help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by FASSETT, J. T.
Right arrow Articles by NILSEN-HAMILTON, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by FASSETT, J. T.
Right arrow Articles by NILSEN-HAMILTON, M.
Endocrinology Vol. 141, No. 5 1863-1871
Copyright © 2000 by The Endocrine Society


ARTICLES

Mrp4, A New Mitogen-Regulated Protein/Proliferin Gene; Unique in this Gene Family for its Expression in the Adult Mouse Tail and Ear1

J. T. FASSETT, R. T. HAMILTON and M. NILSEN-HAMILTON

Departments of Zoology and Genetics (J.T.F., R.T.H.) and Biochemistry, Biophysics and Molecular Biology (M.N.-H.), Iowa State University, Ames, Iowa 50011-3260

Address all correspondence and requests for reprints to: M. Nilsen-Hamilton, Iowa State University, Department of Biochemistry, Biophysics and Molecular Biology, 1210 Molecular Biology Building, Ames, Iowa 50011-3260. E-mail: marit{at}iastate.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mitogen-regulated proteins (also known as proliferin; mrp/plf) are nonclassical members of the PRL/GH family. They are expressed at high levels during midgestation when they are thought to induce angiogenesis and uterine growth. There are between four and six mrp/plf genes, and three different complementary DNAs have been cloned. Here we identify a fourth mrp/plf gene (mrp4) that we have cloned and characterized. MRP4 is 91% identical in amino acid sequence with the other MRP/PLF proteins but is missing two glycosylation sites that are present in the other forms. Consistent with the loss of two of three glycosylation sites, the expressed form of MRP4 has a lower apparent molecular weight compared with other MRP/PLFs. In vivo, mrp4 is expressed in the placenta and the adult skin. Expression of mrp4 messenger RNA peaks in the placenta on day 12. In the skin, mrp4 expression is specific to the ears and tails of mice. Our results suggest that, as well as having growth and angiogenic effects during pregnancy, the MRP/PLFs may have functions in nonreproductive tissues. Unique among the members of the mrp/plf family for its expression in the hair follicles of the tail and ear, MRP4 is expected to have a singular role in the growth and development of these follicles.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PROTEINS OF THE PRL/GH (PRL/GH) family play essential roles in growth and reproduction in mammals. Humans contain three placenta-specific variants of human (h) GH (1), whereas rodents have evolved numerous placental-expressed descendents of PRL (2). In the mouse, the placental members of the family include placental lactogens I and II (mPLs) (3, 4, 5), proliferin-related protein (PRP) (6); the more recently identified homologs of the rat PRL-like proteins (PLP A,B,C{alpha}, Cv, E through L, and d/t-PRP) (7, 8, 9, 10, 11, 12), and the mitogen-regulated proteins (proliferins; MRP/PLF) (13). MRP/PLFs are glycoproteins consisting of a polypeptide core of 21 kDa and appear by gel electrophoresis to be of average sizes varying from 27K to 38K. Like some other members of the PRL/GH family, the MRP/PLFs are synthesized in the placenta, and their synthesis is temporally regulated during gestation (6, 14). Expression of the mrp/plf genes in the placenta begins as early as E7, peaks at midgestation (E9–11), then declines through the remainder of gestation. In situ hybridization and immunohistochemistry have identified the trophoblastic giant cells as the site of MRP/PLF synthesis in the placenta, from which it is released into both the maternal bloodstream and the amniotic fluid (15). MRP/PLFs are believed to function during pregnancy as placental angiogenesis factors through their interaction with the mannose-6-phosphate receptor (16) and as uterine growth factors through another receptor that is specific for MRP/PLFs and does not recognize mannose-6-phosphate (17). PLF1 also has been described as having an intracellular role, in preventing muscle differentiation (18, 19).

The mouse genome contains between four and six mrp/plf genes (20) and previous to this report, three complementary DNAs (cDNAs) had been cloned: plf1 from serum-stimulated 3T3 cells (21), plf2 from a Balb/c mouse placental cDNA library (22), and mrp3 from a Swiss mouse embryo fibroblast library (23). The three MRP/PLFs are approximately 98% identical in amino acid sequence and the variations in sequence do not disrupt any predicted structural motifs. Thus it is likely that all three previously identified MRP/PLFs have a similar structure. Each of the identified MRP/PLFs contain three N-glycosylation motifs within the sequence of the mature secreted protein, and all placental and 3T3 forms are glycosylated (13, 22, 24). Because MRP/PLF binds at least two different receptors during gestation, only one of which recognizes mannose-6-phosphate, the level of glycosylation could be important in determining the functional interactions of the MRP/PLFs with their receptors in vivo (16, 17, 25).

Here we describe a fourth mrp/plf messenger RNA (mRNA) (mrp4) that we have cloned, sequenced and characterized. The mature protein produced from this newly discovered member of the mrp/plf gene family is 91% identical in amino acid sequence to the other members of the family. MRP4 lacks two of the three glycosylation sites found on the other MRP/PLFs, and when expressed, it appears to contain less carbohydrate than the other MRP/PLFs. Expression of mrp4 mRNA is consistent with the presence of MRP/PLF protein found in the placenta in the latter half of gestation and that has a lower apparent molecular weight than the plasma form of MRP/PLFs. MRP4 is also the only mrp/plf mRNA species detected in hair follicles of the tail and the ears of adult mice. These results suggest that, as well as functioning to stimulate uterine growth and placental vascularization during pregnancy, the MRP/PLFs also may have a specific function in adult hair follicles. Because mrp4 is the only member of the mrp/plf gene family expressed in the tail and the ear, this gene may play a singular role in these tissues.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and Materials
CF-1 and FVB mice, originally obtained from Charles River Laboratories, Inc. (Wilmington, MA), were bred and cared for at the Laboratory Animal Facility at Iowa State University under a 12-h light, 12-h dark cycle. For pregnant animals, the day of the plug was counted as day 0. Animal care was provided by an animal caretaker and an attending veterinarian. This research was conducted in accordance with the standards set forth in the NIH guide for the care and use of laboratory animals. Animals were killed by cervical dislocation before removal of tissues for the described studies. Prior approval was obtained from the Iowa State University Committee on Animal Care for all procedures performed on the animals used in these studies.

Polyclonal anti-MRP rabbit sera and preimmune sera were prepared as described (26). pRSV-plf1 and pRSV-plf2 plasmids and a set of cosmids containing mrp/plf-hybridizing sequences were gifts from Jiandie Lin and Daniel Linzer (Northwestern University). The pBluescript II KS(+) plasmid (pBKSII+) was obtained from Stratagene (La Jolla, CA), and the pcDNA3 expression vector was obtained from Invitrogen (Carlsbad, CA). The full mrp3 gene extending from -1450 to 600 bp past the poly A site (including introns) was obtained from David Denhardt (Rutgers University) in four separate pieces. The full-length genomic clone from -1450 was reconstructed almost completely except for an approximately 230 bp AccI-PvuII fragment of intron I and a 300 bp EcoRI fragment of intron 3, which were removed during cloning. The reconstructed gene was placed downstream of the CMV (cytomegalovirus) enhancer (obtained from pcDNA3) to produce pCMV-MRP3. Tunicamycin was from Sigma (St. Louis, MO). Dulbecco-Vogt’s modified Eagles medium with high glucose (DMEG) was from Life Technologies, Inc. (Rockville, MD).

RNA isolation and RT-PCR
Immediately after their removal, tissues were frozen under liquid nitrogen and stored at -70 C until use. Frozen tissue was pulverized in liquid nitrogen using a mortar and pestle, and RNA was isolated using Tri-Reagent (Life Technologies, Inc.) according to the manufacturer’s instructions. For RT, 250 ng of total RNA was incubated with or without 40 U of Superscript II reverse transcriptase (Life Technologies, Inc.) in 5-µl reaction mixtures containing 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 112 ng poly dT primers, 400 µM each of the four dNTPs (dATP, dGTP, dCTP, dTTP), and 50 mM Tris·HCl (pH 8.3 at RT). The reaction mixtures were incubated at 42 C for 50 min, 50 C for 10 min, then 75 C for 15 min.

For PCR, the following primers were used; mrp/plf downstream exon I (DE1), 5'taagcctgggtaggactctgc3' (+45 to +65), or (DE1B) 5'ctctgcagagatgctcccttc3' (+59 to +79) and mrp/plf upstream exon V (NUE5), 5'catgatatttcagaagcagagcac3' (+778 to +756). Briefly, 0.5 µl of the RT reaction mix was added to a 25-µl volume containing 1 U of Taq Polymerase, 20 pmoles of each primer, 200 µM of each of the four dNTPs, 1.5 mM MgCl2, 50 mM KCl, and 10 mM Tris-HCl (pH 8.3). The thermal cycling conditions were as follows: 95 C for 2 min to denature, then 40 cycles at 95 C (30 sec), 66 C (1 min), and 72 C (1.5 min) with a final 3 min at 72 C. The PCR products were resolved by electrophoresis through a 1.5% agarose gel and examined by ethidium bromide staining.

Diagnostic restriction digestion to distinguish between the mrp/plf mRNAs
The diagnostic RT-PCR assay for the mrp/plfs is based on minor differences in the cDNA sequences of these closely related gene products that result in the presence or absence of restriction sites within the cDNA that can be used to distinguish between the mrp/plf mRNAs (Fig. 1Go). For restriction digestion, one-fifth of the reaction mixture from the RT-PCR reaction was subjected to one additional round of PCR using DE1B and NUE5 primers and 62.5 µM of each of the four dNTPs, 0.9 mM MgCl2 and 1 µCi 32P-{alpha}dCTP in a 25-µl volume. The sample was heated to 98 C for 4 min, 64 C for 1 min, then 72 C for 20 min. The radiolabeled cDNA was precipitated with 70% ethanol in the presence of 0.3 M sodium acetate with 10 µg yeast transfer RNA as a carrier. Digestion was carried out using 1 U each of BsoFI (New England Biolabs, Inc., Beverly, MA) and BstXI at 55 C overnight, or 5 U of NdeI (Life Technologies, Inc.) at 37 C including 100 µg/ml BSA (New England Biolabs, Inc.). The radiolabeled and digested products were resolved by electrophoresis through a 2% agarose gel or an 8% or 10% polyacrylamide gel. The gel was dried, and the amount of radioactivity associated with each band was determined using a phosphorimager and ImageQuant software (Molecular Dynamics, Inc., Sunnyvale, CA). Positive controls for identification of specific mrp/plf cDNAs were amplified from pRSV-plf1 or pRSV-plf2 cDNAs, or were produced using mRNA isolated from COS cells that had been transiently transfected with pCMV-MRP3. The diagnostic RT-PCR was validated using known mixes of mrp/plf cDNAs followed by amplification and diagnostic RT-PCR. The amount of each cDNA was then determined quantitatively after restriction digestion and found to reflect the expected ratio of each cDNA.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. Diagnostic RT-PCR of mrp/plf cDNAs. Top panel. Diagram to show how digestion with the restriction enzymes BsoFI and BstXI results in different sized restriction fragments for each mrp/plf. Resolution of these fragment by agarose or acrylamide gel electrophoresis followed by their quantitation provides estimates of the relative amounts of each mrp/plf mRNA in individual samples. Bottom panel, The mrp/plfs are distinguishable by their digestion pattern. Plf1, plf2, and mrp3 cDNAs and placental cDNA from various gestational days were amplified and digested with BsofI and BstxI as described in panel A. The resulting fragments were run on an 8% polyacrylamide gel. The top arrow indicates the 564-bp fragment that does not digest at either internal restriction site.

 
Other mrp/plf primers used for RT-PCR in these studies were DAP1 (-230 with the addition of ccac at the 5' end; 5'ccactagtcagagcatgaacat3') and M3V55 (-129; with the addition of ccactag at the 5' end 5'ccactagtcatggtatctaggctactt3').

Cloning and sequencing of the mrp4 cDNA
The mrp4 complementary DNA (cDNA) was cloned from day 13 CF-1 mouse placenta. Total placental RNA was isolated and reverse transcribed as described under RNA isolation and RT-PCR. The fragment was amplified by PCR using the following primers: DE1; 5'taagcctgggtaggactctgc3' (+45 to +65), ZMRPUE5; 5'gaaaagcttgtcaacaacaaattcaaaag3' (+820 to +801). Twenty-seven cycles of 95 C (30 sec), 64 C (1 min) and 72 C (1.5 min) were performed using a low error rate amplification kit (Expand High Fidelity PCR System, Roche Molecular Biochemicals, Indianapolis, IN). The PCR product was precipitated with ethanol, then digested 5' and 3' of the coding regions using PstI and HincII restriction endonucleases respectively. The resulting cDNA fragment was ligated into pBKSII+ that had been cut with these same restriction endonucleases. The plasmid pBKS-mrp4 was sequenced by the DNA Synthesis and Sequencing Facility at Iowa State University to verify the sequence of the mrp4 cDNA insert. Two of the clones were sequenced. Because the two sequences differed in sequence at five base positions, total mRNA isolated from two different tail samples were amplified by RT-PCR and the amplicons sequenced. The resulting sequences matched each other and clone 2 with the exception of a single base at position 221 in clone 2 which was A. The base in this position in the two amplified total tail RNA samples was G, which matched that of the other three cloned mrp/plfs. The base at position 221 was therefore taken to be G because the amplified tail mRNA sequences were the sum of sequences of many mRNAs in each sample whereas the cDNA clone 2 was the result of a single copy of one mRNA.

Expression of MRP4 in COS cells
The mrp4 cDNA was subcloned into pcDNA3 by digestion of pBKS-mrp4 with SmaI and XhoI and insertion of the mrp4 cDNA into the blunt-ended HindIII and XhoI sites of pcDNA3 to make pcDNA3-mrp4. pcDNA3-Plf1 was made by cloning the HindIII/XbaI fragment of pRSV-Plf 1 into the same sites in pcDNA3. COS cells were transiently transfected with pcDNA3-MRP4 or pcDNA3-PLF1 using DEAE-Dextran as coprecipitant (27). After transfection, the cells were grown in DMEG 10% calf serum for 48 h, then switched to 2% calf serum with or without 5 µg/ml tunicamycin for 24 h. The culture medium was collected and spun in a microcentrifuge for 1 min and then stored at 4 C. The cells were scraped into lysis buffer (0.5% NP40, 100 U/ml Trasylol, 10-5 M PMSF, 20 mM HEPES, pH 7.25) and stored frozen at -70 C.

Western blot analysis
Tissue homogenates for Western blot analysis were prepared as follows: halves of two or more placentae from pregnant mice were collected on either day 11 or day 14 of gestation, pooled according to day of gestation and homogenized in the same lysis buffer used for cultured cells above. Large tissue debris were spun out, and the supernatants were saved. Transfected COS cell lysates or homogenates from day 11 or day 14 placentae were separated on a 15% polyacrylamide-SDS gel as described previously (28). The proteins were electroblotted to nitrocellulose membranes (Nitrobind; Micron Separations, Inc., Westborough, MA), and the MRP/PLFs were detected using rabbit anti-MRP/PLF antiserum at a dilution of 1/200, followed by treatment with horseradish peroxidase-conjugated protein A (Sigma) and Western blotting detection reagents (Amersham International, Buckinghamshire, UK).

Immunohistocemistry
Tissues were fixed in 4% paraformaldehyde in PBS (0.14 M NaCl, 2.7 mM KCl, 4 mM Na2HPO4, 14.7 mM KH2PO4, pH 7.4) for 1–2 h at 4 C immediately after collection. Samples were then rinsed in PBS and stored in 70% ethanol until sectioned. For immunodetection of MRP, 6 µm sections were rehydrated and stained as previously described (29) using a polyclonal rabbit anti-MRP/PLF serum (89rb13a) or a preimmune serum from the same animal, each at a dilution of 1/500. Primary antibody was detected using biotinylated goat antirabbit and horse radish peroxidase conjugated to avidin, and visualized by a peroxidase substrate, diamino benzidine tetrahydrochloride (ABC kit; Vectastain;Burlingame, CA). Samples were counter-stained with hematoxylin and eosin, dehydrated, and mounted with permount (Fisher Scientific, Pittsburgh, PA) with a coverslip on top.

Identification of the promoters for the different mrp/plf genes
Cosmid clones containing mrp/plf-hybridizing sequences and a reconstructed mrp3 gene from -1450 to +600 bp past the poly A site and genomic DNA were amplified using primers that recognize the sequence from +310 to +335 (exon 3; 5'acaaaagccccatgagatgcaatac3') and from +455 to +435 (exon 4; 5'actcactagatcgtccagagg3'). PCR-amplified fragments were digested with EcoRI for 4 h at 37 C and then digested with either BsoFI or BstXI as described for diagnostic RT-PCR. The fragments were resolved through a 2% agarose gel. Individual clones that produced diagnostic PCR digestion patterns consistent with a particular mrp/plf cDNA were sequenced across the promoter region using a primer +71 to +43 (UE1; 5'catctctgcagagtcctacccaggcttag3') that hybridizes with the 5' end of mrp4 and the three mrp/plfs identified previous to this report (21, 22, 23).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A new mrp/plf mRNA that is expressed in the midgestational placenta
Because the placenta was previously the only tissue in which mrp/plf expression was observed, we used the diagnostic RT-PCR protocol diagrammed in Fig. 1Go to determine the relative proportions of mrp/plf mRNAs expressed in the placenta. By incorporating 32P{alpha}CTP into the final round of amplification, we were able to quantitatively determine, using a phosphorimager, the amount of each restriction fragment. The major form of mrp/plf expressed during gestation was mrp3. This can be seen visually in Fig. 1Go in which the majority of the radioactivity is associated with the 289- and 246-bp fragments that are diagnostic for mrp3. Less radioactivity was associated with the 318-bp fragment that is diagnostic for plf1, and no radioactivity was associated with the 275-bp fragment diagnostic for plf2. However, we also found a form of mrp/plf mRNA that was not digested at the internal BsoF1 and BstXI sites present in the three cloned mrp/plfs. The undigested form of mrp/plf was found in the placenta at lower levels before day 11 and peaked between days 12 and 14 (Fig. 1Go) (14). These results suggested the presence of a fourth, previously unidentified, mrp/plf mRNA that is expressed in the placenta during late gestation that does not contain the internal BsoFI or BstXI sites present in the three previously cloned mrp/plfs.

Cloning of mrp4
The fourth mrp/plf cDNA that was identified as uncut by the diagnostic RT-PCR procedure was cloned from day 13 placental RNA and sequenced as described in Materials and Methods to reveal a previously unknown mrp/plf cDNA (mrp4) with 91% amino acid identity to plf1 (Fig. 2Go). Two noteworthy differences between mrp4 and the other three mrp/plfs are changes in amino acids 77 (Ser to Pro) and 88 (Asp to His) that would disrupt two of the three putative N-glycosylation sites found on the other three MRP/PLF mature protein sequences.



View larger version (62K):
[in this window]
[in a new window]
 
Figure 2. Sequence comparisons of MRP4 with other MRP/PLFs. The nucleotide sequence of plf1 is compared with that of mrp4. The complete protein sequence of MRP4 is shown and sequences of the other three proteins are shown only where they differ from MRP4. The signal sequence is underlined. The amino acids that are changed in the N-glycosylation sites are italicized. The three putative glycosylation sites are identified by the boxes. The numbers to the left of the protein sequences show the position of the first amino acid in each row in the PLF1 protein sequence. Note that after position 166, the MRP4 sequence is two amino acids short of the other three sequences due to the deletion of amino acids 167 and 168 from the MRP4 sequence.

 
Other possibly significant alterations include a stretch of five amino acids from 103 to 107 in which there are four differences between MRP4 and PLF1. Also, there is an in-frame deletion of two amino acids 167 and 168. Secondary structure analysis by NNPREDICT query (30) predicts that the substitutions in MRP4 at positions 186 and 188 result in the loss of helical tendency in the four {alpha} carbons between 185 and 188.

Mrp4 expression in the placenta
Among the nucleotide sequence differences between the mrp/plfs is the presence of a NdeI site at +649 that is unique to mrp4. To obtain further evidence that the mrp4 gene accounts for the uncut portion of cDNA observed during later gestation, rather than a different mrp/plf that also lacks the BsofI/BstxI sites, diagnostic RT-PCR was carried out on placental RNAs using NdeI in place of BsofI and BstxI. Measured in this way, mrp4 is found at higher relative levels on days 13–15 than days 9–11 of gestation as was shown previously with the BsofI/BstxI cleavage (Fig. 1Go) (14). Thus, both diagnostic RT-PCR methods identify the same gene product, mrp4, as having a different expression pattern relative to plf1 and mrp3.

Measurements of the relative amounts of plf1, mrp3, and mrp4 in the placenta as a function of gestation showed that the proportion of mrp3 varied between about 50% and 75% of the total mrp/plf mRNA throughout gestation. The relative amounts of plf1 and mrp4 varied reciprocally (Fig. 3Go). The maximum proportion of mrp4 was reached on day 12 when it constituted about 40% of the mrp/plf mRNA in the placenta. At this time, the proportion of plf1 is at its lowest of about 13% from a high of about 35% on day 7 of gestation.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. Placental expression of the mrp/plfs. A, upper panel: Quantitation by diagnostic RT-PCR of the proportional expression of plf1, mrp3, and mrp4 by the placenta through gestation. These data were also used, along with the total amount of RNA determined by Northern blot analysis, to determine the relative amounts of each of the mrp/plf genes in gestation (13 ). The results shown are the average of four separate experiments in which different placental samples were analyzed. The values were averaged to obtain the results shown. As a result of different combinations of samples in each experiment, the values are the average of two (days 8,10,12,13) or four (days 9,11,15) separate values. Shown are the sample standard deviations. A, Lower panel: The expression of mrp4 was analyzed during gestation using the restriction endonuclease NdeI, which digests mrp4, but not the other identified mrp/plfs. Shown are averages of two experiments. B, Digestion pattern of the mrp/plf amplicons with NdeI.

 
MRP4 is glycosylated differently from PLF1
To determine how the loss of two potential N-glycosylation sites affects the glycosylation of MRP4, COS cells were transiently transfected with pcDNA3-MRP4 or pcDNA3-PLF1. Culture media and lysates of the transfected cells were analyzed by Western blot and compared with the MRP/PLFs found in placental homogenates (Fig. 4Go). As expected, PLF1 migrated with an apparent molecular weight ranging between 32K and 36K (13). By comparison, placental minces secrete MRP/PLFs of 27 kDa and 38 kDa. The 38-kDa MRP/PLF band was previously identified as containing MRP3 and PLF1 (14). MRP4 migrated at the same rate as the 27-kDa placental MRP/PLF. The 27-kDa MRP/PLF has a time course of appearance in gestation similar to that of the mrp4 mRNA.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4. Western blot of MRP/PLFs produced by transiently transfected COS cells compared with the MRP/PLF proteins present in the placenta. COS cells were transiently transfected with mammalian expression plasmids for MRP4 (4 ) and PLF1 (1) as described in Materials and Methods. Some cells (1T, 4T) were treated with 5 µg/ml tunicamycin for the last 24 h of incubation. Medium from the transfected cells and cell lysates were resolved by SDS-PAGE. 1, COS cells transfected with pcDNA3-PLF1; 4, COS cells transfected with pcDNA3-MRP4; 1T, 4T, tunicamycin-treated cell cultures transfected with pcDNA3-PLF1 or pcDNA3-MRP4 respectively; e11 and e14, homogenates of day 11 and 14 placentae, respectively. The positions of three molecular weight markers, ovalbumin (45 kDa), carbonic anhydrase (30 kDa), and myoglobin (18 kDa) are shown. The positions of PLF1 and MRP4 in cells and culture medium are marked on the left of the figure and the positions of PLF1 and MRP3, and MRP4 in the placental homogenates are noted on the right of the figure. The position of the nonglycosylated forms of PLF1 and MRP4 is also shown (NG).

 
PLF1 and MRP4 are polypeptides having the same apparent molecular weight. This is demonstrated by a comparison of the nonglycosylated forms of the two proteins (Fig. 4Go). The nonglycosylated forms of the MRP/PLFs, produced by transfected cells that were incubated with tunicamycin, migrated as expected for the 21K molecular weight proteins predicted from their cDNA sequences. These results demonstrate that the difference in electrophoretic migration rates between the two MRP/PLFs is due to their glycosylation. Thus, the loss of two glycosylation sites in the MRP4 sequence results in the addition of less carbohydrate to this protein compared with PLF1. The placental MRP with the same apparent size as the recombinant MRP4 produced by COS cells is more predominant in day 14 placental lysates than day 11 lysates. This is consistent with the delayed expression of MRP4 mRNA relative to PLF1 and MRP3 in the placenta (Fig. 3Go) (14).

Differential cell and tissue-specific expression of mrp/plf genes
Although mrp/plfs were initially demonstrated by Northern blot analysis to be expressed only in the placenta (6), we show here that the mrp/plfs are differentially expressed in a variety of mouse tissues (Fig. 5Go). Mrp/plf mRNAs were detected in the small intestine and tail but not in the liver, lungs, backskin, adult ribs, or large intestine. The same expression pattern was found in males and females. Mrp/plfs were detected in some, but not all, stomach samples and at low levels in some samples of backskin (data not shown). Mrp/plfs were also detected in 3T3 cells as expected from previous studies (13). The major mrp/plf expressed by 3T3 cells is plf1 consistent with the cloning of this mrp/plf from these cells (21). Samples incubated without reverse transcriptase showed no visible bands (Fig. 5AGo). Restriction analysis of radiolabeled cDNAs showed that the mouse tail produces only mrp4, whereas the small intestine and 3T3 cells produce mostly plf1 with lower levels of mrp3 (Fig. 5BGo). Mrp4 seems to be expressed at lower relative levels in the small intestine but is absent from 3T3 cells. The PCR product from cDNA reverse transcribed from whole tail RNA was sequenced, and the results confirmed that the mrp/plf sequence of the mRNA expressed in the tail is the same as that of the mrp4 cDNA cloned from day 13.5 placentae.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 5. Diagnostic RT-PCR demonstrates mrp/plf expression in several murine adult tissues. A, (top three panels): Mrp/plf sequences in RNA isolated from 2-month old CF-1 mouse liver, lungs, skin, tail, ribs, small intestine, large intestine, and 3T3 cells were amplified by RT-PCR as described in Materials and Methods. A control of water alone was also included. The initial reaction to create mrp/plf cDNA was done in the presence (+RT) or absence (-RT) of reverse transcriptase. The third panel down shows the result of amplifying with primers for G3PDH. B, (bottom panel): Mrp/plf cDNAs from e11 placenta, adult tail, ear, adult small intestine, and 3T3 cells were digested with BsoFI and BstXI. Shown are the results from two experiments with the two lanes on the right from the second experiment. The tail samples in the two experiments were from different animals. The results from digestions of the fragments isolated from plf1, plf2, mrp3, and mrp4 standard samples are also shown.

 
The mouse tail skin and the mouse ear skin express unique keratins that are different from those found in normal backskin. Therefore, RNA from the ear also was subjected to diagnostic RT-PCR and compared with the results from tailskin RNA (Fig. 5BGo). Although mrp/plf cDNA was not detected in most normal backskin samples (Fig. 5AGo), mrp/plf cDNAs were regularly identified in both the ears and tailskin where mrp4 was the only identified mrp/plf (Fig. 5BGo). Mrp4 also was the major mrp/plf species detected in the remainder of the tail after the skin was removed (data not shown).

Identification of the mrp4 promoter
To identify the mrp4 promoter, a series of cosmid clones containing mrp/plf sequences were screened for the presence of the mrp4 gene by several PCR-based assays. First, diagnostic PCR was performed between exons 3 and 4 on isolated cosmid clones containing mrp/plf hybridizing genes to identify specific mrp/plf-containing cosmids. Individual clones were identified that produced the predicted restriction digestion pattern for each of the mrp/plfs. Clear restriction patterns were obtained for five cosmid clones; two cosmids gave patterns specific for plf1 (cos4 and cos5), two gave mrp3-specific patterns (cos2 and cos3) and one gave the mrp4 restriction pattern (cos6). Clones that produced PCR products with mrp/plf-specific digestion patterns were also sequenced across the promoter region after PCR amplification starting with a primer in the common 5'UTR. By this method, the promoter known as plf42 was shown to be contiguous with the gene encoding plf1, the promoter plf149 corresponded to mrp4 and the mrp3 promoter corresponded to mrp3.

To confirm the promoter cDNA contiguities deduced from the cosmid clones, RT-PCR was performed using 5' primers that would amplify transcripts initiating at upstream promoters located between 140 or 230 bp of the normal transcriptional start site (data not shown). When performed on RNA from the tail (using primers DAP1 and NUE5), the promoter for mrp4 was confirmed to be plf149. Similarly for 3T3 cells, which express predominantly plf1, RT-PCR using M3V55 and UE5 produced upstream transcripts that corresponded to the plf42 promoter. As expected, the placental mrp3 cDNA was found to be linked to the mrp3 promoter when RT-PCR was performed using DAP1 and NUE5.

Localization of MRP4 in the hair follicles of the mouse tail
To determine the location of the MRP4 protein in the adult tail, immunohistochemistry was performed using a rabbit polyclonal anti-MRP/PLF serum. Binding of anti-MRP/PLF antibody was detected in the hair follicles of the tail skin (Fig. 6Go). The location of MRP/PLF in the hair follicles appeared to be limited to the keratinocytes that make up the outer root sheath. Preimmune sera did not stain these structures.



View larger version (116K):
[in this window]
[in a new window]
 
Figure 6. Immunodetection of MRP in the tail of the adult mouse. Sections of tail from a nonpregnant female FVB mouse were stained with anti-MRP/PLF antibody (A, top panel) or preimmune sera (B, bottom panel). Antibody stains the outer root sheath of the hair follicles (brown color, top panel). Similar results were obtained for male and female, CF-1 and FVB mice.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The MRP/PLFs exhibit several very important biological activities. They stimulate proliferation and angiogenesis and inhibit differentiation. However, until this report, they have only been demonstrated to be expressed in the placenta. There are between four and six mrp/plf genes in the mouse (20) and three of the cDNAs have been previously identified. Here, we describe the identification and cloning of a fourth mrp/plf (mrp4) that is transiently expressed during gestation in a manner distinct from the other mrp/plfs and which is uniquely expressed in the tail and ear of adult mice.

MRP4 is more different in sequence from the other three MRP/PLFs than are the other three MRP/PLFs from each other. Whereas MRP4 is 91% identical with PLF1, the other three MRP/PLFs (PLF1, PLF2 and MRP3) are 99% identical with each other. The MRP4 protein also is differently glycosylated because two differences in the amino acid sequence result in the loss of two potential N-glycosylation sites from MRP4 compared with the other MRP/PLFs. This difference in glycosylation might alter the stability of the protein, its interaction with receptors or its ability to move from one tissue to another. For example, we have demonstrated that the 27-kDa form of MRP/PLF in the placenta that we identified as MRP4 is not found in the bloodstream or the amniotic fluid of the pregnant mouse as are other MRP/PLFs (14).

Mrp4 expression peaks on day 12 of gestation. This is at a time during which expression of the other two mrp/plfs is decreasing (6, 14, 31). Interestingly, it is the same time at which proliferin-related protein (PRP) peaks (32). PRP is closely related in sequence to the mrp/plfs with 37% identity to PLF1 in amino acid sequence and 95% identity to PLF1 in the first 97 nucleotides (6). PRP opposes the effect of bFGF on angiogenesis, and the delayed increase in PRP expression in the placenta is proposed to effect a rapid inhibition of the angiogenic effects of the MRP/PLFs (16). Similar to MRP4, PRP is not found in the amniotic fluid, but unlike MRP4, PRP is found in maternal serum (32).

Individual members of the mrp/plf family are differentially regulated in vivo in both tissue-specific and temporal patterns. As well as being expressed in the placenta, the mrp/plfs are expressed in the small intestine, tail, and ear and sometimes were observed in the stomach. Although not detected in most samples of backskin, occasionally samples showed low levels of mrp/plf expression. This expression is mainly of mrp3 (Fassett, J. T., and M. Nilsen-Hamilton, manuscript in preparation). The mrp/plfs were not detected in the liver, lungs, ribs, and large intestines. Different mrp/plf genes are expressed in different tissues. Plf1 is the major form of mrp/plf mRNA expressed in the stomach, small intestine and 3T3 cells, while mrp3 is the major form expressed by the midgestational placenta. Mrp4 is the only form of mrp/plf expressed in the ear and tail skin. As we have shown a broader tissue expression pattern of the mrp/plfs beyond the placenta, which is their site of highest expression, so are other genes of the PRL/GH family found to be expressed in high levels in one primary tissue and secondarily in other tissues. Beyond its primary site of expression in the pituitary, PRL, the evolutionary precursor to the rodent utero/placental gene family, also is expressed in other tissues, including the dermis (33). The placental lactogens I and II are expressed in the testes in addition to their high levels of expression in the placenta (34).

By immunohistochemistry, the MRP4 protein is localized in the keratinocytes of the outer root sheath of the hair follicle in the tail. These cells may not be the site of the protein’s initial synthesis, but they are apparently the site of highest accumulation of MRP4. Thus, it is likely that the keratinocytes are either the source of MRP4 or the site of its action or perhaps both.

The observation that the mrp/plfs are expressed in a tissue-specific manner suggests that these genes are regulated by distinct factors. As well, the site of expression of MRP4 is specific to the location in the body, e.g. tail vs. back. This observation parallels those of the keratin gene family where the keratin pair of 48 kDa and 65 kDa is expressed specifically in suprabasal cells of the tail epidermis, in the filiform papillae of the tongue, and at low levels in suprabulbar cells of newborn hair follicles (35). In mice, a 70-kDa keratin (mk2e) is expressed specifically in the ear, tail, and footsole epidermis (36). The ear and tail are also the specific sites of mrp4 gene expression.

Here we have shown that the promoter for mrp4 is the previously cloned plf149 promoter and the plf42 promoter is the sequence upstream of the plf1 coding sequence (37). Although 98% homologous to the promoter for plf1 (plf42), the mrp4 (plf149) promoter is not stimulated by the addition of serum (37) or bFGF (38). Interestingly, there are a number of differences between the plf149 and mrp3 and plf42 promoters that affect recognizable regulatory elements. One of these changes affects the FGF response element (FRE) present in mrp3, which is disrupted in the other two promoters (38). This and other alterations in regulatory sequences are likely to be responsible for the differential expression of the mrp/plfs in mouse tissues.

In summary, we have identified a fourth mrp/plf gene with a distinct tissue expression pattern from the other mrp/plf genes. Despite the high identity in nucleotide sequence, it is striking that a large number of the differences in nucleotide sequence of the first 550 bp of these promoters result in alterations of recognizable regulatory element sequences. These observations suggest that the mrp/plf family may have evolved to take advantage of specific combinations of transcriptional regulatory elements for the regulation of mrp/plf gene expression in particular cell types or under special physiological conditions. The resulting MRP/PLF proteins, which are also 91% to 98% identical in amino acid sequence, may not differ in their function. However, there may be other differences. For example, the difference in glycosylation of MRP4 compared with MRP3 and PLF1 could result in altered stability or tissue access for MRP4, or MRP4 may interact with a different set of receptors. Thus, we suggest that MRP4 may function as a growth factor and/or angiogenesis factor in the vicinity of the hair follicle in the tail and ear as MRP3 and PLF1 are proposed to do in the placenta.


    Acknowledgments
 
We thank Lee Bendickson for his help in the maintaining the laboratory and its cell and plasmid stocks and for his preparation of materials for sequencing. Our thanks go also to Pierig Lepont for his useful commentary and careful review of the manuscript. We are very grateful to David Denhardt, Jiandie Lin, and Daniel Linzer for providing plasmids and cosmids for these studies.


    Footnotes
 
1 This work was funded in part by Grant HD-29087 from the National Institute of Child and Human Development and by the Iowa Agricultural Experiment Station in Ames, Iowa. Journal paper No. J-18539 of the Iowa Agriculture and Home Economics Experiment Station, Ames, IA; Project No. 3096. Back

Received September 23, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Chen EY, Liao YC, Smith DH, Barrera-Saldana HA, Gelinas RE, Seeburg PH 1989 The human growth hormone locus: nucleotide sequence, biology, and evolution. Genomics 4:479–497[CrossRef][Medline]
  2. Soares MJ, Muller H, Orwig KE, Peters TJ, Dai G 1998 The uteroplacental prolactin family and pregnancy. Biol Reprod 58:273–284[Free Full Text]
  3. Colosi P, Ogren L, Thordarson G, Talamantes F 1987 Purification and partial characterization of two prolactin-like glycoprotein hormone complexes from the midpregnant mouse conceptus. Endocrinology 120:2500–2511[Abstract]
  4. Colosi P, Talamantes F, Linzer DI 1987 Molecular cloning and expression of mouse placental lactogen I complementary deoxyribonucleic acid. Mol Endocrinol 1:767–776[Abstract]
  5. Jackson LL, Colosi P, Talamantes F, Linzer DI 1986 Molecular cloning of mouse placental lactogen cDNA. Proc Natl Acad Sci USA 83:8496–8500[Abstract/Free Full Text]
  6. Linzer DI, Lee SJ, Ogren L, Talamantes F, Nathans D 1985 Identification of proliferin mRNA and protein in mouse placenta. Proc Natl Acad Sci USA 82:4356–4359[Abstract/Free Full Text]
  7. Lin J, Poole J, Linzer DI 1997 Three new members of the mouse prolactin/growth hormone family are homologous to proteins expressed in the rat. Endocrinology 138:5541–5549[Abstract/Free Full Text]
  8. Lin J, Poole J, Linzer DI 1997 Two novel members of the prolactin/growth hormone family are expressed in the mouse placenta. Endocrinology 138:5535–5540[Abstract/Free Full Text]
  9. Muller H, Orwig KE, Soares MJ 1998 Identification of two new members of the mouse prolactin gene family. Biochim Biophys Acta 1396:251–258[Medline]
  10. Dai G, Chapman BM, Liu B, Orwig KE, Wang D, White RA, Preuett B, Soares MJ 1998 A new member of the mouse prolactin (PRL)-like protein-C subfamily, PRL-like protein-C{alpha}: structure and expression. Endocrinology 139:5157–5163[Abstract/Free Full Text]
  11. Dai G, Wolfe MW, Soares MJ 1999 Distinct regulatory regions from the prolactin-like protein C variant promoter direct trophoblast giant cell versus spongiotrophoblast cell-specific expression. Endocrinology 140:4691–4698[Abstract/Free Full Text]
  12. Ishibashi K, Imai M 1999 Identification of four new members of the rat prolactin/growth hormone gene family. Biochem Biophys Res Commun 262:575–578[CrossRef][Medline]
  13. Nilsen-Hamilton M, Shapiro JM, Massoglia SL, Hamilton RT 1980 Selective stimulation by mitogens of incorporation of 35S-methionine into a family of proteins released into the medium by 3T3 cells. Cell 20:19–28[CrossRef][Medline]
  14. Fang Y, Lepont P, Fassett J, Ford SP, Mubaidin A, Hamilton RT, Nilsen-Hamilton M 1999 Signaling Between the Placenta and the Uterus Involving the Mitogen-Regulated Protein/Proliferins. Endocrinology 140:5239–5274[Abstract/Free Full Text]
  15. Lee SJ, Talamantes F, Wilder E, Linzer DI, Nathans D 1988 Trophoblastic giant cells of the mouse placenta as the site of proliferin synthesis. Endocrinology 122:1761–1768[Abstract]
  16. Jackson D, Volpert OV, Bouck N, Linzer DI 1994 Stimulation and inhibition of angiogenesis by placental proliferin and proliferin-related protein. Science 266:1581–1584[Abstract/Free Full Text]
  17. Nelson JT, Rosenzweig N, Nilsen-Hamilton M 1995 Characterization of the mitogen-regulated protein (proliferin) receptor. Endocrinology 136:283–288[Abstract]
  18. Wilder EL, Linzer DI 1989 Participation of multiple factors, including proliferin, in the inhibition of myogenic differentiation. Mol Cell Biol 9:430–441[Abstract/Free Full Text]
  19. Muscat GE, Gobius K, Emery J 1991 Proliferin, a prolactin/growth hormone-like peptide represses myogenic- specific transcription by the suppression of an essential serum response factor-like DNA-binding activity. Mol Endocrinol 5:802–814[Abstract]
  20. Jackson-Grusby LL, Pravtcheva D, Ruddle FH, Linzer DI 1988 Chromosomal mapping of the prolactin/growth hormone gene family in the mouse. Endocrinology 122:2462–2466[Abstract]
  21. Linzer DI, Nathans D 1984 Nucleotide sequence of a growth-related mRNA encoding a member of the prolactin-growth hormone family. Proc Natl Acad Sci USA 81:4255–4259[Abstract/Free Full Text]
  22. Wilder EL, Linzer DI 1986 Expression of multiple proliferin genes in mouse cells. Mol Cell Biol 6:3283–3286[Abstract/Free Full Text]
  23. Connor AM, Waterhouse P, Khokha R, Denhardt DT 1989 Characterization of a mouse mitogen-regulated protein/proliferin gene and its promoter: a member of the growth hormone/prolactin gene superfamily. Biochim Biophys Acta 1009:75–82[Medline]
  24. Volpert O, Jackson D, Bouck N, Linzer DI 1996 The insulin-like growth factor II/mannose 6-phosphate receptor is required for proliferin-induced angiogenesis. Endocrinology 137:3871–3876[Abstract]
  25. Jackson D, Linzer DI 1997 Proliferin transport and binding in the mouse fetus. Endocrinology 138:149–155[Abstract/Free Full Text]
  26. Nilsen-Hamilton M, Hamilton RT, Alvarez-Azaustre E 1987 Relationship between mitogen-regulated protein (MRP) and proliferin (PLF), a member of the prolactin/growth hormone family. Gene 51:163–170[CrossRef][Medline]
  27. Kingston RE 1987 Transfection of DNA into eukaryotic cells. In: FM Ausubel, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (eds) Current Protocols in Molecular Biology. Greene Publishing Associates and John Wiley Liss & Sons, Inc., New York, NY, pp 9.1.1–9.1.4
  28. Nilsen-Hamilton M, Hamilton R 1987 Detection of proteins induced by growth regulators. Methods Enzymol 147:427–444[Medline]
  29. Allen MP, Nilsen-Hamilton M 1998 Granzymes D, E, F, and G are regulated through pregnancy and by IL-2 and IL-15 in granulated metrial gland cells. J Immunol 161:2772–2779[Abstract/Free Full Text]
  30. Kneller DG, Cohen FE, Langridge R 1990 Improvements in protein secondary structure prediction by an enhanced neural network. J Mol Biol 214:171–182[CrossRef][Medline]
  31. Nilsen-Hamilton M, Jang YJ, Alvarez-Azaustre E, Hamilton RT 1988 Regulation of the production of a prolactin-like protein (MRP/PLF) in 3T3 cells and in the mouse placenta. Mol Cell Endocrinol 56:179–190[CrossRef][Medline]
  32. Colosi P, Swiergiel JJ, Wilder EL, Oviedo A, Linzer DI 1988 Characterization of proliferin-related protein. Mol Endocrinol 2:579–586[Abstract]
  33. Ben-Jonathan N, Mershon JL, Allen DL, Steinmetz RW 1996 Extrapituitary prolactin: distribution, regulation, functions, and clinical aspects. Endocr Rev 17:639–669[CrossRef][Medline]
  34. Untergasser G, Kranewitter W, Schwarzler P, Madersbacher S, Dirnhofer S, Berger P 1997 Organ-specific expression pattern of the human growth hormone/placental lactogen gene-cluster in the testis. Mol Cell Endocrinol 130:53–60[CrossRef][Medline]
  35. Tobiasch E, Winter H, Schweizer J 1992 Structural features and sites of expression of a new murine 65 kD and 48 kD hair-related keratin pair, associated with a special type of parakeratotic epithelial differentiation. Differentiation 50:163–178[CrossRef][Medline]
  36. Rentrop M, Nischt R, Knapp B, Schweizer J, Winter H 1987 An unusual type-II 70-kilodalton keratin protein of mouse epidermis exhibiting postnatal body-site specificity and sensitivity to hyperproliferation. Differentiation 34:189–200[CrossRef][Medline]
  37. Linzer DI, Mordacq JC 1987 Transcriptional regulation of proliferin gene expression in response to serum in transfected mouse cells. Embo J 6:2281–2288[Medline]
  38. Mohideen MAK, Hruska-Hageman A, Nilsen-Hamilton M 1999 A unique bFGF-responsive transcriptional element. Gene 237:81–90[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
D. O. Wiemers, L.-j. Shao, R. Ain, G. Dai, and M. J. Soares
The Mouse Prolactin Gene Family Locus
Endocrinology, January 1, 2003; 144(1): 313 - 325.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. J. Toft, S. B. Rosenberg, G. Bergers, O. Volpert, and D. I. H. Linzer
Reactivation of proliferin gene expression is associated with increased angiogenesis in a cell culture model of fibrosarcoma tumor progression
PNAS, October 16, 2001; (2001) 231364798.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. T. Fassett and M. Nilsen-Hamilton
Mrp3, a Mitogen-Regulated Protein/Proliferin Gene Expressed in Wound Healing and in Hair Follicles
Endocrinology, May 1, 2001; 142(5): 2129 - 2137.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. J. Toft, S. B. Rosenberg, G. Bergers, O. Volpert, and D. I. H. Linzer
Reactivation of proliferin gene expression is associated with increased angiogenesis in a cell culture model of fibrosarcoma tumor progression
PNAS, November 6, 2001; 98(23): 13055 - 13059.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by FASSETT, J. T.
Right arrow Articles by NILSEN-HAMILTON, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by FASSETT, J. T.
Right arrow Articles by NILSEN-HAMILTON, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals