help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zeyse, D.
Right arrow Articles by Huleihel, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zeyse, D.
Right arrow Articles by Huleihel, M.
Endocrinology Vol. 141, No. 4 1521-1527
Copyright © 2000 by The Endocrine Society

ARTICLES

Interleukin-1 Receptor Antagonist Is Produced by Sertoli Cells in Vitro1

Daniel Zeyse2, Eitan Lunenfeld, Melanie Beck, Isebrand Prinsloo and Mahmoud Huleihel

Department of Obstetrics and Gynecology, Soroka University Medical Center (E.L., M.H.) and Department of Microbiology and Immunology (M.H.) and Department of Pathology (I.P.), Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva, Israel; Christian-Albrechts-University of Kiel Medical School (D.Z., M.B.), Kiel, Germany

Address all correspondence and requests for reprints to: Mahmoud Huleihel, Ph.D., Department of Microbiology and Immunology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva, Israel. E-mail: huleihel{at}bgumail.bgu.ac.il


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The interleukin-1 (IL-1) system has been suggested to be involved in the cell-to-cell cross-talk within the testis. To identify a testicular cell source of IL-1 receptor antagonist (IL-1ra), mouse Sertoli cells were isolated, purified, cultured, and examined for IL-1ra. Our investigation revealed that Sertoli cells produce large amounts of immunoreactive IL-1ra under basal culture conditions, as examined by enzyme-linked immunosorbent assays. Its expression can be induced, showing maximum concentrations after 8 h of stimulation. Lipopolysaccharide, as well as IL-1{alpha} and -ß, were found to stimulate IL-1ra production in Sertoli cells. FSH is capable to induce IL-1ra production in Sertoli cells in a dose-dependent manner. Immunocytochemical staining confirmed the presence of IL-1ra in the cytoplasma of Sertoli cells. The presence of IL-1ra messenger RNA was demonstrated by RT-PCR analysis. Our results may help to better evaluate the IL-1 activity in the testis and may indicate the involvement of IL-1ra in the autocrine and paracrine regulation of testicular cell function.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
A UNIQUE FEATURE of the interleukin-1 (IL-1) system is the naturally occurring IL-1 receptor antagonist (IL-1ra). Its genetic structure is homologous with the IL-1{alpha} and IL-1ß genes to a certain degree (1, 2). It binds to the same receptors without transmitting any signal; thus, it inherits an equally important role in the regulation of IL-1 action (3, 4). IL-1ra is known to be produced by tissue macrophages and monocytes, neutrophils, fibroblasts, chondrocytes, keratinocytes, and hepatic cells in response to lipopolysaccharide (LPS), IL-1, and other cytokines (5, 6).

It has been shown that IL-1 is present in lysates of testicular tissue (7, 8). Further investigations have identified several sources of IL-1 in the testis. In the interstitium, Leydig cells (9, 10) and testicular macrophages (11) were found to produce and secrete IL-1, preferably the ß form. IL-1 {alpha} production can be detected in tubular sources, namely Sertoli cells (10, 12, 13, 14) and germ cells (15). Recently, we have demonstrated that IL-1-like activity is present in conditioned media of mature human sperm cells (16, 17). Infection-stimulatory agents such as LPS, as well as gonadotropins or steroid hormones, have shown to affect IL-1 production by interstitial as well as tubular cells (10, 13), thus suggesting that IL-1 is participating in physiological and infection-regulatory functions of the testis.

Various investigations have indicated that IL-1 interferes with the regulation of spermatogenesis and spermiogenesis (18, 19, 20, 21, 22, 23, 24, 25, 26). IL-1 receptors have been identified, characterized, and localized in mouse testis (18, 19). IL-1 or IL-1-containing media have been found to regulate testosterone release by Leydig (20, 21, 22, 23) and to have impact on Sertoli cell activity parameters such as transferrin secretion or the aromatase activity (24, 25). A correlation between IL-1 levels and the meiotic DNA synthesis of spermatogonia has been indicated (26).

Lin et al. (27) studied the effects of IL-1ra on mature Leydig cells. It was demonstrated that monocyte derived IL-1ra is capable to reverse the inhibitory effect of IL-1ß on Leydig cell steroidogenesis. However, a testicular origin of IL-1ra besides testicular macrophages has not yet been identified.

In the present study, we examined the capacity of Sertoli cells isolated from prepubertal mice to produce IL-1ra under physiological and pathological conditions. Specifically, we investigated the involvement of LPS as well as FSH and IL-1{alpha}/ß to enhance immunoreactive IL-1ra production by Sertoli cells. To confirm our findings and localize IL-1ra, Sertoli cells cultured on slides were immunocytochemically colorated using specific anti-mIL-1ra antibodies, and the expression of IL-1ra messenger RNA (mRNA) was assessed.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
Collagenase (359 U/mg) and hyaluronidase (295 U/mg) were obtained from Sigma (St. Louis, MO). Eagle’s MEM, penicillin, streptomycin, and FCS were purchased from Beit Haemek Biological Industries (Israel). BSA was purchased from ICN Biomedicals, Inc. (Aurora, OH). The Ares Serono group (Geneva, Switzerland) kindly provided recombinant human FSH (r-hFSH, Gonal-F). Recombinant human IL-1{alpha}, and IL-1ß were purchased from Genzyme Corp. (Cambridge, MA). LPS was obtained from Difco Laboratories (Detroit, MI). All other chemicals (analytical grade) were purchased from commercial sources.

Isolation and culture of murine Sertoli cells
Highly purified Sertoli cells were isolated from 15-day-old Balb/c mice (Harlan Laboratories, Jerusalem, Israel) using a modification and combination of the methods described by Toebusch et al. (28) and Skinner et al. (29) as follows. Twenty testes were decapsulated and mechanically digested by multiple aspirations through pipette tips (8 aspirations through 2 mm followed by 10 aspirations through 1 mm opening in diameter) into a 50-ml syringe after addition of 20 ml MEM. Mechanical digestion was continued until tubules were completely dissociated. Thereafter the tubules were allowed to settle at unit gravity and washed three times with PBS. Supernatants containing the interstitial cells were discarded. The tubules were transferred to a 50-ml culture flask and subjected to collagenase treatment (8 mg/20 ml PBS, 25 min). All enzymatic digestions were carried out in a shaking water bath (120 cycles/min. at 37 C). The resulting cell clusters and tubule fragments were washed two times with PBS (centrifugation at 100 x g for 4 min), followed by three needle aspirations into an 18-gauge x1.5 needle syringe to break up the remaining tubule fragments. Finally the cell clusters were subjected to hyaluronidase digestion (20 mg/20 ml PBS, 30 min), thereafter filtered through sterile surgical gauze and washed three times with MEM (centrifugation at 100 x g for 5 min).

The resulting, almost completely dissociated Sertoli cells and germ cells were counted under phase-contrast microscopy in a Neubauer counting chamber. Cells were seeded in MEM, containing streptomycin (100 mg/liter), penicillin (105 IU/liter), L-glutamine and 5% FCS in 96-well plates or 6-well plates at a density of 1.3 x 105 or 3.2 x 106 Sertoli cells per well, respectively (3.3–3.4 x 05 Sertoli cells/cm2). Cells were also seeded on Permanox 4-chamber culture slides (Nalge Nunc International, Naperville, IL) at lower densities.

After 48 h of incubation (36 C, 5% CO2), most of the remaining germ cells were removed by hypotonic shock treatment with 10% MEM in distilled water for 2.5 min, unless otherwise indicated, and washed three times with MEM, shaking the plates vigorously in horizontal direction. The culture was continued for another 2 days in the presence of 0.5% BSA. At the end of the 4-dy preincubation period, Sertoli cells were incubated for various times with MEM containing 0.5% BSA in the absence or presence of FSH, LPS, or IL-1{alpha}/ß At the end of incubation, supernatants were collected and stored at -20 C. Cells were washed, and fresh medium was added to each well. Cells were lysed by three cycles of rapid freezing/thawing. RNA extraction was performed immediately after the end of incubation. Culture slides were fixed with methanol (absolute, 10 min, -20 C) and air dried until subjected to IL-1ra immunocytochemistry or procedures to evaluate the purity and composition.

Evaluation of viability, purity, and composition
The viability was evaluated at the end of the incubation period using trypan blue. To examine the purity of Sertoli cell preparations, fixed and air dried culture slides were stained by Mayers hematoxylin (1 min) and eosin (1.5 min) or subjected to immunocytochemical staining using polyclonal rabbit antineurofilament-200 (NF-200) antibodies (Sigma, Rehovot, Israel) in 1:1000 final dilution. Sertoli cells were identified by their distinctive morphology (30).

The presence of peritubular cells was examined according to the method used by Oonk et al. (31). Briefly, SC pellet was fixed in a mixture of ethanol and acetic acid (3:1, vol/vol) and air dried on microscope slides. After addition of a drop of acetic acid (45% vol/vol), the slides were examined under phase-contrast microscopy. Nuclei of peritubular cells can be identified by characteristic shape. Contamination of Leydig cells was assessed at the time of isolation by phase contrast microscopy of the final Sertoli cell enriched fraction. Leydig cells present the characteristic illumination described by Schumacher et al. (32).

Isolation and culture of murine splenic leukocytes
Murine splenic leukocytes were gained by mechanical digestion of mouse spleens. Cells were filtered through gauze, washed two times with MEM and subsequently seeded at a density of 5 x 106 cells/ml in six-well-plates. After 24 h of stimulation (MEM in the presence of 5 µg/ml LPS), cells were washed three times with PBS and total RNA was extracted.

Murine IL-1ra enzyme-linked immunosorbent assays (ELISA)
Immunoreactive murine IL-1ra of Sertoli cell culture supernatants and lysates was quantified using a specific ELISA (R&D Systems, Minneapolis, MN). No cross-reactivity was measured between murine IL-1{alpha}, -ß, human IL-1{alpha}, -ß, and murine IL-1ra ELISA. The sensitivity of IL-1ra ELISA was 120 pg/ml.

Immunocytochemical coloration for murine IL-1ra
Immunoreactive intracellular IL-1ra was immunocytochemically stained using specific polyclonal antibodies. Methanol-fixed and air dried slides were incubated for 15 min in Xylol and subsequently rehydrated before the stained procedure. Blocking of the nonspecific background was done with PBS containing 2.5% normal rabbit serum. Polyclonal goat antimouse IL-1ra antibodies (R&D Systems) were used as primary antibodies diluted in PBS containing 2.5% normal rabbit serum (1:10 final dilution). The biotinylated rabbit antigoat antibodies and the streptavidin-peroxidase conjugate were applied according to suppliers’ directions (Zymed Laboratories, Inc., San Francisco, CA). Endogenous peroxidase was blocked with 3% H2O2 in 80% methanol for 15 min before the streptavidin-peroxidase conjugate was applied. Development was performed with 0.06% diamino-benzidine tetrahydrochloride (DAB; Sigma, Israel). Negative controls performed in parallel using PBS/normal rabbit serum instead of the primary antibody. To visualize cells, negative control slides were counterstained with Mayers hematoxylin for 30 sec. All other slides were not counterstained to evaluate the presence of immunocytochemical staining in the nuclei.

Extraction of total RNA and RT-PCR analysis
Total RNA was extracted from mouse splenic leukocytes and from mouse Sertoli cell cultures immediately after incubation, stimulation and three washes with PBS using the Tri Reagent protocol (MRC, Cincinnati, OH). First-strand complementary DNAs (cDNAs) were synthesized from 2 µg total RNA with 0.5 µg random oligonucleotide primers (Roche Molecular Biochemicals, Mannheim, Germany) and 200 U of Moloney-Murine Leukemia Virus-Reverse Transcriptase (M-MLV-RT; Life Technologies, Inc.,Paisley, Scotland, UK) in a total volume of 20 µl Tris-HCl-MgCl reaction buffer, supplemented with DTT, dNTPs (0.5 mmol/liter; Roche Molecular Biochemicals) and RNase inhibitor (40U; Roche Molecular Biochemicals). The reverse transcriptase (RT) reaction was performed for 1 h at 37 C and stopped for 10 min at 75 C. The volume of 20 µl was subsequently filled up to 50 µl with water. Negative controls for the reverse transcriptase reaction (RT-) prepared in parallel, using the same reaction preparations with the same samples, without M-MLV-RT.

The PCR, performed subsequently, contained cDNA samples in final dilution of 1:15 with two pairs of oligonucleotide primers (0.9 pmol/µl; 5'GGGTCAGAAGGATTCCTATG3'; and 5'GGTCTCAAACATGAT-CTGGG3' for the mouse ß-Actin cDNA sequence, and 5'GGCAGCCTGC-CGCCCTTCTGGG3' and 5'CTCAAAGCTGGTGGTGGGGCC3' for the mouse IL-1ra cDNA sequence; Institute of Biotechnology, Ben-Gurion-University of the Negev, Beer-sheva, Israel). To assess the absence of genomic DNA contamination in RNA preparations and RT-PCR reactions, PCR was performed with negative controls of the RT reaction (RT-) and without cDNA (cDNA-). The PCR reactions were carried out on a {delta} Cycler II System Thermal Cycler (Ericomp, San Diego, CA). Ten microliters of each PCR product were run on 2% agarose gel, containing ethidium bromide, and photographed under UV light. To verify the specificity of the amplified PCR product, it was purified (Concert, Life Technologies, Inc.), and specific enzymatic digestion was carried out. The 346-bp IL-1ra product was cut by EcoRV (Roche Molecular Biochemicals). As shown by restriction map analysis, the chosen enzyme has only one restriction site on the amplified IL-1ra messenger RNA (mRNA) sequence (National Center for Biotechnology Information, National Institutes of Health, Bethesda, MD).

Statistical procedure
Results are expressed as means ± SD of triplicates. Student’s t test was used to calculate P values. Significance was defined as P < 0.05. Each experiment was performed independently at least twice.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Viability, purity, and characteristics of Sertoli cell cultures
The viability of Sertoli cell cultures at the end of incubation periods was always >95%. After a 4-day preincubation period without hypotonic shock treatment, contamination of germ cells and leukocytes, assessed by H&E staining, was 25–30% and 0.5–1%, respectively (Fig. 1AGo). Hypotonic shock, performed according to the regular protocol, lowered the contamination of leukocytes and germ cells to less than 0.5 and 0.1%, respectively (Fig. 1BGo). The presence of peritubular cells, as evaluated by the method of Oonk et al. (31), was always less than 0.5% at the time of isolation. At the same time, no contaminating Leydig cells were observed in the Sertoli cell enriched fraction under phase contrast microscopy.



View larger version (139K):
[in this window]
[in a new window]
  		Figure 1. Light micrographs of murine Sertoli cells after a 4-day preincubation period as described in Materials and Methods without (A) and with hypotonic shock treatment (B). Note the absence of germ cells after hypotonic shock treatment. A telophase of mitosis can be observed (B). (H&E; x400). D and E, Immunocytochemical staining of NF-200 of murine Sertoli cells under basal culture conditions (x400 and x600, respectively). Negative control was prepared in parallel without NF-200 antibody (C; x400; nuclei counterstained with hematoxilin).

 
Sertoli cells show positive staining for NF-200 under basal culture conditions. This staining is limited to the cytoplasma and does not show up in the nuclei, as expected. It cannot be further enhanced by the addition of LPS, FSH or any cytokine used in our experiments. At the end of preincubation periods, no cells other than NF-200 positive cells or, eventually, germ cells could be identified (Fig. 1Go, C–E).

Production of IL-1ra by murine Sertoli cells
Evaluation by ELISA revealed that unstimulated Sertoli cells are capable to produce immunoreactive IL-1ra (in lysates). Basal production levels in Sertoli cell cultures were found to range between 75 and 85 pg/106 cells. Exposure of Sertoli cell cultures to 10 µg/ml LPS resulted in enhanced intracellular IL-1ra production within 4 to 8 h after stimulation. The observed concentrations of immunoreactive IL-1ra in response to LPS at 8 h of stimulation had doubled (P < 0.001) and remained to be 1.6-fold higher (P < 0.001) compared with unstimulated controls after 24 h of stimulation (Fig. 2Go). However, no immunological activity of IL-1ra could be observed in unstimulated or stimulated Sertoli cell-conditioned media, as assessed by ELISA. Sertoli cell-conditioned media (unstimulated and stimulated) had also been concentrated by factor 5 (equivalent to 11.8 million cells/ml), and no immunological activity of IL-1ra been observed.



View larger version (12K):
[in this window]
[in a new window]
  		Figure 2. Time-course of the effect of LPS on immunoreactive IL-1ra levels present in murine Sertoli cells. After a 4-day preincubation period, cell cultures were exposed or not to LPS (10 µg/ml) for different time periods. Lysates were prepared and examined for IL-1ra levels. The data represent means ± SD of triplicate incubations. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

 
Immunocytochemical staining confirmed the presence of IL-1ra in Sertoli cells. The staining showed an even cytoplasmatic distribution of IL-1ra. The intensity of staining increased when cell cultures had been subjected to LPS (Fig. 3Go, A–C).



View larger version (79K):
[in this window]
[in a new window]
  		Figure 3. Immunocytochemical staining of IL-1ra in LPS-activated murine Sertoli cells. Cells were isolated and incubated according to the regular protocol, including hypotonic shock treatment. On day 5, cells were subjected to LPS (10 µg/ml) for 24 h (B and C; Immunocytochemistry; x400 and x600, respectively). Negative control was prepared in parallel without mIL-1ra antibody (A; x400; nuclei counterstained with hematoxilin).

 
FSH and IL-1{alpha}/ß are inducers of IL-1ra in murine Sertoli cells
Exposure of murine Sertoli cell cultures to 5 IU/ml r-hFSH resulted in significantly (P < 0.001) increased intracellular immunoreactive IL-1ra levels, detected by ELISA (Fig. 4Go). The elevation was observed between 5 and 10 h after stimulation, similar to the effect seen in response to LPS (Fig. 3Go). After 10 h of stimulation with FSH, immunoreactive IL-1ra levels were between 170 and 190 pg/106 Sertoli cells and did not show further significant augmentation 24 h after stimulation. At the same time, intracellular levels of IL-1ra in response to lower amounts of FSH revealed a dose-dependent effect of FSH (Fig. 4Go). Significantly enhanced IL-1ra production was also seen when Sertoli cell cultures were exposed to IL-1, with IL-1{alpha} exerting stronger effect than IL-1ß (P < 0.05) (Fig. 5).



View larger version (38K):
[in this window]
[in a new window]
  		Figure 4. Effect of FSH on immunoreactive intracellular IL-1ra production by murine Sertoli cells. Day 5 cells were incubated with various concentrations of FSH for 24 h. Lysates were prepared and examined for IL-1ra levels. The data represent means ± SD of triplicate incubations. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

 
RT-PCR performance
RT-PCR experiments demonstrate the presence of IL-1ra mRNA (346 bp) in primary Sertoli cell cultures. The integrity of RNA preparations was verified by the presence of ß-Actin mRNA in splenic leukocytes and Sertoli cell cultures, as demonstrated by the specific PCR product. RT-PCRs performed without RT- or without cDNA- were always negative (Fig. 6Go). Enzymatic digestion with EcoRV of the amplified and purified product PCR product generated two fragments (233 bp and 113 bp), as expected from restriction map analysis of the IL-1ra mRNA sequence (Fig. 7Go).



View larger version (70K):
[in this window]
[in a new window]
  		Figure 6. Expression of IL-1ra and ß-actin mRNAs in murine Sertoli cells. After a 4-day preincubation period, including hypotonic shock, Sertoli cells were stimulated with LPS (10 µg/ml) for 24 h. Total RNA was extracted, and mRNA expression was examined by RT-PCR analysis. Activated splenic leukocytes were used as positive control for IL-1ra mRNA expression. RT-PCR performed either without M-MLV-reverse transcriptase (RT-) or without cDNA (cDNA-) represent negative controls. PCR products and DNA size marker (S) were run on a 2% agarose gel with ethidium bromide and photographed under UV light. PCR product sizes are listed below.

 


View larger version (85K):
[in this window]
[in a new window]
  		Figure 7. Restriction analysis of IL-1ra PCR product amplified from murine Sertoli cell cells. IL-1ra cut by EcoRV generated two fragments of 233 bp and 113 bp. Undigested (IL-1ra) and digested (IL-1ra/EcoRV) PCR products and size markers (S) were run on 4% agarose gel with ethidium bromide and photographed under UV light.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The present study demonstrates for the first time the capacity of Sertoli cells to produce IL-1ra constitutively in high amounts. Its production can be significantly enhanced within 4–8 h of stimulation and remains at stimulated levels for at least 16 h. Stimulators, which have been demonstrated in the present study for the first time, are LPS, FSH, and IL-1{alpha} and -ß. This study did not find evidence that the IL-1ra is secreted out of immature murine Sertoli cells.

As demonstrated by various light-microscopic methods, our murine Sertoli cell cultures are virtually free of interstitial cells, namely testicular macrophages and Leydig cells, peritubular cells, and germ cells. The achieved purity of mouse Sertoli cell preparations may be an advantage compared with similar procedures done with rat or human tissue (10, 14, 28, 33).

IL-1ra has been shown to bind to the same receptors as IL-1{alpha} and -ß without inducing intracellular signals (5). The biological role of intracellular IL-1ra (icIL-1ra), which examined mainly in epithelial cells, keratinocytes and as we reported here in Sertoli cells, has not been yet determined. This form of IL-1ra dose not has a directional peptide, is not secreted, and remained inside the cells. It is possible that icIL-1ra counteract intracellularly the high amounts of biologically active IL-1{alpha} (34). The inhibitory action and other possible functions of icIL-1ra may be pronounced when it released from dead cells or when appropriate conditions/signals are present. Known production sites of IL-1{alpha} or -ß in the testis include Sertoli cells, Leydig cells, germ cells, and testicular macrophages. Sertoli cells have been shown to produce and secrete only the {alpha} form of IL-1 (12). Known stimuli for IL-1{alpha} production and secretion of purified Sertoli cells are FSH, LPS, Latex beads and residual bodies, testosterone, and IL-1{alpha} itself (10, 13, 14, 35). In contrast, mature Leydig cells are capable of producing IL-1{alpha} as well as ß, and both can be induced by hCG as well as LPS (10). In Leydig cells, the ß form is secreted in greater amounts than the {alpha} form. This may contribute to the role of IL-1ß as a paracrine mediator intended to be released from Leydig cells and act on Sertoli cells, germ cells, interstitial cells, and nontesticular destinations. IL-1{alpha} may play primarily a regulator of intracellular and autocrine events (5).

Unlike the IL-1{alpha} and ß genes, the IL-1ra gene possesses a signal sequence, which allows the peptide to be translated into the endoplasmatic reticulum (ER). After undergoing maturation in the Golgi complex, it is secreted out of the cell (4). It is interesting to note that there has been no detectable trace of the IL-1ra in culture-media conditioned by immature murine Sertoli cells in our experiments. Therefore, it is tempting to speculate, that IL-1ra mRNA in immature Sertoli cells undergoes alternative splicing. This splicing variant of the IL-1ra mRNA, first described by Haskill et al. (36), modifies the sequence coding for the signal peptide and leads to a peptide that remains intracellular, called icIL-1ra. This phenomenon has been observed so far in digestive epithelial cells and keratinocytes (36, 37).

Thus, the role of IL-1ra in immature Sertoli cells could be restricted to intracellular, autocrine functions, such as antagonizing and modifying paracrine or autocrine IL-1 signals. There are numerous indications show IL-1 effects on Sertoli cell activity, which can be quantified by the transferrin or inhibin secretion or the aromatase activity located inside Sertoli cells (38). When investigating transferrin levels in primary cultures of Sertoli cells, one finds that media derived from activated human mononuclear cells are more potent to activate immature Sertoli cells than FSH, testosterone, insulin, and retinol combined (24). Part of this activity can be explained by IL-1ß (24, 25). However, inhibitory effects of IL-1 on transferrin secretion have been observed in mature Sertoli cell cultures (39). This may support the hypothesis that the role of IL-1 changes during sexual maturation. Sertoli cells, by means of intracellular IL-1ra, might be able to modify or completely abolish approaching IL-1 messages.

It is known that during the process of sexual maturation Sertoli cells isolated from rat testes increase the amount of secreted IL-1{alpha}. While Sertoli cells isolated from 45-day-old rats secrete twice as much as similar cultures prepared from 35-day-old animals, there is no detectable amount of IL-1{alpha} present in Sertoli cell-conditioned media from prepubertal animals (20-day-old) (40). The mechanisms leading to the observed pattern of secretion during sexual maturation are not yet understood. Therefore, the possibility that the IL-1ra as well may be secreted by the time the testes are sexually mature, has to be taken into account, and further investigations need to be done.

Recently, we have shown (by immunohistochemical staining) the expression of IL-1ra in Leydig and Sertoli cells of testicular sections from mature and immature mice (41).

Which targets could be affected by Sertoli cell-secreted IL-1ra? In the testis, actions of IL-1ra have been demonstrated on Leydig cells. It was reported that monocyte-derived IL-1ra was able to reverse dose dependently the inhibitory effects of IL-1ß on hCG-induced Leydig cell steroidogenesis (27).

To estimate the impact of IL-1ra on Sertoli cells (autocrine action) and possibly other targets, one should take into consideration, that both IL-1{alpha} and IL-1ra, are produced by Sertoli cells and compete with each other in binding to the same receptor. Therefore, it is necessary to understand patterns of production of IL-1{alpha} and IL-1ra, concerning time and quantity. It is known that Sertoli cells react to LPS with IL-1{alpha} production as soon as 1–2 h after stimulation (42). This, in combination with our findings, that IL-1ra levels are elevated in response to LPS no sooner than 4 to 6 h after addition of LPS, leaves a "window of IL-1 agonistic activity" limited to approximately 4 to 5 h. At this point, it would indeed be interesting to investigate, whether or not the IL-1ra production like IL-6 production by Sertoli cells is triggered by IL-1{alpha} because IL-1ra and IL-6 present similar time-kinetics (42).

FSH and LH are secreted in increased amounts during the maturation of the endocrine system. Cudicini et al. (10) have shown, that FSH induces IL-1{alpha} production in Sertoli cells. In accordance, our data reveals that Sertoli cells produce higher amounts of IL-1ra in response to FSH. The presence of the IL-1 receptors (IL-1RI and II) has been demonstrated in Leydig cells, Sertoli cells, peritubular cells, and germ cells (19). This indicates a possible role of IL-1ra in spermatogenesis and spermiogenesis.

Our study has provided first data that the IL-1ra is present in testicular tubules. It is produced by Sertoli cells and is regulated by physiological and pathological agents. We hereby open the way to the investigation of the role of IL-1ra in normal and pathological regulations of male fertility.



View larger version (52K):
[in this window]
[in a new window]
  		Figure 5. Effects of LPS and IL-1 on immunoreactive IL-1ra levels produced by murine Sertoli cells. Day 5 cells were incubated for 24 h without (control) or with LPS (10 µg/ml), IL-1{alpha} (IL-1a; 50 U/ml) or IL-1 ß (IL-1b; 50 U/ml). Lysates were prepared and examined for IL-1ra levels. The data represent means ± SD of triplicate incubations. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

 

   Acknowledgments
 
The authors express their gratitude to Prof. Charles A. Dinarello for excellent technical and scientific advice.


   Footnotes
 
1 This work was partially supported by a grant (No. 4467) from the Ministry of Health, Jerusalem, Israel. Partial support has been given from the faculty Grants Program of The Dr. Bernard Cwikel Memorial Fund, Israel. Back

2 During the course of this work Daniel Zeyse was the recipient of a Deutscher Akademischer Austauschdienst (DAAD) scholarship. Back

Received August 19, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Eisenberg SP, Evans RJ Arend WP, Verderber E, Brewer MT, Hannum CH, Thompson RC 1990 Primary structure and functional expression from complementary DNA of a human interleukin-1 receptor antagonist. Nature 344:633[CrossRef][Medline]
  2. Carter DB, Deibel Jr MR, Dunn CJ, Tomich CS, Laborde AL, Slightom JL, Berger AE, Bienkowski MJ, Sun FF, McEwan RN, et al 1990 Purification, cloning, expression and biological characterization of an interleukin-1 receptor antagonist protein. Nature 344:633
  3. Hannum CH, Wilcox CJ, Arend WP, Joslin FG, Dripps DJ, Heimdal PL, Armes LG, Sommer A, Eisenberg SP, Thompson RC 1990 Interleukin-1 receptor antagonist activity of a human interleukin-1 inhibitor. Nature 343:336[CrossRef][Medline]
  4. Arend W 1993 Interleukin-1 receptor antagonist. Adv Immunol 54:167–226[Medline]
  5. Dinarello CA 1996 Biologic basis for interleukin-1 in disease. Blood 87:2095–2147[Abstract/Free Full Text]
  6. Roux-Lombard P 1998 The interleukin-1 family. Eur Cytokine Netw 9:565–567[Medline]
  7. Khan S, Soder O, Syed V, Gustafsson K, Lindh M, Ritzen EM 1987 The rat testis produces large amounts of interleukin-1-like factor. Int J Androl 10:494–503
  8. Khan SA, Schmidt K, Hallin P, Di Pauli R, De Geyter C, Nieschlag E 1988 Human testis cytosol and ovarian follicular fluid contain high amounts of interleukin-1-like factors. Mol Cell Endocrinol 58:221–230[CrossRef][Medline]
  9. Wang DL, Nagpal ML, Calkins JH, Chang WW, Sigel MM, Lin T 1991 Interleukin-1ß induces Interleukin-1{alpha} messenger RNA expression in primary cultures of Leydig cells. Endocrinology 129:2862–2866[Abstract/Free Full Text]
  10. Cudicini C, Lejeune H, Gomez E, Bosmans E, Ballet, F, Saez J, Jegou B 1997 Human Leydig cells and Sertoli cells are producers of interleukin-1 and -6. J Clin Endocrinol Metab 82:1426–1433[Abstract/Free Full Text]
  11. Kern S, Robertson SA, Mau VJ, Maddocks S 1995 Cytokine secretion by macrophages in the rat testis. Biol Reprod 53:1407–1416[Abstract]
  12. Gerard N, Syed V, Bardin W, Genetet N, Jegou B 1991 Sertoli cells are the site of interleukin-1a synthesis in rat testis. Mol Cell Endocrinol 82:R13–R16
  13. Stephan JP, Syed V, Jegou B 1997 Regulation of Sertoli cell IL-1 and IL-6 production in vitro. Mol Cell Endocrinol 134:109–118[CrossRef][Medline]
  14. Wang JE, Josefsen GM, Hansson V, Haugen TB 1998 Residual bodies and IL-1{alpha} stimulate expression of mRNA for IL-1{alpha} and IL-1 receptor type I in cultured rat Sertoli cells. Mol Cell Endocrinol 137:139–44[CrossRef][Medline]
  15. Haugen TB, Landmark BF, Josefsen GM, Hansson V, Hogset A 1994 The mature form of interleukin-1 {alpha} is constitutively expressed in immature male germ cells from rat. Mol Cell Endocrinol 105:R19–R23
  16. Huleihel M, Levy A, Lunenfeld E, Horowiz S, Poashnik G, Glezerman M 1997 Distinct expression of cytokines and mitogenic inhibitory factors in semen of fertile and infertile men. Am J Reprod Immunol 37:304–309
  17. Huleihel M, Lunenfeld E, Horowitz S, Levy A, Poashnik G, Glezerman M Involvement of serum and LPS inb the production of interleukin-1- and interleukin-6-like molecules by human sperm cells. Am J Reprod Immunol, in press
  18. Takao T, Mitchell WM, Tracey DE, DeSouza EB 1990 Identification of interleukin-1 receptors in mouse testis. Endocrinology 127:251–258[Abstract/Free Full Text]
  19. Gomez E, Morel G, Cavalier A, Lienard MO, Haour F, Courtens JL, Jegou, B 1997 Type I and type II interleukin-1 receptor expression in rat, mouse, and human testes. Biol Reprod 56:1513–1526[Abstract]
  20. Calkins JH, Guo H, Sigel MM, Lin T 1990 Differential effects of recombinant Interleukin-1 {alpha} and ß on Leydig cell function. Bioch Biophys Res Commun 167:548–553[CrossRef][Medline]
  21. Warren DW, Pasupuleti V, Lu Y, Plater BW, Horton R 1990 Tumor necrosis factor and interleukin-1 stimulate testosterone secretion in adult male rat Leydig cells in vitro. J Androl 11:353–360[Abstract/Free Full Text]
  22. Mauduit C, Chauvin MA, Hartmann DJ 1992 Interleukin-1 {alpha} as a potent inhibitor of gonadotropin action in porcine Leydig cells: sites of action. Biol Reprod 46:1119–1126[Abstract]
  23. Lin T, Wang D, Stocco DM 1998 Interleukin-1 inhibits Leydig cell steroidogenesis without affecting steroidogenic acute regulatory protein messenger ribonucleic acid or protein levels. J Endocrinol 156:461–467[Abstract]
  24. Hoeben E, Van-Damme J, Put W, Swinnen JV, Verhoeven G 1996 Cytokines derived from activated human mononuclear cells markedly stimulate transferrin secretion by cultured Sertoli cells. Endocrinology 137:514–521[Abstract]
  25. Hoeben E, Wuyts A, Proost P, VanDamme J, Verhoeven G 1997 Identification of IL-6 as one of the important cytokines responsible for the ability of mononuclear cells to stimulate Sertoli cells functions. Mol Cell Endocrinol 132:149–160[CrossRef][Medline]
  26. Soeder O, Syed V, Callard GV, Toppari J, Pollanen P, Parvinen M, Froysa D, Ritzen EM 1991 Production and secretion of an interleukin-1-like factor is stage-dependent and correlates with spermatogonial DNA synthesis in the rat seminiferous epithelium. Int J Androl 14:223–231[Medline]
  27. Lin T, Guo H, Calkins JH, Wang D, Chi R 1991 Recombinant monocyte derived Interleukin-1 receptor antagonist reverses inhibitory effects of Interleukin-1 on Leydig cell steroidogenesis. Mol Cell Endocrinol 78:205–209[CrossRef][Medline]
  28. Toebusch AMW, Robertson DM, Klaij IA, De Jong FH, Grootegoed JA 1989 Effects of FSH and testosterone on highly purified rat Sertoli cells: inhibin {alpha}-subunit mRNA expression and inhibin secretion are enhanced by FSH but not by testosterone. J Endocrinol 122:757–762[Abstract/Free Full Text]
  29. Skinner MK, Fritz IB 1985 Testicular cells secrete a protein under androgen control that modulates Sertoli cell functions. Proc Natl Acad Sci USA 82:114–118[Abstract/Free Full Text]
  30. Lipshultz LI, Murthy L, Tindall DJ 1982 Characterization of human Sertoli cells in vitro. J Clin Endocrinol Metab 56:228–237
  31. Oonk R, Grootegoed JA, van der Molen HJ 1985 Comparison of the effects of insulin and follitropin on glucose metabolism by Sertoli cells from immature rats. Mol Cell Endocrinol 42:39–48[CrossRef][Medline]
  32. Schumacher M, Schafer G, Holstein AF, Hilz H 1978 Rapid isolation of mouse Leydig cells by centrifugation in Percoll density gradients with complete retention of morphological and biochemical integrity. FEBS Lett 91:333–338[CrossRef][Medline]
  33. Le Magueresse-Battistoni B, Morera AM, Benahmed M 1995 In vitro regulation of rat Sertoli cell inhibin messenger RNA levels by transforming growth factor-ß1 and tumor necrosis factor {alpha}. J Endocrinol 146:501–508[Abstract/Free Full Text]
  34. Dayer JM, Burger D 1994 Interleukin-1, tumor necrosis factor and their specific inhibitors. Eur Cytokine Netw 5:563–571[Medline]
  35. Cudicini C, Kercret H, Touzalin AM, Ballet F, Jegou B 1997 Vectorial production of interleukin-1 and interleukin-6 by rat Sertoli cells cultured in dual chamber compartment system. Endocrinology 1638:2863–2870
  36. Haskill S, Martin G, van Le L, Morris J, Peace A, Bigler CF, Jaffe CJ, Hammerberg C, Sporn SA, Fong S 1991 cDNA cloning of an intracellular form of the human interleukin-1 receptor antagonist associated with epithelium. Proc Natl Acad Sci USA 88:3681[Abstract/Free Full Text]
  37. Hammerberg C, Arend WP, Fisher GJ, Chan LS, Berger AE, Haskill JS, Voorhees JJ, Cooper KD 1992 Interleukin-1 receptor antagonist in normal and psoriatic epidermis. J Clin Invest 90:571
  38. Skinner MK 1991 Cell-cell interactions in the testis. Endocr Rev 12:45–77[Abstract/Free Full Text]
  39. Karzai AW, Wright WW 1992 Regulation of the synthesis and secretion of transferrin and cycl.protein-2/cathepsin L by mature Sertoli cells in culture. Biol Reprod 47:823–831[Abstract]
  40. Jegou B, Cudicini C, Gomez E, Stephan JP 1995 Interleukin-1, interleukin-6 and the germ cell-Sertoli cell cross-talk. Reprod Fertil Dev 7:723–30[CrossRef][Medline]
  41. Huleihel M, Lunenfeld E, Zeyse D, Prinsloo I, Potashnik G, Mazor M 1999 Expression of interleukin-1 system (IL-1{alpha}, IL-1ß and IL-1 receptor antagonist) in mature and immature mouse testicular cells. Conjoint Annual Meeting, American Society for Reproductive Medicine and Canadian Fertility and Andrology Society, Toronto, Ontario, Canada, S136:P-147
  42. Syed V, Stephan J-P, Gerard N, Legrand A, Parvinen M, Bardin CW, Jegou J 1995 Residual bodies activate Sertoli cell Interleukin-1a (IL-1a) release, which triggers IL-6 production by an autocrine mechanism, through the lipooxygenase pathway. Endocrinology 136:3070–3078[Abstract]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
M. Ganaiem, M. AbuElhija, E. Lunenfeld, N. Cherniy, N. Weisze, S. B.-S. Itach, H. Breitbart, R. Apte, and M. Huleihel
Effect of Interleukin-1 Receptor Antagonist Gene Deletion on Male Mouse Fertility
Endocrinology, January 1, 2009; 150(1): 295 - 303.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
Y Okuma, A E O'Connor, T Hayashi, K L Loveland, D M de Kretser, and M P Hedger
Regulated production of activin A and inhibin B throughout the cycle of the seminiferous epithelium in the rat.
J. Endocrinol., August 1, 2006; 190(2): 331 - 340.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
Y Okuma, A E O'Connor, J A Muir, P G Stanton, D M de Kretser, and M P Hedger
Regulation of activin A and inhibin B secretion by inflammatory mediators in adult rat Sertoli cell cultures
J. Endocrinol., October 1, 2005; 187(1): 125 - 134.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zeyse, D.
Right arrow Articles by Huleihel, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zeyse, D.
Right arrow Articles by Huleihel, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals