help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by de Arrieta, C. M.
Right arrow Articles by Chin, W. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by de Arrieta, C. M.
Right arrow Articles by Chin, W. W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*LEVOTHYROXINE
Endocrinology Vol. 141, No. 5 1693-1698
Copyright © 2000 by The Endocrine Society

ARTICLES

Coactivator and Corepressor Gene Expression in Rat Cerebellum during Postnatal Development and the Effect of Altered Thyroid Status1

Cruz Martinez de Arrieta, Noriyuki Koibuchi and William W. Chin

Division of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, Massachusetts 02115

Address all correspondence and requests for reprints to: Noriyuki Koibuchi, M.D, Ph.D., Department of Physiology, Dokkyo University School of Medicine, Mibu, Tochigi 321-0293, Japan. E-mail: koibuchi{at}dokkyomed.ac.jp


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Thyroid hormone (TH) plays an important role in the postnatal development of the rodent cerebellum, particularly within the first 2 weeks of postnatal life. This action is exerted through the regulation of specific genes during development and is mediated by coactivator and corepressor proteins that determine transcriptional repression or activation, respectively. Thus, we hypothesized that the effect of TH on rodent cerebellar development could be influenced by the relative amounts of coactivator and corepressor proteins in vivo. These ratios might be modulated in an age-specific manner and/or by hormones to generate the "critical period" of TH action. To examine this hypothesis, we cloned rat complementary DNA fragments corresponding to coactivators (SRC1, TIF2 and TRAM1) and corepressors (N-CoR and SMRT), and studied the ontogenic changes in their corresponding messenger RNAs in rat cerebellum of normal and hypothyroid rats during postnatal development, using a RNase protection assay. We found an increased expression of SRC1 and TIF2, as well as of N-CoR, during rat cerebellar development but no change in the expression of SMRT and TRAM1 genes. However, thyroid hormone status did not affect the expression of coactivator and corepressor genes in the cerebellum. These results indicate that coactivator and corepressor messenger RNAs exhibit differential expression through cerellear development but are not regulated by TH during this period.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THYROID HORMONE [TH; tri-iodo-L-thyronine (T3) and tetra-iodo-L-thyronine (T4)] plays a critical role in growth and differentiation of many organs, including the central nervous system (1). Nuclear TH action is mediated through the TH receptor (TR), a ligand-dependent transcription factor, which increases or decreases the expression of target genes. TR regulates gene expression by binding as a monomer, homodimer, or heterodimer with specific nuclear proteins to sequences known as TH response-elements (TREs), which consists of two half-site consensus motifs (AGGTCA) with specific nucleotide spacing and orientation (2, 3, 4). Transcriptional regulation by steroid/thyroid hormone receptors is mediated, in part, by coactivator and corepressor proteins that bind to nuclear hormone receptors (NR) in a ligand-dependent manner and determine transcriptional repression or activation, respectively (5, 6).

The transcriptional repression is exerted, at least in part, by association of unliganded receptors with corepressors such as N-CoR (7) and SMRT (8, 9). Both N-CoR and SMRT have been shown to form a large protein complex that includes histone deacetylase I (HDAC) and sin3A (10, 11). It is hypothesized that the ability of this complex to deacetylate histones results in an altered chromatin state that it is inhibitory to transcription. Ligand induces conformational changes in the NRs that enable receptors to interact with coactivator proteins that mediate transcriptional activation. Such coactivators (NCoA) include a subset of 160-kDa proteins, such as SRC1/NcoA-1 (12), TIF2/GRIP1/NCoA-2 (13, 14), and p/CIP/RAC3/ACTR/AIB1/TRAM 1 (15, 16, 17, 18, 19). It has been shown that coactivators further recruit complexes with histone acetyltransferase activity. Therefore, a postulated mechanism of coactivation mediated by NRs is targeted change of chromatin structure (20, 17).

TH plays an important role in the postnatal development of the rodent cerebellum (21, 22, 23). Abnormal development seen in the perinatal hypothyroid rat cannot be rescued unless TH is replaced within the first 2 weeks of postnatal life (24). Perinatal hypothyroidism largely affects the differentiation of neurons. In particular, dendritic arborization of the Purkinje cell, and synaptic formation between Purkinje and granule cells are seriously affected (22). The critical period for thyroid hormone action in the cerebellum occurs during the first 2 weeks of postnatal life when many TH target genes are regulated at transcriptional level (25, 26). After this key interval, expression of TH-regulated genes equalize regardless of the thyroid status (25, 27, 28, 29). Thus, Oppenheimer et al. (25) have proposed a model in which gene expression in response to TH is divided into three phases in the rat brain: 1) a refractory state during the prenatal period; 2) a T3-responsive period corresponding to the second and third weeks of postnatal life during which TH accelerates the expression of TH-regulated genes; and 3) a third period starting after postnatal day 20, during which gene expression is independent of TH regulation. This pattern of TH-regulation of brain development has been shown for cerebellar genes such as Pcp-2, IP3 receptor (IP3R) (25) and ROR{alpha} (26). This differential transcriptional regulation could be related to changes in TR expression profiles or in modulator proteins that interact with TR.

Thus, we hypothesized that the TH action during cerebellar development may be influenced by the relative amounts of coactivator and corepressor proteins in vivo. These ratios might be modulated, in turn, in an age-specific manner and/or by hormones. We report here the changes in the levels of messenger RNAs (mRNAs) corresponding to coactivator and corepressor genes during rat cerebellum development, using a RNase protection assay. This study was performed in euthyroid rats as well in hypothyroid and T4-replaced animals.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals and treatment
Animal experimental protocol was approved by Harvard Medical School Standing Committee on Animals (protocol no. 02575).

Timed-pregnant Sprague Dawley rats were obtained from Charles River Laboratories, Inc. (Wilmington, MA). These were housed individually under controlled temperature and illumination. Food and water were available ad libitum. Some newborn rats were rendered hypothyroid by administering 0.05% (wt/vol) propylthiouracil (PTU) in the drinking water to their mothers from the 15th day of conception. Some hypothyroid pups received daily injections of T4 (0.02 µg/g BW) dissolved in saline from day 1 after birth (P1) until death. It has been previously shown that this T4-injected rat is comparable to the euthyroid rat regarding the changes in body weight and plasma TSH concentration (29, 30). The rats were killed with 100% CO2 on postnatal days (P) 2, P7, P15 and P30, and the cerebella were dissected out. Tissues were frozen on dry ice and stored at -80 C until use.

RNA extraction and RT-PCR amplification of rat coactivator and corepressor complementary DNA (cDNA) fragments
Total RNA from rat cerebella (5 for P2, 4 for P7, 3 for P15, 2 for P30, and 1 for adult) was extracted using TRI reagent (Sigma, St. Louis, MO). Total RNA of adult rat brain was also isolated, and was reverse transcribed with mouse mammary leukemia virus reverse transcriptase (Superscript Preamplification System, Life Technologies, Inc., Gaithersburg, MD). The resulting cDNA was then amplified by PCR with sense and antisense oligonucleotides (see below) corresponding to mouse (TIF2 and N-CoR) or human (SRC1, SMRT, and TRAM1) comodulator genes, resulting in 185 nucleotide (nt), 302 nt, 261 nt, 159 nt, and 233 nt fragments for TRAM1, SRC1, SMRT, N-CoR and TIF2, respectively, which were then cloned in pGEM-T vector. The fragments were sequenced using version 2.0 of the sequencing kit from Amersham Pharmacia Biotech (Arlington Heights, IL). Sequence comparisons were performed using Blast analysis (31).

Oligonucleotides
cDNA fragments were amplified by PCR using the following pairs of oligonucleotides as forward and reverse primers, respectively.

SRC1: 5'CAAGAAGTGATGACTCGTGGCA3', 5'GATACCATGTTGCTGTTGGATG3'. TIF2: 5'GACAGATCCTGCCAGTAACACAA3', 5'TTCAGCTGTGAGTTGCATGAGG3'. TRAM1: 5'GCAGATGAGTGGAGCTAGGTATG3', 5'CACGATTACGAGGAGAAATCATG3'. N-CoR: 5'GTTCCCTTACAACCCTCTGACCA3', 5'AGTGTCTCATACTGCG-CTGAGAG3'. SMRT: 5'ATGTCTGTGACCCAGTGCTCCAA3', 5'ACGCAGGTAGTCCTCCTGTGCCT3'.

RNase protection assay
RNase protection assay was performed using the RPA II kit (Ambion, Inc., Austin, TX). Rat SRC1, TRAM1, TIF2, N-CoR and SMRT cDNA fragments in pGEM-T vector were linearized with SalI (SMRT) or NcoI (TRAM1, SRC1, TIF2 and N-CoR) restriction endonucleases and 32P-labeled antisense riboprobes were transcribed using T7 RNA polymerase (SMRT) or SP6 RNA polymerase (TRAM1, SRC1, TIF2 and N-CoR). Transcribed riboprobes contain 185 nt (TRAM1), 261 nt (SMRT), 302 nt (SRC1), 233 nt (TIF2) and 159 nt (N-CoR) cDNA fragments, and additional 94 nt, in case of SMRT riboprobe, or 105 nt for TRAM1, SRC1, TIF2 and N-CoR riboprobes, transcribed from vector DNA. A 32P-labeled antisense riboprobe for rat cyclophilin (103 nt, Ambion, Inc.) was also transcribed with T7 RNA polymerase. Twenty micrograms of rat total RNA were hybridized with either N-CoR/SMRT or TRAM1/TIF2/SRC1 cDNA probes (300,000 cpm/sample), together with a rat cyclophilin probe (20,000 cpm/sample) overnight at 42 C, followed by RNase A/RNase T1 digestion. The protected fragments were separated on a 5% polyacrylamide-8 M urea gel. The gel was dried and subjected to PhosphorImaging (Molecular Dynamics, Inc., Sunnyvale, CA) overnight for quantitative analysis of the protected bands, and then to film at -80 C overnight. The amount of RNA was internally standardized using cyclophilin mRNA levels. For normalization among different blots, the same total RNA samples (n = 4), obtained from adult cerebella, were always included in the experiments and hybridized with TRAM1, SRC1, TIF2, SMRT and N-CoR riboprobes. Data are expressed as relative units, which was obtained by dividing normalized arbitrary units by the number of UTP in each probe, and represent the averages of four independent experiments. Treatment effects were examined using ANOVA. Post hoc comparisons were made by the Duncan’s new multiple-range test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
To analyze a possible age-dependent expression of coactivator and corepressor genes in the rat cerebellum, the changes in their corresponding mRNAs in the rat cerebella of euthyroid rats from P2 to P30 were determined. We cloned cDNA fragments corresponding to rat coactivators (SRC1, TIF2, and TRAM1) and corepressors (N-CoR and SMRT), and used them in a RNase protection assay. The nature of the coactivator and corepressor fragments used as probes for the RNase protection assays is illustrated in Fig. 1Go, and their corresponding nucleotide sequences compared with those of the mouse and human cDNAs are shown in Fig. 2AGo. Comparison of rat nucleotide sequences with those of their corresponding mouse and human homologs shows a similarity of 99%, 98%, 94%, 86%, and 95% with mouse SRC1, TIF2, TRAM1, N-CoR and SMRT, respectively, and 96%, 92%, 84%, 80%, and 84%, respectively, with the corresponding human sequences.



View larger version (20K):
[in this window]
[in a new window]
  		Figure 1. Schematic diagram showing the nature of the RT-PCR amplified fragments corresponding to various coactivator and corepressor cDNAs expressed in adult rat brain. The nucleotide positions are shown above each cDNA. Only the region corresponding to the translated sequence of each cDNA is represented.

 


View larger version (33K):
[in this window]
[in a new window]
  		Figure 2. Partial nucleotide sequences of rat N-CoR, SMRT, TRAM1, TIF2, and SRC1 cDNAs fragments obtained by RT-PCR amplification. Comparison with mouse and human sequences is shown. Oligonucleotide sequences used for RT-PCR amplification are indicated by bold letters.

 
The cDNA fragments were used as templates to make radiolabeled riboprobes for rat coactivator and corepressor mRNAs in the RNase protection assay. Examples of the autoradiograms (Fig. 3Go) and the quantitative analysis are shown (Fig. 4Go). Quantification was performed using a PhosphorImager. The data were normalized using cyclophilin mRNA and adult mRNA (see Materials and Methods). A significant 1.8-fold increase in SRC1 mRNA level from P7 to P30 was observed, and an 1.6- and 1.4-fold increase for N-CoR and TIF2 mRNAs, respectively. On P2, coactivator and corepressor mRNAs seemed to be slightly higher than those on P7. However, the levels on P2 varied greatly among samples. Thus, we did not see any statistical significance between P2 and P7. We did not observe any significant change in the expression of SMRT and TRAM1 genes. mRNA levels corresponding to SMRT showed a high variation among different experiments. Among the coactivator and corepressor genes analyzed in the present study, N-CoR and TRAM1 mRNA levels were the most and least abundant, respectively. N-CoR mRNA was the most strongly expressed with its hybridization signal 2.5, 2.4, 2.4, and 3.2-fold greater than those corresponding to SMRT, SRC-1, TIF2, and TRAM1 mRNAs, respectively, at P15.



View larger version (51K):
[in this window]
[in a new window]
  		Figure 3. Representative autoradiogram of the RNase protection assay. Lanes contain 20 mg of total RNA for euthyroid rat cerebellum from postnatal day 2 (P2), 7 (P7), 15 (P15), and 30 (P30), mixed with 300,000 cpm of either SRC1, SMRT, TIF2, TRAM1, and N-CoR riboprobes, and treated with RNase I.

 


View larger version (11K):
[in this window]
[in a new window]
  		Figure 4. Quantitative analysis of the RNase protection assays. (A) and (B) panels correspond to levels of coactivator and corepressor mRNAs, respectively. SRC1 ({blacksquare}), TIF2 ({blacktriangleup}) TRAM1 (•), N-CoR ({square}) and SMRT ({triangleup}) mRNA levels were standardized using cyclophilin mRNA as an internal control (see Materials and Methods for details). Data are mean ± SEM of relative units obtained by dividing the arbitrary units measured using a PhosphorImager (Molecular Dynamics, Inc.) by the number of uracils in each riboprobe (n = 4 determinations obtained from different pooled cerebella). Statistical significance is shown by asterisks. *, P < 0.05, **, P < 0.01 compared with P7 of the same group.

 
Next, to address a possible age-dependent TH regulation of coactivator and corepressor genes in the rat cerebellum, we determined changes in their corresponding mRNAs in hypothyroid (PTU-treated) and T4-replaced (PTU + daily T4 injection) rats from P2 to P30. Using an RNase protection assay, we observed a time-dependent change of coactivator and corepressor mRNA levels in T4-replaced rats that was similar to that observed in normal rats. However, we did not see any significant differences in the levels of any of the coactivator or corepressor mRNAs between hypothyroid and T4-replaced animals. The results of quantitative analysis are shown in Figs. 5Go and 6Go.



View larger version (8K):
[in this window]
[in a new window]
  		Figure 5. Changes in coactivator (SRC1, TIF2, and TRAM1) mRNA content in the cerebella of hypothyroid ({blacksquare}) and T4-replaced rats (•) during development. Data shown are mean ± SEM of relative units obtained by assessing the density of each band using a phosphorImager (Molecular Dynamics, Inc.) (n = 4 determinations obtained from different pooled cerebella) divided by the number of uracils in each riboprobe. mRNA levels were standardized as indicated in Materials and Methods. Note that there are no statistical significant differences between hypothyroid and T4 replaced data at any time point. Statistical significance for ontogeny data is not shown, as the tendencies are the same as those in Fig. 4Go.

 


View larger version (11K):
[in this window]
[in a new window]
  		Figure 6. Changes in corepressor (N-CoR, and SMRT) mRNA content in the cerebella of hypothyroid ({blacksquare}) and T4-replaced rats (•) during development. Data shown are a mean ± SEM of relative units obtained by determining the density of each band using a phosphorImager (Molecular Dynamics, Inc.) divided by the number of uracils in each riboprobe (n = 4 determinations obtained from different pooled cerebella). mRNA levels were standardized as indicated in Materials and Methods.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
TH exerts an important role in the development of the CNS, an effect that is cell- and stage-specific. These responses depend on multiple factors, such as different TR isoforms, different TR heterodimerization partners, and different modulator proteins such as coactivators and corepressors. Although coactivators and corepressors are present in most tissues, differential relative expression of coactivators and corepressors in these tissues and cell lines has been reported (32). This suggests that specific coactivators and/or corepressors could be acting preferentially in different tissues. Furthermore, the presence of a critical period of TH action in developing cerebellum during the first 2 weeks of postnatal life suggests that the differential expression of coactivator and corepressor proteins during this period could be involved. Oppenheimer et al. (25) showed that genes such as Pcp-2 or IP3R are not regulated by TH during the neonatal and adult period of the rat cerebellar development. In contrast, TH regulation occurs during the second and third weeks of postnatal life, with a maximal effect achieved by P15. Similar data have been shown for ROR{alpha}, another cerebellar gene (26). Thus, to determine whether the ratio of coactivators and corepressors present in the rat cerebellum during development could be a factor in the induction of the critical period of TH in this tissue, we determined the levels of coactivator (SRC1, TIF2, and TRAM1) and corepressor (N-CoR and SMRT) mRNAs from P2 to P30. Our results show that, among the coactivators, SRC1 and TIF2 are increased during development suggesting a role for these cofactors in TH-mediated gene activation. Because levels of SRC1 and TIF2 mRNAs are maximal at P30 when TH action is no longer seen, other factors may be also involved in the initiation of the critical period of TH action. For instance, other coactivator proteins, different from NCoA family coactivators, have recently been discovered, such as P120 (33), TRAP 22O (34) and TRIP 230 (35). Furthermore, the fact that the expression of SRC1, which is most abundant in developing cerebellum, and could play a major role in mediating TH action in cerebellum, is not changed at the mRNA level after the critical period, does not exclude the possibility that levels and activities of SRC1, as well as other cofactor proteins, might be altered by translational or posttranslational mechanisms. It would be of interest to examine whether the expression of coactivators and corepressors are developmentally regulated at the translational level. Among the corepressors, a 1.4-fold increase in N-CoR mRNA was observed. No change in SMRT mRNA was seen. In addition, we considered the possibility of regulation of coactivator or corepressor genes by TH. We have reported previously that T3 up-regulates SRC1 mRNA levels in GH3 cells and in the anterior pituitary in vivo, whereas estrogen down regulates SRC1 and SMRT expression (32). In contrast, we did not observed any differences in coactivator and corepressor mRNAs as affected by TH during cerebellar development. These results indicate that these genes may not be regulated by TH in cerebellum at the transcriptional level. Further studies are required, however, to determine the levels of coactivator or corepressors proteins in different thyroid states inasmuch as our results do not exclude a possible regulation at the translational and posttranslational levels.

In summary, coactivator (SRC1 and TIF2) and corepressor (N-CoR) genes appear be developmentally regulated in the rat cerebellum with a maximal increase in SRC1, whereas the coactivator, TRAM1, and corepressor, SMRT, do not show any significant increase. We did not detect any significant change in coactivator and corepressor mRNA levels due to altered thyroid status indicating that P160 family of coactivators and corepressors, SMRT and N-CoR, are not regulated by TH at the transcriptional level during rat cerebellum development. Clearly, we have not excluded whether other coactivator or corepressor genes may be involved in generating the critical period of TH action in developing cerebellum. Alternatively, coactivator and corepressor expression could be differentially regulated at the posttranscriptional level.


   Acknowledgments
 
We thank Dr. Silvia Misiti for her support in preparing the experiment.


   Footnotes
 
1 This work was supported in part by an American Thyroid Association research grant (to N.K.), the William Randolph Hearst Fund (to N.K.), and NIH RO1 DK-54343 (to W.W.C.). Back

Received December 28, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Legrand J 1986 Thyroid hormone effects on growth and development: In: Hennemann G (ed) Thyroid Hormone Metabolism. Marcel Dekker, New York, pp 503–534
  2. Glass CK 1994 Differential recognition of target genes by nuclear receptor monomer, dimers, heterodimers. Endocr Rev 15:391–407[Abstract/Free Full Text]
  3. Chin WW, Yen PM 1997 Molecular mechanisms of nuclear thyroid hormone action. In: Braverman LE (ed) Diseases of The Thyroid. Humana Press, Totowa, pp 1–15
  4. Lazar MA 1993 Thyroid hormone receptors: multiple forms, multiple possibilities. Endocr Rev 14:184–193[Abstract/Free Full Text]
  5. Schulman IG, Juguilon H, Evans RM 1996 Activation and repression by nuclear hormone receptors: hormone modulates an equilibrium between active and repressive state. Mol Cell Biol 16:3807–3813[Abstract]
  6. Xu L, Glass CK, Rosenfeld MG 1999 Coactivator and corepressor complexes in nuclear receptor function. Curr Opin Genet Dev 9:140–147[CrossRef][Medline]
  7. Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Soderstrom M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–403[CrossRef][Medline]
  8. Chen DJ, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457[CrossRef][Medline]
  9. Ordentlich P, Downes M, Xie W, Genin A. Spinner NB, Evans RM 1999 Unique forms of human and mouse nuclear receptor corepressor SMRT. Proc Natl Acad Sci USA 96:2639–2644[Abstract/Free Full Text]
  10. Heinzel T, Lavinsky RM, Mullen TM, Soderstrom M, Laherty CD, Torchia J, Yang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW, Glass CK, Rosenfeld MG 1997 A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 387:43–48[CrossRef][Medline]
  11. Nagy L, Kao HY, Chakravarty D, Lin RJ, Hassig CA, Ayer DE, Schreiber SL, Evans RM 1997 Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell 89:373–380[CrossRef][Medline]
  12. Onate SA, Tsai SY, Tsai MJ, O’Malley B 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  13. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 KDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  14. Hong H, Kohli K, Trivedi A. Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc Natl Acad Sci USA 93:4948–4952[Abstract/Free Full Text]
  15. Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG 1997 The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387:677–684[CrossRef][Medline]
  16. Li H, Gomes PJ, Chen JD 1997 RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF-2. Proc Natl Acad Sci USA 94:8479–8484[Abstract/Free Full Text]
  17. Chen HW, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakartany Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/P300. Cell 90:569–580[CrossRef][Medline]
  18. Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS 1997 AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277:965–968[Abstract/Free Full Text]
  19. Takeshita A, Cardona GR, Koibuchi N, Suen C-S, Chin WW 1997 TRAM-1, a novel 160-kDa thyroid hormone receptor activator molecule, exhibits distinct properties from steroid receptor coactivator-1. J Biol Chem 272:27629–27634[Abstract/Free Full Text]
  20. Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou JX, Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1997 Steroid receptor coactivator 1 is a histone acetyltransferase. Nature 389:194–198[CrossRef][Medline]
  21. Hajos F, Patel AJ, Balazs R 1973 Effect of thyroid deficiency on the synaptic organization of the rat cerebellar cortex. Brain Res 50:387–401[CrossRef][Medline]
  22. Nicholson JL, Altman J 1972 Synaptogenesis in the rat cerebellum: effects of early hypo- and hyperthyroidism. Science 176:530–532[Abstract/Free Full Text]
  23. Rabie A, Favre C, Clavel MC, Legrand J 1979 Sequential effects of thyroxine on the developing cerebellum of rats made hypothyroid by propylthiouracil. Brain Res 161:469–479[CrossRef][Medline]
  24. Legrand J 1967 Variations, en fonction de l’âge, de la réponse du cervelet à l’action morphogénétique de la thyroïde chez le rat. Arch Anat Microsc Morphol Exp 56:291–308[Medline]
  25. Oppenheimer JH, Schwartz HL 1997 Molecular basis of thyroid hormone-dependent brain development. Endocr Rev 18:462–475[Abstract/Free Full Text]
  26. Koibuchi N, Chin WW 1998 ROR{alpha} gene expression in the perinatal rat cerebellum: ontogeny and thyroid hormone regulation. Endocrinology 139:2335–2341[Abstract/Free Full Text]
  27. Strait KA, Zou L, Oppenheimer JH 1992 ß1 Isoform-specific regulation of a triiodothyronine-induced gene during cerebellar development. Mol Endocrinol 6:1874–1880[Abstract/Free Full Text]
  28. Figuereido BC, Almazan G, Ma Y, Tetzlaff W, Miller FD, Cuello AC 1993 Gene expression in the developing cerebellum during perinatal hypo- and hyperthyroidism. Mol Brain Res 17:258–268[Medline]
  29. Koibuchi N, Matsuzaki S, Ichimura K, Ohtake H, Yamaoka S 1996 Ontogenic changes in the expression of cytochrome c oxidase subunit I gene in the cerebellar cortex of the perinatal hypothyroid rat. Endocrinology 137:5096–5108[Abstract]
  30. Koibuchi N, Matsuzaki S, Ichimura K, Ohtake H, Yamaoka S 1995 Effect of perinatal hypothyroidism on expression of cytochrome c oxidase subunit I gene, which is cloned by differential plaque screening from the cerebellum of newborn rat. J Neuroendocrinol 7:847–853[CrossRef][Medline]
  31. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ 1990 Basic local alignment search tool. J Mol Biol 215:403–410[CrossRef][Medline]
  32. Misiti S, Schomburg L, Yen PM, Chin WW 1998 Expression and hormonal regulation of coactivator and corepressor genes. Endocrinology 139:2493–2500[Abstract/Free Full Text]
  33. Monden T, Wondisford FE, Hollenberg AN 1997 Isolation and characterization of a novel ligand-dependent thyroid hormone receptor-coactivating protein. J Biol Chem 272:29834–29841[Abstract/Free Full Text]
  34. Yuan CX, Ito M, Fondell JD, Fu ZY, Roeder RG 1998 The TRAP220 component of a thyroid hormone receptor-associated protein (TRAP) coactivator complex interacts directly with nuclear receptors in a ligand-dependent fashion. Proc Natl Acad Sci USA 95:7939–7944[Abstract/Free Full Text]
  35. Chang KH, Chen Y, Chen TT, Chou WH, Chen PL, Ma YY, Yang-Feng TL, Leng X, Tsai MJ, O’Malley BW, Lee WH 1997 A thyroid hormone receptor coactivator negatively regulated by the retinoblastoma protein. Proc Natl Acad Sci USA 94:9040–9045[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
H. A. Molenda-Figueira, S. D. Murphy, K. L. Shea, N. K. Siegal, Y. Zhao, J. G. Chadwick Jr., L. A. Denner, and M. J. Tetel
Steroid Receptor Coactivator-1 from Brain Physically Interacts Differentially with Steroid Receptor Subtypes
Endocrinology, October 1, 2008; 149(10): 5272 - 5279.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
S. V H Grommen, L. Arckens, T. Theuwissen, V. M Darras, and B. De Groef
Thyroid hormone receptor {beta}2 is strongly up-regulated at all levels of the hypothalamo-pituitary-thyroidal axis during late embryogenesis in chicken
J. Endocrinol., March 1, 2008; 196(3): 519 - 528.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
A. V. Patchev, D. Fischer, S. S. Wolf, M. Herkenham, F. Gotz, M. Gehin, P. Chambon, V. K. Patchev, and O. F. X. Almeida
Insidious adrenocortical insufficiency underlies neuroendocrine dysregulation in TIF-2 deficient mice
FASEB J, January 1, 2007; 21(1): 231 - 238.
[Abstract] [Full Text] [PDF]

Home page
 NeuroscientistHome page
M. Nishi and M. Kawata
Brain Corticosteroid Receptor Dynamics and Trafficking: Implications from Live Cell Imaging
Neuroscientist, April 1, 2006; 12(2): 119 - 133.
[Abstract] [PDF]

Home page
 Eur J EndocrinolHome page
J. Igarashi-Migitaka, A. Takeshita, N. Koibuchi, S. Yamada, R. Ohtani-Kaneko, and K. Hirata
Differential expression of p160 steroid receptor coactivators in the rat testis and epididymis
Eur. J. Endocrinol., October 1, 2005; 153(4): 595 - 604.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
H. A. Molenda, C. P. Kilts, R. L. Allen, and M. J. Tetel
Nuclear Receptor Coactivator Function in Reproductive Physiology and Behavior
Biol Reprod, November 1, 2003; 69(5): 1449 - 1457.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
Y.-Y. Liu and G. A. Brent
A Complex Deoxyribonucleic Acid Response Element in the Rat Ca2+/Calmodulin-Dependent Protein Kinase IV Gene 5'-Flanking Region Mediates Thyroid Hormone Induction and Chicken Ovalbumin Upstream Promoter Transcription Factor 1 Repression
Mol. Endocrinol., November 1, 2002; 16(11): 2439 - 2451.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
G. B. Potter, J. M. Zarach, J. M. Sisk, and C. C. Thompson
The Thyroid Hormone-Regulated Corepressor Hairless Associates with Histone Deacetylases in Neonatal Rat Brain
Mol. Endocrinol., November 1, 2002; 16(11): 2547 - 2560.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
H. A. Molenda, A. L. Griffin, A. P. Auger, M. M. McCarthy, and M. J. Tetel
Nuclear Receptor Coactivators Modulate Hormone-Dependent Gene Expression in Brain and Female Reproductive Behavior in Rats
Endocrinology, February 1, 2002; 143(2): 436 - 444.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by de Arrieta, C. M.
Right arrow Articles by Chin, W. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by de Arrieta, C. M.
Right arrow Articles by Chin, W. W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*LEVOTHYROXINE

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals