| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Institute of Pathology CHU-B23 (O.K., F.B., H.M., N.F., C.R., V.G.), Laboratory of Radio-Immunology & Neuroendocrine-Immunology, Cell Pathology (R.G.), Histology and Cytology (M.-P.D.), Molecular Oncology (R.W.), University of Liège, B-4000 Liège 1-Sart Tilman, Belgium
Address all correspondence and requests for reprints to: Vincent Geenen, M.D., Ph.D., Institute of Pathology CHU-B23, University of Liège, B-4000 Liège 1-Sart Tilman, Belgium. E-mail: vgeenen{at}ulg.ac.be
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
GH and insulin-like growth factors (IGFs) are implicated in the regulation of lymphopoiesis and T cell development (10, 11, 12, 13, 14, 15). IGFs (IGF-1 and IGF-2) are small single chain polypeptides that are known to have growth, mitogenic, and differentiative effects (16). Their biological effects are mediated by three types of receptors: the type 1 IGF receptor (IGF-1R) (17), the mannose-6-phosphate/type 2 IGF receptor (M6P/IGF-2R) (18), and the insulin receptor (19). IGF-1R is a transmembrane protein with intrinsic tyrosine kinase activity. Activation follows the binding of IGF-1, IGF-2 or insulin to IGF-1R, although the affinity of this receptor for the three ligands is different (IGF-1 > IGF-2 > insulin). These ligands activate the IGF-1R and initiate a signaling cascade that results in the differentiation and/or the proliferation of many cell types (20). M6P/IGF-2R is a single-chain transmembrane protein with a high affinity for IGF-2, a low affinity for IGF-1 and almost undetectable affinity for insulin (reviewed in Ref. 16). The M6P/IGF-2R extracellular domain is composed of fifteen highly conserved repeated motifs comprising different binding sites for IGF-2, mannose-6-phosphate, transforming growth factor-ß (TGFß) (21), and retinoic acid (22). The complexity of the system is enhanced by the fact that the biological properties of IGFs are modulated by a family of at least six IGF binding proteins (IGFBPs) (23, 24).
The components of the IGF axis, including IGFBPs, have been characterized in the human thymus. Human thymic epithelial cells (TEC) express different members of the IGF axis, with a predominance of IGF-2 and IGFBP-2 to-6 (25, 26). In the thymus, IGF-1 expression is restricted to sparse cells with a macrophage-like morphology and distribution (25, 27). Thymocytes (pre-T cells) have been found to express both types of IGF receptors (IGF-1R and M6P/IGF-2R) (28, 29, 30). Administration of IGF-1 stimulates thymus and spleen growth and T cell proliferation and development (31, 32) and modulates the regeneration of T cells in a rat model of dexamethasone-induced apoptosis (32). In addition, the thymus of IGF-2 transgenic mice contains high levels of IGF-2 mRNA and displays an increased thymic cellularity, with a higher number of the CD4+ T cell subset (33). Therefore, a number of experimental data support the existence of a functional IGF-mediated signaling between stromal cells (TEC and macrophages) and immature T cells during their differentiation within the thymus.
In the present study, we assessed the expression of IGFs and IGF receptors during the early embryonic development of thymocytes, and their role in T cell development. We first investigated the temporo-spatial expression of IGFs and IGF-receptors during ontogeny of the murine thymus. We then investigated the effects of blockade of IGF-mediated signaling in fetal thymus organ culture (FTOC), a very appropriate in vitro model for the study and manipulation of T cell development (34).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Reagents and antibodies
FTOC were cultured in the Iscove’s modified Dulbecco’s (IMDM)
medium supplemented with L-glutamine (2 mM),
HEPES (25 mM), penicillin (100 UI/ml), streptomycin (100
µg/ml) and 10% FCS (all reagents were purchased from
BioWhittaker, Inc., Verviers, Belgium). This medium will
be referred as complete medium (34).
Rabbit IGF-1 polyclonal antibody (pAb) was obtained from Biogenesis (Sandown, NH). Mouse antihuman IGF-2 monoclonal antibody (mAb) (IgG1) was purchased from Cymbus Biotechnology LTD (Chandlers Ford, UK). Mouse antirat (pro)insulin mAb (IgG1) was obtained from Biogenesis. This antibody recognizes human, rat, and mouse insulin/(pro)insulin.
Mouse antihuman IGF-1R mAb (
IR3, IgG1) was obtained from
Oncogene Science, Inc. (Cambridge, MA). This antibody
recognizes and neutralizes mouse (35), rat (36), and human IGF-1R (37).
Rabbit pAb against M6P/IGF-2R (As 293) was kindly provided by RG
MacDonald (University of Nebraska, Lincoln, NE) (38).
Purified rabbit IgG (Prepro Tech Inc., Rocky Hill, NJ) and mouse antihuman FSH mAb (IgG1) were used as controls.
All the preparation of antibodies were dialyzed overnight in 9
NaCl
to eliminate sodium azide and other preservatives.
Phycoerythrin (PE)-labeled antimouse CD4 and fluorescein (FITC)-labeled antimouse CD8 mAbs were purchased from Becton Dickinson and Co. Immunocytometry System (BDIS, Mountain View, CA).
Fetal thymic organ cultures (FTOC)
FTOC were performed as described by Plum et al. (34).
Briefly, four to six single thymus lobes from mice at fetal day 14 were
placed on the surface of preboiled membrane filters (0.8 µm pore
size; Nucleopore, Costar, Cambridge, MA) which were
supported on blocks of surgical gelfoam (Upjohn, Kalamazoo, MI) in 2.5
ml of complete medium. The cultures were grown for 7 days at 5%
CO2, 37 C in the presence of anti-IGF-1 pAb (1.8,
3.75, and 5 µg/ml), anti-IGF-2 mAb (0.6, 1.8 and 3.75 µg/ml),
anti-proinsulin/insulin mAb (1.8, 3.75, and 5 µg/ml), anti-M6P/IGF-2R
pAb (5 and 10 µg/ml), or anti-IGF-1R mAb (1.5, 3 and 5 µg/ml).
Control cultures were performed in basal conditions, in the presence of
1.8 to 10 µg/ml purified rabbit Ig, or with 0.6 to 3.75 µg/ml mAb
anti-FSH. At the end of the cultures, cell suspensions were prepared
and the percentage of living cells were estimated by trypan blue
exclusion test.
Flow cytometry
Cell suspensions were incubated for 20 min at 4 C with a 1/200
dilution of FITC-CD8 and a 1/400 dilution of PE-CD4 mAbs. Just before
flow cytometry, propidium iodide (PI, 5 µg/ml; Sigma)
was added to the cells to exclude the death of altered PI-positive
cells from analysis. Flow cytometry was performed using a FACStar Plus
sorter (Becton Dickinson and Co.) equipped with an
air-water cooled blue argon laser (488 nm) powered at 100 mW (Spinnaker
160, Spectra Physics, Mountain View, CA) and with the cellquest
analysis software (Becton Dickinson and Co.).
For each sample, forward and right light scatter and triple fluorescence were determined on 10,000 cells and stored in list mode data files. Fluorescence signals were recorded on a three decade log scale. The green (FITC), orange (PE) and far red (PI) fluorescences were collected through a 530/30, a 575/25, and a 670/20 bandpass filter, respectively. An electronic compensation was used to correct spectral overlap between FITC and PE fluorescences. The PI fluorescence is one magnitude order more intense than the PE fluorescence in the orange channel and did not disturb the PE signal. The PI signal is also purely detected in the far-red channel, and no compensation was needed to collect this third fluorescence. Therefore, the PI-positive death cells can be unambiguously discarded by gating the far-red fluorescence.
In situ hybridization
The mouse IGF-2 probe was kindly provided by G. I. Bell
(University of Chicago, Chicago, IL) (39). A 460-bp fragment was
subcloned in the pGEM-3Z, and synthesized using a DIG RNA labeling kit
(SP6/T7) (Roche Molecular Biochemicals, Mannheim, Germany)
according to the manufacturer’s instructions. Briefly, 1 µg of sense
and antisense matrix riboprobes were transcribed and labeled in a
reaction containing SP6 (antisense) or T7 (sense) RNA polymerase and
digoxigenin-labeled UTP for 60 min at 37 C (Roche Molecular Biochemicals). The probe was digested with DNase to remove
template DNA. The mixture was then fractionated by electrophoresis on
agarose gels and purified by ammonium acetate precipitation. The yield
was estimated by comparison to labeled control riboprobe in serially
diluted dot blots.
Eight-micrometer tissue sections were fixed for 10 min in 4% paraformaldehyde at room temperature, washed with PBS, and dehydrated in alcohol. Slides were incubated in a humidified chamber at 50 C with a digoxigenin-conjugated riboprobe (100 ng/ml) in hybridization buffer (300 mM NaCl; 10 mM Na2HPO4, pH 6.8; 10 mM Tris-Cl pH 7.5; 50 mM EDTA, pH 6.8) supplemented with 50% formamide, 5% dextran sulfate, 100 µg/ml transfer RNA, and 100 µg/ml denatured salmon sperm DNA overnight. Posthybridization washes were performed at 50 C for 2 h in 50% formamide hybridization buffer. Sections were digested with 30 µg/ml RNase A (Roche Molecular Biochemicals) at 37 C for 30 min to remove nonspecifically bound probe, then washed twice in 2 x SSC (20 x SSC: 3 M NaCl, 0.3 M sodium citrate dihydrate) at 50 C for 30 min. The sections were then washed in PBS containing 0.05% Tween and incubated overnight with a sheep anti-digoxigenin F(ab)2 mAb conjugated to alkaline phosphatase (Roche Molecular Biochemicals) diluted 1/500 in PBS containing 2% normal sheep serum. After washing in PBS, slides were transferred to alkaline Tris-buffer, pH 9.5. Staining was revealed after 2 h at room temperature in alkaline Tris-buffer containing 4.5 µg/ml nitroblue tetrazolium salt and 3.5 µg/ml 5-bromo-4-chloro-3-indolyl-phosphate. The reaction was stopped by thorough washing in Tris-HCl buffer, pH 7.2, containing 10 mM EDTA. Slides were counterstained with methyl green and mounted in DPX solution.
RT-PCR analyses
Tripure (Roche Molecular Biochemicals) was added to
tissue fragments, and RNA was extracted according to the
manufacturer’s instructions. Samples were treated by RNase free DNase
I (Roche Molecular Biochemicals) to remove potentially
contaminating DNA. Each sample at different ages represents a pool of
mouse thymi and experiments were repeated three times.
RT was performed using 2 µg of total RNA in the presence of 1 mM dNTP (Amersham Pharmacia Biotech, Uppsala, Sweden), 50 mM Tris-HCl pH 8.3, 75 mM KCl, 5 mM MgCl2, 30 U of avian reverse transcriptase (Promega Corp.) and 500 nM random hexamer primers (Amersham Pharmacia Biotech) in a final volume of 25 µl. Samples were incubated at 70 C for 10 min and 1 h at 42 C.
The PCR reaction was carried out in a final volume of 50 µl using the
equivalent of 400 ng of total RNA (5 µl of the RT reaction) was
amplified in the presence of 10 mM Tris-HCl pH 8.3, 50
mM KCl, 1.5 mM MgCl2, 200
µM each dATP, dCTP, dGTP, dTTP, 1.5 U TaKaRa
Taq DNA polymerase (all reagents are from TAKARA SHUZO CO,
Ltd., Japan), and 0.5 µM of each primer
(Life Technologies, Inc.). The newly synthesized
complementary DNAs (cDNAs) were denatured at 94 C for 3 min and
amplified by 30 PCR cycles at 94 C for 90 sec; annealed for 90 sec at
the indicated temperature (Table 1
), 72 C
for 90 sec, followed by 72 C for 10 min. The sequences of
oligonucleotide primers are indicated in Table 1. To discard the risk
of amplifying genomic DNA, primers were chosen in different exons of
IGF genes. Control PCR have also been performed in absence of RT. PCR
products were fractionated by electrophoresis on 2% agarose gel.
|
-32P] dCTP
(50 mCi at a specific activity of 3000 Ci/mmol, ICN, Costa Mesa, CA) by
random priming using Ready To Go reaction mix (Pharmacia LKB, Piscataway, NJ). Unincorporated nucleotides were removed by
gel filtration on a Sephadex G50 column. A 40 mer M6P/IGF-2R
oligonucleotide probe TGGACTGCACCTACT TCTTCACATGGGACACTAAATACGCCTGCA
was purchased from Life Technologies, Inc. and labeled by
T4 polynucleotide kinase with
[
-32P] dATP. The blotted membranes were hybridized for 16 h at 42 C with 5 x 107 cpm of the probe. The washes were performed at 65 C as follows: twice in 40 mM Na2HPO4 pH 7.2, 5% SDS for 30 min and twice in 40 mM Na2HPO4 pH 7.2, 1% SDS for 30 min. The blots were exposed for 1 h to phosphorimager.
Statistical analyses
The percentage of each cell population was computed as mean
± SEM of five to six different experiments for each
condition, and tested for normality with the Kolmogoro-Smirno test. The
inhibition and stimulation were computed as percentage of the control,
and analyzed with ANOVA and multicomparative Student’s-Newmann-Keuls
test. Results were considered to be significant at the 0.01 level.
Statistical analyses were carried out with GraphPad Software, Inc. PRISM 2.0 software (San Diego, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, A and B, and 2, A and B). Although RT-PCR
conditions were not quantitative, a striking difference was apparent
between the IGF-2 signals and the other messages. Similar mRNA levels
of IGF-1 (215 bp), IGF-1R (395 bp), M6P/IGF-2R (235 bp) were detected
in all the fetal and postnatal thymi. On the contrary, IGF-2 (356 bp)
mRNA levels declined after birth, but weak signals were still detected
in 7-week old thymi (Fig. 1, A and B). Amplification of GAPDH cDNA (198
bp) was used as an internal standard (Fig. 1C).
|
, D
and E). In the postnatal thymus, IGF-2 transcripts were located in the
outer cortex and in the medulla (Fig. 3, A and B). This distribution of
IGF-2 mRNA labeling corresponds to the distribution of epithelial
components in the thymic subcapsular cortex and medulla. Hybridization
to liver from FD15 was used as positive control (data not shown). The
absence of hybridization of the sense probe (Fig. 3, C and F) confirmed
the specificity of labeling. Thus, our results indicate that IGF-2 mRNA
is expressed mainly in the epithelial component of the murine
thymus.
|
, there was
a marked increase in the four T cell subpopulations during the 1-week
of incubation, indicating that FTOC is an adequate system to analyze T
cell differentiation.
|
Treatment with anti-IGF-2 mAb (3.75 µg/ml) induced a 27% increase of
the frequency of
CD4-CD8-, a 23% decrease
of CD4+CD8+, and a 70%
increase of CD8+ (Fig. 4). No significant change was observed in
the frequency of single CD4+ (Table 3 and Fig 4).
|
|
and Fig. 4). FTOC
treatment with an anti-(pro)insulin mAb did not exert any significant
effect on the total cell number or on T cell differentiation (Table 3). As further controls, FTOC treatment with anti-FSH mAb or with rabbit IgG did not induce any significant change in the cell number or in the relative proportion of the four T cell subpopulations.
Effect of the blockade of IGF-mediated signaling with anti-IGF-R
Abs on T cell differentiation
FD14 thymi were cultured for 1 week in the presence of
anti-M6P/IGF-2R (10 µg/ml) or anti-IGF-1R (3 µg/ml), and the cell
suspensions were analyzed by flow cytometry. The total percentage of
viable cells was not affected by any of the anti-IGF-R Abs tested. FTOC
treated with purified anti-M6P/IGF-2R pAb displayed a 31% decrease in
total cell number. This included a 46% increase of
CD4-CD8- cells and a 34%
decrease of CD4+CD8+ cells.
The proportion of CD4+ and
CD8+cells was not affected (Table 3).
The total cell number in FTOC treated with anti-IGF-1R was decreased by
81%. Treatment with anti-IGF-1R induced a 72% increase of
CD4-CD8- cells, a 33%
decrease of CD4+CD8+ cells,
a 31% decrease of CD4+ and a 30% decrease of
CD8+ cell subsets (Table 3).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The role of the thymus in T cell differentiation may be approached in vitro by murine FTOC. The advantage of this model is that it closely mimics physiological conditions in vivo (34). We checked the daily expression of IGFs and IGF receptors in FTOC and found that these genes were expressed all along the culture period. To investigate the role of IGFs in thymus physiology, IGFs and IGF-receptors were neutralized by specific Abs, and the development of T lymphocytes was analyzed by their expression of CD surface antigens.
The treatment of FTOC with anti-IGF-1 antibody decreased CD4-CD8- cells and increased CD4+CD8+ cells, but did not change the percent of CD4+ and CD8+ cell subsets. These results indicate that IGF-1 could preferentially exert mitogenic effects on immature CD4-CD8- cells and inhibit commitment from the CD4-CD8- to the CD4+CD8+ stage. This hypothesis is reinforced by the fact that GH and IGF-1 have been previously reported to be important in thymocyte proliferation and survival (28, 31, 32). In 9-month-old mice, systemic administration of IGF-1 induced growth of immature thymocytes (Thy-1), with no visible effect on T cell subpopulations (31). An increase in peanut agglutinin receptor binding, a marker of immature thymocytes (both CD4-CD8- and CD4+CD8+) (31) was also observed in IGF-1-treated mice. In addition, IGF-1 treatment induced an increase of both CD4-CD8-and CD4+CD8+ subpopulations in 4-week-old rats (32). The apparent discrepancy between the positive effect of both IGF-1 and anti-IGF-1 Abs on CD4+CD8+ cell number might be explained by the differences in the models used: in vivo IGF-1 administration to rats vs. in vitro treatment of murine FTOC. The absence of IGF-1 Ab effect on the total thymocyte number could be due to the action of IGF-2, which is the thymic dominant member of the insulin family and is not neutralized by anti-IGF-1. Indeed, the residual thymic IGF-2, acting through both IGF-1R and M6P/IGF-2R, could maintain a normal thymocyte proliferation despite the blockade of IGF-1. This is supported by observations made in Snell dwarf mice. These GH- and IGF-1-deficient mice show a severe reduction in splenocyte cell number (45), but only a moderate reduction in the number of thymocytes. This also suggests that IGF-1 could be more important for B-cell development than for T cell differentiation.
Anti-IGF-2 mAb significantly increased the percentage of CD4-CD8- cells, decreased the CD4+CD8+ cells, and increased CD8+ cells. The simultaneous increase of CD4-CD8- cells and decrease of CD4+CD8+ cells reflect the inhibition by anti-IGF-2 mAb of the early differentiation step from CD4-CD8- to CD4+CD8+ cells. This suggests that IGF-2 may be important for differentiation of CD4-CD8- cells into CD4+CD8+ cells and/or the survival of these two populations. In IGF-2 transgenic mice (33) and in IGF-2 transgenic dwarf mice (45), high levels of thymic IGF-2 mRNA correlate with an increase of thymic cellularity and higher numbers of CD4+ T cells. The increase in the percent of CD4+ cells in IGF-2 transgenic mice and in IGF-2 transgenic dwarf mice suggests that CD4+CD8+ cells preferentially differentiate toward CD4+CD8-. These observations are consistent with the increase in the percentage of CD8+ cells that we observed using anti-IGF-2-treatment of FTOC. Anti-IGF-2 treatment also induces a slight decrease in the percentage of CD4+ cell subset, suggesting that thymic IGF-2 might have a role in determining differentiation into the CD4 or CD8 lineage. Taken together, both the transgenic studies and the present data indicate that thymic IGF-2 exerts an important role in early thymocyte differentiation. It must be kept in mind, however, that although we checked the daily expression of IGF and IGF-R genes in fetal thymic lobes during their incubation, the antibodies used in the blocking studies inhibited both the thymic IGFs as well as the FCS-derived IGFs.
Though the (pro)insulin gene is expressed in the thymus (46, 47), the FTOC treatment with an anti-(pro)insulin mAb did not exert any significant effect on the total cell number or T cell differentiation. This result suggests that, at least using this experimental protocol, thymic (pro)insulin may not be essential for T cell development and differentiation. Further studies are needed to decipher the role of thymic (pro)insulin on T cell development.
Compared with control FTOC and with anti-IGFs Ab-treated FTOC, the treatment of cultures with anti-IGF-1R or anti-M6P/IGF-2R Abs induced a decrease of the total cell number by 81 and 31%, respectively, whereas the percentage of viable cells was not affected. This observation further argues that IGF-1R mainly, but also M6P/IGF-2R, control the level of T cell proliferation and/or survival. It also appears that the neutralizing of the IGF receptors exerts a significant influence on the total number of T cells, whereas the blockade of the ligands did not modify this parameter. This shows that IGF-1 and IGF-2 may compensate each other when one is blocked, whereas this is clearly not the case when one IGF receptor is blocked. Besides a classic mitogenic effect, IGFs have also been repeatedly reported to exert anti-apoptotic effects in different cell systems (48, 49, 50). Treatment with anti-IGF-1R induced an increase in the percentage of CD4-CD8- cells, whereas CD4+CD8+ and mature single positive cell percentages decreased. These results show that the IGF-1R is critical for T cell differentiation at distinct stages. Our data also show that the blockade of IGF-1 and IGF-1R induces two opposite directions in T cell differentiation. One plausible explanation would be that IGF-1 locally exerts some antagonistic effect by decreasing the binding of the dominant IGF-2 to the IGF-receptors so that this antagonism would be alleviated through the blockade with anti-IGF-1 Ab.
Anti-M6P/IGF-2R treatment induced a significant increase of the percentage of CD4-CD8- cells, in parallel with a decrease of the percent of CD4+CD8+ cells, while the percentage of single positive cells was not affected. This experiment indicates that M6P/IGF-2R-mediated signaling is involved in T cell differentiation from CD4-CD8- to CD4+CD8+ subtypes. Because M6P/IGF-2R is also known to bind TGFß (21), retinoic acid (22) and IGF-2, additional work is needed to discriminate the effective thymic ligand of M6P/IGF-2R implicated in T cell development. FTOC treatment with TGFß inhibits the growth and differentiation of CD4-CD8- thymocytes (34), whereas retinoic acid (51, 52) impairs the thymocyte maturation from the double negative stage to the double positive stage and increases the frequency of CD4 single positive cells. With regard to the interactions between IGFs and retinoic acid in hematopoiesis, IGF-1 was previously shown to prevent the apoptosis induced by retinoic acid in human promyeloid cells (49).
The strongest effects upon T cell proliferation and differentiation were observed in FTOC treated with anti-IGF-1R mAb. All the members of the insulin family, IGF-1, IGF-2, and insulin itself, are able to bind and activate IGF-1R-mediated signaling. IGF-1, IGF-2, and IGF-1R are highly expressed in fetal and postnatal thymi, and the expression of IGF-1R has been reported on both mature and immature lymphocytes (28, 29, 30). Our study demonstrates that the neutralization of IGF-1R-mediated signaling strongly inhibits T cell proliferation and differentiation in FTOC. This observation is in agreement with the well-known growth and differentiation-promoting activities mediated by this IGF receptor.
In conclusion, this study confirms the existence of a functional IGF axis in the murine thymus. Only the expression of IGF-2 gene significantly varies during development. The blockade of IGF-mediated signaling profoundly disturbs the early steps of T cell differentiation. Because the different components of the IGF axis have also been characterized in the human thymus, the present results might be transposable to the development of human T lymphocytes.
|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received July 4, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  A. N. Vallejo, J. J. Michel, L. K. Bale, B. H. Lemster, L. Borghesi, and C. A. Conover Resistance to age-dependent thymic atrophy in long-lived mice that are deficient in pregnancy-associated plasma protein A PNAS, July 7, 2009; 106(27): 11252 - 11257. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-W. Chu, S. Schmitz, B. Choudhury, W. Telford, V. Kapoor, S. Garfield, D. Howe, and R. E. Gress Exogenous insulin-like growth factor 1 enhances thymopoiesis predominantly through thymic epithelial cell expansion Blood, October 1, 2008; 112(7): 2836 - 2846. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Hansenne, C. Renard-Charlet, R. Greimers, and V. Geenen Dendritic cell differentiation and immune tolerance to insulin-related peptides in igf2-deficient mice. J. Immunol., April 15, 2006; 176(8): 4651 - 4657. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Baudler, J. Baumgartl, B. Hampel, T. Buch, A. Waisman, C. M. Snapper, W. Krone, and J. C. Bruning Insulin-Like Growth Factor-1 Controls Type 2 T Cell-Independent B Cell Response J. Immunol., May 1, 2005; 174(9): 5516 - 5525. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A. Wylie, D. J. Pulford, A. J. McVie-Wylie, R. A. Waterland, H. K. Evans, Y.-T. Chen, C. M. Nolan, T. C. Orton, and R. L. Jirtle Tissue-Specific Inactivation of Murine M6P/IGF2R Am. J. Pathol., January 1, 2003; 162(1): 321 - 328. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. French, S. R. Broussard, W. A. Meier, C. Minshall, S. Arkins, J. F. Zachary, R. Dantzer, and K. W. Kelley Age-Associated Loss of Bone Marrow Hematopoietic Cells Is Reversed by GH and Accompanies Thymic Reconstitution Endocrinology, February 1, 2002; 143(2): 690 - 699. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
