14488 - 14493.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jeong, K.-H.
Right arrow Articles by Majzoub, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jeong, K.-H.
Right arrow Articles by Majzoub, J. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals