help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bollag, R. J.
Right arrow Articles by Isales, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bollag, R. J.
Right arrow Articles by Isales, C. M.
Endocrinology Vol. 141, No. 3 1228-1235
Copyright © 2000 by The Endocrine Society


ARTICLES

Osteoblast-Derived Cells Express Functional Glucose-Dependent Insulinotropic Peptide Receptors1

R. J. Bollag, Q. Zhong, P. Phillips, L. Min, L. Zhong, R. Cameron, A. L. Mulloy, H. Rasmussen, F. Qin, K. H. Ding and C. M. Isales

Institute of Molecular Medicine and Genetics, Department of Medicine, Medical College of Georgia (R.J.B., Q.Z., P.P., L.M., L.Z., R.C., H.R., F.Q., K.H.D.), and the Augusta Veterans Administration Medical Center (A.L.M., C.M.I.), Augusta, Georgia 30912

Address all correspondence and requests for reprints to: Carlos M. Isales, M.D., Medical College of Georgia, Institute of Molecular Medicine and Genetics, 1120 15th Street, Augusta, Georgia 30912. E-mail: cisales{at}mail.mcg.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Glucose-dependent insulinotropic peptide (GIP) is a 42-amino acid peptide synthesized and secreted from endocrine cells in the small intestine. The role of GIP in coupling nutrient intake and insulin secretion, the incretin effect, is well known. We report that GIP receptor messenger RNA and protein are present in normal bone and osteoblast-like cell lines, and that high affinity receptors for GIP can be demonstrated by [125I]GIP binding studies. When applied to osteoblast-like cells (SaOS2), GIP stimulated increases in cellular cAMP content and intracellular calcium, with both responses being dose dependent. Moreover, administration of GIP results in elevated expression of collagen type I messenger RNA as well as an increase in alkaline phosphatase activity. Both of these effects reflect anabolic actions of presumptive osteoblasts. These results provide the first evidence that GIP receptors are present in bone and osteoblast-like cells and that GIP modulates the function of these cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
BONE MINERALIZATION and demineralization are regulated by several hormones. A primary modulator of these effects is the PTH-vitamin D axis, which is regulated by serum calcium and phosphate levels. In addition, bone formation is known to depend on nutrient uptake, but how this is controlled is largely unknown.

A number of hormones whose levels depend on nutritional status are known to impact bone metabolism. For example, insulin, released from the ß-cells of the pancreatic islets in response to meal ingestion engenders bone matrix deposition and mineralization (1, 2). Another hormone secreted by ß-cells, amylin, has also been shown to impact calcium homeostasis by inhibiting bone resorption, thereby reducing serum calcium and increasing bone mass (3, 4, 5). The possible role of gut-derived peptide hormones in bone homeostasis, however, has not been addressed.

Glucose-dependent insulinotropic peptide (GIP) is one such hormone, initially identified as a duodenal hormone with potential to inhibit gastric acid secretion (6). Subsequently, the 42-amino acid active form of GIP was shown to inhibit amylase release from acinar cells of the pancreas and to modulate insulin secretion from ß-cells in response to elevations in ambient glucose (7). Based on its insulinotropic action, GIP is classified as one of the two main incretin hormones, the other being glucagon-like polypeptide-1 (GLP-1). GIP not only potentiates insulin release, but also stimulates amylin release from the ß-cells of the pancreas, and in this way may potentially modulate bone turnover (5). In addition to the well characterized incretin effect in the pancreas (7), GIP has been shown to activate adipocytes (8), to modulate hepatic blood flow (9), and to inhibit acid secretion in the stomach (10). The receptor for GIP falls into the subclass of seven-transmembrane domain-spanning G protein-coupled receptors that includes receptors for PTH, calcitonin, and several other peptide hormones (11). As a receptor in this class, the GIP receptor (GIPR) is able to activate both cAMP-activated pathways as well as the phosphoinositide/Ca2+-dependent signaling systems. The GIPR localizes not only to the exocrine pancreas, but also to a wide range of tissues and organs, including the distal small bowel, pituitary gland, adrenal cortex, heart, brain, adipose tissue, and endothelial cells in several vascular beds (11).

In the present study we show that GIPRs are present in bone cells, including osteoblasts and osteocytes in bone proper as well as in osteoblast-like osteosarcoma cell lines. We show that these cell lines respond to GIP at physiological levels with metabolic responses exhibited by differentiated bone cells, namely enhanced collagen synthesis and alkaline phosphatase (ALP) activity. Finally, we propose that GIP could serve to coordinate nutrient intake in the intestine with nutrient disposal in a variety of peripheral tissues including bone.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Forskolin, 3-isobutyl-methylxanthine (IBMX), and EGTA were purchased from Sigma (St. Louis, MO); ionomycin was obtained from Calbiochem (San Diego, CA); fura-2/acetoxymethyl ester (fura-2/AM) was purchased from Molecular Probes, Inc. (Eugene, OR); the [125I]cAMP RIA kit was obtained from Biomedical Technologies (Stoughton, MA). Full-length human GIP-(1–42) was obtained from Peninsula Laboratories, Inc. (Belmont, CA). The iodinated derivative, [125I]GIP, was obtained from Amersham Pharmacia Biotech (Arlington Heights, IL). All other chemicals used were of reagent grade.

Cell culture
The cell lines studied in this report included SaOS2, MG63, ROS 17/2.8, HeLa, and NIH-3T3 fibroblasts. Normal primary human osteoblasts were also used (Clonetics, San Diego, CA). Cells were grown to confluence in MEM, RPMI, or DMEM as appropriate (BioWhittaker, Inc., Walkersville, MD), supplemented with 10% FCS (vol/vol; HyClone Laboratories, Inc., Logan, UT), penicillin (100 U/ml), streptomycin (100 mg/ml), and amphotericin (3 mg/ml), and were used 3–7 days postconfluence. For studies on collagen type I expression, SaOS2 cells were grown in a glutamine-free medium, because we found that glutamine increased constitutive collagen expression levels.

Western analyses
A polyclonal antibody was generated in rabbits to a synthetic oligopeptide, SKGQTAGELYQRWERYRREC, corresponding to an extracellular region of the human GIPR protein sequence. The oligopeptide was conjugated to keyhole limpet hemocyanin using an Imject maleimide-activated immunogen conjugation kit (Pierce Chemical Co., Rockford, IL), and was inoculated into rabbits (Animal Pharm Services, Inc., Healdsburg, CA). The serum was affinity purified on oligopeptide-BSA cross-linked to cyanogen bromide-Sepharose, and the antibody was assessed by Western blot analysis to bacterially expressed GIPR protein. The specificity of the primary antibody was tested by competitively displacing the GIPR primary antibody binding in SaOS2 cells with primary antibody in the presence of an excess (140 µg) of the GIPR peptide antigen used to generate the primary antibody.

Confluent bone cells (500,000/pair of lanes) were scraped into ice-cold PBS (pH 7.4) and disrupted by sonication for 60 sec in ice-cold homogenization buffer [60 mM Tris buffer (pH 7.4), 0.25 M sucrose, 10 mM EGTA, 2 mM EDTA, 10 mM ß-mercaptoethanol, and protease inhibitors]. Proteins were placed in sample buffer [0.5 M Tris (pH 6.8), 4% SDS, 20% glycerol, and 0.1% bromophenol blue] and boiled.

The denatured proteins were separated by SDS-PAGE and incubated with affinity-purified GIPR antibody at a 1:250 dilution. Immunoreactive bands were visualized with a horseradish peroxidase-conjugated secondary goat antirabbit serum and developed with enhanced chemiluminescence (Pierce Chemical Co.).

Indirect immunofluorescence
For the animal studies, 3-month-old Sprague Dawley rats (Charles River Laboratories, Inc., Wilmington, MA) were killed, and tissue was removed. This protocol was approved by the Medical College of Georgia animal care committee. Rats were anesthetized and perfused transcardially with 4% paraformaldehyde and 0.2% glutaraldehyde. Tibiae and vertebrae were harvested and fixed in 4% paraformaldehyde overnight at 4 C. The bones were decalcified in 10% EDTA for 4–6 days, dehydrated in ethanol and xylene, and embedded in paraffin. Seven-micron thick sections were cut, deparaffined, and rehydrated.

SaOS2 and MG63 cells were plated on glass coverslips, grown in DMEM supplemented with 10% FCS for 48 h, and fixed in ice-cold 4% paraformaldehyde-PBS (137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2PO4, 1.15 mM KH2PO4, and 1 mM MgSO4, pH 7.4) for 30 min. Cells were then rinsed three times for 5 min each time in PBS and transferred into PBS-NH4Cl (50 mM) for 15 min. After rinsing, the fields were covered with PBS-BSA (100 mg/10 ml) for 15 min (blocking buffer). The cells were then incubated with the GIP antibody in 500 µl PBS-BSA for 45 min. The cells were rinsed and then covered with secondary antibody, Cy3 goat antimouse IgG (5 µl; Molecular Probes, Inc.), and visualized by epifluorescence (Axiophot microscope, Carl Zeiss, Inc., Thornwood, NY).

The immunohistochemical localization analyses were carried out using the Vectastain ABC peroxidase system with 3,3'-diaminobenzidine as the peroxidase substrate (Vector Laboratories, Inc., Burlingame, CA). Developed slides were dehydrated in ethanol, cleared in xylene, and counterstained in hematoxylin (Vector Laboratories, Inc.).

Receptor binding studies
Receptor binding studies were performed as previously described (12). Briefly SaOS2, MG63, or NIH-3T3 fibroblasts were grown in six-well plates and incubated with increasing concentrations of [125I]GIP (Amersham Pharmacia Biotech) in the presence or absence of an excess of unlabeled GIP (1 µM) for 2 h at room temperature. Cells were then washed three times with 1 ml cold PBS (plus 0.05% BSA) and solubilized with 0.3 M NaOH. The extract was counted in a {gamma}-counter, and background counts were subtracted. Experiments were performed in triplicate.

Intracellular calcium measurements with fura-2
Intracellular calcium measurements were made as previously described (13). Briefly, SaOS2 cells were grown on glass coverslips. Cells were loaded with the calcium-sensitive dye fura-2/AM in KRB. After approximately 30 min at room temperature to allow esterase cleavage of fura-2/AM to fura-2, the coverslips were placed in a cuvette in a dual wavelength spectrophotometer (Photon Technologies International, South Brunswick, NJ). Fluorescence was measured using excitation wavelengths of 340 and 380 nm and an emission wavelength of 510 nm. After 200 sec to allow baseline stabilization, cells were stimulated by appropriate concentrations of GIP as indicated in Fig. 4AGo. Measurements were subsequently collected for an additional 800 sec, and peak calcium levels were determined by convention as follows: minimum emission (Rmin) was measured upon addition of EGTA (4 mM) buffered with Tris (pH 8.0) followed by addition of the calcium ionophore, ionomycin (50 µM). Maximum emission (Rmax) was measured upon addition of 12 mM calcium chloride. The free intracellular calcium concentration was then calculated using the equation [Ca2+] = Kd x b(R - Rmin)/(Rmax - r) (14). Autofluorescence was measured in unloaded cells, and this value was subtracted from all measurements.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. GIP increased intracellular Ca2+ and cAMP in a dose-dependent manner in SaOS2 cells. A, SaOS2 cells were grown on glass coverslips, loaded with the fluorescent calcium-sensitive probe fura-2, and stimulated with increasing doses of GIP. Peak increases in intracellular calcium from four different experiments were calculated. Data are expressed as the mean ± SEM. *, P < 0.01; B, SaOS2 cells were grown in six-well plates as described above, preincubated with the phosphodiesterase inhibitor IBMX (1 mM for 10 min), and stimulated with increasing doses of GIP (10 min). Cellular cAMP was measured with a commercially available RIA (Biomedical Technologies). Data are expressed as the mean ± SEM; *, P < 0.01. Each bar represents data from three experiments performed in triplicate (n = 9).

 
RT-PCR
Transcript levels for GIPR and GLP-1R were determined by RT-PCR. Total RNA was isolated using Trizol reagent (Life Technologies, Inc.). First strand cDNA was reverse transcribed from 15 µg total RNA using a cDNA synthesis kit from Invitrogen (San Diego, CA). PCR amplification was performed in a 50-µl volume, which contained 200 µM deoxy-NTP, 0.2 µM primers, 1.5 mM MgCl2 300 ng first strand cDNA, and 0.02U/ml Taq polymerase and subjected to initial denaturation at 94 C for 2 min, followed by 35 cycles of 94 C for 30 sec, 65 C for 30 sec, and 72 C for 1 min. The GIPR was amplified with GIPR-F (CTGCCTGCCGCACGGCCCAGAT) and GIPR-R (GCGAGCCAGCCTCAGCCGGTAA), whereas the GLP-1 receptor was amplified with GLP1R-F (AGCACCAGTGGGATGGGCTCCTCT) and GLP1R-R (GCTGCTGGTGGGACACTTGAGGGG). The primers for GLP-1R match the human sequence perfectly, whereas there is a single mismatch with the mouse sequence at nucleotide 2 of GLP1R-F that does not interfere with PCR amplification. Mouse lung cDNA served as a positive control for GLP-1R and brain cDNA for GIPR.

cAMP measurements
cAMP measurements were performed as previously described (15). Briefly, SaOS2 cells were grown to confluence in 60-mm2 dishes and placed in KRB for 24 h before use. To facilitate the measurement of cAMP production, 1 mM IBMX was added for 10 min before agonist addition, followed by incubation with vehicle (control) or with GIP at concentrations ranging from 0.1 nM to 1 µM for 10 min. Incubations were stopped by addition of 5% trichloroacetic acid and left on ice for 15 min, and the cell extract was collected. The extracts were neutralized by the addition of a 1:1 solution of ice-cold freon/tri-N-octylamine (4:1, vol/vol). Each sample was vortexed for at least 30 sec to ensure adequate mixing. The mixture was then centrifuged at 2500 rpm for 20 min at 4 C. The top aqueous phase containing cAMP was collected. The pH of the upper phase was checked to ensure adequate neutralization. The samples were stored at -70 C until analysis. cAMP was measured using a commercially available RIA (Biomedical Technologies). All incubations were performed in triplicate, and each experiment was repeated three times using different cell preparations.

Preparation of RNA and Northern blot analysis
Total RNA was extracted from cells using Trizol (Life Technologies, Inc.). RNA was stored at -70 C until use. RNA (20 µg/lane) was electrophoresed on a 1.2% agarose-formaldehyde gel and transferred to a nylon filter. The blots were hybridized overnight at 65 C with a 32P-labeled probe (106 cpm/ml), labeled by the random priming method, and washed at maximum stringency. Hybridization was carried out in a solution of 7% SDS, 1% BSA, 1 mM EDTA, and 250 mM Na2HPO4. The hybridized filters were washed with four 5-min washes of 2 x SSC/0.1% SDS at room temperature and twice in 0.1 x SSC/0.1% SDS for 30 min at 65 C. The blots were then exposed to Kodak XAR 5 film (Eastman Kodak Co., Rochester, NY). The probes used were glyceraldehyde-3-phosphate dehydrogenase (American Type Culture Collection, Manassas, VA; clone 57090), collagen I{alpha} (i.m.a.g.e. clone 308919), and a human GIPR fragment derived by PCR corresponding to transmembrane domains 2–7.

ALP activity
ALP activity was measured using a commercially available assay kit (ALP EC 3.1.1.1 colorimetric test, Sigma). This kit measures the conversion of p-nitrophenyl phosphate to p-nitrophenol and inorganic phosphate. The change in absorbance at 405 nm is directly proportional to ALP activity. MG63 cells were grown in six-well plates and incubated with the indicated agonist for the indicated times (medium was changed daily with readdition of fresh agonist), and samples were collected. The kit reagents were added to the sample cuvette in the spectrophotometer at 30 C, and absorbances at 405 nm were obtained at 1, 2, and 3 min. ALP activity (units per liter) was determined using the change in absorbance with time and a millimolar absorptivity of p-nitrophenol at 405 nm of 18.45.

Statistics
Results are expressed as the mean ± SEM. Data were analyzed using either ANOVA or unpaired t tests, where appropriate, with a commercial statistical package (Instat, GraphPad Software, Inc., San Diego, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GIPR message and protein are expressed by osteoblasts
Because the published survey of organs expressing GIPRs did not include bone (11), we sought to determine whether receptors were present in bone. Receptor messenger RNA (mRNA) was detected in two cultured human osteoblast-like cell lines, SaOS2 and MG63, by Northern analysis and RT-PCR (data not shown). As GIP is one of two incretin hormones known to modulate insulin secretion, we tested whether receptors for the other incretin hormone, GLP-1, were present on bone cells. We did not detect GLP-1 receptors in the osteoblast-like cell lines by RT-PCR (data not shown), suggesting that of the incretins, GIP alone has receptors in bone. Because mRNA expression does not always correlate with protein expression, we evaluated the distribution of GIPR protein in bone. We generated an affinity-purified polyclonal antibody to a peptide comprising part of the N-terminal extracellular domain of the human GIPR and surveyed protein expression in a variety of cells and tissues by Western blot analysis. As a positive control, we purified a recombinant bacterially expressed protein corresponding to the amino-terminus of the GIPR fused to GST. Three osteoblast-like cell lines (SaOS2, ROS 17/2.8, and MG63) contain a single immunoreactive band that corresponds to the predicted size of the GIPR. In contrast, two cell lines known not to contain the GIPR (HeLa and NIH-3T3 fibroblasts) do not contain this immunoreactive band (Fig. 1AGo). Protein extracts from several tissues from a normal Sprague Dawley rat were prepared and probed with the GIPR antibody by Western blot (Fig. 1BGo). The same 50-kDa immunoreactive band was observed in normal rat bone. In addition, the pancreas, brain, and heart, tissues previously reported to contain the GIPR (11), were positive; whereas the spleen, which has been reported not to contain the GIPR (11), did not contain any immunoreactive band, thus suggesting antibody specificity.



View larger version (62K):
[in this window]
[in a new window]
 
Figure 1. The GIPR was present in bone and osteoblast-like cells. An affinity-purified polyclonal GIPR antibody was used for Western blot analysis. The upper panel demonstrates that three osteoblast-like cells lines (SaOS2, ROS 17/2.8, and MG63) all contain a single immunoreactive band of around 50 kDa in size, which corresponds to the predicted size of the mature GIPR (n = 5). A recombinant amino-terminal fragment of the human GIPR was used as a positive control. In contrast, neither HeLa cells nor NIH-3T3 fibroblasts (which do not contain GIPR mRNA) have a corresponding immunoreactive band. Shown in the lower panel is a Western blot of rat tissue homogenates, demonstrating that GIPR is also present in normal rat bone. GIPR is known to be present in rat pancreas, brain, and heart and is known to be absent in spleen (11 ).

 
Employing the same affinity-purified antibody, further studies were carried out using indirect immunofluorescence (Fig. 2Go). In normal rat bone both osteocytes and osteoblasts demonstrated intense fluorescence (Fig. 2AGo). This staining pattern was comparable to that seen by in situ hybridization for GIPR mRNA (data not shown). In contrast, rat bone did not demonstrate any cell labeling when incubated only with the secondary antibody (Fig. 2BGo). SaOS2 cells also demonstrated intense nonnuclear fluorescence (Fig. 2CGo), which could be blocked by the presence of an excess of the antigen used to generate the antibody (Fig. 2DGo). This result indicates the specific binding of the antibody to the GIPR. MG63 cells also demonstrated intense fluorescence (Fig. 2EGo) with a pattern similar to that of SaOS2 cells. As an additional control, MG63 cells were labeled only with the secondary antibody (Fig. 2FGo), demonstrating the specificity of the primary antibody. Although MG63 and SaOS2 cells are transformed cells derived from human osteosarcomas, we sought to determine whether, as expected from the observations presented in Fig. 2AGo, normal human osteoblasts would also stain positively with our GIPR antiserum. As shown in Fig. 2GGo, primary cultures of normal human osteoblasts show positive signal with anti-GIP-R antiserum, albeit with lower intensity than the transformed cells. A control with secondary antibody alone (Fig. 2HGo) shows that the signal is specific.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 2. GIPR was localized by immunohistochemistry and by indirect immunofluorescence to osteoblasts and osteocytes. Sections of rat vertebrae were sectioned, fixed, and probed with the GIPR antibody as the primary antibody and then labeled with peroxidase (positive cells are shown in brown; magnification, x10; A). Similar patterns of expression were found in rat tibiae (data not shown). Shown in B is a bone section labeled with only the secondary antibody. SaOS2 cells grown in culture were also labeled with GIPR antibody (magnification, x40; C). Shown in D are SaOS2 cells incubated with primary antibody in the presence of an excess (140 µg) of the GIPR peptide antigen used as an antigen to generate the antibody. MG63 cells also were strongly positive (magnification, x40; E), with a labeling pattern similar to that of SaOS2 cells. Shown in F is fluorescence only in the presence of the secondary antibody. Normal primary human osteoblasts were also positive for the GIPR (magnification, x20; G). Shown in H are human osteoblasts incubated with only the secondary antibody.

 
To further characterize the GIPRs, we examined binding of radiolabeled [125I]GIP to a variety of osteoblast-like cell lines (Fig. 3Go). The osteoblast-like cell lines SaOS2 and MG63 displayed high affinity binding sites, whereas the 3T3 fibroblasts showed minimal background binding effects. The biological efficacy of the radiolabeled GIP was verified by monitoring intracellular Ca2+ mobilization. Radiolabeled GIP at 1 nM elicited an elevation in intracellular Ca2+ in SaOS2 cells comparable to that observed with unlabeled agonist (data not shown). This is consistent with the idea that the binding sites identified in Fig. 3Go are physiologically relevant. Both MG63 and SaOS2 cells had similar Kd values of approximately 0.3 nM, although the binding capacity in MG63 cells was greater than that in SaOS2 cells.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. [125I]GIP specifically bound to osteoblast-like cells. MG-63, SaOS2, or NIH-3T3 fibroblast cells were grown to confluence in six-well plates. Cells were incubated with increasing concentrations of labeled [125I]GIP in the presence or absence of an excess of unlabeled GIP. Background counts were subtracted to obtain specific binding. MG63 ({blacksquare}) demonstrated specific high affinity binding, whereas NIH-3T3 ({blacktriangledown}) cells demonstrated no specific binding. SaOS2 ({square}) demonstrated GIP binding with an affinity similar to that of MG63, but total binding was lower. Shown in the insets are the Scatchard plots for binding in MG63 (A) and SaOS2 (B).

 
GIP activates both cAMP and Ca2+-dependent signal transduction pathways
To address the function of these GIPRs in signal transduction, we initially examined the signaling pathways normally engaged by the GIPR. Receptors for GIP, like those for PTH, are members of a subclass of seven-transmembrane domain-spanning receptors that couple simultaneously to both adenylyl cyclase and phosphoinositide-specific phospholipase C signal transduction pathways (16). As shown in Fig. 4Go, GIP indeed increased both the cytosolic calcium concentration and the cellular cAMP content in SaOS2 cells. The calcium response shows a dose-dependent increase in Ca2+, with a significant increase occurring at 0.1 nM GIP (Fig. 4AGo). GIP at concentrations of 1 nM and above was able to significantly stimulate elevations in cellular cAMP content (Fig. 4BGo). These elevations reached 710% above the control level at a GIP concentration of 1 µM.

GIP stimulates collagen {alpha}(I) gene expression and activates ALP activity in osteoblast-like cells lines
While the GIPR coupled to signaling events in bone cells, an issue still unanswered was the possible role of GIP in normal bone cell biology. To address this issue, we examined the effect of GIP on two anabolic indexes of bone formation: new matrix synthesis and ALP activity in osteoblast-like cells.

We initially determined whether GIP could stimulate collagen type I expression in SaOS2 cells (Fig. 5Go). SaOS2 cells were stimulated with increasing concentrations of GIP, and collagen type I expression was assessed by Northern blot and quantitated by densitometry. GIP, at a concentration of 1 nM or above, stimulated the expression of type 1 collagen, a marker for bone formation (Fig. 5Go, A and B). This GIP effect appeared to show a threshold effect, as no further increases in collagen type I expression were seen at the higher GIP concentrations. Since collagen is the primary constituent of bone matrix, the ability to effect collagen synthesis is consistent with an anabolic effect of GIP on bone. To examine this issue further, we monitored the time course of the GIP effect on collagen synthesis using the dose (1 nM) determined to be maximally effective in the previous experiment. The GIP effect on collagen mRNA could be observed after 6 h of stimulation, with no further increases observed at the later time points (Fig. 5CGo).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 5. GIP increased expression of type I collagen. A, SaOS2 cells were grown in T-75 flasks and stimulated with the indicated dose of GIP for 24 h (culture medium was replaced with fresh GIP containing medium every 8 h). After 24 h, total RNA was extracted and probed with a collagen type I-specific probe. Shown in A is a Northern blot; collagen type I has two bands identified by the arrows. The autoradiographs were then scanned, and densitometry was quantified (B) on a Sun Sparc station (Sun Microsystems, Palo Alto, CA) using Bioimage software (Bio Image, Ann Arbor, MI) (n = 4; *, P < 0.001). The collagen densitometry was normalized to glyceraldehyde-3-phosphate dehydrogenase. C, SaOS2 cells were grown in T-75 flasks as described above, stimulated with 1 nM GIP for the various time points as indicated, and subjected to Northern analysis. Shown in C is a representative Northern blot from four different experiments. D, The densitometry of four different experiments was summed and is expressed as a bar graph. *, P < 0.001 vs. control.

 
In addition to collagen type I synthesis, another index of anabolic activity in bone is ALP activity. We evaluated the effect of GIP on ALP activity in the MG63 cell line. This cell line displays an abundance of GIPRs in receptor binding studies (Fig. 3Go). As shown in Fig. 6Go, GIP at a concentration of 0.1 nM significantly increased ALP activity as early as 2 days after stimulation and continued to increase ALP activity after 6 days of GIP exposure. Higher doses of GIP (1–10 nM) did not increase ALP activity any further than 0.1 nM GIP. The GIP effect on ALP was larger than that observed with 1,25-dihydroxyvitamin D3 (10 ng/ml) and transforming growth factor-ß (10 ng/ml), which were used as a positive control. Hence, GIP is a potent inducer of ALP activity.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 6. GIP increased alkaline phosphatase activity in osteoblast-like cells. MG63 cells were grown to confluence in six-well plates stimulated with 0.1 nM GIP for the indicated times, the reaction was stopped, and ALP activity was measured using a commercially available kit. Shown are the mean ± SEM of triplicate determinations of four different experiments. *, P < 0.05; +, P < 0.001.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The current study demonstrates that GIPRs are present in normal rat bone, in osteoblasts and osteocytes, and in established osteoblast-like cell lines. The presence of these receptors in bone and in osteoblast-derived cells was demonstrated in two ways: 1) mRNA for the GIPR was detected in cell lines and by in situ hybridization in osteoblasts and osteocytes in bone (data not shown); and 2) the protein was observed by both Western blot analysis and indirect immunofluorescence in bone and in cell lines. Furthermore, the existence of GIPRs in bone cells was specific, as a related receptor for another incretin hormone, GLP-1 (17, 18), was not found. In addition, the receptors for GIP appear to be functional, in that they bind the hormone. In fact, we observed an affinity of approximately 0.3 nM, a value comparable to that seen previously in pancreatic ß-cells [0.3–30 nM depending on the cell system and the source of GIP (human vs. porcine)] (19). In addition, this binding affinity is in the physiological range of concentrations of GIP achieved in serum postprandially (see below).

The functionality of the GIPRs in osteoblast-derived cells was also demonstrated by their ability to couple to signal transduction pathways. Like other related seven-transmembrane receptors, the GIPR in osteoblast-like cells appears to couple to both cAMP and phosphoinositide signaling pathways. In fact, the phosphoinositide response demonstrated greater potency, in that a significant effect was observed at 0.1 nM GIP vs. 1 nM for changes in cAMP content. The large increases in intracellular calcium concentration seen with the lower doses of GIP in osteoblast-like cells were unexpected based on previous studies with pancreatic ß-cell lines (16). Although GIP has been reported to increase extracellular calcium influx and to induce calcium mobilization from intracellular stores in pancreatic islets and cell lines, elevations in cAMP content have been considered the main intermediary in the incretin effect of GIP on glucose-induced insulin secretion (16, 20). One caveat, however, is that the cAMP measurements in the present study were of total cellular content; it is possible that localized changes in cAMP may occur to trigger cAMP-dependent protein kinase activation at lower concentrations of GIP.

The GIPRs were also functional, in that ligand binding elicited cellular responses. Thus, treatment with GIP resulted in increased collagen type I mRNA expression and ALP activity. One area of concern is whether the concentrations of GIP used for the present study are physiologically relevant. The reported basal GIP concentration varies between 0.06–0.1 nM. After a meal, GIP levels increase rapidly to reach levels of between 0.2–0.5 nM (21, 22, 23, 24, 25, 26). GIP-induced changes in intracellular calcium and effects on ALP activity could be observed with GIP concentrations as low as 0.1 nM, well within the physiological range. However, changes in collagen type I expression required higher concentrations of GIP (>=1 nM), slightly above the normal physiological range. This discrepancy may be related to limitations in the sensitivity of this assay system itself and/or to the use of an established cell line.

In view of the present data demonstrating functional GIPRs on bone-derived cells, the question then becomes: does GIP play a role in normal bone physiology? It is known that changes in the nutritional state of the organism influence skeletal homeostasis. A reduction in caloric intake rapidly inhibits linear growth (27). If the reduced caloric intake is accompanied by a reduced calcium intake, a shift in the balance between bone formation and resorption occurs, such that bone mass decreases over time (28). Nutrient-induced elevations of both insulin and amylin have been implicated in normal bone metabolism (3, 29, 30), and the ability of GIP to enhance the secretion of both hormones may contribute to an anabolic action of GIP on bone. However, based on our demonstration of GIPRs in bone cells and direct effects of GIP on bone-derived cells, we propose that GIP may serve directly to coordinate nutrient utilization by bone in addition to its incretin effects on insulin secretion. Thus, we speculate that the role of GIP in bone is analogous to that of insulin in other tissues in the body; when food is consumed, the rise in nutrient concentrations in the blood/gut stimulates insulin/GIP release, which then permits nutrient utilization by various insulin/GIP-sensitive tissues. Specifically, GIP may signal bone cells that nutrients are available for matrix deposition, thus allowing new bone formation.

In summary, GIPRs are present in bone and bone-derived cells, and stimulation of these cells with GIP results in increases in intracellular calcium levels, cellular cAMP content, type 1 collagen expression, and ALP activity. The physiological significance of these findings remains to be clarified, but we propose that GIP may be involved in an entero-osseous axis, in which GIP coordinates nutrient utilization for bone formation through direct effects of the hormone on osteoblasts.


    Acknowledgments
 
We thank Jamie Cranford for editorial assistance, and Kimberly Crawford for technical assistance.


    Footnotes
 
1 This work was supported by NIH Grants DK-19813 (to C.M.I.) and HD-34149 (to R.J.B.) and an American Heart Southeast Affiliate Grant-in-Aid (to C.M.I.). Back

Received September 17, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Piepkorn B, Kann P, Forst T, Andreas J, Pfutzner A, Beyer J 1997 Bone mineral density and bone metabolism in diabetes mellitus. Horm Metab Res 29:584–591[Medline]
  2. Canalis E, McCarthy TL, Centrella M 1991 Growth factors and cytokines in bone cell metabolism. Annu Rev Med 42:17–24[CrossRef][Medline]
  3. Cornish J, Callon KE, King AR, Cooper GJ, Reid IR 1998 Systemic administration of amylin increases bone mass, linear growth, and adiposity in adult male mice. Am J Physiol 275:E694–E699
  4. Cornish J, Callon KE, Lin CQ, Xiao CL, Mulvey TB, Coy DH, Cooper GJ, Reid Ir 1998 Dissociation of the effects of amylin on osteoblast proliferation and bone resorption. Am J Physiol 274:E827–E833
  5. Zaidi M, Shankar VS, Huang CL-H, Paizanas M, Bloom SR 1993 Amylin in bone conservation: current evidence and hypothetical considerations. TEM 4:255–259
  6. Brown JC, Mutt V, Pederson RA 1970 Further purification of a polypeptide demonstrating enterogastrone activity. J Physiol 209:57–64[Abstract/Free Full Text]
  7. Fehmann HC, Goke R, Goke B 1995 Cell and molecular biology of the incretin hormones glucagon-like peptide-I and glucose-dependent insulin releasing polypeptide. Endocr Rev 16:390–410[Abstract/Free Full Text]
  8. Yip RG, Boylan MO, Kieffer TJ, Wolfe MM 1998 Functional GIP receptors are present on adipocytes. Endocrinology 139:4004–4007[Abstract/Free Full Text]
  9. Kogire M, Inoue K, Sumi S, Doi R, Takaori K, Yun M, Fuji N, Yajima H, Tobe T 1988 Effects of synthetic human gastric inhibitory polypeptide on splanchnic circulation in dogs. Gastroenterology 95:1636–1640[Medline]
  10. Nauck MA, Bartels E, Orskov C, Ebert R, Creutzfeldt W 1992 Lack of effect of synthetic human gastric inhibitory polypeptide and glucagon-like peptide 1 [7–36 amide] infused at near-physiological concentrations on pentagastrin-stimulated gastric acid secretion in normal human subjects. Digestion 52:214–221[Medline]
  11. Usdin TB, Mezey E, Button DC, Brownstein MJ, Bonner TI 1993 Gastric inhibitory polypeptide receptor, a member of the secretin-vasoactive intestinal peptide receptor family, is widely distributed in peripheral organs and the brain. Endocrinology 133:2861–2870[Abstract/Free Full Text]
  12. Orloff JJ, Ganz MB, Nathanson MH, Moyer MS, Kats Y, Mitnick M, Behal A, Gasalla-Herraiz J, Isales CM 1996 A midregion parathyroid hormone-related peptide mobilizes cytosolic calcium and stimulates formation of inositol trisphosphate in a squamous carcinoma cell line. Endocrinology 137:5376–5385[Abstract]
  13. Gasalla-Herraiz J, Rhee S, Isales CM 1995 Calcium-sensitive probes for the measurement of intracellular calcium: effects of buffer system and magnesium concentration. Biochem Biophys Res Commun 214:373–388[CrossRef][Medline]
  14. Grynkiewicz G, Poenie M, Tsien R 1985 A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem 260:3440–3450[Abstract/Free Full Text]
  15. Isales CM, Barrett PQ, Brines M, Bollag W, Rasmussen H 1991 Parathyroid hormone modulates angiotensin II-induced aldosterone secretion from the adrenal glomerulosa cell. Endocrinology 129:489–495[Abstract/Free Full Text]
  16. Lu M, Wheeler MB, Leng XH, Boyd AE 1993 The role of the free cytosolic calcium level in ß-cell signal transduction by gastric inhibitory polypeptide and glucagon-like peptide I(7–37). Endocrinology 132:94–100[Abstract/Free Full Text]
  17. Dunphy JL, Taylor RG, Fuller PJ 1998 Tissue distribution of rat glucagon receptor and GLP-1 receptor gene expression. Mol Cell Endocrinol 141:179–186[CrossRef][Medline]
  18. Bullock BP, Heller RS, Habener JF 1996 Tissue distribution of messenger ribonucleic acid encoding the rat glucagon-like peptide-1 receptor. Endocrinology 137:2968–2978[Abstract]
  19. McIntosh CH, Wheeler MB, Gelling RW, Brown JC, Pederson RA 1996 GIP receptors and signal-transduction mechanisms. Acta Physiol Scand 157:361–365[CrossRef][Medline]
  20. Dillon JS, Tanizawa Y, Wheeler MB, Leng XH, Ligon BB, Rabin DU, Yoo-Warren H, Permutt MA, Boyd AE 1993 Cloning and functional expression of the human glucagon-like peptide-1 (GLP-1) receptor. Endocrinology 133:1907–1910[Abstract/Free Full Text]
  21. Herrmann C, Goke R, Richter G, Fehmann HC, Arnold R, Goke B 1995 Glucagon-like peptide-1 and glucose-dependent insulin-releasing polypeptide plasma levels in response to nutrients. Digestion 56:117–126[Medline]
  22. Schirra J, Katschinski M, Weidmann C, Schafer T, Wank U, Arnold R, Goke B 1996 Gastric emptying and release of incretin hormones after glucose ingestion in humans. J Clin Invest 97:92–103[Medline]
  23. Fieseler P, Bridenbaugh S, Nustede R, Martell J, Orskov C, Holst JJ, Nauck MA 1995 Physiological augmentation of amino acid-induced insulin secretion by GIP and GLP-I but not by CCK-8. Am J Physiol 268:E949–E955
  24. Lacroix A, Bolte E, Tremblay J, Dupre J, Poitras P, Fournier H, Garon J, Garrel D, Bayard G, Taillefer R, Flanagan RJ, Hamet P 1992 Gastric Inhibitory Polypeptide-dependent cortisol hypersecretion: a new cause of Cushing’s syndrome. N Engl J Med 327:974–980[Abstract]
  25. Gama R, Norris F, Wright J, Morgan L, Hampton S, Watkins S, Marks V 1996 The entero-insular axis in polycystic ovarian syndrome. Ann Clin Biochem 33:190–195
  26. Kruszynska YT, Ghatei MA, Bloom SR, McIntyre N 1995 Insulin secretion and plasma levels of glucose-dependent insulinotropic peptide and glucagon-like peptide 1 [7–36 amide] after oral glucose in cirrhosis. Hepatology 21:933–941[CrossRef][Medline]
  27. Heinrichs C, Colli M, Yanovski JA, Laue L, Gerstl NA, Kramer AD, Uyeda JA, Baron J 1997 Effects of fasting on the growth plate: systemic and local mechanisms. Endocrinology 138:5359–5365[Abstract/Free Full Text]
  28. Kuramitsu N, Matsui T, Yano H, Kawashima R 1985 The influence of protein and/or energy deficiency on the growth of long bone in rats. J Nutr Sci Vitaminol 31:189–196
  29. Canalis E 1983 Effect of hormones and growth factors on alkaline phosphatase activity and collagen synthesis in cultured rat calvariae. Metabolism 32:14–20[CrossRef][Medline]
  30. Kream BE, Smith MD, Canalis E, Raisz LG 1985 Characterization of the effect of insulin on collagen synthesis in fetal rat bone. Endocrinology 116:296–302[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
IBMS BoneKEyHome page
J. Cornish, J. L. Costa, and D. Naot
The Bone-Fat Mass Relationship: Laboratory Studies
IBMS BoneKEy, September 1, 2009; 6(9): 311 - 322.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
W. Kim and J. M. Egan
The Role of Incretins in Glucose Homeostasis and Diabetes Treatment
Pharmacol. Rev., December 1, 2008; 60(4): 470 - 512.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. Salehi, B. A. Aulinger, and D. A. D'Alessio
Targeting {beta}-Cell Mass in Type 2 Diabetes: Promise and Limitations of New Drugs Based on Incretins
Endocr. Rev., May 1, 2008; 29(3): 367 - 379.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Yamada, Y. Yamada, K. Tsukiyama, K. Yamada, N. Udagawa, N. Takahashi, K. Tanaka, D. J. Drucker, Y. Seino, and N. Inagaki
The Murine Glucagon-Like Peptide-1 Receptor Is Essential for Control of Bone Resorption
Endocrinology, February 1, 2008; 149(2): 574 - 579.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Q. Zhong, T. Itokawa, S. Sridhar, K.-H. Ding, D. Xie, B. Kang, W. B. Bollag, R. J. Bollag, M. Hamrick, K. Insogna, et al.
Effects of glucose-dependent insulinotropic peptide on osteoclast function
Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E543 - E548.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
Y. Yamada, K. Miyawaki, K. Tsukiyama, N. Harada, C. Yamada, and Y. Seino
Pancreatic and Extrapancreatic Effects of Gastric Inhibitory Polypeptide
Diabetes, December 1, 2006; 55(Supplement_2): S86 - S91.
[Abstract] [Full Text] [PDF]


Home page
IBMS BoneKEyHome page
D. B. Henriksen
The Gut Feeling of Bone Remodeling
IBMS BoneKEy, November 1, 2005; 2(11): 16 - 23.
[Full Text] [PDF]


Home page
J. Neurosci.Home page
J. Nyberg, M. F. Anderson, B. Meister, A.-M. Alborn, A.-K. Strom, A. Brederlau, A.-C. Illerskog, O. Nilsson, T. J. Kieffer, M. A. Hietala, et al.
Glucose-Dependent Insulinotropic Polypeptide Is Expressed in Adult Hippocampus and Induces Progenitor Cell Proliferation
J. Neurosci., February 16, 2005; 25(7): 1816 - 1825.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
M. J. Theodorakis, O. Carlson, D. C. Muller, and J. M. Egan
Elevated Plasma Glucose-Dependent Insulinotropic Polypeptide Associates With Hyperinsulinemia in Impaired Glucose Tolerance
Diabetes Care, July 1, 2004; 27(7): 1692 - 1698.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K.-H. Ding, Q. Zhong, J. Xu, and C. M. Isales
Glucose-dependent insulinotropic peptide: differential effects on hepatic artery vs. portal vein endothelial cells
Am J Physiol Endocrinol Metab, May 1, 2004; 286(5): E773 - E779.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. A. Clowes, H. C. Allen, D. M. Prentis, R. Eastell, and A. Blumsohn
Octreotide Abolishes the Acute Decrease in Bone Turnover in Response to Oral Glucose
J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 4867 - 4873.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K.-H. Ding, Q. Zhong, and C. M. Isales
Glucose-dependent insulinotropic peptide stimulates thymidine incorporation in endothelial cells: role of endothelin-1
Am J Physiol Endocrinol Metab, August 1, 2003; 285(2): E390 - E396.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
K. E. Mayo, L. J. Miller, D. Bataille, S. Dalle, B. Goke, B. Thorens, and D. J. Drucker
International Union of Pharmacology. XXXV. The Glucagon Receptor Family
Pharmacol. Rev., March 1, 2003; 55(1): 167 - 194.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. A. Clowes, R. T. Robinson, S. R. Heller, R. Eastell, and A. Blumsohn
Acute Changes of Bone Turnover and PTH Induced by Insulin and Glucose: Euglycemic and Hypoglycemic Hyperinsulinemic Clamp Studies
J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3324 - 3329.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bollag, R. J.
Right arrow Articles by Isales, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bollag, R. J.
Right arrow Articles by Isales, C. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals