Endocrinology Vol. 141, No. 4 1425-1433
Copyright © 2000 by The Endocrine Society
Organization and Regulation of the Gene Encoding the Sheep Acid-Labile Subunit of the 150-Kilodalton Insulin-Like Growth Factor-Binding Protein Complex1
Robert P. Rhoads,
Paul L. Greenwood,
Alan W. Bell and
Yves R. Boisclair
Department of Animal Science, Cornell University (R.P.R., A.W.B.,
Y.R.B.), Ithaca, New York 14853; and New South Wales Agriculture Beef
Industry Center, University of New England P.L.G.), Armidale, New South
Wales 2351, Australia
Address all correspondence and requests for reprints to: Dr. Yves R. Boisclair, 259 Morrison Hall, Cornell University, Ithaca, New York 14853-4801. E-mail: yrb1{at}cornell.edu
 |
Abstract
|
|---|
In adult animals, most circulating insulin-like growth factor I (IGF-I)
and IGF-II is sequestered in a 150-kDa complex composed of 1 molecule
each of IGF, IGF-binding protein-3 or -5, and the acid-labile subunit
(ALS). Capture of IGF in ALS-containing complexes increases their
circulating half-lives and concentrations and suppresses their
hypoglycemic potential. ALS has been studied almost exclusively in
rodents and primates, and no information exists in the sheep despite
its extensive use to study the circulating IGF system. To initiate
studies in the sheep, we isolated the ovine ALS gene and characterized
its spatial and developmental regulation. The ALS gene spans about 3.0
kb of chromosomal DNA and consists of 2 exons interrupted by a 977-bp
intron. Exon 1 encodes the first 5 amino acids of the signal peptide;
exon 2 encodes the remaining 27 amino acids of the signal peptide and
the entire mature protein of 579 amino acids. Transcription initiation
occurs at nucleotides -58 and -29 (ATG, +1), 2 sites that are not
preceded by TATA or initiator sequences. A DNA fragment extending from
-727 to -11 of the sheep ALS gene directed basal expression of a
luciferase reporter plasmid in the rat liver cell line H4-II-E. GH
increased promoter activity by 1.8-fold, consistent with conservation
in the sheep promoter of the GH response element previously identified
in the mouse gene. A survey of adult tissues by Northern analysis
revealed the presence of a 2.2-kb transcript only in liver. Weak
expression was first detected in liver on day 130 of fetal life,
increased suddenly on day 7 of postnatal age, and changed little
thereafter. The sheep is a useful model to understand the regulation
and role of ALS, particularly around the time of birth, when final
maturation of the circulating IGF system occurs.
 |
Introduction
|
|---|
IN MOST ANIMALS, the circulating
insulin-like growth factor (IGF) system is comprised of IGF-I, IGF-II,
and a family of six IGF-binding proteins (IGFBP-1 to 6) (1, 2, 3). These
IGFBPs bind IGFs with high affinity, resulting in little free IGF in
the circulation. An additional level of complexity in the circulating
IGF system is seen when comparing fetal and postnatal plasma by neutral
gel filtration chromatography (1, 2, 4). In fetal plasma, most of the
IGF is recovered in fractions eluting at approximately 50 kDa,
corresponding to binary complexes of IGFBP:IGF. After birth, however,
IGF-I and IGF-II occur mostly in ternary complexes of approximately 150
kDa, consisting of one molecule each of IGF-I or IGF-II, IGFBP-3 or
IGFBP-5, and a serum protein called the acid-labile subunit (ALS)
(1, 2, 3, 4, 5). Circulation of IGF in ternary complexes is one of the final
events in the development of the endocrine IGF system. Functional
consequences of this event include extended half-life of IGFs and
prevention of their hypoglycemic potential (2, 4, 6).
ALS complementary DNAs (cDNAs) and genes have been cloned in mice, rat,
human, and baboon (7, 8, 9, 10, 11). These advances have led to molecular studies
of the regulation of ALS synthesis. ALS is synthesized primarily by the
parenchymal cells of liver after birth (12, 13). GH stimulates
transcription of the ALS gene, resulting in increased abundance of ALS
messenger RNA (mRNA) in liver and elevated serum ALS (14, 15, 16, 17, 18). Negative
factors regulating ALS synthesis in liver cells include cAMP, epidermal
growth factor, dexamethasone, and interleukin-1ß (19, 20, 21).
Ruminants have been used extensively to study the role and regulation
of the endocrine IGF system (22, 23, 24, 25, 26, 27). The sheep, which is a precocial
species like the human, is a particularly good model during fetal and
early postnatal life, when final maturation of the circulating IGF
system takes place (25, 27). There are, however, no published molecular
studies on ALS and its regulation in any species of agricultural
importance, including the sheep. As a first step toward studying the
role of ALS in the sheep IGF system, we have cloned and characterized
the sheep ALS gene. In addition, we show that the sheep ALS promoter is
regulated by GH, and we describe the spatial and developmental
regulation of the gene.
 |
Materials and Methods
|
|---|
Reagents and general methods
Restriction endonucleases, DNA polymerases, and DNA-modifying
enzymes were purchased from Life Technologies, Inc.
(Gaithersburg, MD) and New England Biolabs, Inc. (Beverly,
MA). Oligonucleotides were custom made by Life Technologies, Inc. When needed, they were labeled with
[
-32P]ATP using T4 DNA polynucleotide
kinase. PCR was performed using a thermal cycler (GeneAmp PCR System
2400, Perkin-Elmer Corp., Norwalk, CT). Sequencing was
performed by the Biotechnology Resource Center at Cornell University
(Ithaca, NY) using the Perkin-Elmer Corp./PE Applied Biosystems Division 377 Automated DNA Sequencer with Dye
Terminator chemistry and AmpliTaq-FS DNA polymerase (Perkin-Elmer Corp.). DNA sequences were analyzed with the commercial software
MacVector 6.01 and DNA Strider 1.2 (C. Marck, Centré dEtudes de
Saclay, Cedex, France).
Genomic and cDNA cloning
Total RNA was isolated from an adult sheep liver and reverse
transcribed using a commercial kit (Marathon cDNA Amplification kit,
CLONTECH Laboratories, Inc., Palo Alto, CA). A sheep cDNA
fragment of 154 bp was amplified by PCR using primers F-823 and R-976
(Table 1
) and labeled with
[
-32P]deoxy-CTP (3000 Ci/mmol) by a
Taq DNA polymerase-based method (28). Nylon filters
(Colony/Plaque Screen, NEN Life Science Products, Boston,
MA), representing 2 x 106 plaques of a
sheep genomic library (sheep liver DNA in the
phage EMBL3,
CLONTECH Laboratories, Inc.) were hybridized with the
sheep ALS probe at 42 C overnight. Hybridization conditions and washes
were performed as described previously (7). After secondary and
tertiary plaque purifications, positive clones were grown in liquid
culture, and
DNA was extracted (Wizard Lambda Preps DNA
Purification System, Promega Corp., Madison, WI). Genomic
DNA inserts were released from the
vector with the restriction
enzyme SalI, subcloned into the vector
pGEM-11Zf+ (Promega Corp.), and
sequenced.
Additional DNA products covering the entire sheep ALS cDNA were
amplified by RT-PCR of sheep liver total RNA using primer pairs F-(-57)
and R-976, and F-680 and deoxythymidine (dT; Table 1
). The single
products obtained with each pair were subcloned into the vector pCR
2.1-Topo (Invitrogen, San Diego, CA) and sequenced.
Southern analysis of sheep genomic DNA
Genomic DNA was isolated from adult sheep liver by the procedure
described by Hogan (29). Genomic DNA was digested with selected
restriction endonucleases and electrophoresed on a 0.7% agarose gel.
The agarose gel was soaked in 0.2 N HCl and neutralized in
1.5 M NaCl-0.5 N NaOH before blotting onto a
nylon membrane. The membrane was hybridized to the 154-bp sheep ALS
probe as described above.
Northern analysis
Adult sheep were killed by captive bolt stunning and
exsanguination. Fetuses and neonates were killed by lethal injection of
pentobarbital. Liver and other tissues were excised rapidly,
snap-frozen in liquid nitrogen, and stored at -80 C until extraction
of RNA. These procedures were conducted with the guidance and approval
of the Cornell University institutional animal care committee.
Total RNA was extracted by the acid guanidinium thiocyanate
phenol-chloroform method and quantified by absorbance at 260 nm (15, 17). Total RNA was fractionated on agarose-formaldehyde gels, blotted
onto nylon membranes, and hybridized to the 154-bp sheep DNA probe
labeled with [
-32P]deoxy-CTP (15, 17).
Equality of loading was assessed by visualization of ribosomal RNA or
by reprobing membranes with a low specific activity 18S RNA probe. The
18S probe was generated from the pT7 RNA 18S template (Ambion, Inc., Austin, TX) using the RiboMAX system (Promega Corp.) with [
-32P]UTP. The relative
abundance of ALS mRNA and 18S ribosomal RNA was quantified by
phos-phorimaging.
Tobacco acid pyrophosphatase (TAP)-reverse ligation PCR
(TAP-RLPCR)
TAP-RLPCR was performed exactly as previously described (7),
except for the modifications noted below. Total RNA from adult sheep
liver was treated with deoxyribonuclease I and calf intestinal alkaline
phosphatase. The cap of mRNAs was hydrolyzed with TAP, and the exposed
5'-phosphate ends were ligated to the RNA linker
(GGGCAUAGGCUGACCCUCGCUGAAA) with T4 RNA ligase. The RT reaction,
modified to include a greater mass of ligated RNA (1 µg), was
performed with Superscript II RNase H- reverse
transcriptase (Life Technologies, Inc.) and sheep ALS
primer R-210 (Table 1
), as suggested by the manufacturer. Ten percent
of the RT reaction was amplified by PCR with a DNA primer corresponding
to the RNA linker (DNA Pr-1) and sheep ALS-specific primers R-179 and
R-74 (Table 1
). ALS cDNAs were amplified for 35 cycles (30 sec at 94 C,
30 sec at 60 C, and 30 sec at 72 C) using Taq DNA
polymerase. Products were subcloned into pCR 2.1-Topo and
sequenced.
Transfection of liver-derived cells
Fragments corresponding to nucleotides (nt) -727 to -11
(A+1TG) or to nt -616 to -11 of the sheep ALS
gene were generated by PCR using forward primer F-(-727) or F-(-616),
and reverse primer R-(-11) (Table 1
). PCR fragments were inserted in
the SmaI restriction site of the promoterless luciferase
vector pGL3-Basic (Promega Corp.) in the sense orientation
to give s727S or s616S (the number refers to the 5'-end of the promoter
fragment) or in the antisense orientation to give s727A or s616A. Two
independent PCR reactions were performed with the high fidelity Vent
polymerase to prepare duplicate plasmids. The pGL3-Basic plasmid
containing the nt -703 to -11 fragment of the mouse ALS promoter
(m703S) has been described previously (17).
For transfection, H4-II-E cells were grown in DMEM supplemented with
10% FCS in six-well cluster plate. Each well of near-confluent H4-II-E
cells was exposed to 95 µl of a DNA solution containing 0.5 mg/ml
diethylaminoethyl-dextran, 0.7 µg firefly luciferase plasmid, and 0.3
µg plasmid pRL-TK (17). pRL-TK (Promega Corp.) encodes
Renilla luciferase and was used to correct for variation in
transfection efficiency. After a 40-h recovery period in DMEM
supplemented with 10% FCS, media were changed to serum-free DMEM
supplemented with or without 100 ng/ml bovine GH (Protiva, St. Louis,
MO). Twenty-four hours later, cell lysates were assayed for firefly and
Renilla luciferase by the Dual-Luciferase Reporter System
(Promega Corp.).
 |
Results
|
|---|
Cloning of the sheep ALS gene
Northern analysis showed that human or mouse ALS cDNAs did not
hybridize to ALS mRNA in adult sheep liver (results not shown). To
generate a sheep probe, cDNAs were synthesized by RT of total RNA from
adult sheep liver and were used in PCR amplification with primers
corresponding to conserved regions of mouse, rat, and human ALS cDNAs.
The primer pairs F-680/R-976 and F-823/R-976 yielded single products of
297 and 154 bp, respectively (Table 1
). These products were of the
expected size and had over 87% identity with the regions of the human
ALS cDNA bracketed by these primer pairs, indicating that they
correspond to fragments of the sheep ALS cDNA.
Two positive clones, covering over 15 kb of chromosomal DNA, were
isolated from a sheep liver genomic library using the 154-bp ALS DNA
fragment as a probe (Fig. 1
). Two
SalI DNA fragments, corresponding to the entire genomic
insert contained in clone 5, were subcloned into the plasmid vector
pGEM-11Zf+. The SalI restriction
fragment 5A, which hybridized with the 154-bp sheep ALS fragment, was
further characterized by digestion with the restriction endonucleases
FspI and BsmI, two endonucleases that cut the
297-bp partial sheep cDNA only once. Southern blots of these digests
were probed with oligonucleotides corresponding to the 5'-end (F-680)
or the 3'-end (R-976) of the 297-bp partial sheep cDNA. Primer F-680
hybridized only to a 2.3-kb BsmI fragment, designated 5A1,
whereas primer R-976 hybridized only to an overlapping 1.8-kb
FspI fragment, designated 5A3 (Fig. 1
). As the ALS gene in
mouse and rat covers only about 3.3 kb of chromosomal DNA (7, 9), this
analysis suggested that these overlapping restriction fragments
contained the entire coding regions of the sheep ALS gene. DNA
fragments 5A1 and 5A3 were subcloned and sequenced entirely (Fig. 1
).
The FspI fragment 5A2, which extends further upstream of the
gene, was also sequenced.

View larger version (9K):
[in this window]
[in a new window]
|
Figure 1. Organization of the sheep ALS gene. ALS genomic
DNA contained in the positive phage clones are depicted, with their
lengths given in parentheses. A schematic map of the
sheep ALS gene is shown below the clones. Exons are
represented by boxes (coding regions are
closed, noncoding regions are open), and
intron and flanking regions are represented by horizontal
lines. The horizontal line above exon 2
indicates the position of the 154-bp sheep ALS DNA probe. Sites at
which the restriction endonucleases SalI,
FspI, and BsmI cleave the genomic clone
5 are delineated by vertical arrows. Fragments 5A1,
5A2, and 5A3 were subcloned and sequenced.
|
|
Structure of the gene and deduced amino acid sequence of sheep
ALS
Overlapping DNA fragments covering the entire sheep cDNA were
synthesized by RT-PCR with primer pair F-(-57)/R-976 and F-680/dT
(Table 1
). Comparison of their sequences with genomic sequence
indicated that the sheep gene is organized in two exons separated by a
977-bp intron (Fig. 2
). The exact
positions of the exon-intron boundaries conform to the 5'-splice donor
(GT)/3'-splice acceptor (AG) rule (30) and are found at homologous
locations in the rat and mouse genes (7, 9). The coding sequence of the
sheep ALS gene is 80% and 75% identical to the corresponding regions
of the human and mouse genes, respectively.

View larger version (60K):
[in this window]
[in a new window]
|
Figure 2. Nucleotide sequence of the sheep ALS gene and
deduced amino acid sequence of sheep ALS. The nucleotide sequence of
the coding region of exon 1 and the complete nucleotide sequence of
exon 2 are shown. The intron is represented schematically by
dotted lines, except for the nucleotide bordering the
exons (shown in lowercase letters). The nucleotide
sequence is numbered on the left relative to the
translation initiation codon (A+1TG). The intron/exon
boundaries and the 3'-end of exon 2 were determined by comparing
genomic and cDNA sequences. The last nt of exon 2 corresponds to the
site of polyadenylation and is preceded by two potential
polyadenylation signals (shown by double underlines).
The deduced amino acid sequence is given below the
nucleotide sequence in standard one-letter abbreviation. Amino acids
are numbered on the left relative to the methionine
encoded by the initiating ATG. The first amino acid residue of the
mature protein (amino acid 33) is boxed (31 ). A
star denotes the stop codon TGA. Residues in sheep ALS
that differ from those in human ALS are shown by
boldface and underlined
letters (150 of 611 amino acids). Leucine 582, which
accounts for the single amino acid difference in the size of mature
sheep and human ALS, is bracketed.
|
|
A comparison of the product of rapid amplification of 3'-cDNA ends
obtained with the primer pair F-680/dT to genomic DNA indicated that
polyadenylation occurs 164 bp downstream of the stop codon. The
canonical polyadenylation signal AATAAA and its most common variant,
ATTAAA, are present 12 and 25 nt upstream of the polyadenylation
site (Fig. 2
). Finally, sheep genomic DNA was digested with the
restriction enzymes SacI, HindIII, and
XhoI and analyzed by Southern blotting with the 154-bp DNA
probe. A unique hybridization signal was obtained for each restriction
digest, indicating that a single copy of the ALS gene is present in the
sheep genome (Fig. 3
). Overall, the
single sheep ALS gene spans approximately 3.0 kb of genomic DNA. Exon 1
is small and contains only 16 bp of coding sequence; exon 2 is 1957 bp
long, 1803 bp of which are coding sequence.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 3. The ALS gene occurs as a single copy in the sheep
genome. Top panel, Southern blot of sheep genomic DNA.
Each lane contains 10 µg sheep liver DNA digested with the
restriction enzymes SacI, HindIII, and
XhoI. The blot was hybridized to the 154-bp sheep ALS
DNA probe. The positions of the DNA markers are given on the
left of the blot. Bottom panel, A
schematic of the ALS gene is shown with the location of endonuclease
restriction sites. Exons are represented by boxes
(coding regions are closed, noncoding regions are
open), and intron and flanking regions are represented
by horizontal lines. The thick line above
exon 2 indicates the position of the 154-bp ALS DNA probe. The
positions of the endonuclease restriction sites are shown by
vertical arrows.
|
|
The sheep ALS gene encodes a protein of 611 amino acids, with exon 1
contributing only the first 5 amino acids. Analysis of the primary
structure with the SignalP software (30A ) predicted a signal
peptide of 32 amino acids and a mature protein of 579 amino acids (Fig. 2
) (31). Mature sheep ALS protein is 77% identical to human ALS and
73% identical to mouse ALS (comparison of sheep and human ALS is shown
in Fig. 2
). As seen in human, rat, and mouse ALS, the core of mature
sheep ALS is organized into 1820 leucine-rich domains of 24 amino
acids each and contains 12 cysteine residues, 11 of which are present
in human ALS. The difference in the size of mature ALS in sheep
vs. human (579 vs. 578 amino acids) is accounted
for by an additional leucine residue near the carboxyl end of the
protein (Fig. 2
). Consistent with the glycosylated nature of
circulating ALS, six potential asparagine-linked glycosylation sites
(NXS/T) are present in sheep ALS.
Determination of the sites of transcription initiation
TAP-RLPCR was used to identify the site of transcription
initiation in the sheep ALS gene (7, 32). In this assay, a universal
RNA primer is ligated specifically to the cap structure of mRNAs (Fig. 4
). When ligated mRNAs are used in RT-PCR
with the universal DNA Pr-1 and a gene-specific primer, amplification
occurs only from cDNAs extending to the cap site of the selected
mRNA.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 4. Identification of the transcription start sites
for the sheep ALS gene. Left panel, The TAP-RLPCR assay
is illustrated for the sheep ALS mRNAs detected in this experiment. ALS
primers are represented as open boxes, and their
positions are given relative to the ATG of the sheep gene. Total RNA
from sheep adult liver was treated with deoxyribonuclease I, calf
intestinal alkaline phosphatase, and TAP and ligated to the RNA linker
(shown as a bold wavy line). Ligated RNA was annealed to
primer R-210 and reverse transcribed. ALS cDNAs were amplified with DNA
Pr-1 (shown as a closed box) and primer R-179 or R-74.
Both of these primers anneal to sequence located in exon 2.
Right panel, Products detected with DNA-Pr-1 and primer
R-179 or R-74. PCR reactions were performed with RNA incubated in the
absence (-) or presence (+) of TAP and analyzed on a 3% agarose gel.
Products represent amplification of RNA, as amplification of DNA would
yield products containing an additional 977 bp of intronic DNA. A
100-bp ladder is shown in lane 1.
|
|
Total RNA from adult sheep liver was hydrolyzed with TAP, the RNA
linker was ligated to the exposed 5'-ends of mRNAs, and ALS mRNAs were
reverse transcribed with ALS primer R-210 (Fig. 4
). Amplification of
ALS cDNAs with DNA Pr-1 and sheep ALS primer R-179 yielded two products
of approximately 240 bp (Fig. 4
). Use of R-74, which is located 86 bp
upstream of R-179, also yielded two products of about 140 bp.
Sequencing of these products showed that the RNA linker was ligated to
mRNA initiating at nt -58 and -29 of the ALS gene. A third faint
product of approximately 300 bp was detected only with R-74, but
sequencing showed that it did not correspond to ALS mRNA. No products
were obtained when TAP treatment of RNA was omitted, indicating that nt
-58 and -29 are authentic cap sites. Amplification with DNA Pr-1 and
sheep ALS primers located upstream of nt -58 [R-(-307) and R-(-343)]
failed to yield any product, suggesting the absence of more distal
transcription initiation sites (results not shown). The region
immediately upstream of nt -58 and -29 is devoid of TATA or initiator
sequences (Fig. 5
).

View larger version (71K):
[in this window]
[in a new window]
|
Figure 5. Comparison of the nucleotide sequence of the
5'-flanking region of the sheep and mouse ALS gene. Nucleotides of the
5'-flanking regions of the sheep (top) and mouse
(bottom) ALS genes are numbered on the
left relative to ATG, +1. Sequences identical in both
sheep and mouse ALS are shaded. Potential
cis-elements present in the sheep sequence were
identified by searching for homology to the consensus sequences of
known transcription factors [consensus sequence: HNF-3,
T(G/A)TTTG(C/T); ALSGAS1, TTCCTAGAA; nuclear factor-1, TGGNNNNNNGCCA;
activating protein-2, CCC(A/C)N(G/C)(G/C)(G/C); Sp1, GGGCGG; nuclear
factor- B, GGG(A/G)NT(C/T)(C/T)] (17 33 ). They are
underlined (thin lines when on the sense
strand, thick lines when on the antisense strand), with
their names given above their location. Sites of
transcription initiation in the sheep ALS gene are indicated by
arrows.
|
|
Identification of a GH-regulated promoter
Next, we tested whether the region located upstream of the ATG
contained a promoter. A DNA fragment corresponding to nt -727 to -11
of the sheep ALS gene was cloned in the antisense or sense orientation
in the promoterless reporter plasmid pGL3. These plasmids were
transfected in the H4-II-E rat hepatoma cell line. Cell transfected
with the sense plasmid (s727S) had 9.5-fold greater luciferase activity
than the cells transfected with the antisense construct (s727A; Fig. 6
). Therefore, the sequence immediately
upstream of the ATG contains the functional promoter of the gene.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 6. Identification of the promoter of the sheep ALS
gene. Left panel, The region immediately upstream of the
ATG contains the promoter of the sheep ALS gene. A fragment
corresponding to nt -727 to -11 of the sheep ALS gene was ligated
upstream of the promoterless luciferase gene pGL3-basic in the
antisense (s727A) and sense (s727S) orientations. Luciferase plasmids
(0.7 µg) were cotransfected with pRL-TK (300 ng) into H4-II-E rat
hepatoma cells using diethylaminoethyl-dextran. Transfected cells were
incubated for 24 h in serum-free conditions. Then, firefly
luciferase activity was measured in cell extracts and corrected for
Renilla luciferase activity. Each bar
represents the mean ± SE of two replicates
(left panel). Means with different letters differ at
P < 0.05, using one-way ANOVA. Similar results
were obtained in two additional experiments. Right
panel, The sheep ALS promoter is GH responsive. pGL3 plasmids
(0.7 µg) containing the sense nt -703 to -11 mouse ALS promoter
(m703S), the sense nt -727 to -11 sheep ALS promoter (s727S), or the
sense (s616S) or antisense (s616A) nt -616 to -11 sheep ALS promoter
were cotransfected with pRL-TK (300 ng) into H4-II-E rat hepatoma cells
as described above. Transfected cells were incubated for 24 h in
the absence (- GH) or presence (+ GH) of bovine GH. Firefly luciferase
was measured in cell extracts and corrected for Renilla
luciferase activity. Each bar represents the mean
± SE of three replicates. For each plasmid, means with
different letters differ at P < 0.05, using
one-way ANOVA. Similar results were obtained in a duplicate experiment.
Luciferase activity in cells transfected with the promoterless
pGL3-Basic plasmid was 1624 ± 208 in the absence of GH and
1719 ± 233 in the presence of GH.
|
|
The sheep ALS promoter contains sites that could be recognized by the
transcription factors Sp1, AP-2, nuclear factor-
B, nuclear factor-1,
and hepatic nuclear factor-3 (HNF-3; Fig. 5
) (33). Comparison of the
sheep and mouse promoters indicated only 54% sequence identity and
conservation of only the HNF-3 site and of ALSGAS1, an element located
between nt -623 and 615 that resembles a
-interferon-activated
sequence (GAS). We showed previously that this GAS element, present at
a similar location in the mouse promoter, mediates the GH activation of
ALS gene transcription by binding signal transducer and activator of
transcription-5a (STAT5a) and STAT5b (17). To determine whether the
sheep ALS promoter is also GH responsive, the luciferase constructs
driven by the nt -727 to -11 ALS promoter (s727S) or by the
equivalent mouse promoter fragment m703S were transfected in H4-II-E
cells (Fig. 6
). Treatment of the cells with GH stimulated the activity
of the sheep and mouse promoters by 1.8- and 2.3-fold, respectively. To
evaluate this further, cells were transfected with luciferase plasmids
driven by the nt -616 to -11 sheep promoter that does not include the
ALSGAS1 element (see Fig. 5
). Basal activity of the sense construct
(s616S) was 3.7-fold higher than that of the antisense construct
(s616A) and similar to basal activity of the longer construct (s727S).
However, GH was unable to stimulate the activity of this promoter when
present in the sense or antisense orientation. We conclude that
transcription of the sheep ALS promoter is also activated by GH.
Spatial and developmental regulation of ALS gene expression
In the rat, high level expression of the ALS gene is detected only
in postnatal liver. When analyzed by Northern blotting, ALS mRNA was
detected in liver of adult sheep, but was absent in kidney, spleen,
muscle, heart, lung, and brain (Fig. 7
).
To determine the onset of hepatic expression of the ALS gene, total RNA
was extracted from livers of normal sheep before and after birth. Weak
expression was first detected at 130 days of fetal life. Expression
increased sharply at 7 days of age and varied little thereafter (Fig. 7
).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 7. Spatial and developmental regulation of the sheep
ALS gene. Left panel, The ALS gene is expressed only in
liver of adult sheep. Total RNA was isolated from tissues of an adult
sheep, and 15 µg were analyzed by Northern blotting using the 154 bp
sheep ALS DNA probe. The size of the ALS signal is given on the
left. Ethidium bromide staining of the gel indicates
that total RNA was intact and loaded equally. Right
panel, Hepatic expression of the ALS gene increases rapidly
after birth. Total RNA was isolated from the liver of sheep at various
ages of fetal and postnatal life, and 15 µg were analyzed by Northern
blotting using the 154-bp sheep ALS DNA probe. Each lane corresponds to
a different animal. The blot was rehybridized with the 18S ribosomal
RNA riboprobe to show equal loading across lanes. Arrows
on the right of each panel indicate the positions of the
sheep 2.2-kb ALS mRNA and 18S ribosomal RNA.
|
|
 |
Discussion
|
|---|
Before this work, sequences have been published for primate (human
and baboon) and rodent (mouse and rat) ALS cDNAs, whereas the
organization of the gene has been resolved only in the mouse and rat
(7, 8, 9, 10, 11). Comparison across species reveals a high degree of
conservation at the level of the ALS gene, cDNA, and protein. In sheep
and rodents, the ALS gene occurs as a single copy gene, ranging in size
from 3.03.3 kb, and is composed of 2 exons and 1 intron of
approximately 1 kb; exon 1 always contains the first 5 codons and the
first nucleotide of codon 6 (7, 9). Transcription of the ALS gene
produces a mRNA of about 2.2 kb, which encodes proteins of 603 amino
acid residues in the mouse, 605 residues in the human, and 611 residues
in the sheep (7, 10). Most of the extra amino acid residues in the
sheep appear in the predicted secretory peptide of 32 amino acids,
yielding a mature protein of similar size in sheep as in mouse and
human (i.e. 579 residues in sheep vs. 578 in
human and 580 in mouse). Mature sheep ALS is 77% and 73% identical to
human and mouse ALS, respectively, and also features the characteristic
leucine-rich domains of 24 amino acids each (7, 10). This repeating
motif is present in other proteins forming multiprotein complexes and
is thought to confer to ALS its ability to associate with binary
complexes of IGFBP-3:IGF or IGFBP-5:IGF (5, 10).
One difference between species appears to be the location of the
transcription start sites. Multiple start sites were detected between
nt -505 and -385 in the rat, and between nt -151 and -14 in the
mouse (7, 9). In the sheep, transcription initiation was shown to occur
from nt -58 and -29 by TAP-RLPCR. Moreover, we did not detect
additional, more distal start sites when total liver RNA was analyzed
by ribonuclease protection assay using a riboprobe consisting of the
first 163 nt of the cDNA and the first 520 nt of the 5'-region of the
sheep ALS gene (results not shown). Therefore, sheep and mouse appear
to be similar with respect to the region where transcription initiation
occurs.
Surveys of various tissues by Northern analysis indicate that high
level expression of the ALS gene in the mouse, rat, and baboon is
restricted to postnatal liver (7, 11, 12). Our data indicate that this
is also true in adult sheep. It remains possible that low level
expression occurs in other tissues and serves to supply the local IGF
system with ALS. For example, ALS expression has been identified in the
proximal tubule epithelium of rat kidney by the more sensitive in
situ hybridization (13), and significant concentrations of ALS
have been measured in synovial, ovarian, and blister fluids in humans
(34, 35, 36). Using Northern analysis, we have not detected ALS mRNA in
sheep kidney or in thecal or granulosa cells of the bovine ovary (Fig. 7
and results not shown). Although more sensitive techniques may detect
extrahepatic expression, our data indicate that in the sheep, as in
other species, the liver is by far the most important source of
circulating ALS (11, 12, 13, 15).
The developmental regulation of ALS gene expression in liver has been
studied only in the rat. Expression is first detected at low levels
after birth, is induced by 3 weeks of postnatal age, and becomes
maximal by 6 weeks (12); concentration of serum ALS follows an
identical developmental pattern (14, 37). In the sheep, abundance of
ALS mRNA is also low before birth, but increases abruptly within 7 days
of postnatal life. This pattern of developmental expression correlates
with the circulation of IGFs primarily in complexes of 50 kDa before
birth and primarily in complexes of 150 kDa 1 week after birth (24).
The faster onset of ALS synthesis in the postnatal sheep probably
reflects its greater maturity than the rat at birth.
In humans and rodents, GH is the most potent inducer of ALS mRNA in the
liver and of ALS in the circulation (14, 15, 16, 18). The importance of
this regulation is underlined by the temporal correlation between ALS
mRNA levels and the appearance of functional GH receptor in liver in
both sheep and rats (38, 39), and by the near-complete absence of ALS
in GH-deficient animals (40, 41). We have shown that this effect of GH
represents a stimulation of ALS gene transcription mediated by the
binding of STAT5 to ALSGAS1, a GAS-like element in the mouse promoter
(17). This element is also conserved in the human ALS promoter and is
responsible for conferring GH responsiveness (42). In the present study
we show that GH activated the sheep ALS promoter nearly as well as the
mouse promoter when assayed in a rat liver cell line. Significantly,
the sequence and position of the ALSGAS1 element are completely
conserved in the sheep despite only 54% sequence identity between the
proximal regions of the mouse and sheep promoters. Removal of the
GAS-like element had no effect on basal activity, but eliminated the GH
responsiveness of the sheep promoter. This suggests that GH stimulates
transcription of the sheep ALS gene by a mechanism similar to that
described in the mouse and human.
Sheep have been used extensively to study the regulation and roles of
the various components of the circulating IGF system (22, 23, 24, 25, 27).
These studies are of interest because sheep approximate the human IGF
system more closely than rats. With the cloning of the sheep gene, some
unresolved issues concerning ALS can now be addressed in this animal
model. First, because humans are more similar to sheep than to rats in
terms of maturity at birth, sheep are ideal to study the regulation of
ALS gene expression during the transition from fetal to postnatal life,
when development of a fully operational GH-IGF-I axis in liver occurs.
Second, in contrast to rats, humans and sheep maintain significant
concentrations of IGFBP-2 and IGF-II during postnatal life (26, 43, 44). Because IGF-II and IGFBP-2 are important players in the etiology
of diseases associated with impaired formation of the ternary complexes
such as tumor-induced hypoglycemia (45), the sheep may provide a better
physiological context than the rat in which to study functional aspects
of ALS. Finally, ALS has not been considered to play a major role in
regulating serum IGFs levels because it circulates in a 2- to 3-fold
molar excess over the concentrations of IGFBP-3 and IGFs. However, mice
with one and two null ALS alleles have 30% and 60% reductions,
respectively, in the concentration of plasma IGF-I (Boisclair, Y.
R., unpublished results), suggesting that variations in the molar
excess of ALS can contribute to changes in the concentration of serum
IGFs. Ruminants provide unique opportunities to test this hypothesis,
as concentrations of IGFs, particularly IGF-I, are regulated
dynamically by development, nutrition, and physiological states. For
example, concentrations of serum IGF-I are increased severalfold by
exogenous administration of GH and by prolonged
euglycemic/hyperinsulinemic clamps, whereas they decline by 5080%
during periods of undernutrition and during the transition from
pregnancy to lactation (22, 46, 47, 48). Study of the impact of these
factors on hepatic expression and circulating levels of ALS in
ruminants will contribute to a better understanding of the circulating
IGF system.
 |
Footnotes
|
|---|
1 This work was supported by NIH Grant DK-51624 (to Y.R.B.) and the
Cornell University Agricultural Experiment Station. 
Received September 21, 1999.
 |
References
|
|---|
-
Jones JI, Clemmons DR 1995 Insulin-like growth
factors and their binding proteins: biological actions. Endocr Rev 16:334[Abstract/Free Full Text]
-
Rechler MM 1993 Insulin-like growth factor binding
proteins. Vitam Horm 47:1114[Medline]
-
Ooi GT, Boisclair YR 1999 Molecular biology of the
insulin-like growth factor binding proteins. In: Rosenfeld R, Roberts
Jr C (eds) Contemporary Endocrinology: The IGF System. Humana Press,
Totowa, pp 111139
-
Baxter RC 1994 Insulin-like growth factor binding
proteins in the human circulation: a review. Horm Res 42:140144[Medline]
-
Twigg SM, Baxter RC 1998 Insulin-like growth
factor (IGF)-binding protein 5 forms an alternative ternary complex
with IGFs and the acid-labile subunit. J Biol Chem 273:60746079[Abstract/Free Full Text]
-
Zapf J, Hauri C, Futo E, Hussain M, Rutishauser J,
Maack CA, Froesch ER 1995 Intravenously injected insulin-like
growth factor (IGF) I/IGF binding protein-3 complex exerts insulin-like
effects in hypophysectomized, but not in normal rats. J Clin
Invest 95:179186
-
Boisclair YR, Seto D, Hsieh S, Hurst KR, Ooi GT 1996 Organization and chromosomal localization of the gene encoding the
mouse acid labile subunit of the insulin-like growth factor binding
complex. Proc Natl Acad Sci USA 93:1002810033[Abstract/Free Full Text]
-
Dai J, Baxter RC 1992 Molecular cloning of the
acid-labile subunit of the rat insulin-like growth factor binding
protein complex. Biochem Biophys Res Commun 188:304309[CrossRef][Medline]
-
Delhanty PJD, Baxter RC 1997 Cloning and
characterization of the rat gene for the acid-labile subunit of the
insulin-like growth factor binding protein complex. J Mol Endocrinol 19:267277[Abstract/Free Full Text]
-
Leong SR, Baxter RC, Camerato T, Dai J, Wood WI 1992 Structure and functional expression of the acid-labile subunit of
the insulin-like growth factor binding protein complex. Mol Endocrinol 6:870876[Abstract/Free Full Text]
-
Delhanty P, Baxter RC 1996 The cloning and
expression of the baboon acid-labile subunit of the insulin-like growth
factor binding protein complex. Biochem Biophys Res Commun 227:897902[CrossRef][Medline]
-
Dai J, Baxter RC 1994 Regulation in vivo
of the acid-labile subunit of the rat serum insulin-like growth
factor-binding protein complex. Endocrinology 135:23352341[Abstract]
-
Chin E, Zhou J, Dai J, Baxter RC, Bondy CA 1994 Cellular localization and regulation of gene expression for components
of the insulin-like growth factor ternary binding protein complex.
Endocrinology 134:24982504[Abstract/Free Full Text]
-
Baxter RC, Dai J 1994 Purification and
characterization of the acid-labile subunit of rat serum insulin-like
growth factor binding protein complex. Endocrinology 134:848852[Abstract/Free Full Text]
-
Ooi GT, Cohen FJ, Tseng LY-H, Rechler MM, Boisclair
YR 1997 Growth hormone stimulates transcription of the gene
encoding the acid-labile subunit (ALS) of the circulating insulin-like
growth factor-binding protein complex and ALS promoter activity in rat
liver. Mol Endocrinol 11:9971007[Abstract/Free Full Text]
-
Baxter RC 1988 Characterization of the acid-labile
subunit of the growth hormone-dependent insulin-like growth factor
binding protein complex. J Clin Endocrinol Metab 67:265272[Abstract/Free Full Text]
-
Ooi GT, Hurst KR, Poy MN, Rechler MM, Boisclair YR 1998 Binding of STAT5a and STAT5b to a single element resembling a
-interferon activated sequence mediates the growth hormone induction
of the mouse acid-labile subunit promoter in liver cells. Mol
Endocrinol 12:675687[Abstract/Free Full Text]
-
Olivecrona H, Hilding A, Ekstrom C, Barle H, Nyberg B,
Moller C, Delhanty PJ, Baxter RC, Angelin B, Ekstrom J, Tally M 1999 Acute and short-term effects of growth hormone on insulin-like
growth factors and their binding proteins: serum levels and hepatic
messenger ribonucleic acid responses in humans. J Clin Endocrinol
Metab 84:553560[Abstract/Free Full Text]
-
Delhanty PJD, Baxter RC 1998 The regulation of
acid-labile subunit gene expression and secretion by cyclic adenosine
3',5'-monophosphate. Endocrinology 139:260265[Abstract/Free Full Text]
-
Delhanty PJD 1998 Interleukin-1ß suppresses
growth hormone-induced acid-labile subunit mRNA levels and secretion in
primary hepatocytes. Biochem Biophys Res Commun 243:269272[CrossRef][Medline]
-
Dai J, Scott CD, Baxter RC 1994 Regulation of the
acid-labile subunit of the insulin-like growth factor complex in
cultured rat hepatocytes. Endocrinology 135:10661072[Abstract]
-
Pell JM, Saunders JC, Gilmour RS 1993 Differential
regulation of transcription initiation from insulin-like growth
factor-I (IGF-I) leader exons and of tissue IGF-I expression in
response to changed growth hormone and nutritional status in sheep.
Endocrinology 132:17971807[Abstract/Free Full Text]
-
Lee W-H, Gaylord TD, Bowsher RR, Hlaing M, Moorehead H,
Liechty EA 1997 Nutritional regulation of circulating insulin-like
growth factors (IGFs) and their binding proteins in the ovine fetus.
Endocr J 44:163173[Medline]
-
Butler JH, Gluckman PD 1986 Circulating
insulin-like growth factor-binding proteins in fetal, neonatal and
adult sheep. J Endocrinol 109:333338[Abstract/Free Full Text]
-
Gluckman PD 1995 The endocrine regulation of fetal
growth in late gestation: the role of insulin-like growth factors.
J Clin Endocrinol Metab 80:10471050[CrossRef][Medline]
-
Carr JM, Owens JA, Grant PA, Walton PE, Owens PC,
Wallace JC 1995 Circulating insulin-like growth factors (IGFs),
IGF-binding proteins (IGFBPs) and tissue mRNA levels of IGFBP-2 and
IGFBP-4 in the ovine fetus. J Endocrinol 145:545557[Abstract/Free Full Text]
-
Owens JA 1991 Endocrine and substrate control of
fetal growth: placental and maternal influences and insulin-like growth
factors. Reprod Fertil Dev 3:501517[CrossRef][Medline]
-
Medori R, Trischler H-J, Gambetti P 1992 A rapid
and simple method for labeling short DNA fragments using Taq
polymerase. BioTechniques 12:350353[Medline]
-
Hogan B, Constantine F, Lacy E 1986 Manipulating
the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory,
Cold Spring Harbor, pp 332
-
Padgett RA, Grabowski PJ, Konarska MM, Seiber S, Sharp
PA 1986 Splicing of messenger RNA precursors. Annu Rev Biochem 55:11191150[CrossRef][Medline]
-
Nielsen H, Engelbrecht J, Brunak S, Von Heijne G1997 Identification of prokaryotic and eukaryotic signal peptides
and prediction of their cleavage sites. Protein Eng 10:16
-
Nielsen H, Engelbrecht J, Brunak S, von Heijne G 1997 Identification of prokaryotic and eukaryotic signal peptides and
prediction of their cleavage sites. Protein Engin 10:16[Abstract/Free Full Text]
-
Fromont-Racine M, Bertrand E, Pictet R, Grange T 1993 A highly sensitive method for mapping the 5' termini of mRNAs.
Nucleic Acids Res 21:16831684[Free Full Text]
-
Faisst S, Meyer S 1992 Compilation of
vertebrate-encoded transcription factors. Nucleic Acids Res 20:326[Free Full Text]
-
Xu S, Cwyfan-Hughes C, Van der Stappen JWJ, Sansom J,
Burton JL, Donnelly M, Holly JMP 1995 Insulin-like growth factors
(IGFs) and IGF-binding proteins in human skin interstitial fluid.
J Clin Endocrinol Metab 80:29402945[Abstract/Free Full Text]
-
Cwyfan-Hughes SC, Mason HD, Franks S, Holly JMP 1997 The insulin-like growth factors (IGFs) in follicular fluid are
predominantly bound in the ternary complex. J Endocrinol 155:R1R4
-
Khosravi MJ, Diamandi A, Mistry J, Krishna RG, Khare
A 1997 Acid-labile subunit of human insulin-like growth
factor-binding protein complex: measurement, molecular, and clinical
evaluation. J Clin Endocrinol Metab 82:39443951[Abstract/Free Full Text]
-
Frystyk J, Gronbaek H, Skjaerbaek C, Flyvbjerg A, Orskov
H, Baxter RC 1998 Developmental changes in serum levels of free
and total insulin-like growth factor I (IGF-I), IGF-binding proteins-1
and -3, and the acid labile subunit in rats. Endocrinology 139:42864292[Abstract/Free Full Text]
-
Tiong TS, Herington AC 1992 Ontogeny of messenger
RNA for the rat growth hormone receptor and serum binding protein. Mol
Cell Endocrinol 83:133141[CrossRef][Medline]
-
Gluckman PD, Butler JH, Elliott TB 1983 The
ontogeny of somatotrophic binding sites in ovine hepatic membranes.
Endocrinology 112:16071612[Abstract/Free Full Text]
-
Gargosky SE, Tapanainen P, Rosenfeld RG 1994 Administration of growth hormone (GH), but not insulin-like growth
factor-I (IGF-I), by continuous infusion can induce the formation of
the 150-kilodalton IGF-binding protein-3 complex in GH-deficient rats.
Endocrinology 134:22672276[Abstract/Free Full Text]
-
Zapf J, Hauri C, Waldvogel M, Futo E, Hasler H, Binz K,
Guler HP, Schmid C, Froesch ER 1989 Recombinant human insulin-like
growth factor I induces its own specific carrier protein in
hypophysectomized and diabetic rats. Proc Natl Acad Sci USA 86:38133817[Abstract/Free Full Text]
-
Suwanichkul A, Boisclair YR, Olney RC, Durham SK, Powell
DR Conservation of a growth hormone-responsive promoter element
in the human, and mouse acid-labile subunit genes. Endocrinology, in
press
-
Daughaday WH, Rotwein P 1989 Insulin-like growth
factors I and II. Peptide, messenger ribonucleic acid and gene
structures, serum, and tissue concentrations. Endocr Rev 10:6891[Abstract/Free Full Text]
-
Gallaher BW, Breier BH, Blum WF, McCutcheon SN, Gluckman
PD 1995 A homologous radioimmunoassay for ovine insulin-like
growth factor-binding protein-2: ontogenesis and the response to growth
hormone, placental lactogen and insulin-like growth factor-I treatment
in sheep. J Endocrinol 144:7582[Abstract/Free Full Text]
-
Zapf J 1994 Role of insulin-like growth factor II
and IGF binding proteins in extrapancreatic tumor hypoglycemia. Horm
Res 42:2026[Medline]
-
McGuire MA, Dwyer DA, Harrell RJ, Bauman DE 1995 Insulin regulates circulating insulin-like growth factors and some of
their binding proteins in lactating cows. Am J Physiol Endocrinol
Metab 269:E723E730
-
McGuire MA, Bauman DE, Dwyer DA, Cohick WS 1995 Nutritional modulation of the somatotropin/insulin-like growth factor
system: Response to feed deprivation in lactating cows. J Nutr 125:493502
-
Vega JR, Gibson CA, Skaar TC, Hadsell DL, Baumrucker
CR 1991 Insulin-like growth factor (IGF)-I and -II and IGF binding
proteins in serum and mammary secretions during the dry period and in
early lactation in dairy cows. J Anim Sci 69:25382547[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
J. W Kim, R. P Rhoads, N. Segoale, N. B Kristensen, D. E Bauman, and Y. R Boisclair
Isolation of the cDNA encoding the acid labile subunit (ALS) of the 150 kDa IGF-binding protein complex in cattle and ALS regulation during the transition from pregnancy to lactation.
J. Endocrinol.,
June 1, 2006;
189(3):
583 - 593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. P. Rhoads, C. McManaman, K. L. Ingvartsen, and Y. R. Boisclair
The Housekeeping Genes GAPDH and Cyclophilin Are Regulated by Metabolic State in the Liver of Dairy Cows
J Dairy Sci,
November 1, 2003;
86(11):
3423 - 3429.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Leury, L. H. Baumgard, S. S. Block, N. Segoale, R. A. Ehrhardt, R. P. Rhoads, D. E. Bauman, A. W. Bell, and Y. R. Boisclair
Effect of insulin and growth hormone on plasma leptin in periparturient dairy cows
Am J Physiol Regulatory Integrative Comp Physiol,
November 1, 2003;
285(5):
R1107 - R1115.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Ueki, G. T. Ooi, M. L. Tremblay, K. R. Hurst, L. A. Bach, and Y. R. Boisclair
Inactivation of the acid labile subunit gene in mice results in mild retardation of postnatal growth despite profound disruptions in the circulating insulin-like growth factor system
PNAS,
June 6, 2000;
97(12):
6868 - 6873.
[Abstract]
[Full Text]
[PDF]
|
 |
|