help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kramer, P. R.
Right arrow Articles by Wray, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kramer, P. R.
Right arrow Articles by Wray, S.
Endocrinology Vol. 141, No. 5 1823-1838
Copyright © 2000 by The Endocrine Society

ARTICLES

Transcription Factor Activator Protein-2 Is Required for Continued Luteinizing Hormone-Releasing Hormone Expression in the Forebrain of Developing Mice

P. R. Kramer, R. Krishnamurthy, P. J. Mitchell and S. Wray

Cellular and Developmental Neurobiology Section, National Institute of Neurological Disorders and Stroke, National Institutes of Health (P.R.K., S.W.), Bethesda, Maryland 20892; and Department of Biochemistry and Molecular Biology, Pennsylvania State University (R.K., P.J.M.), University Park, Pennsylvania 16302

Address all correspondence and requests for reprints to: Dr. Susan Wray, Cellular and Developmental Neurobiology Section, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Building 36, Room 5A-25, Bethesda, Maryland 20895-4156. E-mail: swray{at}codon.nih.gov


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LHRH is the neuropeptide responsible for reproductive function. Prenatally, LHRH expression begins when neurons are in the olfactory pit and continues as these cells migrate into the brain. Thus, LHRH neurons maintain neuropeptide expression through very distinct environments. The regulatory interactions that control onset and continued expression of the LHRH phenotype are unknown. To begin to address this question primary LHRH neurons were removed from nasal explants at different ages. A complementary DNA (cDNA) subtraction screen was performed comparing a 3.5-days in vitro LHRH neuron [approximately embryonic day 15 (E15) in vivo] to two 10.5-days in vitro LHRH neurons (approximately postnatal day 1 in vivo). The transcription factor activator protein-2 (AP-2{alpha}) was differentially expressed and was present in the developmentally younger LHRH neuron. In vivo analysis revealed that LHRH neurons expressed AP-2 as they migrated across the cribriform plate and into the forebrain beginning on E13.5, but that coexpression of LHRH and AP-2 was no longer detected in postnatal day 1 animals. This suggested a regulatory role for AP-2 in LHRH neurons. Analysis of animals lacking AP-2{alpha} revealed a dramatic decrease in forebrain LHRH neurons between E13.5 and E14.5, correlating with normal onset of AP-2 expression in LHRH neurons as they entered the central nervous system. Nasal cells robustly expressing LHRH were still present on E14.5. The continued presence of forebrain LHRH cells is proposed based on a second marker, galanin, and lack of increased apoptotic/necrotic cells in this region. A decrease in LHRH messenger RNA in forebrain neurons indicates regulation of LHRH occurred at the transcriptional or posttranscriptional level in mutant animals. These results indicate a developmentally restricted involvement of the transcription factor AP-2 in LHRH expression once the LHRH neurons have migrated into the forebrain, but before establishment of an adult-like distribution.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
LHRH NEURONS regulate reproductive processes postnatally (for review, see Ref. 1). Developmentally, in all mammals, these LHRH neurons originate outside the central nervous system (CNS) in the olfactory placode (2, 3, 4, 5). LHRH expression begins when neurons are still present within the olfactory pit and continues as these cells migrate into the brain. Thus, LHRH neurons initiate gene expression in the absence of direct CNS cues and thereafter maintain neuropeptide expression through very distinct environments. The regulatory interactions that control onset and continued expression of the LHRH phenotype are unknown.

Work examining neuropeptide processing (6), membrane properties (7) and secretory capacity (8) of primary LHRH neurons maintained in culture provided evidence that residing within the CNS is not essential for LHRH neuronal activity. Therefore, intrinsic to the LHRH neuron and/or retained in nasal environments in vitro, are cues leading to onset and maturation of the LHRH neuronal phenotype. Since maturation of these neurons takes place in vitro, a cDNA subtraction screen was performed to begin to identify genes important for regulation of LHRH neuronal activity. Earlier studies (7) had shown a change in LHRH neuronal properties occurred in neurons maintained in vitro for 6 days vs. 10 days. The later time point being the in vitro equivalent of postnatal day 1 (PN1) in vivo. Thus, a cDNA library from a young (3.5-days in vitro) (div) LHRH cell was created and screened with the genes expressed in two 10.5 div LHRH cells. The transcription factor activator protein-2 (AP-2{alpha}) was found to be differentially expressed and was present in the developmentally younger LHRH neuron.

Three related AP-2 genes plus variants have been identified, AP-2{alpha}, -ß, and -{gamma} (9, 10, 11, 12, 13). AP-2 {alpha}, the focus of this study, is a trans-acting regulatory protein (enhancer-binding protein) expressed initially in neural crest (14, 15) and in many neural, neuroectodermal, and ectodermal tissues during development (16). AP-2{alpha} mediates transcriptional activation in response to two different signal transduction pathways, the phorbol ester and diacylglycerol-activated protein kinase C and the cAMP-dependent protein kinase A (17). Coupled to more than one pathway, AP-2 may serve as a bridge, coordinating effects and ensuring that target genes will be regulated in response to a variety of different signals.

AP-2{alpha} is important in embryogenesis, especially in craniofacial development and midline fusion (18, 19). It is expressed throughout nasal regions in mesenchymal cells (16) and has also been detected in the olfactory placode, but limited to the presumptive respiratory epithelium (20). The AP-2 gene encodes a retinoic acid-inducible protein (19), and its expression is associated with a decrease in proliferation (21, 22) and cellular differentiation (9, 12, 23, 24, 25). Interestingly, with respect to the success in making immortalized LHRH cells lines (26, 27), AP-2 interacts with the simian virus 40 T antigen (12). The binding of AP-2 to T antigen can inhibit AP-2 binding to DNA and thus its transcriptional activities. AP-2 has also been shown to regulate neuropeptide receptors (28, 29, 30) and enzymes such as choline acetyltransferase (31) and dopamine ß-hydroxylase (24) that produce the neurotransmitters acetylcholine and norepinephrine, respectively. In addition, transcriptional activation via AP-2 has been shown for several neuropeptide genes. AP-2 maintains or enhances the expression of neuropeptide tyrosine (32), proenkephalin (33), and neuropeptides in the dorsal root ganglion (34).

Although a perfect AP-2 consensus element is not located in the LHRH promoter (our personal observation), a direct role for AP-2 as a DNA-binding protein on the 5'-region of the LHRH gene has yet to be determined. However, AP-2 consensus elements have been located in the promoters of several genes, including galanin (35), the ß3 subunit of the {gamma}-aminobutyrate type A (GABAA) receptor (29), and the neuropeptide Y-Y1 receptor (30), which have been identified in LHRH neurons (7, 36, 37) or the GT1 immortalized LHRH cell line (38). As such, the differential expression of AP-2 found in LHRH neurons in vitro may reflect either a general maturation event that occurs in LHRH neurons or a LHRH gene-specific event. Thus, to address the role that AP-2 may play in LHRH neuronal maturation, we examined LHRH expression in mice lacking AP-2{alpha}. LHRH messenger RNA (mRNA) and protein levels in mutants were similar to those in wild-type animals until embryonic day 13.5 (E13.5). This result suggests that AP-2 is not involved in the early events necessary for the onset of LHRH expression in olfactory pit cells or LHRH cell migration in nasal regions. After E13.5, a rapid and dramatic decrease in LHRH expression within forebrain neurons occurred. This result is consistent with AP-2 being required to maintain LHRH expression at a restricted developmental stage.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Isolation of single LHRH cells
Embryos (E11.0–E11.5) were removed from pregnant NIH-Swiss mice in accordance with NIH guidelines. Nasal explants containing the olfactory pits were generated and grown in vitro under serum-free conditions (6). The murine olfactory explants were then placed in 60-mm tissue culture plates, washed twice in 2 ml PBS, (without Ca2+ or Mg2+), and placed in 2 ml PBS with 1 x 10-3% trypsin solution (0.05% trypsin without Ca2+ or Mg2+). Explants were observed under a Carl Zeiss inverted microscope (New York, NY), and LHRH-like neurons were identified by morphology and anatomical location; bipolar neurons were associated with fibers exiting from the explant (6). Isolated neurons were removed from the explant with a micromanipulator fitted with a pulled and beveled microcapillary (FHC, Bowdoinham, ME). In addition to nasal explants, NLT (39) and GT-1 (26) immortalized LHRH cell lines were grown in DMEM supplemented with 10% FCS. Single cells were removed as described above and run in parallel with nasal explant cells as positive controls. Ten NLT cells, 8 GT-1 cells, and 13 bipolar primary neurons (6 cells, 3.5 div; 7 cells, 10.5 div) were removed and lysed, and RT-PCR was performed as described below. The resulting cDNAs were screened by Southern analysis for LHRH. Robust LHRH expression was found in 40% of the NLT cells, 50% of the GT-1 cells, and 100% of primary cells extracted at 3.5 div and 57% of primary cells extracted at 10.5 div.

Construction of single cell libraries
Construction of the single cell cDNA libraries was based on the 1995 protocol of Dulac and Axel (40). Single cell aliquots were placed into a reaction mixture containing 4 µl lysis buffer [50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 0.5% Nonidet P-40, containing 80 ng/ml pd(T) 19–24, 5 U/ml prime ribonuclease inhibitor (5 Prime,3 Prime, Inc., Bolder, CO), 324 U/ml RNAguard (Pharmacia Biotech, Piscataway, NJ), and 10 µM deoxy (d)-ATP, dCTP, dTTP, and dGTP] at 4 C. The cells were lysed by a 1-min incubation at 65 C, then 50 U Moloney murine leukemia virus and 0.5 U avian reverse transcriptases (BRL, Beverly, MA) were added, and the mixture was incubated for 15 min at 37 C, then heat inactivated at 65 C for 10 min. The 15-min RT reaction produces cDNA products ranging from 300-1000 bp (40, 41). The next step, a polyadenylase addition, was performed on the cDNA product by adding an equal volume of 200 mM potassium cacodylate (pH 7.2), 4 mM CoCl2, 0.4 mM dithiothreitol (DTT), 200 µM dATP containing 10 U terminal transferase (Roche Molecular Biochemicals, Inc., Indianapolis, IN) and incubating the reaction mixture for 15 min at 37 C. The sample was heat inactivated by incubating at 65 C for 10 min. PCR amplification was performed using 5 µg of the AL1 primer [ATT GGA TCC AGG CCG CTC TGG ACA AAA TAT GAA TTC (T)24]; PCR buffer [10 mM Tris-HCl (pH 8.3) and 50 mM KCl); 2.5 mM MgCl2; 1 mM dGTP, dTTP, dATP, and dCTP; 10 µg BSA; 0.05% Triton X-100 (Roche Molecular Biochemicals, Inc.); and 10 U AmpliTaq (Perkin-Elmer Corp., Branchburg, NJ) and 25 cycles using the following protocol: 94 C for 1 min, 42 C for 2 min, and 72 C for 6 min with 10-sec extensions following each cycle. After the initial 25 cycles an additional 5 U AmpliTaq were added, and 25 more cycles were performed. Southern analysis was performed using 1 µg amplified single cell cDNA run on a 1.5% agarose gel and blotted on nylon membrane (GeneScreen Plus, DuPont/NEN, Boston, MA). The membranes were probed with LHRH (350-bp fragment of the rat LHRH cDNA including exons 1–4, a gift from Dr. J. Adelman) as described below. The PCR products of LHRH-positive cells were digested with EcoRI and packaged using Gigapack Gold packaging extract (Stratagene, La Jolla, CA) according to the manufacturer’s directions.

Comparative analysis of LHRH neurons
Plaque-lifts using GeneScreen Plus membranes (DuPont/NEN) were completed. Membranes displaying the single cell cDNA library from a cell grown in vitro for 3.5 days were hybridized with a PCR-labeled cDNA library from two other LHRH-positive neurons grown in vitro for 10.5 days. Membranes were prehybridized for 3 h at 60 C with 1% dextran sulfate, 1.0 M NaCl, 1% SDS, and 100 µg/ml sheared herring sperm DNA. Probes were labeled with [{alpha}-32P]dCTP using random primer labeling (Roche Molecular Biochemicals, Inc.) or PCR amplification. PCR amplification of cDNA from a single cell was labeled by amplifying 0.3 µl neuron cDNA in a 50-µl volume containing 0.8 µg AL1 primer in PCR buffer [10 mM Tris-HCl (pH 8.3) and 50 mM KCl]; 2.5 mM MgCl2; 4 µM dGTP, dTTP, and dATP; and 100 µCi [{alpha}-32P]dCTP for 30 cycles using the following protocol: 94 C for 1 min, 55 C for 2 min, 72 C for 3 min, and one cycle at 72 C for 5 min. The probe was boiled for 5 min in hybridization solution (1% dextran sulfate, 1.0 M NaCl, 1% SDS, and 700 µg/ml sheared herring sperm DNA), incubated at 65 C for 3 h, and then added to the prehybridization solution. The membranes were hybridized for more than 12 h, washed twice for 45 min each time at 60 C in a solution of 2 x SSC (300 mM NaCl and 30 mM sodium citrate, pH 7.0)-1% SDS, and exposed to film.

PCR amplification and sequencing of inserts
Differentially expressed cDNA inserts were PCR amplified by picking isolated plaques with a pipette tip and submerging the end in a 40-µl solution of PCR buffer [10 mM Tris-HCl (pH 8.3) and 50 mM KCl]; 5 mM MgCl2; 0.5 mM T3 (5AATTAACCCTCACTAAAGGG3) and T7 (5GTAATACGACTCACTATAGGGC3) primers; 1 mM dATP, dCTP, dGTP, and dTTP; 0.1% Tween 20; and 0.5 U AmpliTaq. Pipette tips were removed, and samples were cycled once at 94 C for 5 min, then for 30 cycles at 94 C for 1 min, 55 C for 1 min, 72 C for 2 min, and once at 72 C for 3 min. Southern analysis was performed on the PCR products as previously described. The inserts that were differentially expressed in the second screen were purified using Microcon 100 concentrators (Amicon, Beverly, MA), primers were designed, and the insert DNA was sequenced. Sequencing revealed that the gene isolated from LHRH neurons maintained for different days in vitro was the transcription factor AP-2{alpha}. Thus, Southern blots of amplified single cell cDNA libraries previously probed with LHRH were subsequently stripped and probed with AP-2 (pSE, Dr. P. J. Mitchell).

AP-2-/- mouse embryos
The homozygous mutation made in the AP-2{alpha} gene was described previously (19). Briefly, exon 5 was targeted for deletion in the homozygous mutant mice (19). Embryonic stem cell lines were generated. Chimaeric males were bred to BALB/c and 129/Sv wild-type females to generate heterozygotes for intercrossing. Homozygous mutant animals die perinatally (19). Mutant and wild-type embryos (E12.5–E15.5) were used in these studies.

Single and double label immunocytochemistry
Pro-LHRH antisera (42) was used at 1:2500, AP-2 monoclonal antisera specific for the {alpha} form of the protein (a gift from Dr. T. Williams) was used at 1:1, AP-2 polyclonal antisera (C-18, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was used at 1:400. Polyclonal antibody C-18 is specific for the {alpha} form of AP-2 with little or no binding to the ß or {gamma} form of the AP-2 protein (Mitchell, P. J., personal communication). Tyrosine hydroxylase antibody (Eugene Tech, Allendale, NJ) was used at 1:3000, and antineurophysin (a gift from Dr. Robinson) was used at 1:5000. Substance P antibody (1:4000) and somatostatin antibody (1:3000) were purchased from INCSTAR Corp. (Stillwater, MN).

Single label immunocytochemistry on either explants (6) or frozen embryonic sections (5) was performed using standard avidin-biotin-horseradish peroxidase (Vector Laboratories, Inc., Burlingame, CA) procedures. Double label immunocytochemistry on explants or frozen parasagittal sections (16–20 µm) from AP-2 mutant and wild-type embryos was performed 1) using an avidin-biotin complex (Vector Laboratories, Inc.) and two chromogens for horseradish peroxidase (6) [nickel-enhanced diaminobenzidine (DAB; blue-black reaction) and DAB (brown reaction)] or one chromogen [nickel-enhanced DAB or Vector VIP (purple; Vector Laboratories, Inc.)] and avidin-Texas Red; or 2) using a directly conjugated fluorescent Cy-3 goat antirabbit secondary [1:1000; Jackson ImmunoResearch Laboratory (West Grove, PA)], for visualization of the first antigen/antibody complex, then reactive cells were captured with a VideoScope ICCD-35OF Camera (Sterling, VA), and the section was processed for the second antigen/antibody complex using nickel-enhanced DAB as described above. Nickel enhancement DAB procedures (as opposed to dual fluorescent procedures) were required to optimize AP-2 staining in embryonic sections. All sections stained with fluorescent compounds were blocked with an unconjugated Fab (80 ng/ml; Jackson ImmunoResearch Laboratory). Controls for double label immunocytochemical experiments consisted of replacement of either the first primary or the second primary antibody with a normal goat serum incubation. Control sections revealed no cross-reactivity between the first and second labeling procedures (data not shown). For presentation purposes (see Figs. 3Go and 4Go), AP-2 staining (nickel-enhanced DAB) was visualized under brightfield, captured (in black and white), colorized green, and then overlaid on the captured image of LHRH, which was stained with avidin-Texas Red or Cy-3 and colorized red. Cell counts are given as the mean ± SEM. Statistical significance comparing various groups of immunopositive neurons was calculated using one-way ANOVA followed by Tukey’s multiple comparison test.



View larger version (45K):
[in this window]
[in a new window]
  		Figure 3. LHRH neurons begin to express AP-2 at the nasal/forebrain junction after E13.5. Most LHRH cells (A) did not express AP-2 (B) at the nasal/forebrain junction on E13.5 (C, an overlay of A and B). An adjacent section (D) stained for methyl green (box region indicates the location of A–C). After E13.5, AP-2 (F) expression in LHRH cells (E) increased and was detected in a number of cells in this region by E15.5 (E–G, box region in H indicates the location of E–G). Arrows in A and E point to a few of the LHRH-immunopositive cells in these sections with visible nuclei. op, Olfactory pit; oe, olfactory epithelium; fb, forebrain. Bar, 50 µm in A–C and E–G, and 1 mm in D and H.

 


View larger version (40K):
[in this window]
[in a new window]
  		Figure 4. Prenatally, AP-2 expression was detected in LHRH neurons within the forebrain in addition to LHRH cells at the nasal/forebrain junction. LHRH neurons (A and D) express AP-2 (B and E) in the forebrain (C and F, overlay) of E14.5 embryos (adjacent section stained for methyl green, G; box region indicates the location of A–F). Expression of AP-2 (I) in LHRH cells (H) was no longer detected by PN1 (J, overlay). Bar, 50 µm in A–C, E, F, and H–J, and 1 mm in G.

 
In situ hybridization histochemistry
Fresh-frozen mouse embryo sections (16–20 µm) were cut on a Reichert-Jung 2800-Frigocut-E cryostat (Leica Microsystems, Heidelberg, Germany) and mounted on subbed slides. The sections were processed as previously described (4). Briefly, sections were fixed in 4% formaldehyde, rinsed in PBS, permeabilized in 0.3% Triton X-100/0.05 M EDTA/0.1 M Tris (pH 8.0) buffer, rinsed in Tris buffer (pH 8.0), washed in 0.25% acetic anhydride/0.1 M triethanolamine hydrochloride-0.9% NaCl, rinsed in 2 x SSC, dehydrated through ethanol, delipidated in chloroform, rinsed in ethanol, and air-dried.

Slides were processed for LHRH using synthetic deoxynucleo-tides. Synthetic 48-nucleotide probes (5 pmol) complementary to LHRH (5-TTCAGTGTTTCTCTTTCCCCCAGGGCGCAACCCATAG-GACCAGTGCTG-3) were 3'-end labeled with [35S]dATP (SA, 1000–1500 Ci/mmol; DuPont/NEN) (4). One microgram of linearized PCRII plasmid containing a 423-bp cDNA fragment of the galanin precursor (a gift from Dr. L. Eiden) and plasmid BH500 (sequence specific for {alpha}-AP-2, P. Mitchell) were reverse transcribed; BH500 digested with BamHI using T7 polymerase produced AP-2 antisense cDNA, and digestion with HindIII using T3 polymerase produced the sense strand. The galanin and AP-2 cDNA incorporated 35S-labeled dUTP and dCTP to specific activities of 90,000 and 110,000 Ci/mmol, respectively, during RT. Slides were hybridized (500,000–1,000,000 cpm/slide) overnight in humid chambers at 37 C (oligo) and 55 C (riboprobe). The following day, slides hybridized with the oligo probe were rinsed in 1 x SSC/65 mM DTT, washed at high stringency in 2 x SSC/50% formamide/20 mM DTT at 40 C, and washed in 1 x SSC at room temperature. Posthybridization of the ribopobe was completed as previously described (43). All slides were then dehydrated in ethanol, dried, and placed against film. After x-ray film exposure for 5 days, slides were dipped in NTB3 (Eastman Kodak Co., Rochester, NY) and exposed for 3.5 weeks; emulsion-covered slides were developed in Dektol (Eastman Kodak Co.) at 15–17 C, rinsed in water, and fixed with Kodak fixer, then counterstained with 0.5% methyl green, dehydrated in ethanol, cleared in xylene, and mounted with Permount (Fisher Scientific, Pittsburgh, PA). Control slides hybridized with the sense strand gave only a background signal (data not shown). Quantitation and analysis of the optical density of the silver grains were completed as previously described (44).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
The sensitivity of performing a Southern blot on PCR-amplified cDNA from a single cell was tested. A mammalian single cell contains about 20 pg total RNA (45). Each sample, representing a single cell, had a specific number of neo mRNAs added to 20 pg total mouse brain RNA. The samples were reverse transcribed and PCR amplified, and Southern analysis was performed using a neo-specific probe. No signal was observed when no copies of neo mRNA were added (n = 6). The intensity of the neo cDNA product on the Southern blot decreased as the number of neo mRNA copies per sample decreased (data not shown). Using this assay, the maximum sensitivity was 5 mRNA copies/cell (using 5 copies of neo, 1 of 6 samples was positive for neo). Most importantly, the assay reliably detected 10–50 copies of mRNA/cell (using 10 and 50 copies/cell we detected neo in 7 of 9 samples and 10 of 10 samples, respectively).

Discovery of transcription factor AP-2{alpha} within LHRH cells was made during a cDNA subtraction screen performed on LHRH cells removed from embryonic nasal explants at 3.5 and 10.5 div. To confirm this finding, the cDNA from single cells removed from nasal explants was amplified (Fig. 1AGo) and hybridized with a LHRH and an AP-2 probe (Fig. 1Go, B and C). Four of seven cells (lanes 5, 6, 8, and 10) coexpressed LHRH and AP-2 mRNAs at 3.5 div. Five hundred- and 360-bp DNA fragments were detected on the Southern blot probed for LHRH (Fig. 1BGo). The 500-bp fragment corresponds to the pro-LHRH transcript (26). Production of the small 360-bp cDNA fragment was due to the attenuated RT reaction (see Materials and Methods). Unlike the 500-bp transcript of LHRH, AP-2 has a 1596-bp transcript that cannot be synthesized in its entirety by this procedure and a variety of band sizes (750, 500, 450, and 300 bp) were obtained (41). Positive (lanes 1, 3, and 4) and negative (lane 2) controls for LHRH indicate that the assay is highly specific for the gene being analyzed (Fig. 1Go).



View larger version (101K):
[in this window]
[in a new window]
  		Figure 1. Cells coexpressed LHRH and AP-2. Initially, mRNA coexpression was determined by Southern analysis of PCR-amplified cDNA from single cells. A, Ethidium bromide staining of a 360-bp BamHI-EcoRI fragment (1 ng) from the rat LHRH gene (lane 1) and PCR-amplified cDNA from a control that contained no cells (lane 2), NLT (lane 3), GT-1 (lane 4), and single bipolar cells maintained for 3.5 div in olfactory explants (lanes 5–11). Amplified product appears as a smear between 300 and 1000 bp in length, in agreement with previous reports (40 ). B and C, Southern blot using a LHRH (B) and an AP-2 (C) cDNA probe. Eight cells were LHRH positive (lanes 3–10; 500- and 360-bp bands). The blot was stripped and reprobed. Five AP-2-positive cells were found (lanes 5, 6, 8, 10, and 11; 750-, 500-, 450-, and 300-bp bands), and of these, four cells (lanes 5, 6, 8, and 10) coexpressed LHRH. The different bands sizes are expected due to a truncated RT reaction (see Materials and Methods). It should be noted that one NLT cell and one GT-1 cell were positive for AP-2 but negative for LHRH, highlighting the importance of stabilizing the mitotic state of such cell lines before use. D–G, Expression of AP-2 in LHRH cells in vivo. The location of LHRH cells is shown within the forebrain on E14.5. D, Schematic, (arrow); the box illustrates the region of the remaining panels. E, LHRH-immunopositive cells are present within the developing forebrain (for orientation, three positive cells have arrows). The middle arrow points to a cell in E that is shown in the inset (upper cell). In an adjacent section, cells positive for AP-2 mRNA were found in similar forebrain areas (darkfield, F; the arrows in E–G point to the same locations). Overlay of sections E and F indicates double labeled cells (G, open arrows), the center cell is enlarged in the inset (dotted region indicates LHRH staining on the section beneath silver grains). ob, Olfactory bulb; op, olfactory pit. Bar, 50 µm.

 
To verify AP-2{alpha} and LHRH coexpression in vivo, in situ hybridization was performed for AP-2 mRNA and immunohistochemistry for LHRH on alternate serial embryonic sections (Fig. 1Go, D–G). As previously reported (16), AP-2 mRNA was robustly expressed throughout nasal regions from E12.5–E15.5, but coexpression with LHRH neurons within this region was not detected (data not shown). However, on E14.5 in the developing diencephalon, the patterns of cells expressing LHRH protein and AP-2 mRNA were similar (Fig. 1Go, D–F). Overlay of serial sections showed coexpression of LHRH and AP-2 mRNA within single cells within the forebrain (Fig. 1GGo).

Examination of AP-2 protein in LHRH-immunopositive neurons was performed in vitro (Fig. 2Go) and in vivo (Fig. 3Go and 4Go). In vitro, AP-2 staining was detected in a subpopulation of LHRH cells that had migrated into the periphery of the nasal explant (Fig. 2CGo, arrowheads). AP-2 expression in LHRH neurons was not detected in LHRH neurons located on the main tissue mass, proximal to the olfactory pits. Double label immunocytochemistry indicated AP-2 expression in primary LHRH neurons located approximately 600–900 µm from the olfactory pit (n = 11 cultures). Note that approximately 1 mm is the distance LHRH neurons are required to migrate to enter the forebrain in a developing embryo. Other AP-2-positive cells were present, but were not LHRH positive (Fig. 2CGo, open arrowheads). These cells are likely to be mesenchymal cells (14). In vivo coexpression began once LHRH cells had migrated to the cribriform plate (Fig. 3Go). At all ages examined (E13.5, n = 4; E14.5, n = 3; E15.5, n = 3) AP-2-immunopositive LHRH neurons were not observed in nasal regions. The nasal forebrain junction (cribriform plate) was the first region along the LHRH migrational route wherer LHRH neurons expressed AP-2 (Fig. 3Go). On E13.5, an occasional LHRH neuron in this region was AP-2 positive, but most cells appeared AP-2 immunonegative (Fig. 3Go, A–C). Between E14.5–E15.5, many AP-2-positive LHRH neurons were detected at the nasal forebrain junction (Fig. 3Go, D–F), and AP-2-positive LHRH neurons were also detected in the forebrain (Fig. 4Go, A–F). However, AP-2 expression in LHRH neurons was transient. On PN 1 (n = 3), AP-2-immunopositive LHRH neurons were no longer detected (Fig. 4Go, H–J). The pattern of AP-2 expression in LHRH neurons in vitro and in vivo suggested a late migrational and/or temporal restriction on AP-2 expression in LHRH cells during development.



View larger version (65K):
[in this window]
[in a new window]
  		Figure 2. In vitro, neurons immunostaining for LHRH and the transcription factor AP-2 are located in the periphery of the explant. A, Diagramatic representation of a bilateral olfactory explant culture showing the locations of the two olfactory pits (OPE) and nasal midline cartilage (NMC) contained within the main tissue mass. The LHRH cells (arrow) migrate out of the olfactory pits to the NMC, turn, migrate along the NMC, and then move directionally off of the main tissue. B, After 7 div, LHRH cells have migrated from the OPE into the periphery of the explant (the location of B is indicated by the box in A). LHRH-immunopositive cells (brown) migrate along fibers away from the olfactory pit (the box in B is enlarged in C). Some LHRH neurons have AP-2 nuclear staining (blue-black, solid arrowheads). Some cells stained only for LHRH (arrows) or the transcription factor AP-2 (blue-black, open arrowheads). The culture was counterstained with methyl green. Bar, 100 µm in B and 20 µm in C.

 
To evaluate the role of AP-2{alpha} in development of the LHRH system, LHRH neurons were examined in AP-2{alpha} mutants. LHRH expression dramatically decreased within the forebrain between E13.5 (n = 4) and E14.5 (n = 3) in mutant animals compared with their wild-type littermates. In situ hybridization indicated a reduction in forebrain LHRH mRNA signal on E14.5 in mutant embryos (Fig. 5Go). Analysis of the optical density of the hybridization signal (related to mRNA levels) indicated a significant decrease (P < 0.05) in the relative LHRH mRNA per cell in the forebrain between E13.5 and E14.5 (E13.5 wild type, 98,822 ± 5,071 OD µm2/cell; mutant, 130,740 ± 27,723 OD µm2/cell; E14.5 wild type, 117,084 ± 10,978 OD µm2/cell; mutant, 32,156 ± 12,379 OD µm2/cell; n = 2 wild type; n = 3 mutants). In contrast to the decrease in LHRH mRNA observed in neurons within the forebrain of mutant animals, comparison of mutant and wild-type E13.5 and E14.5 embryos indicated that the LHRH mRNA signal remained unchanged in LHRH cells within nasal regions (P = 0.82; E13.5 wild type, 87,890 ± 4,052 OD µm2/cell; mutant, 76,640 ± 13,410 OD µm2/cell; E14.5 wild type, 70,390 ± 2,792 OD µm2/cell; mutant, 73,760 ± 18,990 OD µm2/cell; n = 2 wild type; n = 3 mutants). A decrease in the level of LHRH peptide staining and the number of immunopositive LHRH neurons within the forebrain was also observed in E14.5 (n = 3) and E15.5 (n = 4) mutant animals compared with wild-type animals (Fig. 6Go). A significant decrease (P < 0.05) in the number of cells staining for LHRH was observed between mutant E13.5 (n = 4) vs. mutant E14.5 and E15.5 embryos. Furthermore, a significant decrease (P < 0.01) was found in the number of LHRH cells present in the forebrain of mutant E14.5 and E15.5 embryos compared with wild-type embryos (Fig. 6Go, histogram).



View larger version (97K):
[in this window]
[in a new window]
  		Figure 5. In situ hybridization indicated a decrease in LHRH mRNA in cells present within the forebrain of mice lacking AP-2 on E14.5. The intensity of the LHRH signal was similar in the forebrain of E13.5 wild-type (A) and AP-2 mutant (B) embryos. On E14.5, the LHRH signal in the forebrain decreased dramatically [compare wild-type (C) to AP-2 mutant (D)]. The box region in the forebrain (A) indicates the area where LHRH cells are detected. The dashed line indicates the ventral aspect of the brain. Bar, 0.5 mm in A, and 50 µm in B–D; B and D are the same magnification. The insets in A and B–D are darkfield images. Fb, Forebrain.

 


View larger version (106K):
[in this window]
[in a new window]
  		Figure 6. The number of LHRH-immunopositive cells decreased in the forebrain of E14.5 AP-2 mutant embryos. The robustness of LHRH staining and the number of LHRH-positive cells were similar in E13.5 wild-type (A) and mutant (B) embryos (the inset in both panels show an enlarged view of LHRH cells). On E14.5, detection of LHRH cells in the forebrain of mutant animals decreased noticeably [compare wild-type embryo (C) to the AP-2 mutant (D); the inset is an enlarged image of a LHRH cell]. The histogram indicates the mean cell number of LHRH cells in the forebrain (±SEM) at three embryonic ages. *, Significant difference (P < 0.05) in the number of cells detected in the mutant E13.5 vs. mutant E14.5 and E15.5 embryos. **, Significant differences (P < 0.01) between wild-type and mutant animals on E14.5 and E15.5. The box region in the forebrain (A) is the area where LHRH neurons are detected. Bar, 0.5 mm in A and 50 µm in B–D. E13.5, n = 4; E14.5, n = 3; E15.5, n = 3.

 
The decrease in the number of LHRH neurons could have been due to apoptosis or necrosis. Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling analysis of AP-2 mutant embryos (n = 3) did not indicate a higher level of apoptotic cell death within the forebrain; furthermore, apoptotic cells were not associated with LHRH neurons present in the forebrain (data not shown). In mice, the only marker consistently found to be expressed in LHRH neurons during development is galanin, with most LHRH cells expressing galanin mRNA in nasal regions but galanin mRNA expression falling below detectable levels as LHRH neurons enter the CNS (46 and see Fig. 7Go, A and B). We examined galanin expression in LHRH neurons of mutant mice to determine whether longer exposure times and/or altered galanin expression levels would allow galanin mRNA to be used as a marker to determine whether LHRH cells were still present within the forebrain of E14.5 mice after LHRH mRNA and/or peptide fell below detectable levels. In contrast to the decrease in galanin mRNA observed in wild-type embryos as LHRH cells entered the brain (46), galanin mRNA remained high in presumptive LHRH cells within the forebrain of mutant embryos (Fig. 7Go, compare C to D, E to F, and G to H). Galanin mRNA was detected in the area that contained LHRH-positive cells in three different E13.5 mutant embryos. Galanin expression was maintained in the olfactory pit and forebrain of E13.5 and E14.5 (n = 3) mutant embryos (Fig. 7Go, F and H, respectively; arrowheads) as LHRH expression decreased in the forebrain (Figs. 5Go and 6Go).



View larger version (85K):
[in this window]
[in a new window]
  		Figure 7. Galanin mRNA expression in the region of LHRH neurons continued in the E14.5 mutant forebrain. Consistent with previous results (46 ), in wild-type embryos galanin mRNA is expressed in LHRH neurons in nasal regions (arrowheads, A and B), but decreases below detectable levels as LHRH neurons enter the CNS (arrows, A and B). In A and B, and E and F, galanin silver grains have been col-orized blue and overlaid on an adjacent section hybridized with a LHRH probe. The LHRH hybridization signal was colorized red. In this format, double labeled cells appear magenta. It should be noted that 16-µm adjacent sections were used, thereby limiting the number of cells that would be detectable as double labeled. Instead, intermixed labeling patterns are observed, indicating similar spatial and temporal expression patterns. C and D, Low magnification, darkfield photomicrographs of galanin mRNA expression in E13.5 wild-type (C) and mutant (D) mice. Galanin mRNA is present in extra-CNS structures in both genotypes, including the dorsal root ganglia (arrows). Boxed regions are enlarged in E and F and colorized as described above. In wild-type mice, a galanin signal was detected in the olfactory pit (arrowhead, C and E), and a LHRH signal was detected in the olfactory pit (not shown in this section), nasal tracts, and forebrain (arrows, E). Double labeled cells were present in the olfactory pit (data not shown). In mutant mice, double labeled cells were found in both the olfactory pit and forebrain (magenta, arrowheads). G, Darkfield image of an E14.5 wild-type mouse indicates little or no galanin signal in the forebrain, but a strong signal in a glandular region in the nose (arrow). In contrast, a galanin signal was detected in the olfactory pit and forebrain of an E14.5 mutant mouse (H, arrowheads). Fb, Forebrain; nc, nasal cavity; op, olfactory pit. The dotted line indicates the border between the forebrain and the nasal regions (A, B, E, and F). Bar, 50 µm in A and B, 1 mm in C and D, 100 µm in E and F, and 300 µm in G and H.

 
AP-2 mutants show dramatic morphological changes in forebrain structures during prenatal development. Thus, to ensure that loss of LHRH expression was not a general phenomenon due to overall brain malformation, four other neuronal phenotypes were examined in mutant animals on E14.5 (n = 2) and E15.5 (n = 3). Staining for tyrosine hydroxylase showed similar immunopositive cell groups in the brains of mutant and wild-type animals. On E14.5 three cell groups were clearly evident in both genotypes: in the dorsocaudal telencephalon, at the midbrain flexure, and within the ventral aspect of the brain stem (data not shown). Somatostatin-immunopositive cells were detected in the pons and brainstem (data not shown) and the ventral hypothalamic/presumptive arcuate nucleus (Fig. 8Go, A and B) on E14.5 and E15.5 in both mutant and wild-type mice. In both mutant and wild-type embyros, staining for the neurophysin-containing magnocellular neurosecretory system gave a robust signal in the median eminence (Fig. 8Go, C and D), and cells were detected in nuclear structures corresponding to the presumptive supraoptic and paraventricular nucleus (Fig. 8Go, E and F). Numerous substance P-positive cell groups (data not shown) were detected in the telencephalon (presumptive striatum), mesencephalon, and brainstem (presumptive solitary tract nucleus). Faintly labeled cells were present in the hypothalamus (presumptive medial/ventrolateral nuclei). The presence of these other neuronal phenotypes indicates that the loss of forebrain LHRH cells was not a general disruption of brain morphology and/or cell type.



View larger version (150K):
[in this window]
[in a new window]
  		Figure 8. Other hypothalamic cell types and LHRH-positive tectal cells are present in the brain of AP-2 mutants. Schematic of an E14.5 wild-type embryo head (upper left corner) shows the locations of A–J. Somatostatin-positive fibers and cells were present in the ventral hypothalamus/arcuate nucleus anlagen (vh/arc; A and B). Neurophysin-positive fibers were detected in the median eminence (me; C and D, E14.5 embryo), and neurophysin-containing magnocellular neurosecretory cells were localized in the presumptive paraventricular nucleus (PVN; E and F, E15.5 embryo). The insets in E and F are enlarged images of neurophysin-immunopositive cells in respective panels. In A–F, wild-type animals are on the left, and AP-2 mutant animals are on the right. LHRH-expressing cells (arrows) were observed in the tectum of E14.5 (G and H) and E15.5 (I and J) wild-type (G and I) and mutant embryos (H and J). The insets are enlarged images of LHRH-immunopositive cells in I and J and are indicated by the left arrow in each panel. ppit, Posterior pituitary; III, third ventricle. Bar, 100 µm in A, B, E, and F; 200 µm in C and D; and 50 µm in G and H.

 
Further evidence for the specificity of the observed loss of LHRH protein in LHRH neuroendocrine cells was obtained by examining the expression of a fifth cell type. Cells expressing LHRH have been observed in the tectum of the developing mouse cortex on E13.75, reaching a peak in number on E15.75, and thereafter declining (47). Analysis of this transient tectal LHRH cell population in AP-2 mutant embryos and wild-type littermates indicated that this cell population was maintained (Fig. 8Go, G–J), in contrast to LHRH cells in the forebrain (Fig. 6Go, histogram). On E15.5, all three AP-2 mutant animals had a comparable number of LHRH cells as positive wild-type littermates (compare Fig. 8Go, I and J). In three wild-type E15.5 animals, AP-2 expression was not observed in the LHRH-expressing cells within the tectum (data not shown).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The transcription factor AP-2 was discovered in LHRH cells by subtractive hybridization analysis of cDNAs from primary cells at different maturational states. To ensure that the presence of this transcription factor in LHRH cells was not the result of in vitro conditions, subsequent studies were performed in vivo and in vitro. In vivo, AP-2 protein was colocalized in LHRH neurons as they crossed the nasal/forebrain junction (crossing the cribriform plate) on E13.5–E15.5 and was expressed in forebrain LHRH neurons on E14.5–15.5. By PN1, AP-2 expression in LHRH neurons was no longer detectable. Examination of AP-2 mutants indicated that LHRH expression and transcript levels were similar in wild-type and mutant E13.5 embryos, but a significant decrease in LHRH was found in the forebrain of mice lacking AP-2 beginning on E14.5 and continuing through E15.5. The decrease in LHRH expression was not due to the cells dying, as shown by no difference in apoptotic/necrotic cells in this region between genotypes. Furthermore, the continued presence of forebrain LHRH cells is proposed based on a second marker for LHRH neurons, galanin. The decrease in LHRH expression was specific for LHRH cells in the forebrain (that express AP-2) and was not observed in the transient population of LHRH cells in the tectum (that do not express AP-2). In addition, other neuronal phenotypes, tryosine hydrox- ylase-producing neurons, substance P neurons, hypothalamic vasopressin and oxytocin neurons, and somatostatin neurons were still detectable when LHRH expression was absent. The correlation of onset and location of AP-2 expression in LHRH neurons in normal mice, with the dramatic reduction of LHRH at this same age in the forebrain of mice lacking AP-2, is consistent with AP-2 maintaining CNS LHRH expression as this neuroendocrine system attains an adult-like distribution.

AP-2 expression in LHRH neurons coincides with GABAergic input
Analysis of AP-2 mRNA and protein in vivo pointed to AP-2 and LHRH colocalization once the LHRH neurons had migrated into the nasal-forebrain junction and forebrain. As forebrain is not present in nasal explant cultures, either AP-2 expression in LHRH neurons is intrinsically controlled (time-based onset) or cues activating AP-2 expression are present in the nasal explants. An intrinsic activational mechanism for AP-2 expression is feasible, but extrinsic cues are present in vitro and in vivo that correlate with AP-2 expression. Cell counts on double labeled immunocytochemically stained explants showed heterogeneous AP-2 expression in LHRH neurons. These results were consistent with heterogeneous AP-2 mRNA expression observed in LHRH neurons in vivo. In one 7-day-old explant, 15 of 57 LHRH neurons displayed AP-2 immunoreactivity, but in another 7 cultures, between 1–10% of the LHRH neurons were double labeled for AP-2. Although heterogeneous coexpression was observed in vitro, the AP-2/LHRH population consistently was located 600–900 µm from the olfactory pit. This distance in vitro is similar to the distance that LHRH neurons migrate from the olfactory pit to the nasal-forebrain junction in vivo (~1 mm).

In embryos, a transient population of GABAergic neurons is present in the olfactory pit (48). Axons from these GABAergic olfactory cells terminate at the cribriform plate (~1 mm from the olfactory pit), the location where LHRH neurons migrate from the nasal region into the forebrain. Expression of this GABAergic population correlates with LHRH neuronal migration out of nasal regions (48, 49). In nasal explants, a similar GABAergic olfactory population has been documented (48). Although these GABAergic cells remain close to the main explant, GABAergic axons, on the average, extend 500–600 µm into the periphery of the explant. However, studies on GABAergic input on developing LHRH neurons found that muscimol inhibited LHRH neuronal migration in general, but tetrodotoxin only altered the migration of cells that had migrated 600–800 µm into the periphery (50). Thus developmentally, in vivo and in vitro, the onset of AP-2 expression in LHRH neurons precisely coincides with LHRH neurons entering the region of GABAergic input. The signals transduced that may lead to AP-2 expression are currently unknown.

Forebrain LHRH neurons in AP-2 mutant
In the majority of AP-2 mutant animals, LHRH transcript and protein levels fell below detectable limits within the span of 24 h (E13.5 and E14.5). Certainly one explanation for these results was that LHRH cells were dying, apoptotic, or necrotic. Terminal deoxynucleotidyl transferase-mediated dUTP nick end staining was inconsistent with apoptotic cell death, and histological staining showed no overt signs of cellular necrosis in this region. Thus, to assess what was happening to the LHRH cells in the forebrain of AP-2 mutants, additional neuronal markers were examined.

Galanin expression is prolonged in AP-2 mutants.We examined a second marker for LHRH neurons, galanin. Galanin mRNA is localized in LHRH neurons in the nasal regions of developing mice, but was shown to decrease in LHRH neurons as they migrated into the brain (46). We decided to examine whether, via hotter riboprobes/longer exposure times, and/or altered expression levels, galanin mRNA could be used to track LHRH neurons in the forebrain of wild-type and/or mutant mice. As in wild-type animals, galanin mRNA was localized in LHRH cells in nasal regions of mutant animals. Technical changes did not enhance the detection of galanin mRNA in forebrain LHRH neurons in wild-type mice. However in mutant animals, galanin mRNA was detected in adjacent forebrain regions, areas of presumptive LHRH neurons. Thus, in contrast to wild-type embryos (46), galanin mRNA was robustly detected in cells entering the forebrain of AP-2 mutants. After the dramatic decrease in LHRH transcript and protein levels in the forebrain, galanin mRNA levels remained relatively high. Thus, galanin mRNA, used as an alternative marker for LHRH neurons, was present in the forebrain (specifically in the region of the LHRH neurons) in AP-2 mutant animals. Although with the techniques used in this study we cannot be assured that the entire population of galanin-expressing cells observed in the forebrain expressed LHRH, the spatial and temporal appearance of galanin mRNA coincided with the expected LHRH neuronal distribution. This result suggests that LHRH neurons are present within the forebrain (note that the number of LHRH cells in the forebrain of AP-2 mutants could not be determined) and that rapid down-regulation of LHRH transcription and/or changes in posttranscriptional processing occur in the absence of AP-2. Studies of postnatal LHRH neurons indicate that LHRH mRNA has a very short half-life (51). Perhaps in the absence of AP-2, LHRH mRNA in prenatal LHRH neurons undergoes a similar rapid turnover, and compensatory transcriptional activity is absent. The maintained expression of galanin mRNA in mutants compared with wild-type animals also raises the possibility that AP-2 regulates galanin expression through the AP-2 consensus element in the galanin promoter (35).

Presence of other neuronal phenotypes.The brains of AP-2 mutants were examined for four other neuronal phenotypes known to be present in the developing mouse by E14.5–E15.5. These cells types included tyrosine hydroxylase cell groups (52), substance P cell groups (53), neurophysin hypothalamic cells (54), and somatostatin hypothalamic cells (55). Although the forebrains of AP-2 mutants showed many morphological anomalies, staining for all four phenotypes revealed immunopositive cells in areas corresponding to those observed in wild-type animals and previously reported. Although the absolute cell numbers could not be determined, the presence of these markers indicates that the general pleiotropic effects of the AP-2 mutation does not occur in most other hypothalamic cells through E15.5 and that the effect on the LHRH neuroendocrine cells in the hypothalamus is a specific event.

Tectal LHRH expression is not regulated by AP-2.Transient LHRH cells are detected in the tectum of the developing mouse cortex beginning on E13.75 and reach a peak in number on E15.75 (47). In contrast to neuroendocrine LHRH cells in the forebrain, tectal LHRH cells have an unknown function and most likely a different ontogeny. This tectal cell group was examined to determine the specificity of the observed effect. Maintenance of the tectal LHRH cell population occurred in the AP-2 mutant embryos in contrast to the neuroendocrine LHRH cells in the forebrain. Furthermore, in wild-type animals, LHRH cells within the tectum did not express AP-2. Thus, there is a strict correlation between LHRH/AP-2 coexpression and the dramatic decrease in LHRH expression observed in mutants. These results suggest specificity for AP-2 regulation on the forebrain LHRH cell population.

AP-2 regulation in LHRH neurons
Once activated, how does AP-2 influence LHRH expression? Although we cannot rule out that the lack of AP-2 alters an afferent input to LHRH neurons, which then causes the decrease in LHRH expression observed, the expression of AP-2 in LHRH neurons as they enter the brain strongly suggests an event(s) occurring within the LHRH cell. Thus, the results observed in this study are consistent with AP-2 directly altering LHRH gene expression or acting indirectly via an intermediate gene product.

A perfect AP-2 consensus element (GCCNNNGGC) is not located in the LHRH promoter (our personal observation). Thus, a direct role for AP-2 as a DNA-binding protein on the 5'-region of the LHRH gene has yet to be determined. However, AP-2 consensus elements are located in the promoter of the ß3-subunit of the GABAA receptor (29) that is present in LHRH neurons (56) and in the GT1 immortalized LHRH cell line (57). GABA is a key regulator of LHRH mRNA levels in both the embryo and the adult (58, 59, 60, 61, 62, 63). Therefore, AP-2, which normally acts as an enhancer, may act on the ß3-subunit of the GABAA receptor to maintain LHRH transcription. Further work is required to understand the mechanism by which posttranscriptional or transcriptional regulation of LHRH mRNA levels may occur through a GABAA receptor-specific mechanism.

Depletion of LHRH in animals without AP-2.In animals lacking AP-2, LHRH peptide levels decreased after a reduction in the LHRH transcript. Intrinsic pulsatile release of LHRH in developing LHRH cells (64) could deplete LHRH peptide stores. In the absence of the putative enhancer AP-2, basal transcription of the ß3-subunit of the GABAA may maintain LHRH neuronal responsiveness to depolarization by GABA in the forebrain, leading to LHRH release (8, 65, 66). Without concomitant production or processing of the primary LHRH transcript, LHRH peptide would be depleted. However, these would not explain the rapid decrease in LHRH from peptidergic stores. Therefore, alternatively (but not exclusively), peptide storage and degradative processes in prenatal LHRH neurons may be different from those observed postnatally or may be a direct consequence of the AP-2 mutation.

Altered posttranslational processing of LHRH in AP-2 mutants.A multistep process is required to produce the LHRH peptide (for review, see Ref. 38). Thus, regulation of the LHRH posttranslational processing enzymes by AP-2 could lead to a decrease in LHRH peptide levels. However, this does not appear to be the case, as the polyclonal antibody used in these studies (SW-1) detects the preprohormone, so the unprocessed protein plus any variants were detected. As detection of LHRH was independent of posttranslational processing, the loss of LHRH observed in the mutants suggests that the absence of AP-2 protein alters LHRH expression at the level of transcription or posttranscription and the release and/or degradation of LHRH.

AP-2 localization suggests alterations in posttranslational processing
In vivo AP-2 and LHRH mRNAs were colocalized in cells in the forebrain. Colocalization did not occur in LHRH neurons within nasal regions, although this was difficult to determine due to the high level of AP-2 mRNA expression in nasal mesenchymal cells (10, 16). At all ages examined (E12.5–E15.5), AP-2 immunostaining was not observed in LHRH neurons in the olfactory pit or migrating along olfactory axons across the nasal septum. However, on E13.5, immunopositive AP-2/LHRH neurons were initially detected at the nasal/forebrain junction. The AP-2 staining in these LHRH cells consisted of cytoplasmic staining as well as nuclear staining. As LHRH cells crossed the nasal/forebrain junction and entered the forebrain, AP-2 nuclear staining predominated. In all other areas examined, AP-2 immunostaining was restricted to the nucleus, and Western blots using this antibody indicated specificity for the {alpha} form of the AP-2 protein (Mitchell, P., personal communication). Nuclear and cytoplasmic localization of AP-2 in LHRH neurons may be the result of posttranscriptional processing of the AP-2 mRNA transcript, which has been found to lead to changes in localization as well as function (16, 67). Alternatively, the apparent shuttling of AP-2 from the cytoplasm to the nucleus may be the result of posttranslational changes that alter protein sequestering to specific compartments. Such changes have been shown to be a common mechanism by which transcription factor activity is modulated (68, 69).

AP-2 in development
A mechanistic linkage in AP-2-dependent systems is the commonality of inductive tissue interactions (14, 15, 18, 19, 70), usually associated with an epithelial-mesenchymal transition. Although not an epithelial-mesenchymal transition, it is worth noting that AP-2 expression in LHRH neurons first occurred as LHRH neurons underwent a major tissue transition and crossed the nasal forebrain junction. The changes that LHRH neurons undergo at this transitional point are just beginning to be investigated. Evidence suggests that LHRH neurons pause at this junction before migration into the brain (50, 71). Thus, at this transition point, LHRH neurons may mature/differentiate with respect to properties required for appropriate function in the CNS (50). Alternatively (but not exclusively), LHRH neurons may alter/acquire pathfinding molecules necessary to establish their appropriate CNS distribution. Interestingly, the AP-2 protein has been implicated in the transcriptional regulation of cell adhesion molecules and matrix metalloproteinases, which may coordinate cell/cell communication and cell movement (72, 73, 74, 75). It is thus possible that in the absence of AP-2, LHRH neurons do not reach their appropriate locations and/or are not capable of responding to appropriate CNS stimuli and, as such, cease LHRH expression.

Summary
In this report we documented the onset of AP-2 expression in LHRH neurons as they migrated into the forebrain. To determine the role of AP-2 expression in LHRH neurons, we examined the development of this neuroendocrine system in AP-2 mutant animals. In AP-2 mutants a dramatic reduction in the number of forebrain LHRH-expressing cells occurred at these same developmental ages. A second marker (galanin) provides evidence that LHRH cells were still present within the forebrain, but that LHRH expression decreased at the transcriptional level. Furthermore, cells in the tectum did not express or require AP-2 to maintain LHRH expression. These results indicate a developmentally restricted involvement of the transcription factor AP-2 in LHRH expression that is specific for neuroendocrine LHRH cells and activated once the LHRH neurons have migrated into the forebrain, but before establishment of an adult-like distribution.


   Acknowledgments
 
We thank Sharon Key, Trevor Williams, and Jim Nagle.

Received July 9, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Seeburg PH, Mason AJ, Stewart TA, Nikolics K 1987 The mammalian GnRH gene and its pivotal role in reproduction. Recent Prog Horm Res 43:69–98
  2. Schwanzel-Fukuda M 1999 Origin and migration of luteinizing hormone-releasing hormone neurons in mammals. Microsc Res Technol 44:2–10[CrossRef][Medline]
  3. Tobet SA, Sower SA, Schwarting GA 1997 Gonadotropin-releasing hormone containing neurons and olfactory fibers during development: from lamprey to mammals. Brain Res Bull 44:479–486[CrossRef][Medline]
  4. Wray S, Grant P, Gainer H 1989 Evidence that cells expressing luteinizing hormone-releasing hormone mRNA in the mouse are derived from progenitor cells in the olfactory placode. Proc Natl Acad Sci USA 86:8132–8136[Abstract/Free Full Text]
  5. Wray S, Nieburgs A, Elkabes S 1989 Spatiotemporal cell expression of luteinizing hormone-releasing hormone in the prenatal mouse: evidence for an embryonic origin in the olfactory placode. Brain Res Dev Brain Res 46:309–318[Medline]
  6. Fueshko S, Wray S 1994 LHRH cells migrate on peripherin fibers in embryonic olfactory explant cultures: an in vitro model for neurophilic neuronal migration. Dev Biol 166:331–348[CrossRef][Medline]
  7. Kusano K, Fueshko S, Gainer H, Wray S 1995 Electrical and synaptic properties of embryonic luteinizing hormone-releasing hormone neurons in explant cultures. Proc Natl Acad Sci USA 92:3918–3922[Abstract/Free Full Text]
  8. Terasawa E, Quanbeck CD, Schulz CA, Burich AJ, Luchansky LL, Claude P 1993 A primary cell culture system of luteinizing hormone releasing hormone neurons derived from embryonic olfactory placode in the rhesus monkey. Endocrinology 133:2379–2390[Abstract]
  9. Ohtaka-Maruyama C, Hanaoka F, Chepelinsky AB 1998 A novel alternative spliced variant of the transcription factor AP2{alpha} is expressed in the murine ocular lens. Dev Biol 202:125–135[CrossRef][Medline]
  10. Meier P, Koedood M, Philipp J, Fontana A, Mitchell PJ 1995 Alternative mRNAs encode multiple isoforms of transcription factor AP-2 during murine embryogenesis. Dev Biol 169:1–14[CrossRef][Medline]
  11. Moser M, Imhof A, Pscherer A, Bauer R, Amselgruber W, Sinowatz F, Hofstadter F, Schule R, Buettner R 1995 Cloning and characterization of a second AP-2 transcription factor: AP-2ß. Development 121:2779–2788[Abstract]
  12. Mitchell PJ, Wang C, Tjian R 1987 Positive and negative regulation of transcription in vitro: enhancer-binding protein AP-2 is inhibited by SV40 T antigen. Cell 50:847–861[CrossRef][Medline]
  13. Chazaud C, Oulad-Abdelghani M, Bouillet P, Decimo D, Chambon P, Dolle P 1996 AP-2.2, a novel gene related to AP-2, is expressed in the forebrain, limbs and face during mouse embryogenesis. Mech Dev 54:83–94[CrossRef][Medline]
  14. Mitchell PJ, Timmons PM, Hebert JM, Rigby PW, Tjian R 1991 Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis. Genes Dev 5:105–119[Abstract/Free Full Text]
  15. Shen H, Wilke T, Ashique AM, Narvey M, Zerucha T, Savino E, Williams T, Richman JM 1997 Chicken transcription factor AP-2: cloning, expression and its role in outgrowth of facial prominences and limb buds. Dev Biol 188:248–266[CrossRef][Medline]
  16. Moser M, Ruschoff J, Buettner R 1997 Comparative analysis of AP-2{alpha} and AP-2ß gene expression during murine embryogenesis. Dev Dyn 208:115–124[CrossRef][Medline]
  17. Imagawa M, Chiu R, Karin M 1987 Transcription factor AP-2 mediates induction by two different signal-transduction pathways: protein kinase C and cAMP. Cell 51:251–260[CrossRef][Medline]
  18. Zhang J, Hagopian-Donaldson S, Serbedzija G, Elsemore J, Plehn-Dujowich D, McMahon AP, Flavell RA, Williams T 1996 Neural tube, skeletal and body wall defects in mice lacking transcription factor AP-2. Nature 381:238–241[CrossRef][Medline]
  19. Schorle H, Meier P, Buchert M, Jaenisch R, Mitchell PJ 1996 Transcription factor AP-2 essential for cranial closure and craniofacial development. Nature. 381:235–238
  20. Mitchell PJ, Timmons PM, Hebert JM, Rigby PW, Tjian R 1991 Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis. Genes Dev 5:105–119
  21. Gaubatz S, Imhof A, Dosch R, Werner O, Mitchell P, Buettner R, Eilers M 1995 Transcriptional activation by Myc is under negative control by the transcription factor AP-2. EMBO J 14:1508–1519[Medline]
  22. Zeng YX, Somasundaram K, el-Deiry WS 1997 AP2 inhibits cancer cell growth and activates p21WAF1/CIP1 expression. Nat Genet 15:78–82[CrossRef][Medline]
  23. Medcalf RL, Ruegg M, Schleuning WD 1990 A DNA motif related to the cAMP-responsive element and an exon-located activator protein-2 binding site in the human tissue-type plasminogen activator gene promoter cooperate in basal expression and convey activation by phorbol ester and cAMP. J Biol Chem 265:14618–14626[Abstract/Free Full Text]
  24. Greco D, Zellmer E, Zhang Z, Lewis E 1995 Transcription factor AP-2 regulates expression of the dopamine ß-hydroxylase gene. J Neurochem 65:510–516[Medline]
  25. Johnson W, Albanese C, Handwerger S, Williams T, Pestell RG, Jameson JL 1997 Regulation of the human chorionic gonadotropin {alpha}- and ß-subunit promoters by AP-2. J Biol Chem 272:15405–15412[Abstract/Free Full Text]
  26. Mellon PL, Windle JJ, Goldsmith PC, Padula CA, Roberts JL, Weiner RI 1990 Immortalization of hypothalamic GnRH neurons by genetically targeted tumorigenesis. Neuron 5:1–10[CrossRef][Medline]
  27. Zhen S, Dunn IC, Wray S, Liu Y, Chappell PE, Levine JE, Radovick S 1997 An alternative gonadotropin-releasing hormone (GnRH) RNA splicing product found in cultured GnRH neurons and mouse hypothalamus. J Biol Chem 272:12620–12625[Abstract/Free Full Text]
  28. Tsai-Morris CH, Geng Y, Xie XZ, Buczko E, Dufau ML 1994 Transcriptional protein binding domains governing basal expression of the rat luteinizing hormone receptor gene. J Biol Chem 269:15868–15875[Abstract/Free Full Text]
  29. Kirkness EF, Fraser CM 1993 A strong promoter element is located between alternative exons of a gene encoding the human {gamma}-aminobutyric acid-type A receptor beta 3 subunit (GABRB3). J Biol Chem 268:4420–4428[Abstract/Free Full Text]
  30. Ball HJ, Shine J, Herzog H 1995 Multiple promoters regulate tissue-specific expression of the human NPY-Y1 receptor gene. J Biol Chem 270:27272–27276[Abstract/Free Full Text]
  31. Baskin F, Li YP, Hersh LB, Davis RM, Rosenberg RN 1997 An AP-2 binding sequence within exon 1 of human and porcine choline acetyltransferase genes enhances transcription in neural cells. Neuroscience 76:821–827[CrossRef][Medline]
  32. Andersson G, Pahlman S, Parrow V, Johansson I, Hammerling U 1994 Activation of the human NPY gene during neuroblastoma cell differentiation: induced transcriptional activities of AP-1 and AP-2. Cell Growth Differ 5:27–36[Abstract]
  33. Hyman SE, Comb M, Pearlberg J, Goodman HM 1989 An AP-2 element acts synergistically with the cyclic AMP- and phorbol ester-inducible enhancer of the human proenkephalin gene. Mol Cell Biol 9:321–324[Abstract/Free Full Text]
  34. Donaldson LF, McQueen DS, Seckl JR 1995 Induction of transcription factor AP2 mRNA expression in rat primary afferent neurons during acute inflammation. Neurosci Lett 196:181–184[CrossRef][Medline]
  35. Rokaeus A, Waschek JA 1994 Primary sequence and functional analysis of the bovine galanin gene promoter in human neuroblastoma cells. DNA Cell Biol 13:845–855[Medline]
  36. Hohmann JG, Clifton DK, Steiner RA 1998 Galanin: analysis of its coexpression in gonadotropin-releasing hormone and growth hormone-releasing hormone neurons. Ann NY Acad Sci 863:221–35:221–235[Abstract/Free Full Text]
  37. Leupen SM, Besecke LM, Levine JE 1997 Neuropeptide Y Y1-receptor stimulation is required for physiological amplification of preovulatory luteinizing hormone surges. Endocrinology 138:2735–2739[Abstract/Free Full Text]
  38. Wetsel WC 1995 Immortalized hypothalamic luteinizing hormone-releasing hormone (LHRH) neurons: a new tool for dissecting the molecular and cellular basis of LHRH physiology. Cell Mol Neurobiol 15:43–78[CrossRef][Medline]
  39. Radovick S, Wray S, Lee E, Nicols DK, Nakayama Y, Weintraub BD, Westphal H, Cutler GB, Jr, Wondisford FE 1991 Migratory arrest of gonadotropin-releasing hormone neurons in transgenic mice. Proc Natl Acad Sci USA 88:3402–3406[Abstract/Free Full Text]
  40. Dulac C, Axel R 1995 A novel family of genes encoding putative pheromone receptors in mammals. Cell 83:195–206[CrossRef][Medline]
  41. Brady G, Barbara M, Iscove N 1990 Representative in vitro cDNA amplification from individual hemopoietic cells and colonies. Methods Mol Cell Biol 2:17–25
  42. Wray S, Gahwiler BH, Gainer H 1988 Slice cultures of LHRH neurons in the presence and absence of brainstem and pituitary. Peptides 9:1151–1175[CrossRef][Medline]
  43. Battey J, Wada E, Wray S 1994 Bombesin receptor gene expression during mammalian development. Ann NY Acad Sci 739:244–252[Abstract]
  44. Maurer JA, Wray S 1997 Neuronal dopamine subpopulations maintained in hypothalamic slice explant cultures exhibit distinct tyrosine hydroxylase mRNA turnover rates. J Neurosci 17:4552–4561[Abstract/Free Full Text]
  45. Davis LG, Kuehl WM, Battey J 1994 Preparation and analysis of RNA from eukaryotic cells. In: Greenfield S, Wonsiewicz M (eds) Basic Methods in Molecular Biology. Appleton and Lange, East Norwalk, pp 320–321
  46. Key S, Wray S Two olfactory placode derived galanin subpopulations: luteinizing hormone releasing hormone (LHRH) neurons and vomeronasal cells. J Neuroendocrinol, in press
  47. Wu TJ, Gibson MJ, Silverman AJ 1995 Gonadotropin-releasing hormone (GnRH) neurons of the developing tectum of the mouse. J Neuroendocrinol 7:899–902[CrossRef][Medline]
  48. Wray S, Fueshko SM, Kusano K, Gainer H 1996 GABAergic neurons in the embryonic olfactory pit/vomeronasal organ: maintenance of functional GABAergic synapses in olfactory explants. Dev Biol 180:631–645[CrossRef][Medline]
  49. Tobet SA, Chickering TW, King JC, Stopa EG, Kim K, Kuo-Leblank V, Schwarting GA 1996 Expression of gamma-aminobutyric acid and gonadotropin-releasing hormone during neuronal migration through the olfactory system. Endocrinology 137:5415–5420[Abstract]
  50. Fueshko SM, Key S, Wray S 1998 GABA inhibits migration of luteinizing hormone-releasing hormone neurons in embryonic olfactory explants. J Neurosci 18:2560–2569[Abstract/Free Full Text]
  51. Maurer JA, Wray S 1997 Luteinizing hormone-releasing hormone (LHRH) neurons maintained in hypothalamic slice explant cultures exhibit a rapid LHRH mRNA turnover rate. J Neurosci 17:9481–9491[Abstract/Free Full Text]
  52. Specht LA, Pickel VM, Joh TH, Reis DJ 1981 Light-microscopic immunocytochemical localization of tyrosine hydroxylase in prenatal rat brain. II. Late ontogeny. J Comp Neurol 199:255–276[CrossRef][Medline]
  53. Ni L, Jonakait GM 1988 Development of substance P-containing neurons in the central nervous system in mice: an immunocytochemical study. J Comp Neurol 275:493–510[CrossRef][Medline]
  54. Whitnall MH, Key S, Ben-Barak Y, Ozato K, Gainer H 1985 Neurophysin in the hypothalamo-neurohypophysial