help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rhoads, R. P.
Right arrow Articles by Boisclair, Y. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rhoads, R. P.
Right arrow Articles by Boisclair, Y. R.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Endocrinology Vol. 141, No. 4 1425-1433
Copyright © 2000 by The Endocrine Society


ARTICLES

Organization and Regulation of the Gene Encoding the Sheep Acid-Labile Subunit of the 150-Kilodalton Insulin-Like Growth Factor-Binding Protein Complex1

Robert P. Rhoads, Paul L. Greenwood, Alan W. Bell and Yves R. Boisclair

Department of Animal Science, Cornell University (R.P.R., A.W.B., Y.R.B.), Ithaca, New York 14853; and New South Wales Agriculture Beef Industry Center, University of New England P.L.G.), Armidale, New South Wales 2351, Australia

Address all correspondence and requests for reprints to: Dr. Yves R. Boisclair, 259 Morrison Hall, Cornell University, Ithaca, New York 14853-4801. E-mail: yrb1{at}cornell.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In adult animals, most circulating insulin-like growth factor I (IGF-I) and IGF-II is sequestered in a 150-kDa complex composed of 1 molecule each of IGF, IGF-binding protein-3 or -5, and the acid-labile subunit (ALS). Capture of IGF in ALS-containing complexes increases their circulating half-lives and concentrations and suppresses their hypoglycemic potential. ALS has been studied almost exclusively in rodents and primates, and no information exists in the sheep despite its extensive use to study the circulating IGF system. To initiate studies in the sheep, we isolated the ovine ALS gene and characterized its spatial and developmental regulation. The ALS gene spans about 3.0 kb of chromosomal DNA and consists of 2 exons interrupted by a 977-bp intron. Exon 1 encodes the first 5 amino acids of the signal peptide; exon 2 encodes the remaining 27 amino acids of the signal peptide and the entire mature protein of 579 amino acids. Transcription initiation occurs at nucleotides -58 and -29 (ATG, +1), 2 sites that are not preceded by TATA or initiator sequences. A DNA fragment extending from -727 to -11 of the sheep ALS gene directed basal expression of a luciferase reporter plasmid in the rat liver cell line H4-II-E. GH increased promoter activity by 1.8-fold, consistent with conservation in the sheep promoter of the GH response element previously identified in the mouse gene. A survey of adult tissues by Northern analysis revealed the presence of a 2.2-kb transcript only in liver. Weak expression was first detected in liver on day 130 of fetal life, increased suddenly on day 7 of postnatal age, and changed little thereafter. The sheep is a useful model to understand the regulation and role of ALS, particularly around the time of birth, when final maturation of the circulating IGF system occurs.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IN MOST ANIMALS, the circulating insulin-like growth factor (IGF) system is comprised of IGF-I, IGF-II, and a family of six IGF-binding proteins (IGFBP-1 to –6) (1, 2, 3). These IGFBPs bind IGFs with high affinity, resulting in little free IGF in the circulation. An additional level of complexity in the circulating IGF system is seen when comparing fetal and postnatal plasma by neutral gel filtration chromatography (1, 2, 4). In fetal plasma, most of the IGF is recovered in fractions eluting at approximately 50 kDa, corresponding to binary complexes of IGFBP:IGF. After birth, however, IGF-I and IGF-II occur mostly in ternary complexes of approximately 150 kDa, consisting of one molecule each of IGF-I or IGF-II, IGFBP-3 or IGFBP-5, and a serum protein called the acid-labile subunit (ALS) (1, 2, 3, 4, 5). Circulation of IGF in ternary complexes is one of the final events in the development of the endocrine IGF system. Functional consequences of this event include extended half-life of IGFs and prevention of their hypoglycemic potential (2, 4, 6).

ALS complementary DNAs (cDNAs) and genes have been cloned in mice, rat, human, and baboon (7, 8, 9, 10, 11). These advances have led to molecular studies of the regulation of ALS synthesis. ALS is synthesized primarily by the parenchymal cells of liver after birth (12, 13). GH stimulates transcription of the ALS gene, resulting in increased abundance of ALS messenger RNA (mRNA) in liver and elevated serum ALS (14, 15, 16, 17, 18). Negative factors regulating ALS synthesis in liver cells include cAMP, epidermal growth factor, dexamethasone, and interleukin-1ß (19, 20, 21).

Ruminants have been used extensively to study the role and regulation of the endocrine IGF system (22, 23, 24, 25, 26, 27). The sheep, which is a precocial species like the human, is a particularly good model during fetal and early postnatal life, when final maturation of the circulating IGF system takes place (25, 27). There are, however, no published molecular studies on ALS and its regulation in any species of agricultural importance, including the sheep. As a first step toward studying the role of ALS in the sheep IGF system, we have cloned and characterized the sheep ALS gene. In addition, we show that the sheep ALS promoter is regulated by GH, and we describe the spatial and developmental regulation of the gene.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents and general methods
Restriction endonucleases, DNA polymerases, and DNA-modifying enzymes were purchased from Life Technologies, Inc. (Gaithersburg, MD) and New England Biolabs, Inc. (Beverly, MA). Oligonucleotides were custom made by Life Technologies, Inc. When needed, they were labeled with [{gamma}-32P]ATP using T4 DNA polynucleotide kinase. PCR was performed using a thermal cycler (GeneAmp PCR System 2400, Perkin-Elmer Corp., Norwalk, CT). Sequencing was performed by the Biotechnology Resource Center at Cornell University (Ithaca, NY) using the Perkin-Elmer Corp./PE Applied Biosystems Division 377 Automated DNA Sequencer with Dye Terminator chemistry and AmpliTaq-FS DNA polymerase (Perkin-Elmer Corp.). DNA sequences were analyzed with the commercial software MacVector 6.01 and DNA Strider 1.2 (C. Marck, Centré d’Etudes de Saclay, Cedex, France).

Genomic and cDNA cloning
Total RNA was isolated from an adult sheep liver and reverse transcribed using a commercial kit (Marathon cDNA Amplification kit, CLONTECH Laboratories, Inc., Palo Alto, CA). A sheep cDNA fragment of 154 bp was amplified by PCR using primers F-823 and R-976 (Table 1Go) and labeled with [{alpha}-32P]deoxy-CTP (3000 Ci/mmol) by a Taq DNA polymerase-based method (28). Nylon filters (Colony/Plaque Screen, NEN Life Science Products, Boston, MA), representing 2 x 106 plaques of a sheep genomic library (sheep liver DNA in the {lambda} phage EMBL3, CLONTECH Laboratories, Inc.) were hybridized with the sheep ALS probe at 42 C overnight. Hybridization conditions and washes were performed as described previously (7). After secondary and tertiary plaque purifications, positive clones were grown in liquid culture, and {lambda} DNA was extracted (Wizard Lambda Preps DNA Purification System, Promega Corp., Madison, WI). Genomic DNA inserts were released from the {lambda} vector with the restriction enzyme SalI, subcloned into the vector pGEM-11Zf+ (Promega Corp.), and sequenced.


View this table:
[in this window]
[in a new window]
 
Table 1. Nucleotide sequence of oligonucleotides used to amplify various regions of the sheep ALS cDNA

 
Additional DNA products covering the entire sheep ALS cDNA were amplified by RT-PCR of sheep liver total RNA using primer pairs F-(-57) and R-976, and F-680 and deoxythymidine (dT; Table 1Go). The single products obtained with each pair were subcloned into the vector pCR 2.1-Topo (Invitrogen, San Diego, CA) and sequenced.

Southern analysis of sheep genomic DNA
Genomic DNA was isolated from adult sheep liver by the procedure described by Hogan (29). Genomic DNA was digested with selected restriction endonucleases and electrophoresed on a 0.7% agarose gel. The agarose gel was soaked in 0.2 N HCl and neutralized in 1.5 M NaCl-0.5 N NaOH before blotting onto a nylon membrane. The membrane was hybridized to the 154-bp sheep ALS probe as described above.

Northern analysis
Adult sheep were killed by captive bolt stunning and exsanguination. Fetuses and neonates were killed by lethal injection of pentobarbital. Liver and other tissues were excised rapidly, snap-frozen in liquid nitrogen, and stored at -80 C until extraction of RNA. These procedures were conducted with the guidance and approval of the Cornell University institutional animal care committee.

Total RNA was extracted by the acid guanidinium thiocyanate phenol-chloroform method and quantified by absorbance at 260 nm (15, 17). Total RNA was fractionated on agarose-formaldehyde gels, blotted onto nylon membranes, and hybridized to the 154-bp sheep DNA probe labeled with [{alpha}-32P]deoxy-CTP (15, 17). Equality of loading was assessed by visualization of ribosomal RNA or by reprobing membranes with a low specific activity 18S RNA probe. The 18S probe was generated from the pT7 RNA 18S template (Ambion, Inc., Austin, TX) using the RiboMAX system (Promega Corp.) with [{alpha}-32P]UTP. The relative abundance of ALS mRNA and 18S ribosomal RNA was quantified by phos-phorimaging.

Tobacco acid pyrophosphatase (TAP)-reverse ligation PCR (TAP-RLPCR)
TAP-RLPCR was performed exactly as previously described (7), except for the modifications noted below. Total RNA from adult sheep liver was treated with deoxyribonuclease I and calf intestinal alkaline phosphatase. The cap of mRNAs was hydrolyzed with TAP, and the exposed 5'-phosphate ends were ligated to the RNA linker (GGGCAUAGGCUGACCCUCGCUGAAA) with T4 RNA ligase. The RT reaction, modified to include a greater mass of ligated RNA (1 µg), was performed with Superscript II RNase H- reverse transcriptase (Life Technologies, Inc.) and sheep ALS primer R-210 (Table 1Go), as suggested by the manufacturer. Ten percent of the RT reaction was amplified by PCR with a DNA primer corresponding to the RNA linker (DNA Pr-1) and sheep ALS-specific primers R-179 and R-74 (Table 1Go). ALS cDNAs were amplified for 35 cycles (30 sec at 94 C, 30 sec at 60 C, and 30 sec at 72 C) using Taq DNA polymerase. Products were subcloned into pCR 2.1-Topo and sequenced.

Transfection of liver-derived cells
Fragments corresponding to nucleotides (nt) -727 to -11 (A+1TG) or to nt -616 to -11 of the sheep ALS gene were generated by PCR using forward primer F-(-727) or F-(-616), and reverse primer R-(-11) (Table 1Go). PCR fragments were inserted in the SmaI restriction site of the promoterless luciferase vector pGL3-Basic (Promega Corp.) in the sense orientation to give s727S or s616S (the number refers to the 5'-end of the promoter fragment) or in the antisense orientation to give s727A or s616A. Two independent PCR reactions were performed with the high fidelity Vent polymerase to prepare duplicate plasmids. The pGL3-Basic plasmid containing the nt -703 to -11 fragment of the mouse ALS promoter (m703S) has been described previously (17).

For transfection, H4-II-E cells were grown in DMEM supplemented with 10% FCS in six-well cluster plate. Each well of near-confluent H4-II-E cells was exposed to 95 µl of a DNA solution containing 0.5 mg/ml diethylaminoethyl-dextran, 0.7 µg firefly luciferase plasmid, and 0.3 µg plasmid pRL-TK (17). pRL-TK (Promega Corp.) encodes Renilla luciferase and was used to correct for variation in transfection efficiency. After a 40-h recovery period in DMEM supplemented with 10% FCS, media were changed to serum-free DMEM supplemented with or without 100 ng/ml bovine GH (Protiva, St. Louis, MO). Twenty-four hours later, cell lysates were assayed for firefly and Renilla luciferase by the Dual-Luciferase Reporter System (Promega Corp.).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning of the sheep ALS gene
Northern analysis showed that human or mouse ALS cDNAs did not hybridize to ALS mRNA in adult sheep liver (results not shown). To generate a sheep probe, cDNAs were synthesized by RT of total RNA from adult sheep liver and were used in PCR amplification with primers corresponding to conserved regions of mouse, rat, and human ALS cDNAs. The primer pairs F-680/R-976 and F-823/R-976 yielded single products of 297 and 154 bp, respectively (Table 1Go). These products were of the expected size and had over 87% identity with the regions of the human ALS cDNA bracketed by these primer pairs, indicating that they correspond to fragments of the sheep ALS cDNA.

Two positive clones, covering over 15 kb of chromosomal DNA, were isolated from a sheep liver genomic library using the 154-bp ALS DNA fragment as a probe (Fig. 1Go). Two SalI DNA fragments, corresponding to the entire genomic insert contained in clone 5, were subcloned into the plasmid vector pGEM-11Zf+. The SalI restriction fragment 5A, which hybridized with the 154-bp sheep ALS fragment, was further characterized by digestion with the restriction endonucleases FspI and BsmI, two endonucleases that cut the 297-bp partial sheep cDNA only once. Southern blots of these digests were probed with oligonucleotides corresponding to the 5'-end (F-680) or the 3'-end (R-976) of the 297-bp partial sheep cDNA. Primer F-680 hybridized only to a 2.3-kb BsmI fragment, designated 5A1, whereas primer R-976 hybridized only to an overlapping 1.8-kb FspI fragment, designated 5A3 (Fig. 1Go). As the ALS gene in mouse and rat covers only about 3.3 kb of chromosomal DNA (7, 9), this analysis suggested that these overlapping restriction fragments contained the entire coding regions of the sheep ALS gene. DNA fragments 5A1 and 5A3 were subcloned and sequenced entirely (Fig. 1Go). The FspI fragment 5A2, which extends further upstream of the gene, was also sequenced.



View larger version (9K):
[in this window]
[in a new window]
 
Figure 1. Organization of the sheep ALS gene. ALS genomic DNA contained in the positive phage clones are depicted, with their lengths given in parentheses. A schematic map of the sheep ALS gene is shown below the clones. Exons are represented by boxes (coding regions are closed, noncoding regions are open), and intron and flanking regions are represented by horizontal lines. The horizontal line above exon 2 indicates the position of the 154-bp sheep ALS DNA probe. Sites at which the restriction endonucleases SalI, FspI, and BsmI cleave the genomic clone {lambda}5 are delineated by vertical arrows. Fragments 5A1, 5A2, and 5A3 were subcloned and sequenced.

 
Structure of the gene and deduced amino acid sequence of sheep ALS
Overlapping DNA fragments covering the entire sheep cDNA were synthesized by RT-PCR with primer pair F-(-57)/R-976 and F-680/dT (Table 1Go). Comparison of their sequences with genomic sequence indicated that the sheep gene is organized in two exons separated by a 977-bp intron (Fig. 2Go). The exact positions of the exon-intron boundaries conform to the 5'-splice donor (GT)/3'-splice acceptor (AG) rule (30) and are found at homologous locations in the rat and mouse genes (7, 9). The coding sequence of the sheep ALS gene is 80% and 75% identical to the corresponding regions of the human and mouse genes, respectively.



View larger version (60K):
[in this window]
[in a new window]
 
Figure 2. Nucleotide sequence of the sheep ALS gene and deduced amino acid sequence of sheep ALS. The nucleotide sequence of the coding region of exon 1 and the complete nucleotide sequence of exon 2 are shown. The intron is represented schematically by dotted lines, except for the nucleotide bordering the exons (shown in lowercase letters). The nucleotide sequence is numbered on the left relative to the translation initiation codon (A+1TG). The intron/exon boundaries and the 3'-end of exon 2 were determined by comparing genomic and cDNA sequences. The last nt of exon 2 corresponds to the site of polyadenylation and is preceded by two potential polyadenylation signals (shown by double underlines). The deduced amino acid sequence is given below the nucleotide sequence in standard one-letter abbreviation. Amino acids are numbered on the left relative to the methionine encoded by the initiating ATG. The first amino acid residue of the mature protein (amino acid 33) is boxed (31 ). A star denotes the stop codon TGA. Residues in sheep ALS that differ from those in human ALS are shown by boldface and underlined letters (150 of 611 amino acids). Leucine 582, which accounts for the single amino acid difference in the size of mature sheep and human ALS, is bracketed.

 
A comparison of the product of rapid amplification of 3'-cDNA ends obtained with the primer pair F-680/dT to genomic DNA indicated that polyadenylation occurs 164 bp downstream of the stop codon. The canonical polyadenylation signal AATAAA and its most common variant, ATTAAA, are present 12 and 25 nt upstream of the polyadenylation site (Fig. 2Go). Finally, sheep genomic DNA was digested with the restriction enzymes SacI, HindIII, and XhoI and analyzed by Southern blotting with the 154-bp DNA probe. A unique hybridization signal was obtained for each restriction digest, indicating that a single copy of the ALS gene is present in the sheep genome (Fig. 3Go). Overall, the single sheep ALS gene spans approximately 3.0 kb of genomic DNA. Exon 1 is small and contains only 16 bp of coding sequence; exon 2 is 1957 bp long, 1803 bp of which are coding sequence.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. The ALS gene occurs as a single copy in the sheep genome. Top panel, Southern blot of sheep genomic DNA. Each lane contains 10 µg sheep liver DNA digested with the restriction enzymes SacI, HindIII, and XhoI. The blot was hybridized to the 154-bp sheep ALS DNA probe. The positions of the DNA markers are given on the left of the blot. Bottom panel, A schematic of the ALS gene is shown with the location of endonuclease restriction sites. Exons are represented by boxes (coding regions are closed, noncoding regions are open), and intron and flanking regions are represented by horizontal lines. The thick line above exon 2 indicates the position of the 154-bp ALS DNA probe. The positions of the endonuclease restriction sites are shown by vertical arrows.

 
The sheep ALS gene encodes a protein of 611 amino acids, with exon 1 contributing only the first 5 amino acids. Analysis of the primary structure with the SignalP software (30A ) predicted a signal peptide of 32 amino acids and a mature protein of 579 amino acids (Fig. 2Go) (31). Mature sheep ALS protein is 77% identical to human ALS and 73% identical to mouse ALS (comparison of sheep and human ALS is shown in Fig. 2Go). As seen in human, rat, and mouse ALS, the core of mature sheep ALS is organized into 18–20 leucine-rich domains of 24 amino acids each and contains 12 cysteine residues, 11 of which are present in human ALS. The difference in the size of mature ALS in sheep vs. human (579 vs. 578 amino acids) is accounted for by an additional leucine residue near the carboxyl end of the protein (Fig. 2Go). Consistent with the glycosylated nature of circulating ALS, six potential asparagine-linked glycosylation sites (NXS/T) are present in sheep ALS.

Determination of the sites of transcription initiation
TAP-RLPCR was used to identify the site of transcription initiation in the sheep ALS gene (7, 32). In this assay, a universal RNA primer is ligated specifically to the cap structure of mRNAs (Fig. 4Go). When ligated mRNAs are used in RT-PCR with the universal DNA Pr-1 and a gene-specific primer, amplification occurs only from cDNAs extending to the cap site of the selected mRNA.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. Identification of the transcription start sites for the sheep ALS gene. Left panel, The TAP-RLPCR assay is illustrated for the sheep ALS mRNAs detected in this experiment. ALS primers are represented as open boxes, and their positions are given relative to the ATG of the sheep gene. Total RNA from sheep adult liver was treated with deoxyribonuclease I, calf intestinal alkaline phosphatase, and TAP and ligated to the RNA linker (shown as a bold wavy line). Ligated RNA was annealed to primer R-210 and reverse transcribed. ALS cDNAs were amplified with DNA Pr-1 (shown as a closed box) and primer R-179 or R-74. Both of these primers anneal to sequence located in exon 2. Right panel, Products detected with DNA-Pr-1 and primer R-179 or R-74. PCR reactions were performed with RNA incubated in the absence (-) or presence (+) of TAP and analyzed on a 3% agarose gel. Products represent amplification of RNA, as amplification of DNA would yield products containing an additional 977 bp of intronic DNA. A 100-bp ladder is shown in lane 1.

 
Total RNA from adult sheep liver was hydrolyzed with TAP, the RNA linker was ligated to the exposed 5'-ends of mRNAs, and ALS mRNAs were reverse transcribed with ALS primer R-210 (Fig. 4Go). Amplification of ALS cDNAs with DNA Pr-1 and sheep ALS primer R-179 yielded two products of approximately 240 bp (Fig. 4Go). Use of R-74, which is located 86 bp upstream of R-179, also yielded two products of about 140 bp. Sequencing of these products showed that the RNA linker was ligated to mRNA initiating at nt -58 and -29 of the ALS gene. A third faint product of approximately 300 bp was detected only with R-74, but sequencing showed that it did not correspond to ALS mRNA. No products were obtained when TAP treatment of RNA was omitted, indicating that nt -58 and -29 are authentic cap sites. Amplification with DNA Pr-1 and sheep ALS primers located upstream of nt -58 [R-(-307) and R-(-343)] failed to yield any product, suggesting the absence of more distal transcription initiation sites (results not shown). The region immediately upstream of nt -58 and -29 is devoid of TATA or initiator sequences (Fig. 5Go).



View larger version (71K):
[in this window]
[in a new window]
 
Figure 5. Comparison of the nucleotide sequence of the 5'-flanking region of the sheep and mouse ALS gene. Nucleotides of the 5'-flanking regions of the sheep (top) and mouse (bottom) ALS genes are numbered on the left relative to ATG, +1. Sequences identical in both sheep and mouse ALS are shaded. Potential cis-elements present in the sheep sequence were identified by searching for homology to the consensus sequences of known transcription factors [consensus sequence: HNF-3, T(G/A)TTTG(C/T); ALSGAS1, TTCCTAGAA; nuclear factor-1, TGGNNNNNNGCCA; activating protein-2, CCC(A/C)N(G/C)(G/C)(G/C); Sp1, GGGCGG; nuclear factor-{kappa}B, GGG(A/G)NT(C/T)(C/T)] (17 33 ). They are underlined (thin lines when on the sense strand, thick lines when on the antisense strand), with their names given above their location. Sites of transcription initiation in the sheep ALS gene are indicated by arrows.

 
Identification of a GH-regulated promoter
Next, we tested whether the region located upstream of the ATG contained a promoter. A DNA fragment corresponding to nt -727 to -11 of the sheep ALS gene was cloned in the antisense or sense orientation in the promoterless reporter plasmid pGL3. These plasmids were transfected in the H4-II-E rat hepatoma cell line. Cell transfected with the sense plasmid (s727S) had 9.5-fold greater luciferase activity than the cells transfected with the antisense construct (s727A; Fig. 6Go). Therefore, the sequence immediately upstream of the ATG contains the functional promoter of the gene.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. Identification of the promoter of the sheep ALS gene. Left panel, The region immediately upstream of the ATG contains the promoter of the sheep ALS gene. A fragment corresponding to nt -727 to -11 of the sheep ALS gene was ligated upstream of the promoterless luciferase gene pGL3-basic in the antisense (s727A) and sense (s727S) orientations. Luciferase plasmids (0.7 µg) were cotransfected with pRL-TK (300 ng) into H4-II-E rat hepatoma cells using diethylaminoethyl-dextran. Transfected cells were incubated for 24 h in serum-free conditions. Then, firefly luciferase activity was measured in cell extracts and corrected for Renilla luciferase activity. Each bar represents the mean ± SE of two replicates (left panel). Means with different letters differ at P < 0.05, using one-way ANOVA. Similar results were obtained in two additional experiments. Right panel, The sheep ALS promoter is GH responsive. pGL3 plasmids (0.7 µg) containing the sense nt -703 to -11 mouse ALS promoter (m703S), the sense nt -727 to -11 sheep ALS promoter (s727S), or the sense (s616S) or antisense (s616A) nt -616 to -11 sheep ALS promoter were cotransfected with pRL-TK (300 ng) into H4-II-E rat hepatoma cells as described above. Transfected cells were incubated for 24 h in the absence (- GH) or presence (+ GH) of bovine GH. Firefly luciferase was measured in cell extracts and corrected for Renilla luciferase activity. Each bar represents the mean ± SE of three replicates. For each plasmid, means with different letters differ at P < 0.05, using one-way ANOVA. Similar results were obtained in a duplicate experiment. Luciferase activity in cells transfected with the promoterless pGL3-Basic plasmid was 1624 ± 208 in the absence of GH and 1719 ± 233 in the presence of GH.

 
The sheep ALS promoter contains sites that could be recognized by the transcription factors Sp1, AP-2, nuclear factor-{kappa}B, nuclear factor-1, and hepatic nuclear factor-3 (HNF-3; Fig. 5Go) (33). Comparison of the sheep and mouse promoters indicated only 54% sequence identity and conservation of only the HNF-3 site and of ALSGAS1, an element located between nt -623 and 615 that resembles a {gamma}-interferon-activated sequence (GAS). We showed previously that this GAS element, present at a similar location in the mouse promoter, mediates the GH activation of ALS gene transcription by binding signal transducer and activator of transcription-5a (STAT5a) and STAT5b (17). To determine whether the sheep ALS promoter is also GH responsive, the luciferase constructs driven by the nt -727 to -11 ALS promoter (s727S) or by the equivalent mouse promoter fragment m703S were transfected in H4-II-E cells (Fig. 6Go). Treatment of the cells with GH stimulated the activity of the sheep and mouse promoters by 1.8- and 2.3-fold, respectively. To evaluate this further, cells were transfected with luciferase plasmids driven by the nt -616 to -11 sheep promoter that does not include the ALSGAS1 element (see Fig. 5Go). Basal activity of the sense construct (s616S) was 3.7-fold higher than that of the antisense construct (s616A) and similar to basal activity of the longer construct (s727S). However, GH was unable to stimulate the activity of this promoter when present in the sense or antisense orientation. We conclude that transcription of the sheep ALS promoter is also activated by GH.

Spatial and developmental regulation of ALS gene expression
In the rat, high level expression of the ALS gene is detected only in postnatal liver. When analyzed by Northern blotting, ALS mRNA was detected in liver of adult sheep, but was absent in kidney, spleen, muscle, heart, lung, and brain (Fig. 7Go). To determine the onset of hepatic expression of the ALS gene, total RNA was extracted from livers of normal sheep before and after birth. Weak expression was first detected at 130 days of fetal life. Expression increased sharply at 7 days of age and varied little thereafter (Fig. 7Go).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 7. Spatial and developmental regulation of the sheep ALS gene. Left panel, The ALS gene is expressed only in liver of adult sheep. Total RNA was isolated from tissues of an adult sheep, and 15 µg were analyzed by Northern blotting using the 154 bp sheep ALS DNA probe. The size of the ALS signal is given on the left. Ethidium bromide staining of the gel indicates that total RNA was intact and loaded equally. Right panel, Hepatic expression of the ALS gene increases rapidly after birth. Total RNA was isolated from the liver of sheep at various ages of fetal and postnatal life, and 15 µg were analyzed by Northern blotting using the 154-bp sheep ALS DNA probe. Each lane corresponds to a different animal. The blot was rehybridized with the 18S ribosomal RNA riboprobe to show equal loading across lanes. Arrows on the right of each panel indicate the positions of the sheep 2.2-kb ALS mRNA and 18S ribosomal RNA.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Before this work, sequences have been published for primate (human and baboon) and rodent (mouse and rat) ALS cDNAs, whereas the organization of the gene has been resolved only in the mouse and rat (7, 8, 9, 10, 11). Comparison across species reveals a high degree of conservation at the level of the ALS gene, cDNA, and protein. In sheep and rodents, the ALS gene occurs as a single copy gene, ranging in size from 3.0–3.3 kb, and is composed of 2 exons and 1 intron of approximately 1 kb; exon 1 always contains the first 5 codons and the first nucleotide of codon 6 (7, 9). Transcription of the ALS gene produces a mRNA of about 2.2 kb, which encodes proteins of 603 amino acid residues in the mouse, 605 residues in the human, and 611 residues in the sheep (7, 10). Most of the extra amino acid residues in the sheep appear in the predicted secretory peptide of 32 amino acids, yielding a mature protein of similar size in sheep as in mouse and human (i.e. 579 residues in sheep vs. 578 in human and 580 in mouse). Mature sheep ALS is 77% and 73% identical to human and mouse ALS, respectively, and also features the characteristic leucine-rich domains of 24 amino acids each (7, 10). This repeating motif is present in other proteins forming multiprotein complexes and is thought to confer to ALS its ability to associate with binary complexes of IGFBP-3:IGF or IGFBP-5:IGF (5, 10).

One difference between species appears to be the location of the transcription start sites. Multiple start sites were detected between nt -505 and -385 in the rat, and between nt -151 and -14 in the mouse (7, 9). In the sheep, transcription initiation was shown to occur from nt -58 and -29 by TAP-RLPCR. Moreover, we did not detect additional, more distal start sites when total liver RNA was analyzed by ribonuclease protection assay using a riboprobe consisting of the first 163 nt of the cDNA and the first 520 nt of the 5'-region of the sheep ALS gene (results not shown). Therefore, sheep and mouse appear to be similar with respect to the region where transcription initiation occurs.

Surveys of various tissues by Northern analysis indicate that high level expression of the ALS gene in the mouse, rat, and baboon is restricted to postnatal liver (7, 11, 12). Our data indicate that this is also true in adult sheep. It remains possible that low level expression occurs in other tissues and serves to supply the local IGF system with ALS. For example, ALS expression has been identified in the proximal tubule epithelium of rat kidney by the more sensitive in situ hybridization (13), and significant concentrations of ALS have been measured in synovial, ovarian, and blister fluids in humans (34, 35, 36). Using Northern analysis, we have not detected ALS mRNA in sheep kidney or in thecal or granulosa cells of the bovine ovary (Fig. 7Go and results not shown). Although more sensitive techniques may detect extrahepatic expression, our data indicate that in the sheep, as in other species, the liver is by far the most important source of circulating ALS (11, 12, 13, 15).

The developmental regulation of ALS gene expression in liver has been studied only in the rat. Expression is first detected at low levels after birth, is induced by 3 weeks of postnatal age, and becomes maximal by 6 weeks (12); concentration of serum ALS follows an identical developmental pattern (14, 37). In the sheep, abundance of ALS mRNA is also low before birth, but increases abruptly within 7 days of postnatal life. This pattern of developmental expression correlates with the circulation of IGFs primarily in complexes of 50 kDa before birth and primarily in complexes of 150 kDa 1 week after birth (24). The faster onset of ALS synthesis in the postnatal sheep probably reflects its greater maturity than the rat at birth.

In humans and rodents, GH is the most potent inducer of ALS mRNA in the liver and of ALS in the circulation (14, 15, 16, 18). The importance of this regulation is underlined by the temporal correlation between ALS mRNA levels and the appearance of functional GH receptor in liver in both sheep and rats (38, 39), and by the near-complete absence of ALS in GH-deficient animals (40, 41). We have shown that this effect of GH represents a stimulation of ALS gene transcription mediated by the binding of STAT5 to ALSGAS1, a GAS-like element in the mouse promoter (17). This element is also conserved in the human ALS promoter and is responsible for conferring GH responsiveness (42). In the present study we show that GH activated the sheep ALS promoter nearly as well as the mouse promoter when assayed in a rat liver cell line. Significantly, the sequence and position of the ALSGAS1 element are completely conserved in the sheep despite only 54% sequence identity between the proximal regions of the mouse and sheep promoters. Removal of the GAS-like element had no effect on basal activity, but eliminated the GH responsiveness of the sheep promoter. This suggests that GH stimulates transcription of the sheep ALS gene by a mechanism similar to that described in the mouse and human.

Sheep have been used extensively to study the regulation and roles of the various components of the circulating IGF system (22, 23, 24, 25, 27). These studies are of interest because sheep approximate the human IGF system more closely than rats. With the cloning of the sheep gene, some unresolved issues concerning ALS can now be addressed in this animal model. First, because humans are more similar to sheep than to rats in terms of maturity at birth, sheep are ideal to study the regulation of ALS gene expression during the transition from fetal to postnatal life, when development of a fully operational GH-IGF-I axis in liver occurs. Second, in contrast to rats, humans and sheep maintain significant concentrations of IGFBP-2 and IGF-II during postnatal life (26, 43, 44). Because IGF-II and IGFBP-2 are important players in the etiology of diseases associated with impaired formation of the ternary complexes such as tumor-induced hypoglycemia (45), the sheep may provide a better physiological context than the rat in which to study functional aspects of ALS. Finally, ALS has not been considered to play a major role in regulating serum IGFs levels because it circulates in a 2- to 3-fold molar excess over the concentrations of IGFBP-3 and IGFs. However, mice with one and two null ALS alleles have 30% and 60% reductions, respectively, in the concentration of plasma IGF-I (Boisclair, Y. R., unpublished results), suggesting that variations in the molar excess of ALS can contribute to changes in the concentration of serum IGFs. Ruminants provide unique opportunities to test this hypothesis, as concentrations of IGFs, particularly IGF-I, are regulated dynamically by development, nutrition, and physiological states. For example, concentrations of serum IGF-I are increased severalfold by exogenous administration of GH and by prolonged euglycemic/hyperinsulinemic clamps, whereas they decline by 50–80% during periods of undernutrition and during the transition from pregnancy to lactation (22, 46, 47, 48). Study of the impact of these factors on hepatic expression and circulating levels of ALS in ruminants will contribute to a better understanding of the circulating IGF system.


    Footnotes
 
1 This work was supported by NIH Grant DK-51624 (to Y.R.B.) and the Cornell University Agricultural Experiment Station. Back

Received September 21, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jones JI, Clemmons DR 1995 Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev 16:3–34[Abstract/Free Full Text]
  2. Rechler MM 1993 Insulin-like growth factor binding proteins. Vitam Horm 47:1–114[Medline]
  3. Ooi GT, Boisclair YR 1999 Molecular biology of the insulin-like growth factor binding proteins. In: Rosenfeld R, Roberts Jr C (eds) Contemporary Endocrinology: The IGF System. Humana Press, Totowa, pp 111–139
  4. Baxter RC 1994 Insulin-like growth factor binding proteins in the human circulation: a review. Horm Res 42:140–144[Medline]
  5. Twigg SM, Baxter RC 1998 Insulin-like growth factor (IGF)-binding protein 5 forms an alternative ternary complex with IGFs and the acid-labile subunit. J Biol Chem 273:6074–6079[Abstract/Free Full Text]
  6. Zapf J, Hauri C, Futo E, Hussain M, Rutishauser J, Maack CA, Froesch ER 1995 Intravenously injected insulin-like growth factor (IGF) I/IGF binding protein-3 complex exerts insulin-like effects in hypophysectomized, but not in normal rats. J Clin Invest 95:179–186
  7. Boisclair YR, Seto D, Hsieh S, Hurst KR, Ooi GT 1996 Organization and chromosomal localization of the gene encoding the mouse acid labile subunit of the insulin-like growth factor binding complex. Proc Natl Acad Sci USA 93:10028–10033[Abstract/Free Full Text]
  8. Dai J, Baxter RC 1992 Molecular cloning of the acid-labile subunit of the rat insulin-like growth factor binding protein complex. Biochem Biophys Res Commun 188:304–309[CrossRef][Medline]
  9. Delhanty PJD, Baxter RC 1997 Cloning and characterization of the rat gene for the acid-labile subunit of the insulin-like growth factor binding protein complex. J Mol Endocrinol 19:267–277[Abstract/Free Full Text]
  10. Leong SR, Baxter RC, Camerato T, Dai J, Wood WI 1992 Structure and functional expression of the acid-labile subunit of the insulin-like growth factor binding protein complex. Mol Endocrinol 6:870–876[Abstract/Free Full Text]
  11. Delhanty P, Baxter RC 1996 The cloning and expression of the baboon acid-labile subunit of the insulin-like growth factor binding protein complex. Biochem Biophys Res Commun 227:897–902[CrossRef][Medline]
  12. Dai J, Baxter RC 1994 Regulation in vivo of the acid-labile subunit of the rat serum insulin-like growth factor-binding protein complex. Endocrinology 135:2335–2341[Abstract]
  13. Chin E, Zhou J, Dai J, Baxter RC, Bondy CA 1994 Cellular localization and regulation of gene expression for components of the insulin-like growth factor ternary binding protein complex. Endocrinology 134:2498–2504[Abstract/Free Full Text]
  14. Baxter RC, Dai J 1994 Purification and characterization of the acid-labile subunit of rat serum insulin-like growth factor binding protein complex. Endocrinology 134:848–852[Abstract/Free Full Text]
  15. Ooi GT, Cohen FJ, Tseng LY-H, Rechler MM, Boisclair YR 1997 Growth hormone stimulates transcription of the gene encoding the acid-labile subunit (ALS) of the circulating insulin-like growth factor-binding protein complex and ALS promoter activity in rat liver. Mol Endocrinol 11:997–1007[Abstract/Free Full Text]
  16. Baxter RC 1988 Characterization of the acid-labile subunit of the growth hormone-dependent insulin-like growth factor binding protein complex. J Clin Endocrinol Metab 67:265–272[Abstract/Free Full Text]
  17. Ooi GT, Hurst KR, Poy MN, Rechler MM, Boisclair YR 1998 Binding of STAT5a and STAT5b to a single element resembling a {gamma}-interferon activated sequence mediates the growth hormone induction of the mouse acid-labile subunit promoter in liver cells. Mol Endocrinol 12:675–687[Abstract/Free Full Text]
  18. Olivecrona H, Hilding A, Ekstrom C, Barle H, Nyberg B, Moller C, Delhanty PJ, Baxter RC, Angelin B, Ekstrom J, Tally M 1999 Acute and short-term effects of growth hormone on insulin-like growth factors and their binding proteins: serum levels and hepatic messenger ribonucleic acid responses in humans. J Clin Endocrinol Metab 84:553–560[Abstract/Free Full Text]
  19. Delhanty PJD, Baxter RC 1998 The regulation of acid-labile subunit gene expression and secretion by cyclic adenosine 3',5'-monophosphate. Endocrinology 139:260–265[Abstract/Free Full Text]
  20. Delhanty PJD 1998 Interleukin-1ß suppresses growth hormone-induced acid-labile subunit mRNA levels and secretion in primary hepatocytes. Biochem Biophys Res Commun 243:269–272[CrossRef][Medline]
  21. Dai J, Scott CD, Baxter RC 1994 Regulation of the acid-labile subunit of the insulin-like growth factor complex in cultured rat hepatocytes. Endocrinology 135:1066–1072[Abstract]
  22. Pell JM, Saunders JC, Gilmour RS 1993 Differential regulation of transcription initiation from insulin-like growth factor-I (IGF-I) leader exons and of tissue IGF-I expression in response to changed growth hormone and nutritional status in sheep. Endocrinology 132:1797–1807[Abstract/Free Full Text]
  23. Lee W-H, Gaylord TD, Bowsher RR, Hlaing M, Moorehead H, Liechty EA 1997 Nutritional regulation of circulating insulin-like growth factors (IGFs) and their binding proteins in the ovine fetus. Endocr J 44:163–173[Medline]
  24. Butler JH, Gluckman PD 1986 Circulating insulin-like growth factor-binding proteins in fetal, neonatal and adult sheep. J Endocrinol 109:333–338[Abstract/Free Full Text]
  25. Gluckman PD 1995 The endocrine regulation of fetal growth in late gestation: the role of insulin-like growth factors. J Clin Endocrinol Metab 80:1047–1050[CrossRef][Medline]
  26. Carr JM, Owens JA, Grant PA, Walton PE, Owens PC, Wallace JC 1995 Circulating insulin-like growth factors (IGFs), IGF-binding proteins (IGFBPs) and tissue mRNA levels of IGFBP-2 and IGFBP-4 in the ovine fetus. J Endocrinol 145:545–557[Abstract/Free Full Text]
  27. Owens JA 1991 Endocrine and substrate control of fetal growth: placental and maternal influences and insulin-like growth factors. Reprod Fertil Dev 3:501–517[CrossRef][Medline]
  28. Medori R, Trischler H-J, Gambetti P 1992 A rapid and simple method for labeling short DNA fragments using Taq polymerase. BioTechniques 12:350–353[Medline]
  29. Hogan B, Constantine F, Lacy E 1986 Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, pp 332
  30. Padgett RA, Grabowski PJ, Konarska MM, Seiber S, Sharp PA 1986 Splicing of messenger RNA precursors. Annu Rev Biochem 55:1119–1150[CrossRef][Medline]
  31. Nielsen H, Engelbrecht J, Brunak S, Von Heijne G1997 Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 10:1–6
  32. Nielsen H, Engelbrecht J, Brunak S, von Heijne G 1997 Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engin 10:1–6[Abstract/Free Full Text]
  33. Fromont-Racine M, Bertrand E, Pictet R, Grange T 1993 A highly sensitive method for mapping the 5' termini of mRNAs. Nucleic Acids Res 21:1683–1684[Free Full Text]
  34. Faisst S, Meyer S 1992 Compilation of vertebrate-encoded transcription factors. Nucleic Acids Res 20:3–26[Free Full Text]
  35. Xu S, Cwyfan-Hughes C, Van der Stappen JWJ, Sansom J, Burton JL, Donnelly M, Holly JMP 1995 Insulin-like growth factors (IGFs) and IGF-binding proteins in human skin interstitial fluid. J Clin Endocrinol Metab 80:2940–2945[Abstract/Free Full Text]
  36. Cwyfan-Hughes SC, Mason HD, Franks S, Holly JMP 1997 The insulin-like growth factors (IGFs) in follicular fluid are predominantly bound in the ternary complex. J Endocrinol 155:R1–R4
  37. Khosravi MJ, Diamandi A, Mistry J, Krishna RG, Khare A 1997 Acid-labile subunit of human insulin-like growth factor-binding protein complex: measurement, molecular, and clinical evaluation. J Clin Endocrinol Metab 82:3944–3951[Abstract/Free Full Text]
  38. Frystyk J, Gronbaek H, Skjaerbaek C, Flyvbjerg A, Orskov H, Baxter RC 1998 Developmental changes in serum levels of free and total insulin-like growth factor I (IGF-I), IGF-binding proteins-1 and -3, and the acid labile subunit in rats. Endocrinology 139:4286–4292[Abstract/Free Full Text]
  39. Tiong TS, Herington AC 1992 Ontogeny of messenger RNA for the rat growth hormone receptor and serum binding protein. Mol Cell Endocrinol 83:133–141[CrossRef][Medline]
  40. Gluckman PD, Butler JH, Elliott TB 1983 The ontogeny of somatotrophic binding sites in ovine hepatic membranes. Endocrinology 112:1607–1612[Abstract/Free Full Text]
  41. Gargosky SE, Tapanainen P, Rosenfeld RG 1994 Administration of growth hormone (GH), but not insulin-like growth factor-I (IGF-I), by continuous infusion can induce the formation of the 150-kilodalton IGF-binding protein-3 complex in GH-deficient rats. Endocrinology 134:2267–2276[Abstract/Free Full Text]
  42. Zapf J, Hauri C, Waldvogel M, Futo E, Hasler H, Binz K, Guler HP, Schmid C, Froesch ER 1989 Recombinant human insulin-like growth factor I induces its own specific carrier protein in hypophysectomized and diabetic rats. Proc Natl Acad Sci USA 86:3813–3817[Abstract/Free Full Text]
  43. Suwanichkul A, Boisclair YR, Olney RC, Durham SK, Powell DR Conservation of a growth hormone-responsive promoter element in the human, and mouse acid-labile subunit genes. Endocrinology, in press
  44. Daughaday WH, Rotwein P 1989 Insulin-like growth factors I and II. Peptide, messenger ribonucleic acid and gene structures, serum, and tissue concentrations. Endocr Rev 10:68–91[Abstract/Free Full Text]
  45. Gallaher BW, Breier BH, Blum WF, McCutcheon SN, Gluckman PD 1995 A homologous radioimmunoassay for ovine insulin-like growth factor-binding protein-2: ontogenesis and the response to growth hormone, placental lactogen and insulin-like growth factor-I treatment in sheep. J Endocrinol 144:75–82[Abstract/Free Full Text]
  46. Zapf J 1994 Role of insulin-like growth factor II and IGF binding proteins in extrapancreatic tumor hypoglycemia. Horm Res 42:20–26[Medline]
  47. McGuire MA, Dwyer DA, Harrell RJ, Bauman DE 1995 Insulin regulates circulating insulin-like growth factors and some of their binding proteins in lactating cows. Am J Physiol Endocrinol Metab 269:E723–E730
  48. McGuire MA, Bauman DE, Dwyer DA, Cohick WS 1995 Nutritional modulation of the somatotropin/insulin-like growth factor system: Response to feed deprivation in lactating cows. J Nutr 125:493–502
  49. Vega JR, Gibson CA, Skaar TC, Hadsell DL, Baumrucker CR 1991 Insulin-like growth factor (IGF)-I and -II and IGF binding proteins in serum and mammary secretions during the dry period and in early lactation in dairy cows. J Anim Sci 69:2538–2547[Abstract]



This article has been cited by other articles:


Home page
J EndocrinolHome page
J. W Kim, R. P Rhoads, N. Segoale, N. B Kristensen, D. E Bauman, and Y. R Boisclair
Isolation of the cDNA encoding the acid labile subunit (ALS) of the 150 kDa IGF-binding protein complex in cattle and ALS regulation during the transition from pregnancy to lactation.
J. Endocrinol., June 1, 2006; 189(3): 583 - 593.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
R. P. Rhoads, C. McManaman, K. L. Ingvartsen, and Y. R. Boisclair
The Housekeeping Genes GAPDH and Cyclophilin Are Regulated by Metabolic State in the Liver of Dairy Cows
J Dairy Sci, November 1, 2003; 86(11): 3423 - 3429.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. J. Leury, L. H. Baumgard, S. S. Block, N. Segoale, R. A. Ehrhardt, R. P. Rhoads, D. E. Bauman, A. W. Bell, and Y. R. Boisclair
Effect of insulin and growth hormone on plasma leptin in periparturient dairy cows
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2003; 285(5): R1107 - R1115.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Ueki, G. T. Ooi, M. L. Tremblay, K. R. Hurst, L. A. Bach, and Y. R. Boisclair
Inactivation of the acid labile subunit gene in mice results in mild retardation of postnatal growth despite profound disruptions in the circulating insulin-like growth factor system
PNAS, June 6, 2000; 97(12): 6868 - 6873.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rhoads, R. P.
Right arrow Articles by Boisclair, Y. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rhoads, R. P.
Right arrow Articles by Boisclair, Y. R.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals