| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Cellular and Developmental Neurobiology Section, National Institute of Neurological Disorders and Stroke, National Institutes of Health (P.R.K., S.W.), Bethesda, Maryland 20892; and Department of Biochemistry and Molecular Biology, Pennsylvania State University (R.K., P.J.M.), University Park, Pennsylvania 16302
Address all correspondence and requests for reprints to: Dr. Susan Wray, Cellular and Developmental Neurobiology Section, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Building 36, Room 5A-25, Bethesda, Maryland 20895-4156. E-mail: swray{at}codon.nih.gov
| Abstract |
|---|
|
|
|---|
) was differentially expressed and was
present in the developmentally younger LHRH neuron. In
vivo analysis revealed that LHRH neurons expressed AP-2 as they
migrated across the cribriform plate and into the forebrain beginning
on E13.5, but that coexpression of LHRH and AP-2 was no longer detected
in postnatal day 1 animals. This suggested a regulatory role for AP-2
in LHRH neurons. Analysis of animals lacking AP-2
revealed a
dramatic decrease in forebrain LHRH neurons between E13.5 and E14.5,
correlating with normal onset of AP-2 expression in LHRH neurons as
they entered the central nervous system. Nasal cells robustly
expressing LHRH were still present on E14.5. The continued presence of
forebrain LHRH cells is proposed based on a second marker, galanin, and
lack of increased apoptotic/necrotic cells in this region. A decrease
in LHRH messenger RNA in forebrain neurons indicates regulation of LHRH
occurred at the transcriptional or posttranscriptional level in mutant
animals. These results indicate a developmentally restricted
involvement of the transcription factor AP-2 in LHRH expression once
the LHRH neurons have migrated into the forebrain, but before
establishment of an adult-like distribution. | Introduction |
|---|
|
|
|---|
Work examining neuropeptide processing (6), membrane properties (7) and
secretory capacity (8) of primary LHRH neurons maintained in culture
provided evidence that residing within the CNS is not essential for
LHRH neuronal activity. Therefore, intrinsic to the LHRH neuron and/or
retained in nasal environments in vitro, are cues leading to
onset and maturation of the LHRH neuronal phenotype. Since maturation
of these neurons takes place in vitro, a cDNA subtraction
screen was performed to begin to identify genes important for
regulation of LHRH neuronal activity. Earlier studies (7) had shown a
change in LHRH neuronal properties occurred in neurons maintained
in vitro for 6 days vs. 10 days. The later time
point being the in vitro equivalent of postnatal day 1 (PN1)
in vivo. Thus, a cDNA library from a young (3.5-days
in vitro) (div) LHRH cell was created and screened with the
genes expressed in two 10.5 div LHRH cells. The transcription factor
activator protein-2 (AP-2
) was found to be differentially expressed
and was present in the developmentally younger LHRH neuron.
Three related AP-2 genes plus variants have been identified, AP-2
,
-ß, and -
(9, 10, 11, 12, 13). AP-2
, the focus of this study, is a
trans-acting regulatory protein (enhancer-binding protein)
expressed initially in neural crest (14, 15) and in many neural,
neuroectodermal, and ectodermal tissues during development (16).
AP-2
mediates transcriptional activation in response to two
different signal transduction pathways, the phorbol ester and
diacylglycerol-activated protein kinase C and the cAMP-dependent
protein kinase A (17). Coupled to more than one pathway, AP-2 may serve
as a bridge, coordinating effects and ensuring that target genes will
be regulated in response to a variety of different signals.
AP-2
is important in embryogenesis, especially in craniofacial
development and midline fusion (18, 19). It is expressed throughout
nasal regions in mesenchymal cells (16) and has also been detected in
the olfactory placode, but limited to the presumptive respiratory
epithelium (20). The AP-2 gene encodes a retinoic acid-inducible
protein (19), and its expression is associated with a decrease in
proliferation (21, 22) and cellular differentiation (9, 12, 23, 24, 25).
Interestingly, with respect to the success in making immortalized LHRH
cells lines (26, 27), AP-2 interacts with the simian virus 40 T antigen
(12). The binding of AP-2 to T antigen can inhibit AP-2 binding to DNA
and thus its transcriptional activities. AP-2 has also been shown to
regulate neuropeptide receptors (28, 29, 30) and enzymes such as choline
acetyltransferase (31) and dopamine ß-hydroxylase (24) that produce
the neurotransmitters acetylcholine and norepinephrine, respectively.
In addition, transcriptional activation via AP-2 has been shown for
several neuropeptide genes. AP-2 maintains or enhances the expression
of neuropeptide tyrosine (32), proenkephalin (33), and neuropeptides in
the dorsal root ganglion (34).
Although a perfect AP-2 consensus element is not located in the LHRH
promoter (our personal observation), a direct role for AP-2 as a
DNA-binding protein on the 5'-region of the LHRH gene has yet to be
determined. However, AP-2 consensus elements have been located in the
promoters of several genes, including galanin (35), the
ß3 subunit of the
-aminobutyrate type A
(GABAA) receptor (29), and the neuropeptide Y-Y1
receptor (30), which have been identified in LHRH neurons (7, 36, 37)
or the GT1 immortalized LHRH cell line (38). As such, the differential
expression of AP-2 found in LHRH neurons in vitro may
reflect either a general maturation event that occurs in LHRH neurons
or a LHRH gene-specific event. Thus, to address the role that AP-2 may
play in LHRH neuronal maturation, we examined LHRH expression in mice
lacking AP-2
. LHRH messenger RNA (mRNA) and protein levels in
mutants were similar to those in wild-type animals until embryonic day
13.5 (E13.5). This result suggests that AP-2 is not involved in the
early events necessary for the onset of LHRH expression in olfactory
pit cells or LHRH cell migration in nasal regions. After E13.5, a rapid
and dramatic decrease in LHRH expression within forebrain neurons
occurred. This result is consistent with AP-2 being required to
maintain LHRH expression at a restricted developmental stage.
| Materials and Methods |
|---|
|
|
|---|
Construction of single cell libraries
Construction of the single cell cDNA libraries was based on the
1995 protocol of Dulac and Axel (40). Single cell aliquots were placed
into a reaction mixture containing 4 µl lysis buffer [50
mM Tris-HCl (pH 8.3), 75 mM KCl, 3
mM MgCl2, 0.5% Nonidet P-40,
containing 80 ng/ml pd(T) 1924, 5 U/ml prime ribonuclease inhibitor
(5 Prime,3 Prime, Inc., Bolder, CO), 324 U/ml RNAguard (Pharmacia Biotech, Piscataway, NJ), and 10 µM deoxy (d)-ATP,
dCTP, dTTP, and dGTP] at 4 C. The cells were lysed by a 1-min
incubation at 65 C, then 50 U Moloney murine leukemia virus and 0.5 U
avian reverse transcriptases (BRL, Beverly, MA) were added, and the
mixture was incubated for 15 min at 37 C, then heat inactivated at 65 C
for 10 min. The 15-min RT reaction produces cDNA products ranging from
300-1000 bp (40, 41). The next step, a polyadenylase addition, was
performed on the cDNA product by adding an equal volume of 200
mM potassium cacodylate (pH 7.2), 4 mM
CoCl2, 0.4 mM dithiothreitol (DTT),
200 µM dATP containing 10 U terminal transferase
(Roche Molecular Biochemicals, Inc., Indianapolis, IN) and
incubating the reaction mixture for 15 min at 37 C. The sample was heat
inactivated by incubating at 65 C for 10 min. PCR amplification was
performed using 5 µg of the AL1 primer [ATT GGA TCC AGG CCG CTC TGG
ACA AAA TAT GAA TTC (T)24]; PCR buffer [10
mM Tris-HCl (pH 8.3) and 50 mM KCl); 2.5
mM MgCl2; 1 mM dGTP,
dTTP, dATP, and dCTP; 10 µg BSA; 0.05% Triton X-100 (Roche Molecular Biochemicals, Inc.); and 10 U AmpliTaq
(Perkin-Elmer Corp., Branchburg, NJ) and 25 cycles using
the following protocol: 94 C for 1 min, 42 C for 2 min, and 72 C for 6
min with 10-sec extensions following each cycle. After the initial 25
cycles an additional 5 U AmpliTaq were added, and 25 more cycles were
performed. Southern analysis was performed using 1 µg amplified
single cell cDNA run on a 1.5% agarose gel and blotted on nylon
membrane (GeneScreen Plus, DuPont/NEN, Boston, MA). The
membranes were probed with LHRH (350-bp fragment of the rat LHRH cDNA
including exons 14, a gift from Dr. J. Adelman) as described below.
The PCR products of LHRH-positive cells were digested with
EcoRI and packaged using Gigapack Gold packaging extract
(Stratagene, La Jolla, CA) according to the
manufacturers directions.
Comparative analysis of LHRH neurons
Plaque-lifts using GeneScreen Plus membranes
(DuPont/NEN) were completed. Membranes displaying the
single cell cDNA library from a cell grown in vitro for 3.5
days were hybridized with a PCR-labeled cDNA library from two other
LHRH-positive neurons grown in vitro for 10.5 days.
Membranes were prehybridized for 3 h at 60 C with 1% dextran
sulfate, 1.0 M NaCl, 1% SDS, and 100 µg/ml
sheared herring sperm DNA. Probes were labeled with
[
-32P]dCTP using random primer labeling
(Roche Molecular Biochemicals, Inc.) or PCR amplification.
PCR amplification of cDNA from a single cell was labeled by amplifying
0.3 µl neuron cDNA in a 50-µl volume containing 0.8 µg AL1 primer
in PCR buffer [10 mM Tris-HCl (pH 8.3) and 50
mM KCl]; 2.5 mM
MgCl2; 4 µM dGTP, dTTP,
and dATP; and 100 µCi [
-32P]dCTP for 30
cycles using the following protocol: 94 C for 1 min, 55 C for 2 min, 72
C for 3 min, and one cycle at 72 C for 5 min. The probe was boiled for
5 min in hybridization solution (1% dextran sulfate, 1.0
M NaCl, 1% SDS, and 700 µg/ml sheared herring
sperm DNA), incubated at 65 C for 3 h, and then added to the
prehybridization solution. The membranes were hybridized for more than
12 h, washed twice for 45 min each time at 60 C in a solution of
2 x SSC (300 mM NaCl and 30
mM sodium citrate, pH 7.0)-1% SDS, and exposed
to film.
PCR amplification and sequencing of inserts
Differentially expressed cDNA inserts were PCR amplified by
picking isolated plaques with a pipette tip and submerging the end in a
40-µl solution of PCR buffer [10 mM Tris-HCl (pH 8.3)
and 50 mM KCl]; 5 mM
MgCl2; 0.5 mM T3
(5AATTAACCCTCACTAAAGGG3) and T7 (5GTAATACGACTCACTATAGGGC3) primers; 1
mM dATP, dCTP, dGTP, and dTTP; 0.1% Tween 20; and 0.5 U
AmpliTaq. Pipette tips were removed, and samples were cycled once at 94
C for 5 min, then for 30 cycles at 94 C for 1 min, 55 C for 1 min, 72 C
for 2 min, and once at 72 C for 3 min. Southern analysis was performed
on the PCR products as previously described. The inserts that were
differentially expressed in the second screen were purified using
Microcon 100 concentrators (Amicon, Beverly, MA), primers were
designed, and the insert DNA was sequenced. Sequencing revealed that
the gene isolated from LHRH neurons maintained for different days
in vitro was the transcription factor AP-2
. Thus,
Southern blots of amplified single cell cDNA libraries previously
probed with LHRH were subsequently stripped and probed with AP-2 (pSE,
Dr. P. J. Mitchell).
AP-2-/- mouse embryos
The homozygous mutation made in the AP-2
gene was
described previously (19). Briefly, exon 5 was targeted for deletion in
the homozygous mutant mice (19). Embryonic stem cell lines were
generated. Chimaeric males were bred to BALB/c and 129/Sv wild-type
females to generate heterozygotes for intercrossing. Homozygous mutant
animals die perinatally (19). Mutant and wild-type embryos
(E12.5E15.5) were used in these studies.
Single and double label immunocytochemistry
Pro-LHRH antisera (42) was used at 1:2500, AP-2 monoclonal
antisera specific for the
form of the protein (a gift from Dr. T.
Williams) was used at 1:1, AP-2 polyclonal antisera (C-18, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was used at 1:400.
Polyclonal antibody C-18 is specific for the
form of AP-2 with
little or no binding to the ß or
form of the AP-2 protein
(Mitchell, P. J., personal communication). Tyrosine hydroxylase
antibody (Eugene Tech, Allendale, NJ) was used at 1:3000, and
antineurophysin (a gift from Dr. Robinson) was used at 1:5000.
Substance P antibody (1:4000) and somatostatin antibody (1:3000) were
purchased from INCSTAR Corp. (Stillwater, MN).
Single label immunocytochemistry on either explants (6) or frozen
embryonic sections (5) was performed using standard
avidin-biotin-horseradish peroxidase (Vector Laboratories, Inc., Burlingame, CA) procedures. Double label
immunocytochemistry on explants or frozen parasagittal sections (1620
µm) from AP-2 mutant and wild-type embryos was performed 1) using an
avidin-biotin complex (Vector Laboratories, Inc.) and two
chromogens for horseradish peroxidase (6) [nickel-enhanced
diaminobenzidine (DAB; blue-black reaction) and DAB (brown reaction)]
or one chromogen [nickel-enhanced DAB or Vector VIP (purple;
Vector Laboratories, Inc.)] and avidin-Texas Red; or 2)
using a directly conjugated fluorescent Cy-3 goat antirabbit secondary
[1:1000; Jackson ImmunoResearch Laboratory (West
Grove, PA)], for visualization of the first antigen/antibody complex,
then reactive cells were captured with a VideoScope ICCD-35OF Camera
(Sterling, VA), and the section was processed for the second
antigen/antibody complex using nickel-enhanced DAB as described above.
Nickel enhancement DAB procedures (as opposed to dual fluorescent
procedures) were required to optimize AP-2 staining in embryonic
sections. All sections stained with fluorescent compounds were blocked
with an unconjugated Fab (80 ng/ml; Jackson ImmunoResearch Laboratory). Controls for double label immunocytochemical
experiments consisted of replacement of either the first primary or the
second primary antibody with a normal goat serum incubation.
Control sections revealed no cross-reactivity between the first and
second labeling procedures (data not shown). For presentation purposes
(see Figs. 3
and 4
), AP-2 staining (nickel-enhanced DAB) was visualized
under brightfield, captured (in black and white), colorized green, and
then overlaid on the captured image of LHRH, which was stained with
avidin-Texas Red or Cy-3 and colorized red. Cell counts are given as
the mean ± SEM. Statistical significance comparing
various groups of immunopositive neurons was calculated using one-way
ANOVA followed by Tukeys multiple comparison test.
|
|
Slides were processed for LHRH using synthetic
deoxynucleo-tides. Synthetic 48-nucleotide probes (5 pmol)
complementary to LHRH
(5-TTCAGTGTTTCTCTTTCCCCCAGGGCGCAACCCATAG-GACCAGTGCTG-3) were 3'-end
labeled with [35S]dATP (SA, 10001500 Ci/mmol;
DuPont/NEN) (4). One microgram of linearized PCRII
plasmid containing a 423-bp cDNA fragment of the galanin precursor (a
gift from Dr. L. Eiden) and plasmid BH500 (sequence specific for
-AP-2, P. Mitchell) were reverse transcribed; BH500 digested with
BamHI using T7 polymerase produced AP-2 antisense cDNA, and
digestion with HindIII using T3 polymerase produced the
sense strand. The galanin and AP-2 cDNA incorporated
35S-labeled dUTP and dCTP to specific activities
of 90,000 and 110,000 Ci/mmol, respectively, during RT. Slides were
hybridized (500,0001,000,000 cpm/slide) overnight in humid chambers
at 37 C (oligo) and 55 C (riboprobe). The following day, slides
hybridized with the oligo probe were rinsed in 1 x SSC/65
mM DTT, washed at high stringency in 2 x
SSC/50% formamide/20 mM DTT at 40 C, and washed
in 1 x SSC at room temperature. Posthybridization of the ribopobe
was completed as previously described (43). All slides were then
dehydrated in ethanol, dried, and placed against film. After x-ray film
exposure for 5 days, slides were dipped in NTB3 (Eastman Kodak Co., Rochester, NY) and exposed for 3.5 weeks; emulsion-covered
slides were developed in Dektol (Eastman Kodak Co.) at
1517 C, rinsed in water, and fixed with Kodak fixer,
then counterstained with 0.5% methyl green, dehydrated in ethanol,
cleared in xylene, and mounted with Permount (Fisher Scientific, Pittsburgh, PA). Control slides hybridized with the
sense strand gave only a background signal (data not shown).
Quantitation and analysis of the optical density of the silver grains
were completed as previously described (44).
| Results |
|---|
|
|
|---|
Discovery of transcription factor AP-2
within LHRH cells was made
during a cDNA subtraction screen performed on LHRH cells removed from
embryonic nasal explants at 3.5 and 10.5 div. To confirm this finding,
the cDNA from single cells removed from nasal explants was amplified
(Fig. 1A
) and
hybridized with a LHRH and an AP-2 probe (Fig. 1
, B and C). Four of
seven cells (lanes 5, 6, 8, and 10) coexpressed LHRH and AP-2 mRNAs at
3.5 div. Five hundred- and 360-bp DNA fragments were detected on the
Southern blot probed for LHRH (Fig. 1B
). The 500-bp fragment
corresponds to the pro-LHRH transcript (26). Production of the small
360-bp cDNA fragment was due to the attenuated RT reaction (see
Materials and Methods). Unlike the 500-bp transcript of
LHRH, AP-2 has a 1596-bp transcript that cannot be synthesized in its
entirety by this procedure and a variety of band sizes (750, 500, 450,
and 300 bp) were obtained (41). Positive (lanes 1, 3, and 4) and
negative (lane 2) controls for LHRH indicate that the assay is highly
specific for the gene being analyzed (Fig. 1
).
|
and LHRH coexpression in vivo, in
situ hybridization was performed for AP-2 mRNA and
immunohistochemistry for LHRH on alternate serial embryonic sections
(Fig. 1
Examination of AP-2 protein in LHRH-immunopositive neurons was
performed in vitro (Fig. 2
) and in
vivo (Fig. 3
and 4
). In vitro, AP-2 staining
was detected in a subpopulation of LHRH cells that had migrated into
the periphery of the nasal explant (Fig. 2C
, arrowheads).
AP-2 expression in LHRH neurons was not detected in LHRH neurons
located on the main tissue mass, proximal to the olfactory pits. Double
label immunocytochemistry indicated AP-2 expression in primary LHRH
neurons located approximately 600900 µm from the olfactory pit
(n = 11 cultures). Note that approximately 1 mm is the distance
LHRH neurons are required to migrate to enter the forebrain in a
developing embryo. Other AP-2-positive cells were present, but were not
LHRH positive (Fig. 2C
, open arrowheads). These cells are
likely to be mesenchymal cells (14). In vivo coexpression
began once LHRH cells had migrated to the cribriform plate (Fig. 3
). At
all ages examined (E13.5, n = 4; E14.5, n = 3; E15.5, n
= 3) AP-2-immunopositive LHRH neurons were not observed in nasal
regions. The nasal forebrain junction (cribriform plate) was the first
region along the LHRH migrational route wherer LHRH neurons expressed
AP-2 (Fig. 3
). On E13.5, an occasional LHRH neuron in this region was
AP-2 positive, but most cells appeared AP-2 immunonegative (Fig. 3
, AC). Between E14.5E15.5, many AP-2-positive LHRH neurons were
detected at the nasal forebrain junction (Fig. 3
, DF), and
AP-2-positive LHRH neurons were also detected in the forebrain (Fig. 4
, AF). However, AP-2 expression in LHRH neurons was transient. On PN 1
(n = 3), AP-2-immunopositive LHRH neurons were no longer detected
(Fig. 4
, HJ). The pattern of AP-2 expression in LHRH neurons in
vitro and in vivo suggested a late migrational and/or
temporal restriction on AP-2 expression in LHRH cells during
development.
|
in development of the LHRH system, LHRH
neurons were examined in AP-2
mutants. LHRH expression dramatically
decreased within the forebrain between E13.5 (n = 4) and E14.5
(n = 3) in mutant animals compared with their wild-type
littermates. In situ hybridization indicated a reduction in
forebrain LHRH mRNA signal on E14.5 in mutant embryos (Fig. 5
|
|
|
|
| Discussion |
|---|
|
|
|---|
AP-2 expression in LHRH neurons coincides with GABAergic input
Analysis of AP-2 mRNA and protein in vivo pointed to
AP-2 and LHRH colocalization once the LHRH neurons had migrated into
the nasal-forebrain junction and forebrain. As forebrain is not present
in nasal explant cultures, either AP-2 expression in LHRH neurons is
intrinsically controlled (time-based onset) or cues activating AP-2
expression are present in the nasal explants. An intrinsic activational
mechanism for AP-2 expression is feasible, but extrinsic cues are
present in vitro and in vivo that correlate with
AP-2 expression. Cell counts on double labeled immunocytochemically
stained explants showed heterogeneous AP-2 expression in LHRH neurons.
These results were consistent with heterogeneous AP-2 mRNA expression
observed in LHRH neurons in vivo. In one 7-day-old explant,
15 of 57 LHRH neurons displayed AP-2 immunoreactivity, but in another 7
cultures, between 110% of the LHRH neurons were double labeled for
AP-2. Although heterogeneous coexpression was observed in
vitro, the AP-2/LHRH population consistently was located 600900
µm from the olfactory pit. This distance in vitro is
similar to the distance that LHRH neurons migrate from the olfactory
pit to the nasal-forebrain junction in vivo (
1 mm).
In embryos, a transient population of GABAergic neurons is present in
the olfactory pit (48). Axons from these GABAergic olfactory cells
terminate at the cribriform plate (
1 mm from the olfactory pit), the
location where LHRH neurons migrate from the nasal region into the
forebrain. Expression of this GABAergic population correlates with LHRH
neuronal migration out of nasal regions (48, 49). In nasal explants, a
similar GABAergic olfactory population has been documented (48).
Although these GABAergic cells remain close to the main explant,
GABAergic axons, on the average, extend 500600 µm into the
periphery of the explant. However, studies on GABAergic input on
developing LHRH neurons found that muscimol inhibited LHRH neuronal
migration in general, but tetrodotoxin only altered the migration of
cells that had migrated 600800 µm into the periphery (50). Thus
developmentally, in vivo and in vitro, the onset
of AP-2 expression in LHRH neurons precisely coincides with LHRH
neurons entering the region of GABAergic input. The signals transduced
that may lead to AP-2 expression are currently unknown.
Forebrain LHRH neurons in AP-2 mutant
In the majority of AP-2 mutant animals, LHRH transcript and
protein levels fell below detectable limits within the span of 24
h (E13.5 and E14.5). Certainly one explanation for these results was
that LHRH cells were dying, apoptotic, or necrotic. Terminal
deoxynucleotidyl transferase-mediated dUTP nick end staining was
inconsistent with apoptotic cell death, and histological staining
showed no overt signs of cellular necrosis in this region. Thus, to
assess what was happening to the LHRH cells in the forebrain of AP-2
mutants, additional neuronal markers were examined.
Galanin expression is prolonged in AP-2 mutants.We examined a second marker for LHRH neurons, galanin. Galanin mRNA is localized in LHRH neurons in the nasal regions of developing mice, but was shown to decrease in LHRH neurons as they migrated into the brain (46). We decided to examine whether, via hotter riboprobes/longer exposure times, and/or altered expression levels, galanin mRNA could be used to track LHRH neurons in the forebrain of wild-type and/or mutant mice. As in wild-type animals, galanin mRNA was localized in LHRH cells in nasal regions of mutant animals. Technical changes did not enhance the detection of galanin mRNA in forebrain LHRH neurons in wild-type mice. However in mutant animals, galanin mRNA was detected in adjacent forebrain regions, areas of presumptive LHRH neurons. Thus, in contrast to wild-type embryos (46), galanin mRNA was robustly detected in cells entering the forebrain of AP-2 mutants. After the dramatic decrease in LHRH transcript and protein levels in the forebrain, galanin mRNA levels remained relatively high. Thus, galanin mRNA, used as an alternative marker for LHRH neurons, was present in the forebrain (specifically in the region of the LHRH neurons) in AP-2 mutant animals. Although with the techniques used in this study we cannot be assured that the entire population of galanin-expressing cells observed in the forebrain expressed LHRH, the spatial and temporal appearance of galanin mRNA coincided with the expected LHRH neuronal distribution. This result suggests that LHRH neurons are present within the forebrain (note that the number of LHRH cells in the forebrain of AP-2 mutants could not be determined) and that rapid down-regulation of LHRH transcription and/or changes in posttranscriptional processing occur in the absence of AP-2. Studies of postnatal LHRH neurons indicate that LHRH mRNA has a very short half-life (51). Perhaps in the absence of AP-2, LHRH mRNA in prenatal LHRH neurons undergoes a similar rapid turnover, and compensatory transcriptional activity is absent. The maintained expression of galanin mRNA in mutants compared with wild-type animals also raises the possibility that AP-2 regulates galanin expression through the AP-2 consensus element in the galanin promoter (35).
Presence of other neuronal phenotypes.The brains of AP-2 mutants were examined for four other neuronal phenotypes known to be present in the developing mouse by E14.5E15.5. These cells types included tyrosine hydroxylase cell groups (52), substance P cell groups (53), neurophysin hypothalamic cells (54), and somatostatin hypothalamic cells (55). Although the forebrains of AP-2 mutants showed many morphological anomalies, staining for all four phenotypes revealed immunopositive cells in areas corresponding to those observed in wild-type animals and previously reported. Although the absolute cell numbers could not be determined, the presence of these markers indicates that the general pleiotropic effects of the AP-2 mutation does not occur in most other hypothalamic cells through E15.5 and that the effect on the LHRH neuroendocrine cells in the hypothalamus is a specific event.
Tectal LHRH expression is not regulated by AP-2.Transient LHRH cells are detected in the tectum of the developing mouse cortex beginning on E13.75 and reach a peak in number on E15.75 (47). In contrast to neuroendocrine LHRH cells in the forebrain, tectal LHRH cells have an unknown function and most likely a different ontogeny. This tectal cell group was examined to determine the specificity of the observed effect. Maintenance of the tectal LHRH cell population occurred in the AP-2 mutant embryos in contrast to the neuroendocrine LHRH cells in the forebrain. Furthermore, in wild-type animals, LHRH cells within the tectum did not express AP-2. Thus, there is a strict correlation between LHRH/AP-2 coexpression and the dramatic decrease in LHRH expression observed in mutants. These results suggest specificity for AP-2 regulation on the forebrain LHRH cell population.
AP-2 regulation in LHRH neurons
Once activated, how does AP-2 influence LHRH expression? Although
we cannot rule out that the lack of AP-2 alters an afferent input to
LHRH neurons, which then causes the decrease in LHRH expression
observed, the expression of AP-2 in LHRH neurons as they enter the
brain strongly suggests an event(s) occurring within the LHRH cell.
Thus, the results observed in this study are consistent with AP-2
directly altering LHRH gene expression or acting indirectly via an
intermediate gene product.
A perfect AP-2 consensus element (GCCNNNGGC) is not located in the LHRH promoter (our personal observation). Thus, a direct role for AP-2 as a DNA-binding protein on the 5'-region of the LHRH gene has yet to be determined. However, AP-2 consensus elements are located in the promoter of the ß3-subunit of the GABAA receptor (29) that is present in LHRH neurons (56) and in the GT1 immortalized LHRH cell line (57). GABA is a key regulator of LHRH mRNA levels in both the embryo and the adult (58, 59, 60, 61, 62, 63). Therefore, AP-2, which normally acts as an enhancer, may act on the ß3-subunit of the GABAA receptor to maintain LHRH transcription. Further work is required to understand the mechanism by which posttranscriptional or transcriptional regulation of LHRH mRNA levels may occur through a GABAA receptor-specific mechanism.
Depletion of LHRH in animals without AP-2.In animals lacking AP-2, LHRH peptide levels decreased after a reduction in the LHRH transcript. Intrinsic pulsatile release of LHRH in developing LHRH cells (64) could deplete LHRH peptide stores. In the absence of the putative enhancer AP-2, basal transcription of the ß3-subunit of the GABAA may maintain LHRH neuronal responsiveness to depolarization by GABA in the forebrain, leading to LHRH release (8, 65, 66). Without concomitant production or processing of the primary LHRH transcript, LHRH peptide would be depleted. However, these would not explain the rapid decrease in LHRH from peptidergic stores. Therefore, alternatively (but not exclusively), peptide storage and degradative processes in prenatal LHRH neurons may be different from those observed postnatally or may be a direct consequence of the AP-2 mutation.
Altered posttranslational processing of LHRH in AP-2 mutants.A multistep process is required to produce the LHRH peptide (for review, see Ref. 38). Thus, regulation of the LHRH posttranslational processing enzymes by AP-2 could lead to a decrease in LHRH peptide levels. However, this does not appear to be the case, as the polyclonal antibody used in these studies (SW-1) detects the preprohormone, so the unprocessed protein plus any variants were detected. As detection of LHRH was independent of posttranslational processing, the loss of LHRH observed in the mutants suggests that the absence of AP-2 protein alters LHRH expression at the level of transcription or posttranscription and the release and/or degradation of LHRH.
AP-2 localization suggests alterations in posttranslational
processing
In vivo AP-2 and LHRH mRNAs were colocalized in cells
in the forebrain. Colocalization did not occur in LHRH neurons within
nasal regions, although this was difficult to determine due to the high
level of AP-2 mRNA expression in nasal mesenchymal cells (10, 16). At
all ages examined (E12.5E15.5), AP-2 immunostaining was not observed
in LHRH neurons in the olfactory pit or migrating along olfactory axons
across the nasal septum. However, on E13.5, immunopositive AP-2/LHRH
neurons were initially detected at the nasal/forebrain junction. The
AP-2 staining in these LHRH cells consisted of cytoplasmic staining as
well as nuclear staining. As LHRH cells crossed the nasal/forebrain
junction and entered the forebrain, AP-2 nuclear staining predominated.
In all other areas examined, AP-2 immunostaining was restricted to the
nucleus, and Western blots using this antibody indicated specificity
for the
form of the AP-2 protein (Mitchell, P., personal
communication). Nuclear and cytoplasmic localization of AP-2 in LHRH
neurons may be the result of posttranscriptional processing of the AP-2
mRNA transcript, which has been found to lead to changes in
localization as well as function (16, 67). Alternatively, the apparent
shuttling of AP-2 from the cytoplasm to the nucleus may be the result
of posttranslational changes that alter protein sequestering to
specific compartments. Such changes have been shown to be a common
mechanism by which transcription factor activity is modulated (68, 69).
AP-2 in development
A mechanistic linkage in AP-2-dependent systems is the
commonality of inductive tissue interactions (14, 15, 18, 19, 70),
usually associated with an epithelial-mesenchymal transition. Although
not an epithelial-mesenchymal transition, it is worth noting that AP-2
expression in LHRH neurons first occurred as LHRH neurons underwent a
major tissue transition and crossed the nasal forebrain junction. The
changes that LHRH neurons undergo at this transitional point are just
beginning to be investigated. Evidence suggests that LHRH neurons pause
at this junction before migration into the brain (50, 71). Thus, at
this transition point, LHRH neurons may mature/differentiate with
respect to properties required for appropriate function in the CNS
(50). Alternatively (but not exclusively), LHRH neurons may
alter/acquire pathfinding molecules necessary to establish their
appropriate CNS distribution. Interestingly, the AP-2 protein has been
implicated in the transcriptional regulation of cell adhesion molecules
and matrix metalloproteinases, which may coordinate cell/cell
communication and cell movement (72, 73, 74, 75). It is thus possible that in
the absence of AP-2, LHRH neurons do not reach their appropriate
locations and/or are not capable of responding to appropriate CNS
stimuli and, as such, cease LHRH expression.
Summary
In this report we documented the onset of AP-2 expression in LHRH
neurons as they migrated into the forebrain. To determine the role of
AP-2 expression in LHRH neurons, we examined the development of this
neuroendocrine system in AP-2 mutant animals. In AP-2 mutants a
dramatic reduction in the number of forebrain LHRH-expressing cells
occurred at these same developmental ages. A second marker (galanin)
provides evidence that LHRH cells were still present within the
forebrain, but that LHRH expression decreased at the transcriptional
level. Furthermore, cells in the tectum did not express or require AP-2
to maintain LHRH expression. These results indicate a developmentally
restricted involvement of the transcription factor AP-2 in LHRH
expression that is specific for neuroendocrine LHRH cells and activated
once the LHRH neurons have migrated into the forebrain, but before
establishment of an adult-like distribution.
| Acknowledgments |
|---|
Received July 9, 1999.
| References |
|---|
|
|
|---|
is expressed in the murine ocular lens. Dev Biol 202:125135[CrossRef][Medline]
and AP-2ß gene expression during murine
embryogenesis. Dev Dyn 208:115124[CrossRef][Medline]
- and ß-subunit promoters by AP-2. J Biol Chem 272:1540515412
-aminobutyric acid-type A receptor beta 3 subunit (GABRB3).
J Biol Chem 268:44204428
-o120-one on gonadotropin-releasing
hormone gene expression in the male rat. Eur J Pharmacol 260:157162[CrossRef][Medline]
-amino-butyric acid and glutamate of
[Ca2+]i and neuropeptide
secretion in immortalized gonadodropin-releasing hormone neurons.
Neuroendocrinology 61:499508[Medline]
2 integrin gene
promoter. Identification of positive and negative regulatory elements
important for cell-type and developmentally restricted gene expression.
J Biol Chem 269:463469This article has been cited by other articles:
![]() |
S. Constantin, C. S. Caligioni, S. Stojilkovic, and S. Wray Kisspeptin-10 Facilitates a Plasma Membrane-Driven Calcium Oscillator in Gonadotropin-Releasing Hormone-1 Neurons Endocrinology, March 1, 2009; 150(3): 1400 - 1412. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Giacobini, A. Messina, F. Morello, N. Ferraris, S. Corso, J. Penachioni, S. Giordano, L. Tamagnone, and A. Fasolo Semaphorin 4D regulates gonadotropin hormone-releasing hormone-1 neuronal migration through PlexinB1-Met complex J. Cell Biol., November 3, 2008; 183(3): 555 - 566. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Constantin and S. Wray Gonadotropin-Releasing Hormone-1 Neuronal Activity Is Independent of Hyperpolarization-Activated Cyclic Nucleotide-Modulated Channels but Is Sensitive to Protein Kinase A-Dependent Phosphorylation Endocrinology, July 1, 2008; 149(7): 3500 - 3511. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Constantin and S. Wray Gonadotropin-Releasing Hormone-1 Neuronal Activity Is Independent of Cyclic Nucleotide-Gated Channels Endocrinology, January 1, 2008; 149(1): 279 - 290. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Giacobini, A. Messina, S. Wray, C. Giampietro, T. Crepaldi, P. Carmeliet, and A. Fasolo Hepatocyte Growth Factor Acts as a Motogen and Guidance Signal for Gonadotropin Hormone-Releasing Hormone-1 Neuronal Migration J. Neurosci., January 10, 2007; 27(2): 431 - 445. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Giacobini and S. Wray Cholecystokinin Directly Inhibits Neuronal Activity of Primary Gonadotropin-Releasing Hormone Cells through Cholecystokinin-1 Receptor Endocrinology, January 1, 2007; 148(1): 63 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Givens, N. Rave-Harel, V. D. Goonewardena, R. Kurotani, S. E. Berdy, C. H. Swan, J. L. R. Rubenstein, B. Robert, and P. L. Mellon Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families J. Biol. Chem., May 13, 2005; 280(19): 19156 - 19165. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Gill, S. M. Moenter, and P.-S. Tsai Developmental Regulation of Gonadotropin-Releasing Hormone Neurons by Fibroblast Growth Factor Signaling Endocrinology, August 1, 2004; 145(8): 3830 - 3839. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Giacobini, A. S. Kopin, P. M. Beart, L. D. Mercer, A. Fasolo, and S. Wray Cholecystokinin Modulates Migration of Gonadotropin-Releasing Hormone-1 Neurons J. Neurosci., May 19, 2004; 24(20): 4737 - 4748. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Moore Jr, E. Shang, and S. Wray In Situ GABAergic Modulation of Synchronous Gonadotropin Releasing Hormone-1 Neuronal Activity J. Neurosci., October 15, 2002; 22(20): 8932 - 8941. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sharifi, A. E. Reuss, and S. Wray Prenatal LHRH Neurons in Nasal Explant Cultures Express Estrogen Receptor {beta} Transcript Endocrinology, July 1, 2002; 143(7): 2503 - 2507. [Abstract] [Full Text] [PDF] |
||||
![]() |
I Monge, R Krishnamurthy, D Sims, F Hirth, M Spengler, L Kammermeier, H Reichert, and P. Mitchell Drosophila transcription factor AP-2 in proboscis, leg and brain central complex development Development, January 4, 2001; 128(8): 1239 - 1252. [Abstract] [PDF] |
||||
![]() |
P.R. Kramer and S. Wray Novel gene expressed in nasal region influences outgrowth of olfactory axons and migration of luteinizing hormone-releasing hormone (LHRH) neurons Genes & Dev., July 15, 2000; 14(14): 1824 - 1834. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |