| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Chair of Endocrinology, Department of Experimental Medicine and Pathology (G.C., F.S.C., M.A., M.C.), University La Sapienza, Institute of Experimental Medicine (M.A., M.C.) and Institute of Biomedical Technology (L.S.), CNR, 00161 Rome, Italy; and Department of Oncology and Neuroscience (G.B.), University G. D’Annunzio, 66013 Chieti, Italy
Address all correspondence and requests for reprints to: Marco Centanni, M.D., Chair of Endocrinology, Department of Experimental Medicine and Pathology, Policlinico Umberto I, 00161 Rome, Italy. E-mail: lucanett{at}tiscalinet.it
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
These results indicate the existence of a functional promoter within the 5' flanking region of hD2 gene which is characterized by the presence of a CRE. The specific involvement of CREB in the cAMP-mediated hD2 gene promoter induction also has been demonstrated.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The mechanisms that modulate 5'-D2 expression and activity are not
entirely clarified. In rat, hypothyroidism is associated with marked
elevations of 5'-D2 messenger RNA (mRNA) expression and activity (9, 10). However, no direct evidence of a transcriptional regulation of the
5'-D2 gene by thyroid hormone has been described so far, and the
regulation seems to be exerted mainly at pre- or posttranslational
levels, at least in rat tissues (6, 11). The modulatory action of the
adrenergic system on 5'-D2 expression and activity has also been
reported (3, 6, 12). In fact, 5'-D2 mRNA levels increase after the cold
exposure and 
1 and ß adrenergic stimulation in rat brown adipose
tissue (6), suggesting that 5'-D2 contributes to the control of
thermogenesis in connection with the adrenergic receptor system (3).
Furthermore, isoproterenol and (Bu)2AMP stimulation on 5'-D2
expression and activity was also reported in rat pineal gland (12),
suggesting the involvement of the cAMP pathway. The evidence that
forskolin and 8-bromo-cAMP may induce 5'-D2 mRNA expression in rat
astroglial cells strengthens that hypothesis (13). In humans, Salvatore
et al. (14) showed an up-regulation of 5'-D2 expression
and/or activity in the thyroid of patients with hyperfunctioning
thyroid diseases, suggesting that cAMP may regulate also the 5'-D2 mRNA
levels in human thyroid gland. However, the promoter region of the
human 5'-D2 gene has not been characterized so far, and thus the
transcriptional mechanisms regulating this gene may not be
properly studied. Here, we analyze the structure and function of the 5'
flanking region of the human 5'-D2 gene.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-32P] deoxycycidine
triphosphate) by readyprime labeling protocol (Amersham Pharmacia Biotech, Arlington Heights, IL) and used as a probe. Washing
conditions were: 2 x SSC, 0.1% SDS, 20 min at room temperature;
1 x SSC, 0.1% SDS, 15 min at 65 C. After washes, filters were
exposed to autoradiography. A contiguous upstream 3.8-kb subclone was
obtained by digesting P1 clone with BamHI and subcloning the
fragments in pBluescript KS II. The recombinant colony was then
isolated by colony hybridization using, as probe, an oligonucleotide
labeled with [
-32P] deoxy-ATP by
T4 polinucleotide kinase (USB), complementary to
the overlapping region between the HindIII and
BamHI restriction sites. Filters were washed twice at room
temperature for 15 min with 2 x SSC, 0.1% SDS and 10 min at 37 C
with 2 x SSC, 0.1% SDS. Automatic sequence analysis was then
performed on both strands. The sequence of the 5' flanking region was
submitted to the MatInspector software analysis (15) for identification
of potential regulatory sequences involved in the hD2 gene
transcriptional modulation.
5' rapid amplification of cDNA ends (RACE)
Total human placenta RNA was isolated with the RNA STAT-60 kit
(Tel-Test "B" Inc.), and first-strand tagged
cDNA for 5'RACE was performed on 750 ng of RNA with a commercially
available Kit (Life Technologies, Inc., Gaithersburg, MD).
A 5'AACCAGCTAATCTAGTTTTCTTTCATCTCTTGCTG3' sequence, localized on exon 2
of the human 5'-D2 gene, was used as gene-specific primer for the RT.
The cDNA was then amplified using Advantage-GC Klen-Taq
(CLONTECH Laboratories, Inc.) using the following primers:
5'GGCCACGCGTCGACTAGTAC3' (universal primer) and 5'CTGGTTCCCCTTCACCCTC3'
(antisense gene specific primer, complementary to -54 to -35),
designed on the basis of the previously published 1.9-kb brain hD2 cDNA
sequence (A.N. Z44095) (7). The PCR conditions were as follows: initial
denaturation (2 min, 94 C), followed by 35 cycles of amplification (30
sec at 55 C, 4 min at 72 C, 20 sec at 94 C), whereas, in the last
cycle, the elongation time was 10 min. The PCR product was visualized
on a 1% agarose gel, blotted, hybridized with an upstream
32P end-labeled oligonucleotide probe
(5'CTTTACCCTTTCATTGTCTCTATG3', antisense, from -432 to -409) and
washed twice at room temperature for 15 min with 2 x SSC, 0.1%
SDS and 10 min at 37 C with 2 x SSC, 0.1% SDS. The specific band
was gel-separated, electroeluted, and cloned in pCR 2.1, according to
the manufacturer’s instructions (Invitrogen). Automatic
sequence analysis was then performed on both strands.
Primer extension analysis
Total RNA from a primary culture of human trophoblastic cells
was isolated by guanidinium thiocyanate and cesium chloride gradients.
The 5' end of hD2 gene transcript was determined by using a 20mer
(5'CCTCTGTCAGAGTCCGTTAA3') oligonucleotide primer complementary to
-344 to -325 of the hD2 gene and labeled with
[-32P] deoxy-ATP and
T4 nucleotide kinase (USB). The primer (1.2
x 106 cpm) was hybridized with total RNA (10
µg) at 50 C for 15 min and extended with Moloney murine leukemia
virus reverse transcriptase (Life Technologies, Inc.) for
1 h at 42 C. The resulting product was analyzed on a 6%
polyacrylamide -8.3-M urea gel in parallel with a
sequencing reaction generated with the extension primer.
Reporter gene constructs
Genomic sequences (from -1274 to +1, from -983 to +1, from
-744 to +1, from -560 to +1, numbered on the basis of their
respective distance from the translational start site) were amplified
by PCR with pBluescript containing the 6-kb fragment, together with
forward and reverse primers which contained a 5' HindIII
adapter sequence. PCR products were cloned into HindIII site
of plasmid pSVOAL
5', a luciferase expression vector (16). The
luciferase constructs were designated as follows: hD2-luc (-1274),
hD2-luc (-983), hD2-luc (-744), hD2-luc (-560). The recombinant
constructs were sequenced to verify the absence of PCR-induced errors.
The 5' deletion mutant of rat somatostatin promoter (-71), which
contains a potent cAMP-responsive element (CRE) (17), was removed with
HindIII from CAT reporter plasmid pSRIF (-71)-CAT and
cloned in the luciferase reporter vector pSVOAL5'. This construct,
designated rSS Luc (-71), was the positive control used
in the experiments with stimulated cells. Mutagenesis of CRE was
performed by digesting the hD2-luc (-1274) construct with Aat II,
which cut the sequence GACGT/C. The 3' protruding ends were removed by
using the Klenow enzyme (Roche Molecular Biochemicals,
Manza, Italy), and the resulting blunted ends were ligated.
Four nucleotides (ACGT) were, therefore, deleted from the TGACGTCA
sequence of CRE, and the construct was indicated as hD2-luc (-1270)
mut.
Cell lines and transient transfections
Human embryonic kidney (HEK- 293) cells were maintained in
DMEM (EuroClone Ltd.) supplemented with 10% FBS and 1%
L-glutamine. The day before, transfection cells were
seeded in 6-well plates and grown overnight to 50–60% confluence. For
transfection, HEK 293 cells were incubated overnight in OPTIMEM
(Life Technologies, Inc.) with 1 µg DNA, 5 µl
lipofectamine/well (Life Technologies, Inc.). Cells were
transfected with the promoter constructs or the promoterless
pSVOAL5' reporter plasmid, used to measure the background signal. To
measure the basal promoter activity, the medium containing the
DNA/liposomes complexes was replaced the day after transfections, and
the cells were incubated for 4 h in DMEM containing 10% FBS. To
measure the stimulated promoter activity, the day after transfection,
cells were incubated for 4 h in DMEM containing 0.1% BSA and 10
µM forskolin. As forskolin was dissolved in DMSO,
equimolar amounts of the vehicle were added to the nonstimulated cells
for control purposes. To analyze the effect of a dominant negative
inhibitor of cAMP responsive element binding protein (CREB), named
A-CREB (18), on the forskolin-stimulation of the hD2 gene promoter
activity, 1 µg of the hD2-luc (-1274) construct was cotransfected
with 1 µg of the expression construct Zeo A-CREB or with an equal
amount of the empty expression vector Rc/RSV (Invitrogen).
Transfections and forskolin treatment were carried out as above.
F9 teratocarcinoma cells were maintained in DMEM supplemented with 10% FBS. The day before transfection, 200,000 cells/well were seeded in 6-well plates and grown overnight. For transfection, F9 cells were incubated overnight in OPTIMEM (Life Technologies, Inc.) with 3 µg DNA, 5 µl lipofectamine/well (Life Technologies, Inc.). One microgram of the promoter constructs hD2-luc (-1274) was cotransfected with 1 µg of the expression vector Rc/RSV pKA and/or with 1 µg of the expression vector Rc/RSV CREB. The empty expression vector Rc/RSV (Invitrogen) has been used to maintain a total of 3 µg of plasmid DNA. The day after transfections, the cells were incubated for 24 h in DMEM containing 10% FBS.
Plasmid pCMVß-gal, which expresses ß-galactosidase under the control of the CMV promoter, was used in all transfections to normalize the luciferase activity.
After transfection procedures, the cells were lysed in 0.5% Triton X-100, 0.25 M Tris (pH 8), and luciferase activity was measured in a Packard luminometer (Bioscan, Washington, DC). Results are expressed as the ratio of luciferase to ß-galactosidase activity, relative to the promoterless or the full-length hD2 promoter constructs, and represent the mean ± SD of three independent experiments performed in triplicate.
JEG-3 cell culture, RNA isolation, and Northern blot analysis
Human choriocarcinoma JEG-3 cells were cultured in MEM
supplemented with 10% FBS. When the cells reached 70–80% confluence,
the medium was replaced with a serum-free, 0.1% BSA containing medium;
and 10 µM forskolin was added for the times indicated.
Total RNA was isolated with RNeasy mini Kit (QIAGEN),
according to the manufacturer’s instructions; and 10 µg were loaded
onto a 1.3% formaldehyde agarose gel, separated, and transferred to a
nylon membrane (Gene Screne Plus; New Life Science Products, Boston, MA). The probe, a PCR-generated 663-bp hD2
cDNA fragment, spanning from codon 53 to 274, encompassing most
of the coding region, was labeled with
[-32P]deoxycycidine triphosphate using the
random primer labeling kit (Amersham Pharmacia Biotech).
After hybridization, the filter was washed twice with 2 x SSC,
0.5% SDS for 15 min at room temperature and twice with 0.2 x
SSC, 0.5% SDS for 15 min at 50 C and exposed to x-ray film. The same
filter was hybridized with human ß-actin cDNA probe as a control.
Electrophoretic mobility shift assay (EMSA)
HEK 293 cell nuclear extracts were prepared as described by
Granelli-Piperno et al. (19). Binding reactions mixture
contained 0.6 ng 32P-labeled oligonucleotide
probe, 15 µg nuclear extract, 2 µg poly (dI-dC), 200
mM KCl, 75 mM HEPES (pH
7.9), 5 mM EDTA, 2.5 mM
dithiothreitol, and 25% glycerol, in a total vol of 25 µl. To
perform supershift experiments, 2 µg of the following antibodies were
added to the binding reaction mixture: 1) an antibody, indicated as
DBDD, which recognizes an epitope within the specific DNA binding
and dimerization domain, reactive with all three members of
activating transcription factor (ATF)/CREB transcription factors
family (Santa Cruz Biotechnology, Inc., Santa Cruz,
CA); 2) the anti-CREB-1 (CREB-1) (New England Biolabs, Inc., Beverly, MA), anti-CRE modulator-1
(CREM-1), anti-ATF-1 (ATF-1) antibodies (Cruz Biotechnology, Inc.); 3) an antiestrogen receptor antibody used as nonspecific
antibody (Cruz Biotechnology, Inc.). The effect of increasing
amounts (4 and 6 µg) of anti-CREB-1 antibody has also been analyzed.
In competition experiments, 100-fold molar excess of cold
oligonucleotides was added to the binding reaction mixture. The
oligonucleotide probe (hD2 CRE) used was:
5'-CTCTTTCTCAATGACGTCAAGA-TCTTTACCAAG-3' (-777 to -745). The CRE
consensus oligonucleotide was the same as that of Promega Corp. The mutated oligonucleotide (hD2 CRE mut) was
5'-CTCTTTCTCAATGCAAGATCTTTACCA-AG-3' and contained the same
mutation as the reporter construct used in the transfection
experiments. Reaction mixtures were incubated for 30 min at room
temperature, resolved on nondenaturing 4% polyacrylamide gel, dried,
and exposed to autoradiography.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
).
|
), which was cloned and sequenced.
The result was confirmed by RT-PCR (not shown). The sequence
analysis of the product, once compared with the genomic one, revealed
the presence of a 274-bp intron in the 5' UT region of the gene. That
intron divided the described exon 1 (8) from an upstream small exon
that we called 1a. (Fig. 2B). Therefore, the 5' end of the RACE product
corresponded to position -438 from the translation start site on the
genomic sequence.
|
). The genomic
organization of the 5' UT region of hD2 gene is depicted in Fig. 3B.
|
). Deletion of 291-bp [hD2-luc (-983)
construct] slightly increased luciferase activity, which was instead
clearly reduced by deleting further 239 bp, as in hD2-luc (-744)
construct, which did not contain the CRE. Luciferase activity was
similarly reduced in cells transfected with the smaller construct
[hD2-luc (-560)], which, however, retained some significant promoter
activity, compared with the promoterless vector. The effect of
forskolin, a direct activator of adenylate cyclase, has been analyzed
to examine cAMP responsiveness (Fig. 5).
The 5' deletion mutant of rat somatostatin promoter, designated rSS-luc
(-71) construct, which contains a potent CRE (17), has
been used as reference for the forskolin effect. Forskolin treatment of
cells transfected with rSS-luc (- 71) construct significantly
increased luciferase activity (3-fold), compared with the nonstimulated
cells transfected with the same construct. In cells transfected with
the hD2-Luc (-1274) and hD2-luc (-983) constructs, forskolin
stimulated luciferase activity essentially to the same extent as in
those transfected with rSS-luc (- 71) construct. This effect was
abolished in the deletion mutants hD2-luc (-744) and hD2-luc (-560),
which did not include the CRE. The treatment with forskolin also failed
to stimulate the cells transfected with hD2-luc (-1270) mut
construct, which contained the mutagenized CRE (Fig. 5). The
same results were obtained by transfecting the different constructs
into JEG-3 cells (data not shown), a placenta-derived cell line in
which hD2 gene is cAMP-inducible (see below).
|
|
). Similarly to results reported
from Salvatore et al. (7), two additional bands, possibly
representing smaller transcripts, were also seen.
|
, lane 2). The pattern of migration of
hD2 probe was identical to the one observed with the consensus CRE
probe (not shown). The specific DNA-protein complex was partially
supershifted by all amounts (2, 4, and 6 µg) of CREB-1 used,
therefore demonstrating that CREB actually binds DNA in
vitro (Fig. 7, lanes 3–5). A partial supershift was also obtained
by using the CREM-1 (Fig. 7, lane 7), whereas the anti-ATF-1 (Fig. 7, lane 6), as well as the antiestrogen receptor antibody (Fig. 7, lane
9), did not modify the electrophoretic mobility of the DNA-protein
complex. The antibody DBDD, reactive with all three members of
ATF/CREB transcription factors family, completely supershifted the
electrophoretic band (Fig. 7, lane 8). The band corresponding to
DNA-protein complex disappeared upon competition with a 100-fold molar
excess of cold hD2 CRE or consensus CRE oligonucleotides (Fig. 7, lanes
10 and 11). In contrast, no competition occurred using the mutated
oligonucleotide (hD2 CRE mut) under the same experimental
conditions.
|
, A-CREB completely inhibited forskolin
induction of the hD2 luc (-1274) construct.
|
). Cotransfection of
both pKA and CREB expression plasmid caused a huge (43-fold) increase
of hD2 luc (-1274) activity, indicating that phosphorylated CREB is
able to stimulate hD2 gene transcription.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We have previously described the coding region of human 5'-D2 gene encompassing two exons divided by a 7.4-kb intron (8). In this study on human placenta, the 5' RACE analysis revealed the presence, in the 5' UT region of this gene, of an additional small exon. We have evidence for two major TSSs located at -470/-474 from the translational start site, as indicated by primer extension analysis.
A canonical CRE, upstream from a TTTAAAA motif has been identified. It is worth noting that this atypical TATA consensus element has been previously described as being associated with a number of functional CRE (22) and characterizes the so-called Goldberg-Hogness promoters. However, this TTTAAAA motif is located closer than expected for a functional TATA box (22). The actual functionality of this element remains to be elucidated.
In this study, we demonstrated that the CRE located in the promoter
region of hD2 gene is functional, based on the following: 1) the
transient transfection studies under basal conditions revealed that the
promoter constructs owned significant transcriptional activity if they
contained CRE and a clearly reduced one if they were devoid of that
element; 2) the effect of forskolin, which increases cAMP levels by
adenylate cyclase stimulation, was completely abolished in cells
transfected with hD2 promoter constructs where CRE was absent or
specifically mutagenized; and 3) forskolin stimulation of HEK 293 cells
transfected with the hD2 promoter constructs that contained the CRE was
comparable with that obtained using the rat somatostatin promoter
construct, which includes a well-characterized and functional CRE (17).
This evidence also indicates that the CRE is critical to cAMP-induced
hD2 gene expression (22). Several transcription factors interacting
with CRE to couple the cAMP-mediated signal transduction with gene
transcription have been described (see Ref. 23 for review). Some of
them activate transcription (CREB, ATF-1, CREM-1), some other act as a
repressor (CREM isoforms ,ß,, CREB-2 gene members) (23).
In this study, the results of the EMSA and supershift assay clearly
indicated that CREB and CREM-1 proteins, as homodimers and/or
heterodimers, are indeed bound to CRE in vitro. The effect
of the dominant negative inhibitor of CREB (18), A-CREB, which
abolished the forskolin-induced transcription of the reporter gene in
the hD2-luc (-1274) construct, confirmed the functional role of CREB
or its closely related family members in vivo (22, 23). The
role of CREB was further confirmed in human undifferentiated F9
teratocarcinoma cells, which are not responsive to cAMP (21). In these
cells, once cotransfected the full-length hD2 promoter construct
with pKA plus CREB expression vectors, it was evident that
phosphorylated CREB is able to stimulate hD2 gene transcription. The
described mechanism of transcriptional activation has been proven to be
effective on hD2 natural promoter in a placenta-derived cell line
(JEG-3) responsive to cAMP agonists (20), thus indicating that, in this
tissue, hormonal and nonhormonal signals, acting through the cAMP
pathway, are able to modulate hD2 gene expression. These findings may
represent the molecular basis of the adrenergic effects on 5'-D2
expression and activity (12, 13, 24) and their relationship with cAMP
pathway described in rat (13, 25). In humans, Salvatore et
al. (14) reported an increased hD2 mRNA expression and activity in
hyperfunctioning thyroid tissues, suggesting a linkage with TSH
receptor status. The stimulatory effect of TSH receptor on thyroid
economy is mediated by the cAMP pathway through protein kinase A
activation (26). The evidence that forskolin induced hD2 gene promoter
via CREB is in keeping with these findings and may represent
one of the missed links claimed in that previous report (14).
Other regulatory elements (e.g. thyroid response elements) may be involved in modulating the expression of hD2 gene, but evidence of a transcriptional regulation of 5'-D2 gene through these other pathways is, up to now, faint. In rat tissues, although 5'-D2 expression and activity are greatly affected by the iodothyronine levels, most of the effects seem, in fact, to be regulated via pretranslational and/or posttranslational mechanisms (4, 6, 11, 27). Furthermore, in our study, the computer analysis did not detect the presence of canonical thyroid response elements in the 5' flanking region. These elements, described instead in the promoter region of human type 1 deiodinase (28, 29), are required to mediate the transcriptional effects of thyroid hormones. The hypothesis that iodothyronines predominantly regulate 5'-D2 activity at a posttranscriptional level is also in keeping with the presence of AU-rich motifs in the 3' UT region of hD2 cDNA (5); these elements are usually characteristic of genes whose expression is regulated by shortening transcripts half-life through rapid mRNA deadenylation (30).
Finally, the different expression of 5'-D2 gene in human and in rat thyroid (14), and even in different human tissues (4, 6), indicates that this gene is regulated in a species- and tissue-specific fashion. This implies that some other transcription factor, beside the CREB, may be essential in the modulation of hD2 gene. In this view, this first characterization of its promoter region may allow us to further understand these issues.
In summary, a functional promoter has been described within the 5' flanking region of human 5'-D2 gene which is characterized by the presence of a CRE. The specific involvement of CREB and/or one of its closely related family members in the cAMP-mediated hD2 gene promoter induction also has been demonstrated. These data provide new information to promote further understanding of the molecular mechanisms involved in 5'-D2 expression in humans.
|
Acknowledgments |
|---|
(-71)-CAT reporter plasmid, Rc/RSV pKA, and Rc/RSV CREB expression
vectors. |
Footnotes |
|---|
2 Dr. Canettieri and Dr. Celi equally contributed to this work.
Received October 7, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  B. Gereben, A. M. Zavacki, S. Ribich, B. W. Kim, S. A. Huang, W. S. Simonides, A. Zeold, and A. C. Bianco Cellular and Molecular Basis of Deiodinase-Regulated Thyroid Hormone Signaling Endocr. Rev., December 1, 2008; 29(7): 898 - 938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Lamirand, S. Pallud-Mothre, M. Ramauge, M. Pierre, and F. Courtin Oxidative Stress Regulates Type 3 Deiodinase and Type 2 Deiodinase in Cultured Rat Astrocytes Endocrinology, July 1, 2008; 149(7): 3713 - 3721. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. S. Celi, G. Coppotelli, A. Chidakel, M. Kelly, B. A. Brillante, T. Shawker, N. Cherman, P. P. Feuillan, and M. T. Collins The Role of Type 1 and Type 2 5'-Deiodinase in the Pathophysiology of the 3,5,3'-Triiodothyronine Toxicosis of McCune-Albright Syndrome J. Clin. Endocrinol. Metab., June 1, 2008; 93(6): 2383 - 2389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Canettieri, A. Franchi, M. D. Guardia, I. Morantte, M. G. Santaguida, J. W. Harney, P. R. Larsen, and M. Centanni Activation of Thyroid Hormone Is Transcriptionally Regulated by Epidermal Growth Factor in Human Placenta-Derived JEG3 Cells Endocrinology, February 1, 2008; 149(2): 695 - 702. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Chik, M. T. Wloka, D. M. Price, and A. K. Ho The Role of Repressor Proteins in the Adrenergic Induction of Type II Iodothyronine Deiodinase in Rat Pinealocytes Endocrinology, July 1, 2007; 148(7): 3523 - 3531. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kohrle, F. Jakob, B. Contempre, and J. E. Dumont Selenium, the Thyroid, and the Endocrine System Endocr. Rev., December 1, 2005; 26(7): 944 - 984. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. P. Peeters, A. W. van den Beld, H. Attalki, H. v. Toor, Y. B. de Rijke, G. G. J. M. Kuiper, S. W. J. Lamberts, J. A. M. J. L. Janssen, A. G. Uitterlinden, and T. J. Visser A new polymorphism in the type II deiodinase gene is associated with circulating thyroid hormone parameters Am J Physiol Endocrinol Metab, July 1, 2005; 289(1): E75 - E81. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. W. J. S. Wassen, W. Klootwijk, E. Kaptein, D. J. Duncker, T. J. Visser, and G. G. J. M. Kuiper Characteristics and Thyroid State-Dependent Regulation of Iodothyronine Deiodinases in Pigs Endocrinology, September 1, 2004; 145(9): 4251 - 4263. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Araki, T. Morimura, T. Ogiwara, H. Mizuma, M. Mori, and M. Murakami Expression of Type 2 Iodothyronine Deiodinase in Corticotropin-Secreting Mouse Pituitary Tumor Cells Is Stimulated by Glucocorticoid and Corticotropin-Releasing Hormone Endocrinology, October 1, 2003; 144(10): 4459 - 4465. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Mentuccia, L. Proietti-Pannunzi, K. Tanner, V. Bacci, T. I. Pollin, E. T. Poehlman, A. R. Shuldiner, and F. S. Celi Association Between a Novel Variant of the Human Type 2 Deiodinase Gene Thr92Ala and Insulin Resistance: Evidence of Interaction With the Trp64Arg Variant of the {beta}-3-Adrenergic Receptor Diabetes, March 1, 2002; 51(3): 880 - 883. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Bianco, D. Salvatore, B. Gereben, M. J. Berry, and P. R. Larsen Biochemistry, Cellular and Molecular Biology, and Physiological Roles of the Iodothyronine Selenodeiodinases Endocr. Rev., February 1, 2002; 23(1): 38 - 89. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
