| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Unitat de Recerca Biomèdica (D.M.S., O.M.T., J.R., F.M.) and the Departament dAnatomia Patològica (N.T.), Hospital Materno-Infantil Vall dHebron, 08035 Barcelona, Spain; and the Department of Cell Biology, Georgetown University Medical Center (C.A.S.-Q.), Washington, D.C. 20007
Address all correspondence and requests for reprints to: Dr. Jaume Reventós, Unitat de Recerca Biomèdica, Hospital Materno-Infantil Vall dHebrón, Ps. Vall dHebrón, 119129, 08035 Barcelona, Spain. E-mail: reventos{at}hg.vhebron.es
| Abstract |
|---|
|
|
|---|
All animals homozygous for transgenic ABP exhibited an increased accumulation of primary spermatocytes and cells at metaphase with abnormal morphology and localization within the seminiferous epithelium. Analysis of DNA fragmentation by in situ techniques and agarose gel electrophoresis provided evidence for an increased occurrence of apoptosis in the transgenic animals, principally involving pachytene spermatocytes and cells at metaphase. Flow cytometric analysis of the DNA content of isolated germ cells revealed a reduction in the number of haploid cells, an increase in the number of tetraploid cells, and the appearance of a hypotetraploid cell population, consistent with degenerating primary spermatocytes. In mice heterozygous for the transgene, the effects were less prominent, and the degree to which spermatogenesis was compromised correlated with the levels of ABP messenger RNA in individual animals. The present results are interpreted to suggest that ABP can act as a modulator of spermatogenesis by regulating completion of the first meiotic division of primary spermatocytes.
| Introduction |
|---|
|
|
|---|
Ever since its initial characterization, the function of ABP has been
extensively discussed. Based on its role as steroid carrier, ABP was
initially proposed to function during spermatogenesis and sperm
maturation by regulating the bioavailability of androgens in the
extracellular space of the male reproductive tract (8, 9). More
recently, an intracellular role for ABP was also suggested, either
acting through a specific membrane receptor (10, 11, 12, 13), as steroid
trans-membrane carrier (14), or directly interacting with
cytoplasmic or nuclear proteins (15). Observations made in support of
this function include the internalization of ABP into epithelial cells
of the caput epididymis demonstrated by immunohistochemistry (16, 17)
and by autoradiographic detection of a photoaffinity-labeled ABP bound
to [3H]
6-testosterone
(18). In addition, ABP/SHBG was shown to undergo endocytosis by coated
vesicles, with eventual delivery to the nucleus of spermatogonia,
spermatocytes, and round and elongated spermatids (19).
To gain possible insight into ABP function during spermatogenesis, transgenic mice carrying a rat ABP (rABP)/SHBG genomic DNA clone were developed (20). These animals exhibit increased expression of rABP messenger RNA (mRNA) in Sertoli cell and enhanced [3H]dihydrotestosterone-binding activity in testicular homogenates. They also display fertility disturbances and focal damage in seminiferous epithelia, with loss of germinal cells (21, 22). In the present study, we examined the mechanism by which the specific focal damage occurs within the seminiferous epithelium and identified the cell types afflicted in the transgenic mice. We demonstrate that rat ABP overexpression in the transgenic mice produces a partial block of spermatogenesis at the first meiotic division, with subsequent apoptotic death of the growth-arrested germ cells.
| Materials and Methods |
|---|
|
|
|---|
Histological observations and in situ end labeling of fragmented
DNA (TUNEL)
For morphological studies, 15 control and 17 transgenic mice
were used. The control groups consisted of six wild-type CD1 mice, aged
3 (n = 3) and 6 (n = 3) months, 6 wild-type C57BL/6 mice,
aged 3 (n = 3) and 6 (n = 3) months, and 3 nontransgenic,
3-month-old, littermates. Transgenic animals included 7 homozygous
mice, aged 3 (n = 3), 6 (n = 3), and 12 (n = 1) months.
Ten heterozygous transgenic mice, 3 (n = 3) and 6 (n = 7)
month old, were also examined.
Testis were fixed in 4% paraformaldehyde for 24 h and embedded in paraffin. Serial 5-µm thick sections were used for histological examination, after hematoxylin-eosin (H&E) staining, and for in situ DNA fragmentation analysis.
In situ end labeling of fragmented DNA was performed according to the protocol originally described (24), but with some modifications. Paraffin sections were dewaxed in xylenes, rehydrated in a graded series of alcohols, and incubated with 20 µg/ml proteinase K for 15 min at room temperature and then with 3% hydrogen peroxide in distilled water for 5 min. Sections were washed in distilled water and immersed in terminal deoxynucleotidyltransferase (TdT) buffer [25 nM Tris-HCl (pH 6.6), 200 mM cacodylate acid, and 200 mM KCl] for 15 min at room temperature. The sections were then incubated with 0.05 U/µl TdT (Roche Molecular Biochemicals, Mannheim, Germany) and 0.5 nM biotin-16-deoxy (d)-UTP (Roche Molecular Biochemicals) in TdT buffer for 90 min at 37 C and with 300 mM NaCl and 30 mM sodium citrate for 15 min at room temperature. Sections were rinsed in distilled water, incubated in 2% BSA for 10 min, and rinsed again in distilled water and PBS. Finally, sections were incubated with avidin-biotin complex (ABC, Vector Laboratories, Inc., Burlingame, CA), diluted 1:25, at 37 C for 45 min, and the peroxidase reaction was visualized with diaminobenzidine and hydrogen peroxide. Quantification was performed by counting individually labeled cells in at least three sections per sample. To know the total amount of labeled cells per testis and the distribution of positive cells, two parameters were recorded: number of labeled cells per labeled tubule and number of labeled tubules per total tubules analyzed.
H&E and TUNEL assays photographs were scanned using a ScanMaker III (Microtek) set at 300-dpi resolution. Images were composed using Photoshop IV software (ADOBE) and printed on a FUJIX Pictography 3000 printer. H&E-stained color photographs were converted to grayscale for publication.
DNA fragmentation analysis on agarose gel
Low mol wt DNA was isolated from two transgenic and two
nontransgenic littermate mice, aged 6months, by using the apoptotic DNA
ladder kit from Roche Molecular Biochemicals according to
the manufacturers instructions. Low mol wt DNA (0.5 µg) from all
samples and a 100-bp ladder marker DNA were electrophoresed on 1.8%
agarose gel with ethidium bromide, visualized by UV transillumination,
and imaged with the Gel Doc System using Molecular Analyst/Macintosh
software (Bio-Rad Laboratories, Inc., Hercules, CA).
Germ cell isolation and DNA index measurement by flow cytometry
Germ cells were isolated from the testis of three nontransgenic
littermates, four heterozygous mice, and three homozygous mice, all 3
months of age, according to the method of Weiss et al. (25).
Testes were excised and washed with PBS supplemented with
penicillin-streptomycin (5 mg/ml) and amphotericin (5 mg/ml),
decapsulated, minced, and incubated for 8 min in 100 ml of the above
PBS solution. The medium was removed, and the remaining testicular
pieces were digested in trypsin (80 mg/ml)/PBS for 10 min at 33 C. The
reaction was stopped by adding 25 mg/ml trypsin inhibitor, and the
resulting solution was treated with deoxyribonuclease (0.4 mg/ml) for 5
min at room temperature. The isolated tubules were minced in a petri
dish for 30 min and sequentially filtered through a 100-µm pore size
nylon filter, a fine glass-fiber filter, and a 20-µm pore size nylon
filter. The recovered solution was centrifuged at 800 rpm for 10 min,
and the pellet was resuspended in 15 ml DMEM/NUT mix F-12 culture
medium (Life Technologies, Inc., Gaithersburg, MD)
supplemented with 10% FBS. The cell suspension was incubated in
the same medium in tissue culture flasks for 5 h, and the
supernatant, free of Sertoli cells, was recovered and centrifuged at
800 rpm for 10 min. The pellet was resuspended in 0.4
M sodium citrate, pH 2.35, and after a 24-h
incubation the sample was pelleted again and resuspended in 0.4
M sodium citrate, pH 4.5, in a final
concentration of 1 x 106 cells/ml as
previously described (26).
Cellular DNA was subsequently treated with ribonuclease A (RNase; 0.1 mg/ml; Roche Molecular Biochemicals) at 37 C for 30 min, stained with propidium iodide (PI; Sigma, St. Louis, MO) at 100 µg/ml, stored at 4 C, and analyzed at 12 h after staining as previously described (26). Part of some samples were analyzed simultaneously using the same protocol but without RNase pretreatment. Fluorescence was recorded using an EPICS XL flow cytometer (Coulter Corp., Hialeah, FL) equipped with an argon ion laser set at 488 nm. Red fluorescence (620 nm) for PI and light scatter were measured simultaneously and plotted against each other. Aggregates were excluded gating single cells by their area vs. peak fluorescence signal. DNA analysis on single fluorescence histograms was performed using Multicycle software (Phoenix Flow Systems, San Diego, CA). A minimum amount of 12,000 cells/sample were analyzed.
mRNA isolation and ABP expression by RT-PCR
Testicular mRNA was isolated from the same animals in which
morphological studies and TUNEL analysis were performed, by means of
the Quickprep mRNA purification kit from Pharmacia Biotech
(Piscataway, NJ), according to the suppliers instructions. Eluted
mRNA (0.25 ng) was reverse transcribed using 200 U Superscript II H-
reverse transcriptase (Life Technologies, Inc.) in a
20-µl reaction volume in the presence of 25 µg/ml
oligo(deoxythymidine)15, first strand buffer (50
mM Tris-HCl, 75 mM KCl, and 3 mM
MgCl2), 0.01 M DTT, and 1
mM each of dATP, dGTP, dCTP, and dTTP. The mRNA and
oligo(deoxythymidine) mix was heated at 70 C for 10 min, then cooled to
4 C, the other reagents were added, and RT was performed at 42 C for 50
min. One microliter of the resultant complementary DNA (cDNA) was
amplified in a 50-µl reaction in the presence of 2 U Taq
polymerase (Ecogen, Barcelona, Spain), 0.05 mM
MgCl2, 0.2 mM of each dNTP,
and 0.1 µM of specific primers for rat ABP,
mouse ABP, and cyclophilin A (CypA) mRNA as a control, in different
microtubes. For rat ABP, a 954-bp product was amplified using an upper
primer designed specifically against rat exon 1 (GAGAAGGGAGAGGTGGCCT)
and a lower primer which specifically recognized rat exon 7
(GCTCAAGGCTACTTTGAATAC). For mouse ABP, a 955-bp fragment was obtained
using an upper primer that specifically recognized mouse exon 1
(GGAGAAGAGAGACTCTGTGG) and a lower primer that specifically recognized
mouse exon 7 (GCTCAAGACCACTTTGACTC). For CypA, a 569-bp fragment was
amplified using mouse-specific primers (CAGATGGGGTAGGGACG as upper
primer and ATGGTCAACCCCACCACCGTG as lower primer). Amplification was
carried out in a thermocycler (model 2400, Perkin-Elmer Corp., PE Applied Biosystems, Foster City, CA) and
consisted of 40 cycles of amplification for rat and mouse ABP and 30
cycles for CypA. Denaturation was performed at 94 C for 15 sec,
annealing at 65 C for rat ABP/Cyp A and 55.5 C for mouse ABP/CypA for
30 sec, and extension at 72 C for 45 sec. PCR products were separated
on a 2% agarose gel and quantified by the Molecular Analyst/Macintosh
data analysis software using a Bio-Rad Laboratories, Inc.,
Image Analysis System.
The products of amplification were purified using the QIAquick PCR Purification Kit (Quiagen, Hilden, Germany) according to the suppliers instructions. The purified products were digested with two restriction enzymes, one specific for rat ABP (AccI) and the other for mouse ABP (HhaI). Digested fragments were visualized on a 2% agarose gel. Alternatively, the nondigested purified products were sequenced using an ABI Prism 310 genetic analyzer from Perkin-Elmer Corp.
| Results |
|---|
|
|
|---|
Morphological examination
In H&E-stained sections of testes from homozygous transgenic mice
of ages 3, 6, and 12 months, all stages of spermatogenesis were present
(Fig. 1a
), although in some tubules
evidence for germ cell differentiation beyond the first meiotic
division was absent (Fig. 1b
). Furthermore, an apparent accumulation of
pachytene and metaphase spermatocytes was frequently noted in sections
prepared from these mice (Fig. 1d
), some of which exhibited abnormal
morphology and localization. Pyknotic figures, for example, were often
encountered in the apical region of the seminiferous epithelium (Fig. 1c
) or within the lumen of the tubules. Interestingly, specific cell
types found as a collective and comprising a specific stage of the
cycle of the seminiferous epithelium were at times missing, making
tubule staging difficult. Specifically, elongated spermatids, cells
resulting from round spermatid differentiation, were most infrequent in
those tubules seeming to contain pachytene spermatocyte accumulation
(Fig. 1c
). In these tubules, early spermatids were located in the
tubular lumen together with meiotic cells. Heterozygous transgenic mice
at 3 and 6 months of age also presented a wide range of variability in
testicular morphology, ranging from normal features to identical
alteration in their seminiferous epithelium histology as the homozygous
mice (data not shown).
|
Analysis of DNA fragmentation
Agarose gel electrophoresis of extracted DNA and TUNEL assays were
performed to confirm whether the germ cell loss occurs through
induction of apoptosis and to elucidate the specific cellular types
involved in this process. Electrophoresis of low mol wt DNA isolated
from ABP transgenic animals revealed the presence of characteristic
oligonucleosomal fragmentation resulting from apoptosis (Fig. 2
). Nontransgenic littermates showed no
DNA fragments or a faint ladder pattern with a more intense band at 90
bp.
|
|
|
|
In conclusion, transgenic animals presented a marked increase in apoptotic cells, with pachytene spermatocytes and metaphases being the most involved cellular types.
ABP expression
To correlate the degree of apoptosis as a function of ABP mRNA
levels in each animal, testicular rat and mouse ABP mRNA levels were
measured by RT-PCR in the same animals used for in situ
assays. Homozygous males showed a high and constant amount of rat ABP
mRNA (ratio rABP/CypA, 1.16; SD, 0.019), whereas
heterozygous males presented lower levels (ratio ABP/CypA, 0.77) with a
wider range of variability (SD, 0.16; Fig. 5
). Wild-type C57BL/6 mice and
nontransgenic littermates showed no amplification of rat ABP, as
expected. A positive correlation was found between the rat ABP mRNA
expression and the number of apoptotic cells per labeled tubule in
heterozygous males (Fig. 5
).
|
To corroborate the specificity of each PCR reaction, the rat and mouse
ABP amplified products were digested with restriction enzymes specific
for each cDNA or, alternatively, were sequenced. The rat ABP cDNA was
completely digested with AccI and nondigested with
HhaI, whereas the mouse ABP cDNA was completely digested
with HhaI and nondigested when AccI was used
(Fig. 6
). The sequence analysis of both
cDNAs demonstrated the presence of a unique band in each product of
amplification. The rat and mouse amplified products were identical to
the rat ABP transcript (nucleotides 36990 of the GenBank sequence
M31179) and to the mouse ABP mRNA (nucleotides 9964 of the GenBank
sequence U85644), respectively.
|
|
|
| Discussion |
|---|
|
|
|---|
Although morphological and biochemical criteria that define cellular death as apoptosis have been extensively described and are common for most somatic cell types (27, 28), degeneration of germ cells present several differential features that seem to be specific for each maturation step (29, 30, 31). In terms of morphological presentation, for example, instead of the typical chromatin margination characteristic of somatic cells undergoing apoptosis, meiotic spermatocytes may present chromatin condensation over the chromosome axes, as shown in adult rats treated with estradiol (31). These researchers suggested that margination of chromatin may not be possible because paired chromosomes are anchored to the nuclear envelope by their telomerases in meiotic cells. Regarding cellular size, cellular swelling with decondensed and homogeneous chromatin was demonstrated in pachy-tene cells in spontaneous and GnRH antagonist-induced cell death (30). In ABP transgenic mice, we demonstrated by in situ end labeling of DNA fragmentation that most labeled cells were indeed pachytene spermatocytes and metaphase cells. Although some of these cells apparently looked normal under light microscopic examination, a subset of them exhibited clear evidence of cells in the apoptotic process, including increased size, chromatin condensation over the chromosome axes, abnormal disposition of the chromatin, and loss of intercellular contacts. Cellular swelling with decondensed chromatin and homogeneous nuclear staining were also evident in our model. The high amount of apparently normal pachytene and metaphase cells labeled for DNA fragmentation does not seem to be the product of nonspecific labeling of the DNA by terminal transferase (30), however, because a low concentration of the enzyme was used and almost no labeled cells were found in controls. These cells were most likely cells in an early stage of degeneration, bearing DNA fragments but still maintaining their overall morphology.
In the testis of ABP transgenic mice, we demonstrated an increase in pyknotic cells. These pyknotic bodies are indicators of late stages of apoptosis and are a common feature of the somatic and germinal cell apoptotic pathway (29). In our transgenic animals, apoptotic cells may be removed by two possible mechanisms: phagocytosis by Sertoli cells and/or expulsion to the epididymis. Evidence in support of the first pathway was the presence of faint TUNEL labeling in cell debris in the basal part of some tubules as well as the ultrastructural finding of apoptotic bodies within the cytoplasm of Sertoli cells (data not shown). The presence of pyknotic cells and primary spermatocytes within the epididymis of the ABP transgenic mice provided evidence supporting the second pathway. Thus, our results may be interpreted to suggest that germ cell removal occurs by both of these possible pathways.
The most widely used biochemical hallmark of apoptosis, the demonstration of internucleosomal cleavage of the DNA into fragments that resolve on electrophoresis as multiples of about 180 bp, has also been found in germ cells undergoing programmed cell death (32). Agarose electrophoresis of DNA isolated from the testis of ABP transgenic mice showed the presence of a band of 180 bp and three additional bands whose sizes were multiples of 180. Interestingly, in nontransgenic littermates, we detected a band approximately 90 bp in size. A 90-bp band has also been described in testicular DNA isolated from adult male rats treated with a GnRH antagonist and methoxyacetic acid (30). These researchers suggested that the smaller fragments might reflect the apoptotic degradation of cells with nucleosomal particles of different sizes, as histones are replaced by other nucleoproteins during spermatogenesis (30). This interpretation would explain the emergence of an extra band in the present study, because in nontransgenic littermates, TUNEL labeling was found in some primary spermatocytes and round spermatids, as in transgenics, but also in elongated spermatids.
Apoptosis as a consequence of meiotic blockade
We demonstrated in morphological studies that pachytene
spermatocytes and metaphase cells were the most susceptible cells for
undergoing apoptosis in ABP transgenic mice. However, the increase in
the number of pachytene spermatocytes and metaphase cells and the
decrease in or even absence of cells at later maturation steps in some
tubules suggested the existence of a partial arrest during the first
meiotic division. In concordance with these findings, flow cytometric
analysis of PI-labeled germ cells showed a marked decrease in haploid
cells, an increase in tetraploid cells, and the emergence of a new germ
cell population with a ploidy status below 4c. It has been described
that apoptotic cells stained with PI are typically detected by the
cytometer "down and to the left" with respect to their normal
counterpart, reflecting the cell shrinkage and the loss of fluorochrome
binding because of chromatin condensation (33). The aneuploid peak
identified in ABP transgenic animals was recorded as a well delineated
area located "down and to the left" with respect to the tetraploid
cells when light scatter was plotted against PI fluorescence,
suggesting that they may represent apoptotic cells, emerging pachytene
spermatocytes, and metaphase cells. Although some round spermatids also
exhibited TUNEL labeling, we did not observe a major hypohaploid peak
in the histogram when RNase A was used. These results lead us to
speculate that in ABP transgenic mice pachytene spermatocytes and
metaphase cells of most damaged tubules arrest their differentiation
program and degenerate by apoptosis.
An overall reduction in the number of spermatids as the cause of the fertility impairment in ABP transgenic mice has been reported by Joseph et al. (34). However, in this initial report, the mechanism by which a decrease in spermatid number occurs was not addressed, although a suggestion was made that the reduction was caused by cellular degeneration of this differentiated cell type. As we did not find apoptosis in the haploid population (except for the rare exception of some round spermatids stained by the TUNEL assay), we conclude, in marked contrast to the hypothesis of Joseph et al., that the spermatid decrease is more likely due to the interruption of spermatogenesis rather than to spermatid degeneration.
A transgenic mouse model overexpressing human SHBG has been also produced, and neither infertility nor impaired spermatogenesis has been found in these animals (35). As these researchers suggested, however, these differences may be due to a differential pattern of expression of human and rat SHBG, or, alternatively, may be caused by the regulatory elements contained in the promoter introduced in each transgene construction.
Several studies have demonstrated the existence of germ cell apoptosis during normal spermatogenesis (29, 30, 32, 36, 37, 38, 39). Spontaneous germ cell loss occurs during the mitotic division of spermatogonia, the meiotic division of spermatocytes, and spermiogenesis. In general, the fertility disturbances and the abnormal spermatogenesis observed in several lines of transgenic mice are produced by the loss of specific gene function regulating spermatogenesis. (40, 41, 42). In particular, the prophase of the first meiotic division and the number of primary spermatocytes entering meiosis seem to be apoptosis regulated (43). During meiosis, as occurs in mitosis, DNA damage is detected at specific checkpoints, providing the cell with a control mechanism that may result in cell cycle arrest (44, 45, 46, 47) and, ultimately, in genomic instability and/or cell death (48, 49). Although most of our knowledge about the genes that control meiosis comes from cell cycle division mutants in yeast (44, 50), transgenic animals have proven to be a useful tool for studying meiotic regulation in mammals (45, 51). Among genes whose targeted disruption causes meiotic arrest in transgenic animals are BAX, PMS2, CREM, MLH-1, ATM, and HSP702 (45, 52). A similar phenotype has also been described as a consequence of the overexpression of some genes, such as c-myc (53). All of the above proteins have been localized in germ cells undergoing meiosis in normal mice. Although internalization of ABP in germ cells has been demonstrated in the rat and monkey (14, 19), ABP immunoreactivity has not been detected in the germ cells of wild-type mice. It is possible that the amount of ABP in the wild-type mice is too low to be detected by means of immunohistochemistry, but is high enough to be detected in ABP transgenic mice. The presence of the rat ABP protein in pachytene spermatocytes and metaphase cells in ABP transgenic mice and their accumulation in those tubules presenting arrest of spermatogenesis (54) suggest that the excess of ABP causes the meiotic arrest and cellular degeneration. Nevertheless, the parallel increase in the endogenous ABP in transgenic mice raises the possibility that the rat ABP protein could not be active in mice and could antagonize the effect of the endogenous protein. Thus, it might be the lack, rather than the excess, of ABP that is responsible for the interruption of spermatogenesis.
Although only one line of ABP transgenic mice has been analyzed in the present report, several data support the assumption that the spermatogenic disorder is caused by rat ABP overexpression rather than by an insertional mutation. First, it has been demonstrated that another ABP transgenic line presented reduced fertility and that a transgenic mouse founder was unable to develop a new line because it was not fertile (20, 21). Second, the degree of the germ cell apoptosis during meiosis can be correlated with the amount of rat ABP mRNA in each animal in the heterozygote population. Third, the levels of endogenous ABP mRNA show a similar profile to that of the levels of the rat ABP mRNA and the degree in the germ cell apoptosis. Fourth, the transgenic ABP protein accumulates in the pachytene spermatocytes in the most afflicted tubules (54). Fifth, there is no evidence to suggest that the inserted ABP is expressed in germ cells. Rather, the gene was only expressed in Sertoli cells (21, 22).
Possible mechanisms of ABP action
One possible mode of ABP action is to function inside the cell by
regulating steroid levels. Although we (unpublished results) and others
(34) failed to demonstrate changes in total plasma and tissue
testosterone in ABP transgenic mice, the ratio between free and bound
testosterone was not measured. It has been shown that testosterone
withdrawal produces apoptosis in pachytene spermatocytes and in round
and elongated spermatids (39, 55). A decrease in free testosterone
could explain the pachytene and round spermatid apoptosis found in ABP
transgenic mice. However, the mechanism by which androgen deprivation
produces this degeneration is not known, as no androgen receptors have
been demonstrated in these cellular types (56). Recently, convincing
evidence appeared in the literature that primary spermatocytes express
p450 aromatase (57) and estrogen receptors (58). Taken together, the
above results allow us to speculate that an excess of ABP could raise
the rate of bound testosterone and decrease the free hormone levels as
well as their aromatization to estrogens. Interestingly, the estrogen
receptor knockout mice also manifest reduced fertility, germ cell
degeneration, and diminished sperm count (59).
In summary, our report demonstrates a novel role for ABP in regulating the progression of meiosis. Further studies will be necessary to elucidate the precise mechanisms of this action.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received October 7, 1999.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Muir, I. Sadler-Riggleman, and M. K. Skinner Role of the Basic Helix-Loop-Helix Transcription Factor, Scleraxis, in the Regulation of Sertoli Cell Function and Differentiation Mol. Endocrinol., August 1, 2005; 19(8): 2164 - 2174. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Selva, K. N. Hogeveen, and G. L. Hammond Repression of the Human Sex Hormone-binding Globulin Gene in Sertoli Cells by Upstream Stimulatory Transcription Factors J. Biol. Chem., February 11, 2005; 280(6): 4462 - 4468. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Selva, O. M. Tirado, N. Toran, C. A. Suarez-Quian, J. Reventos, and F. Munell Estrogen Receptor {beta} Expression and Apoptosis of Spermatocytes of Mice Overexpressing a Rat Androgen-Binding Protein Transgene Biol Reprod, November 1, 2004; 71(5): 1461 - 1468. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. M. Tirado, D. M. Selva, N. Toran, C. A. Suarez-Quian, M. Jansen, D. P. McDonnell, J. Reventos, and F. Munell Increased Expression of Estrogen Receptor {beta} in Pachytene Spermatocytes After Short-Term Methoxyacetic Acid Administration J Androl, January 1, 2004; 25(1): 84 - 94. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. M. Tirado, E. D. Martinez, O. C. Rodriguez, M. Danielsen, D. M. Selva, J. Reventos, F. Munell, and C. A. Suarez-Quian Methoxyacetic Acid Disregulation of Androgen Receptor and Androgen-Binding Protein Expression in Adult Rat Testis Biol Reprod, April 1, 2003; 68(4): 1437 - 1446. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Selva, K. N. Hogeveen, K. Seguchi, F. Tekpetey, and G. L. Hammond A Human Sex Hormone-binding Globulin Isoform Accumulates in the Acrosome during Spermatogenesis J. Biol. Chem., November 15, 2002; 277(47): 45291 - 45298. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Munell, C. A. Suarez-Quian, D. M. Selva, O. M. Tirado, and J. Reventos Androgen-Binding Protein and Reproduction: Where Do We Stand? J Androl, September 1, 2002; 23(5): 598 - 609. [Full Text] [PDF] |
||||
![]() |
D.A. Jeyaraj, G. Grossman, C. Weaver, and P. Petrusz Dynamics of Testicular Germ Cell Proliferation in Normal Mice and Transgenic Mice Overexpressing Rat Androgen-Binding Protein: A Flow Cytometric Evaluation Biol Reprod, April 1, 2002; 66(4): 877 - 885. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||