Endocrinology Vol. 141, No. 5 1882-1892
Copyright © 2000 by The Endocrine Society
Enhanced Growth of MCF-7 Breast Cancer Cells Overexpressing Parathyroid Hormone-Related Peptide1
Miriam Falzon and
Pingfeng Du
Department of Pharmacology and Toxicology, and Sealy Center for
Molecular Science, University of Texas Medical Branch, Galveston, Texas
77555
Address all correspondence and requests for reprints to: Miriam Falzon, Ph.D., Department of Pharmacology and Toxicology, 10th and Market Streets, The University of Texas Medical Branch, Galveston, Texas 77555-1031. E-mail: mfalzon{at}utmb.edu
 |
Abstract
|
|---|
PTH-related peptide (PTHrP) is a secreted protein produced by breast
cancer cells both in vivo and in vitro.
Because of its structural similarity to PTH at the amino terminus, the
two proteins interact with a common cell surface receptor, the
PTH/PTHrP receptor. When overproduced by tumor cells, PTHrP enters the
circulation, giving rise to the common paraneoplastic syndrome of
humoral hypercalcemia of malignancy. Although initially discovered in
malignancies, PTHrP is now known to be produced by most cells and
tissues in the body. It acts as an autocrine and paracrine mediator of
cell proliferation and differentiation, effects which are mediated via
the PTH/PTHrP receptor. Recent evidence also has shown that, directly
after translation, PTHrP is able to enter the nucleus and/or nucleolus
and influence cell cycle progression and apoptosis. In this study, we
have either overproduced PTHrP or inhibited endogenous PTHrP production
in the breast cancer cell line, MCF-7. Overexpression of PTHrP was
associated with an increase in mitogenesis, whereas inhibiting
endogenous PTHrP production resulted in decreased cell proliferation.
The overexpressed peptide targeted to the perinuclear space. In
contrast, PTHrP interaction with the cell surface PTH/PTHrP receptor
resulted in decreased cell proliferation in the same cell line. This
latter effect is dependent on interaction with the receptor, in that
exogenously added PTHrP moieties known not to interact with the
receptor had no effect on cell growth. Furthermore, neutralization of
added peptide with an anti-PTHrP antiserum completely abolished the
growth inhibitory effects. In contrast, this antibody has no effect on
the increased proliferation rate of the MCF-7 transfectants that
overexpress PTHrP, compared with control cells. The net effect of
autocrine/paracrine and intracrine effects of PTHrP in MCF-7 cells
overproducing the peptide is accelerated cell growth. These findings
have critical implications regarding the role of PTHrP in breast
cancer, and they suggest that controlling PTHrP production in breast
cancer may be useful therapeutically.
 |
Introduction
|
|---|
PTH-RELATED peptide (PTHrP) was originally
identified as the causative agent of humoral hypercalcemia of
malignancy (HHM), one of the most frequent paraneoplastic syndromes
(1, 2, 3, 4, 5, 6). The amino terminus of PTHrP shares structural similarity to PTH
(7, 8); and consequently, the two peptides interact with a common G
protein-coupled cell surface receptor, the PTH/PTHrP receptor (9, 10, 11, 12).
Hence, when tumor-derived PTHrP enters the circulation, it activates
receptors in classic PTH-sensitive organs, such as bone and kidney, and
elicits PTH-like activity that gives rise to HHM (1, 4, 13).
Malignancy-associated hypercalcemia is a very common complication in
breast cancer patients, because breast cancers frequently secrete high
levels of PTHrP (14, 15, 16).
Although initially discovered in malignancies, PTHrP is now known to be
produced by most cells and tissues in the body (6, 17, 18, 19). Unlike PTH,
PTHrP does not circulate in appreciable amounts in normal subjects but
is thought to exert its effects in an autocrine/paracrine manner. After
translation, PTHrP enters the secretory pathway; during its transit,
the peptide is proteolytically cleaved at basic residues, to yield a
family of mature secretory forms of the peptide (17, 18, 20, 21). In
view of its widespread distribution in normal cells, functions
unrelated to calcium homeostasis have been ascribed to PTHrP, including
modulation of cell growth and differentiation. Indeed, the peptide has
now been shown to modulate growth in normal cells such as keratinocytes
(22), vascular smooth muscle cells (23), and chondrocytes (24) and in
transformed cells such as prostate cancer (25) and renal carcinoma (26)
cells.
In addition to effects that are mediated via signal transduction
cascades initiated at membrane receptors, there is evidence for an
intracellular role for PTHrP in cell cycle progression and apoptosis
(27, 28, 29). The PTHrP molecule contains a midregion nuclear localization
sequence (NLS) that localizes PTHrP to the nucleus or nucleolus (22, 23, 28, 30). The NLS comprises multibasic clusters in the 88106
region, similar to nuclear or nucleolar localization signals found in
viral and mammalian transcription factors (31). In fact, PTHrP has been
localized in the nucleus/nucleolus of chondrocytes, transfected COS
cells, and vascular smooth muscle cells (23, 28). Deletion of the NLS
prevents this targeting (23, 28), and expression of the multibasic
87106 region as a fusion protein with the ß-galactosidase gene
directs the ß-galactosidase protein to the nucleolus (28).
Most breast cancer cells secrete higher levels of PTHrP than do normal
breast cells (1, 7). PTHrP is also closely linked to normal mammary
gland function and is expressed by human breast epithelium (32). It is
found in considerable amounts in the milk of several mammalian species,
including human (33, 34, 35). Its expression is enhanced during lactation,
when the mammary gland is in a proliferative state and mobilization and
transfer of calcium to the milk are required (36). In fact, PTHrP is
thought to control the proliferation/differentiation that is linked to
the compensatory growth of the mammary gland during lactation (37, 38).
Primary cultures of mammary epithelial cells from lactating rats
secrete PTHrP in vitro (39). Studies in transgenic mice have
shown the involvement of the peptide in branching morphogenesis of the
mammary gland, again indicating active participation of the peptide in
normal mammary development (40). The biological relevance of PTHrP in
the breast is further underscored by studies in knockout mice, where
the absence of PTHrP leads to mammary epithelial cell degeneration
(41).
It has thus been suggested that production of PTHrP by breast
carcinomas may reflect uncontrolled activation in the tumor cells of
pathways normally operative in lactation (37). Therefore, the effects
of PTHrP on breast cancer cell growth are of both biological and
clinical significance. We were interested in studying the growth
effects of PTHrP in the breast cancer cell line, MCF-7. Here, we report
that PTHrP exerts opposing mitogenic and antimitogenic effects,
depending on whether it is acting via the intracrine or
autocrine/paracrine pathways, respectively, and that the net effect of
PTHrP overexpression in MCF-7 cells is accelerated cell growth.
 |
Materials and Methods
|
|---|
Materials
Synthetic human (h) PTHrP(116), hPTHrP(134),
hPTHrP(186), hPTHrP(107139), and hPTH(134) were purchased from
Bachem (Torrance, CA). Synthetic
[Leu11,
D-Trp12]hPTHrP-(734) amide and
[Asn10,
Leu11]hPTHrP-(734) amide, and the PTH
antagonist bovine (b) PTH(334) were purchased from Peninsula Laboratories, Inc. (Belmont, CA). Recombinant PTHrP(1139) was
prepared by the IMPACT (Intein Mediated Purification with an Affinity
Chitin-binding Tag) method (New England Biolabs, Inc.,
Beverly, MA) (Wu, C., P. K. Seitz, and M. Falzon, manuscript
submitted). Peptide stocks (10-4 M)
were prepared in 10 mM acetic acid. Forskolin, 8-bromo-cAMP
(8Br-cAMP), and tetradecanoyl phorbol 13-acetate (TPA) were purchased
from Sigma (St. Louis, MO). Rabbit antiserum to
recombinant hPTHrP([-5 to +139) was kindly provided by Dr. C. W.
Cooper (University of Texas Medical Branch).
Plasmids and oligonucleotides
The PTHrP constructs expressing PTHrP in the sense or antisense
orientation were constructed by cloning hPTHrP complementary DNA (cDNA)
coding for amino acids -5 to +139 (a generous gift from Dr. W. I.
Wood, Genentech, Inc., South San Francisco, CA) in the
expression vectors pCDNA3.1 (+) or (-) (Invitrogen, San
Diego, CA), respectively [(+) and (-) refer to the orientation of the
multiple cloning site within the vector, relative to the direction of
transcription from the T7 promoter]. These constructs, as well as
pCDNA3.1(+) as the empty vector control, were transfected into MCF-7
cells by the calcium phosphate coprecipitation technique. The DNA
template used to prepare the sense and antisense probes for Northern
blot analysis was a 231-bp DNA fragment spanning exons 3 and 4 of the
hPTHrP gene (43, 44).
A phosphorothioated antisense oligodeoxynucleotide was used to inhibit
PTHrP production in MCF-7 cells. This oligomer (5' CCGCTGCATCGTCTC 3';
Genosys, Woodlands, TX) is complimentary to the translation start site
of the PTHrP gene. A phosphorothioated sense oligodeoxynucleotide (5'
GAGACGATGCAGCGG 3'), whose sequence spans the PTHrP translation start
site, was used as negative control. These oligomers were used to treat
MCF-7 cells, as described below.
Cell culture and stable transfection
MCF-7 cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and were grown at
37 C in a humidified 95% O2-5%
CO2 atmosphere in DMEM (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% FBS (Atlanta
Biologicals, Norcross, GA) and L-glutamine. For cell
proliferation experiments, cells were grown in the amount of FBS
specified in the Results section.
MCF-7 cells were stably transfected by the calcium phosphate
coprecipitation technique, according to the manufacturers
specifications (Promega Corp., Madison, WI). Two days
after transfection, 600 µg/ml G418 (Geneticin; Life Technologies, Inc./BRL) was added, and resistant clones were
selected. Single clones of stably transfected cells, isolated by
limiting dilution in 96-well plates, were transferred to individual
flasks and cultured in medium containing 150 µg/ml G418. Individual
clones were tested for PTHrP production using an immunoradiometric
assay (described below), and endogenous and transfected messenger RNAs
(mRNAs) were detected by Northern blot analysis (also described
below).
Northern blot analysis
Total RNA was isolated using RNA STAT-60 (Tel-Test
B, Friendswood, TX), and mRNA was prepared using the mRNA Isolator
kit (CLONTECH Laboratories, Inc., Palo Alto, CA). RNA gel
electrophoresis was performed under standard conditions (45) using 15
µg of total RNA or 2 µg of mRNA. The RNA was then blotted onto
nitrocellulose (Schleicher & Schuell, Inc., Keene, NH) by
capillary action. Probes for hybridization were prepared by the
asymmetric PCR (46). The PCR template was a 231-bp DNA fragment
spanning exons 3 and 4 of the hPTHrP gene (43, 44). To detect
endogenous RNA and RNA produced by the transfected sense PTHrP
construct, an antisense probe was prepared using the downstream primer
from exon 4 of the hPTHrP gene (5'-GTTAGGGGACACCTCCGAGGT-3'). RNA
produced as a result of transfection with the antisense PTHrP construct
was detected using the upstream primer (5'- CTGGTTCAGCAGTGGAGCGTC-3')
from exon 3 of the hPTHrP gene, to prepare a sense probe. The blots
were prehybridized for 30 min and hybridized for 2 h in Expresshyb
(CLONTECH Laboratories, Inc.) at 68 C. After
hybridization, the blots were washed twice in 2 x SSC (1 x
SSC is 0.15 M NaCl plus 0.15 M sodium citrate),
0.05% SDS for 15 min at room temperature, and then twice in 0.1
x SSC, 0.1% SDS at 65 C for 30 min. The washed membranes were exposed
to Kodak X-Omat film (Eastman Kodak Co.,
Rochester, NY), at -70 C, with intensifying screens.
To control for equal RNA loading and transfer, the membranes were also
probed with a DNA fragment containing cyclophilin sequences (47),
labeled by the random primer extension reaction using a multiprime
labeling kit (Amersham Pharmacia Biotech, Arlington
Heights, IL). After autoradiography, the intensities of the bands
representing PTHrP and cyclophilin were evaluated using the Sigmagel
program (Jandel Scientific, San Rafael, CA).
PCR
PCR was used to confirm the integrity of the transfected sense
and antisense PTHrP and of the transfected empty vector control.
Genomic DNA from transfected cells was prepared using DNA Isolator
(Tel-Test B), per the manufacturers specifications.
PCR was carried out using the following primers: upstream, the T7
primer (5' TAATACGACTCACTATAGGG 3'); and downstream, the pCDNA3.1
reverse primer (5' TAGAAGGCACAGTCGAGG 3'). These primers recognize
sequences within the pCDNA3.1 vector. After initial denaturation of the
template at 94 C for 5 min, PCR was carried out for 30 cycles as
follows: denaturing at 94 C for 30 sec, annealing at 60 C for 45 sec,
and extension at 72 C for 45 sec. After gel electrophoresis to assess
its size, the PCR product was sequenced to ascertain the integrity of
the insert.
Immunoprecipitation
Rabbit antiserum to human recombinant PTHrP(-5 to +139) was
used to immunoprecipitate PTHrP secreted into the culture medium. This
antiserum shows the same pattern of immunostaining using skin or
gastrointestinal tissues, as does a rabbit antiserum to synthetic
hPTHrP(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), and staining could be abolished by prior adsorption of
the antiserum with its antigen (48). This antiserum to recombinant
PTHrP has not yet been fully characterized with synthetic PTHrP
fragments to determine the major epitopes that it recognizes (48).
The antiserum-antigen (PTHrP) complex contained in the conditioned
medium was immunoprecipitated using staphylococcal protein A-Sepharose
beads (Sigma). A 100-µl aliquot of protein A beads (10%
vol/vol in 0.02 M disodium hydrogen phosphate, 0.015
M sodium chloride) was added, and the mixture was incubated
overnight at 4 C with rocking. The beads were then collected by
centrifugation at 10,000 x g for 15 sec at 4 C. The
supernatant was collected, concentrated, and analyzed for PTHrP by the
radioimmunometric assay described below. Immunoprecipitation of
conditioned medium from cell cultures to which preimmune rabbit serum
was added served as control.
Immunoassay for secreted PTHrP
The amount of PTHrP secreted into the culture medium was
measured using a immunoradiometric sandwich assay (Nichols Institute Diagnostics, San Juan Capistrano, CA), as previously
described (43). Single clones of transfected cells and control
(untransfected) cells were plated in 24-well dishes (5 x
104 cells/well). The medium was replaced after
24 h. Conditioned medium was collected after a further 5 days and
frozen at -80 C for future use, and the cell number was determined
using a Coulter counter. Before assay, aliquots of the conditioned
medium (range, 0.41 ml, calculated to represent conditioning by the
same number of cells) were concentrated to 0.2 ml by acetone
precipitation. This concentration procedure did not cause a significant
loss of PTHrP (
95% recovery). Similarly concentrated unconditioned
medium (never exposed to cells) served as a negative control. The assay
was carried out per the manufacturers specifications. The detection
limit of the assay is 0.7 pmol/liter (49).
PTHrP immunocytochemistry
PTHrP was detected using an avidin-biotin-immunoperoxidase
method (Vector Laboratories, Inc., Burlingame, CA). Cells
grown on Lab-Tek chamber slides (Nalge Nunc International,
Naperville, IL) were washed with cold PBS, fixed in acetone for 10 min
at -20 C, washed again with PBS, and then treated with 2% hydrogen
peroxide for 5 min at room temperature to inactivate endogenous
peroxidase. Labeling was carried out using a kit from Oncogene Research
Products (Cambridge, MA), per the manufacturers specifications. Cells
were first preincubated with diluted normal horse serum for 20 min at
room temperature, followed by primary antibody (anti-PTHrP mouse
monoclonal IgG) for 60 min at room temperature. Control cells received
no primary antibody. After washing in cold PBS, cells were treated with
biotinylated antimouse secondary antibody for 30 min at room
temperature. The cells were washed again in PBS and then treated with
avidin-biotin-horseradish peroxidase complex (Vector Laboratories, Inc.) for 30 min at room temperature. After
washing with PBS, cells were exposed to diaminobenzidine for 5
min. The percentage of cells whose nuclei stained positively were
counted in a blinded fashion by two observers using computerized
histomorphometry (Optimus Corp., Bothell, WA).
Measurement of intracellular cAMP levels
MCF-7 cells were plated into 24-well dishes, at 5 x
104 cells/well, in DMEM containing 10% FBS. When
the cells were nearly confluent, the medium was removed and replaced
with PBS containing 1 mM calcium chloride, 15% NuSerum
(Collaborative Biomedical Products, Bedford, MA), 1 mM
magnesium chloride, 20 mM HEPES, 85 U/ml
Trasylol (FBA Pharmaceuticals, New York, NY), 0.2% BSA,
0.1% glucose, and 1 µM isobutylmethylxanthine
(IBMX, Sigma), and the indicated concentrations of
hPTHrP(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), hPTH(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), bPTH(3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), [Leu11,
D-Trp12]hPTHrP-(734) amide,
[Asn10,
Leu11]hPTHrP-(734) amide, salmon calcitonin,
or secretin. Incubation was carried out for 15 min at room temperature.
After removal of medium, cells were rinsed twice with 1 ml ice-cold
PBS, and 500 µl cold 10% trichloroacetic acid was added. After
centrifugation, trichloroacetic acid supernatants were frozen at -70 C
until assayed for cAMP. Cell precipitates were dissolved in 1
N sodium hydroxide, and protein was measured by the
Bradford assay (50) (Bio-Rad Laboratories, Inc., Hercules,
CA). The RIA for cAMP was carried out as previously described (51). For
assay, aliquots of supernatant were neutralized with calcium carbonate
and acetylated to increase sensitivity.
125I-succinylated cAMP was purchased from
Amersham Pharmacia Biotech, and goat antiserum to
succinylated cAMP (kindly provided by Dr. G. A. Nickols, Monsanto,
St. Louis, MO) was used at a final dilution of 1:200,000.
Experimental design; cell proliferation
To measure the effects of added PTHrP peptides on cell
proliferation, MCF-7 cells were plated into 24-well dishes at
104 cells/well in medium containing 10% FBS. In
some experiments, cells were transferred to medium containing 2.5%
serum after 24 h. After a further 24 h, cells were treated
with the different hPTHrP peptides, forskolin, 8Br-cAMP or TPA at the
indicated concentrations for the indicated time intervals. Control
cells received an equivalent volume of vehicle. Cells were counted
after 3 or 5 days of treatment. When cells were treated with peptides
for 5 days, the growth medium was replaced with fresh
peptide-containing medium after 3 days. The cells were then trypsinized
and counted in a Coulter counter (Coulter Electronics Inc., Hialeah, FL).
Anti-PTHrP(-5 to +139) antiserum was used to neutralize secreted PTHrP
and exogenously added PTHrP(134) or (186). Cells were plated into
24-well dishes at 104 cells/well in medium
containing 10% FBS. After 24 h, cells were transferred to medium
containing 2.5% FBS (day 0). Cells were then treated with anti-PTHrP
antiserum or preimmune rabbit serum as control (final concentration 2%
vol/vol), with or without 10-7 M
PTHrP(134) or PTHrP(186). After 72 h, the cell culture medium
was collected for immunoprecipitation, the supernatant was assayed for
PTHrP by the immunoradiometric assay, and cells were then trypsinized
and counted.
To measure the effects of over- or underexpression of PTHrP on cell
proliferation, cells were plated into 24-well dishes at
104 cells/well in medium containing 10%
serum, then transferred to medium containing 2.5% serum after 24
h (day 0). Cells were then trypsinized and counted at days 1, 3, 5, and
8.
Anti-PTHrP(-5 to +139) antiserum was used to neutralize secreted PTHrP
in sense PTHrP- or empty vector-transfected cells. Cells were plated
into 24-well dishes at 104 cells/well in medium
containing 10% FBS. After 24 h, cells were transferred to medium
containing 2.5% serum (day 0), and anti-PTHrP antiserum was added in
concentrations (% vol/vol) ranging from 0.55%. Preimmune rabbit
serum was used as control. At days 1, 3, 5, and 8, the cell culture
medium was collected for immunoprecipitation, the supernatant was
assayed for PTHrP by immunoassay, and the cells were then trypsinized
and counted.
To measure the effects of inhibition of PTHrP synthesis on MCF-7 cell
proliferation, cells were plated into 24-well dishes at
104 cells/well in medium containing 10% serum,
then transferred to 2.5% serum after 24 h. After a further
24 h, the cells were treated with either antisense or sense
phosphorothioated oligonucleotide (in a concentration range of 15
µM). Three or 5 days after treatment, the culture medium
was collected for measurement of secreted PTHrP by the
immunoradiometric assay. Cells were then trypsinized for counting.
Thymidine incorporation assay
For these experiments, cells were plated in 24-well plates at
104 cells/well in medium containing 10% FBS.
After 24 h, cells were transferred to medium containing 2.5%
serum. In some experiments, cells were treated with the indicated
hPTHrP fragments (10-7 M). After 3
days (when exogenous peptides were added) or 8 days (when comparing
sense PTHrP-, antisense PTHrP- and empty vector-transfected cells) in
culture, the cells were pulse-treated with
[3H]thymidine (0.2 µCi/ml) for 2 h. To
determine [3H]thymidine incorporation, the cell
monolayer was washed twice with PBS, and a fraction of the cells was
counted with a Coulter counter. The nucleic acids in the rest of the
cell fraction were precipitated with trichloroacetic acid and
solubilized with sodium hydroxide for scintillation counting. The
results were expressed as counts per number of cells.
Statistics
Numerical data are presented as the mean ±
SEM. Data were analyzed by ANOVA, with t tests,
to determine the statistical significance of differences.
 |
Results
|
|---|
MCF-7 cells express functional PTH/PTHrP receptors
MCF-7 cells express the PTH/PTHrP receptor (52). To assess whether
these receptors are functional, we measured cAMP accumulation in
response to hPTHrP(134) and hPTH(134). MCF-7 cells showed an
increase in cAMP production in response to both peptides (Fig. 1
and Table 1
). The ability of hPTHrP(134) and
hPTH(134) to induce a cAMP response in MCF-7 cells was dose-related
between 0.1 and 100 nM; cAMP production reached a plateau
at 10 nM with both peptides (Fig. 1
). The
ED50 for PTH(134) in the ROS 17/2.8 (rat
osteosarcoma) cell line, which is a classical positive control for
PTH/PTHrP receptor studies, is 3 nM (53), a value
similar to that obtained in MCF-7 cells (Fig. 1
). This indicates that
PTH/PTHrP receptors behave in a classical manner in MCF-7 cells. In
contrast, the structurally unrelated peptides salmon calcitonin and
secretin, as well as hPTHrP(107139), which do not interact with the
PTH/PTHrP receptor, had no effect on cAMP production, even at 1
µM (Table 1
). Similarly, two PTHrP antagonists,
[Leu11,
D-Trp12]hPTHrP-(734) amide and
[Asn10,
Leu11]hPTHrP-(734) amide, and the PTH
antagonist bPTH(3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), did not increase cAMP in these cells (Table 1
).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 1. Dose-dependent cAMP response of MCF-7 cells. Cells
were exposed to hPTHrP(134) () or hPTH(134) ( ) in the
presence of isobutylmetylxanthine, as describe in Materials and
Methods. Each point is the mean ±
SEM of three independent experiments (three wells per
treatment). The amount of protein was 18.4 ± 0.7 µg/well.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1. cAMP response of MCF-7 breast cancer cells to
hPTHrP(134), hPTH(134), PTHrP analogs, and peptides unrelated
structurally to PTHrP
|
|
Exogenously added PTHrP peptides decrease cell proliferation
The rate of proliferation of parental MCF-7 cells in culture
medium to which PTHrP peptides had been added was examined. Addition of
hPTHrP(134) and (186) to cells cultured in 2.5% serum decreased
cell proliferation in a concentration-dependent manner (Fig. 2A
). The two peptides were equipotent,
with peak inhibition (
40% decrease in cell number after 3 days
treatment) occurring with concentrations of 10-7
M or higher (Fig. 2A
). Concentrations of
10-8 M and lower produced proportionately
smaller effects for each peptide (Fig. 2A
). MCF-7 cells exposed to
hPTHrP(134) or (186) in culture medium containing 10% serum
required higher concentrations of PTHrP(134) or (186) for growth
inhibition, such that a 35% decrease in cell number was observed with
10-6 M peptide (data not
shown).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 2. Effects of exogenously added PTHrP peptides on
MCF-7 cell proliferation. Cells were plated in 10% FBS at a density of
104 cells/well, in 24-well dishes, then transferred to
2.5% serum after 24 h. Treatment was initiated after a further
24 h. After 72 h, cells were trypsinized, and cell numbers
were determined using a Coulter counter. C, Control (no treatment). The
numbers along the x-axis indicate the molar
concentrations of the various treatments [PTHrP moieties, forskolin,
8-bromo-cAMP (8Br-cAMP), or TPA] employed. A, PTHrP moieties that are
known to interact with the cell surface PTH/PTHrP receptor; B, peptides
which do not interact with the receptor; *, significantly different
from control at P < 0.001; #, significantly
different from control at P < 0.05.
|
|
We also examined the effects of recombinant hPTHrP(1139) on MCF-7
cell proliferation. This peptide showed approximately the same profile
as the N-terminal fragments hPTHrP(134) and (186), reducing the
cell number by approximately 50% at a concentration of
10-8 M (Fig. 2A
). Again, the effects on cell
growth were greater when the culture medium contained 2.5% serum, as
opposed to 10% serum (data not shown).
Growth inhibition was also observed in cells exposed to 8Br-cAMP and
forskolin (Fig. 2A
), supporting the idea that the growth effects may be
cAMP-mediated and that the PTH/PTHrP receptor is coupled to adenylyl
cyclase in MCF-7 cells. TPA also inhibited cell growth (Fig. 2A
),
suggesting that the receptor may also be coupled to phospholipase C in
these cells.
PTHrP(116) did not affect cell growth (Fig. 2B
), presumably because
this peptide does not interact with the cell surface PTH/PTHrP
receptor. Similarly, hPTHrP(27139) and (107139), which lack the N
terminus, had no effect on cell growth (Fig. 2B
).
Exposing MCF-7 cells to hPTHrP(134), (186), or (1139) for 5 days
produced slightly larger inhibition of cell growth (
10% greater
effect), compared with the 3-day treatment (data not shown).
hPTHrP(116), (27139), and (107139) still produced no effect after
a 5-day treatment (data not shown).
These results were confirmed using the
[3H]thymidine incorporation assay.
PTHrP(134), (186), and (1139), at a concentration of
10-7 M, decreased thymidine incorporation by
3550% after 3 days of treatment; whereas PTHrP(116), (27139),
and (107139) had no effect (data not shown).
PTHrP antibody neutralizes the effects of added peptides
Anti-PTHrP(-5 to +139) antiserum was used to confirm the
growth-inhibitory effects of added PTHrP peptides on MCF-7 cells.
Secreted PTHrP was neutralized with 2% (vol/vol) antiserum, and the
PTHrP-antiserum complex was removed by immunoprecipitation.
Immunoradiometric measurement of PTHrP in the culture medium detected
negligible residual amounts of PTHrP after 3 days in culture (
80%
decrease). Neutralization of endogenously produced and secreted PTHrP
resulted in an increase of approximately 20% in MCF-7 cell growth
(Fig. 3
), presumably because the
endogenous peptide inhibits MCF-7 cell growth. The antiserum also
neutralized the effects of added hPTHrP(134) and (186), such that a
10-7 M concentration of each of the
peptides did not inhibit cell proliferation (Fig. 3
). In contrast, each
of the peptides inhibited MCF-7 cell proliferation by approximately
40% in the presence of preimmune serum (Fig. 3
). Preimmune serum alone
(2% vol/vol) had no effect on cell growth (Fig. 3
). These results
confirm that added PTHrP peptides affect cell growth by acting at the
cell surface and that endogenous PTHrP acting at the cell surface
inhibits MCF-7 cell growth.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 3. Effects of neutralizing secreted and exogenous
PTHrP on cell proliferation in MCF-7 cells. Cells were plated, at
104 cells/well in 24-well dishes, in medium containing 10%
FBS, then transferred to 2.5% FBS after 24 h. After a further
24 h, anti-PTHrP(-5 to +139) antiserum was added to a final
concentration of 2% vol/vol, in the presence or absence of
PTHrP(134) or PTHrP(186). Control cells received preimmune serum.
After 72 h, cells were trypsinized, and the cell number was
determined in a Coulter counter. Each bar is the
mean ± SEM of three independent experiments (four
wells per experiment), after subtracting the background value. *,
Significantly different from control at P < 0.001;
#, significantly different from control at P <
0.05.
|
|
Establishment of cell lines over- or underexpressing PTHrP
The effect of transfection with a construct expressing PTHrP mRNA
in the antisense orientation on the endogenous PTHrP mRNA levels was
examined by Northern blot analysis (Fig. 4A
, where data are shown for two clones
per treatment). Equivalent quantities of endogenous PTHrP transcript
were observed in sense PTHrP- and empty vector-transfected MCF-7 cells.
However, the endogenous transcript was not detected in cells
transfected with a vector expressing antisense PTHrP mRNA (Fig. 4A
).
Untransfected MCF-7 cells expressed the same level of transcript as
sense and empty vector transfectants (data not shown). Transfected
sense PTHrP mRNA was only detected in cells transfected with the sense
PTHrP expression construct (Fig. 4B
). This transcript was not detected
in empty vector- or antisense PTHrP-transfected cells (Fig. 4B
)
[longer exposure of blots from empty vector and sense
PTHrP-transfected cells showed the presence of endogenous RNA (data not
shown)]. The antisense transcript was only expressed in
antisense-transfected cells, and it was absent in both sense PTHrP- and
empty vector-transfected cells (Fig. 4C
).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 4. Characterization of MCF-7 cells over- or
under-expressing PTHrP. Northern blot analysis of mRNA to detect
endogenous transcript (A) or total RNA to detect transfected transcript
(B and C), and PCR analysis of genomic DNA (D) from cells transfected
with a vector expressing sense PTHrP mRNA (SN), antisense PTHrP mRNA
(AS), or the vector control (V). In (A), (B), and (C), the probe was
prepared by asymmetric PCR of a cDNA fragment spanning exons 3 and 4 of
the hPTHrP gene, as described in Materials and Methods.
The position of the 28 S and 18 S ribosomal bands is indicated.
Top panel, PTHrP mRNA; bottom panel,
cyclophilin mRNA. Two clones each are shown for vector, sense, and
antisense transfectants. In (D), PCR was carried out using genomic DNA
and the T7 and pCDNA3 reverse primers, described in Materials
and Methods. The arrows point to the PCR product
(176 bp for V and 678 bp for SN and AS).
|
|
The presence and integrity of the integrated PTHrP sense- and
antisense-transfected sequences, as well as the integrity of the
transfected vector sequences, were confirmed by carrying out PCR on
genomic DNA. As shown in Fig. 4D
, a 176-bp amplimer was detected in
empty vector-transfected cells, and a 678-bp amplimer, corresponding to
vector plus PTHrP sequences, was detected in cells transfected with
sense and antisense PTHrP-expression constructs. No amplimer was
detected in untransfected cells (data not shown).
PTHrP secretion was measured by immunoassay, where data are again shown
for two clones per treatment. The amount of PTHrP secreted by control
cells is 1.3 ± 0.04 pM. Transfection with the sense
construct produced a significant increase in PTHrP production, whereas
transfection with the antisense construct decreased PTHrP production
(Fig. 5
). PTHrP secretion from the empty
vector-transfected cells was not significantly different from that of
untransfected cells (Fig. 5
).

View larger version (17K):
[in this window]
[in a new window]
|
Figure 5. PTHrP secretion by sense and antisense PTHrP
transfectants. Conditioned medium from MCF-7 cells transfected with a
vector expressing either sense or antisense PTHrP was collected after 5
days in culture and concentrated; secreted PTHrP was measured by the
immunoradiometric sandwich assay. U, Untransfected (parent) cells; V,
empty vector-transfected cells; AS, cells expressing antisense PTHrP;
SN, cells expressing sense PTHrP. Two independent clones are shown for
each transfectant. Each bar is the mean ±
SEM of four wells, obtained after subtracting the
background value, represented by unconditioned medium (not exposed to
cells). Asterisks, Significant differences from
untreated (P < 0.001).
|
|
PTHrP overexpression increases cell proliferation
The growth rates of cells stably transfected with PTHrP(-5 to
+139) in the sense or antisense orientation are shown in Fig. 6
. The proliferation rate of MCF-7 clones
overexpressing PTHrP was more rapid than that of empty
vector-transfected cells, such that, after 8 days in culture, the cell
number of the two PTHrP-overexpressing clones was about twice that of
the empty vector-transfected clones. On the other hand, the growth rate
of two antisense PTHrP-transfected clones was significantly less than
that of the empty vector-transfected clones. The rate of proliferation
of untransfected MCF-7 cells was the same as that of the
vector-transfected clones (data not shown).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 6. Proliferation of MCF-7 cells over- or
underexpressing PTHrP. Cells were plated in 10% FBS at a density of
104 cells/well in 24-well dishes, then transferred to 2.5%
serum after 24 h. At the indicated time intervals, cells were
trypsinized, and cell numbers were determined using a Coulter counter.
Two independent clones per transfectant are shown (open
and closed symbols). , , Transfected with empty
vector alone; , , sense PTHrP transfectants; , , antisense
PTHrP transfectants. Each point is the mean ±
SEM of three independent experiments (six wells per
experiment). *, Significantly different from control (empty vector
transfectant) at P < 0.001; #, significantly
different from control at P < 0.05.
|
|
The differences in the rate of proliferation of the sense- and
antisense-transfected cells, compared with empty vector-transfected
cells, was confirmed using the [3H]thymidine
incorporation assay. After 8 days in culture, sense PTHrP increased
(whereas antisense PTHrP decreased) thymidine incorporation, compared
with vector-transfected clones (data not shown).
Neutralization of secreted PTHrP does not affect the increased cell
proliferation of sense PTHrP-transfected cells
To establish a role for nuclear PTHrP in the increased rate of
proliferation of sense PTHrP-transfected cells, secreted PTHrP was
neutralized with increasing amounts of anti-PTHrP(-5 to +139)
antiserum. Immunoradiometric measurement of PTHrP in culture
medium from sense PTHrP- and empty vector-transfected MCF-7 cells
(after immunoprecipitation of the PTHrP-antiserum complex) confirmed
that there was negligible free PTHrP in the culture medium (Fig. 7A
). Preimmune serum had no effect on
secreted PTHrP levels (Fig. 7A
). Anti-PTHrP antiserum did not eliminate
the growth advantage of sense PTHrP-transfected MCF-7 cells over the
empty vector-transfected counterparts. Thus, the rate of proliferation
of sense PTHrP-transfected cells was still significantly higher than
that of vector-transfected cells (Fig. 7B
). In fact, anti-PTHrP
antiserum-treated sense PTHrP-transfected cells proliferated
approximately 1520% faster than the same cells not exposed to
anti-PTHrP antiserum, presumably because the anti-PTHrP antiserum
neutralized secreted PTHrP, which normally has a growth-inhibitory
effect on MCF-7 cells (Fig. 3
). Preimmune serum had no effect on cell
growth (Fig. 7C
). These results suggest that PTHrP accelerates cell
growth via an intracrine mechanism in these transfected cells.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 7. Effects of neutralizing secreted PTHrP on cell
proliferation of PTHrP-overexpressing MCF-7 cells. A, Effect of
addition of PTHrP antiserum or preimmune serum on free secreted PTHrP
levels. Sense PTHrP transfectants were plated in 24-well plates at
104 cells/well in medium containing 10% FBS. After 24
h, cells were transferred to medium containing 2.5% FBS, and the
indicated concentrations of PTHrP(-5 to +139) antiserum or preimmune
serum were added (day 0). After 5 days in culture, the culture medium
was collected for immunoprecipitation, the supernatant was
concentrated, and PTHrP was measured by immunoassay. Two independent
clones, represented by the open and closed
bars, are shown. Each bar is the mean ±
SEM of three independent experiments (three wells per
antiserum concentration), after subtracting the background value,
represented by unconditioned medium (not exposed to cells). B and C,
Effect of treatment with anti-PTHrP antiserum to deplete secreted PTHrP
(B) or preimmune serum as control (C) on cell proliferation. At the
indicated time intervals, cells were trypsinized, and cell numbers were
determined using a Coulter counter. Two independent clones per
transfectant are shown (open and closed
symbols). , , Transfected with empty vector; , ,
sense PTHrP transfectants; , , sense PTHrP transfectants cultured
in the presence of anti-PTHrP antiserum (3% vol/vol). Each
point is the mean ± SEM of three
independent experiments (three wells per experiment). *, Significantly
different from control (vector transfectant) at P
< 0.001.
|
|
Overexpressed PTHrP targets to the nucleus
Immunocytochemistry was used to detect the presence of PTHrP in
the transfected and control MCF-7 cells. PTHrP-overexpressing cells
showed both nuclear and cytoplasmic staining (Fig. 8A
). Cytoplasmic staining was present in
all the cells, whereas perinuclear staining was present in
approximately 5% of nuclei. Perinuclear staining was most often
associated with cells in the process of, or just completing, cell
division (Fig. 8A
). Empty vector-transfected cells showed less intense
cytoplasmic staining, and perinuclear staining was observed in less
than 1% of nuclei (Fig. 8B
). Again, perinuclear staining was observed
in cells that were dividing or that had just completed cell division.
Control untransfected cells showed the same pattern of staining as
vector-transfected cells (data not shown). Antisense PTHrP-transfected
cells showed no cytoplasmic or perinuclear staining (Fig. 8C
). Cells
stained in the absence of primary antibody showed no cytoplasmic or
nuclear staining (data not shown).

View larger version (75K):
[in this window]
[in a new window]
|
Figure 8. Immunocytochemical staining for PTHrP in
PTHrP-overexpressing MCF-7 cells. A, Cells overexpressing PTHrP show
both nuclear and cytoplasmic staining. Note that nuclear staining
showed a perinuclear localization, and that the most prominent nuclei
occur in cells that have just undergone, or are undergoing, cell
division. B, Empty vector-transfected cells show less intense
cytoplasmic staining. Nuclear staining was observed in less than 1% of
nuclei but was still seen in dividing cells. C, Antisense-PTHrP
transfectants showed no cytoplasmic or nuclear staining.
|
|
Inhibition of PTHrP production decreases cell proliferation
Further proof that the overall effect of endogenously produced
PTHrP is increased MCF-7 cell proliferation was obtained using
antisense oligodeoxynucleotide technology. To inhibit PTHrP production,
MCF-7 cells were treated with a phosphorothioated antisense
oligonucleotide spanning the translational start site of the PTHrP
gene. After 3 or 5 days of treatment, immunoradiometric measurement of
PTHrP in culture medium showed a decrease in PTHrP secretion of 65 and
80%, respectively, compared with cells treated with a oligomer having
the sense sequence (Fig. 9A
). Treatment
with the latter oligomer had no effect on PTHrP secretion, compared
with an untreated control (Fig. 9A
).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 9. Effect of inhibition of PTHrP production on
MCF-7 cell proliferation. Cells were plated at 104
cells/well in 24-well dishes in medium containing 10% FBS. After
24 h, they were transferred to 2.5% FBS. After a further 24
h, cells were treated with a phosphorothioated oligodeoxynucleotide
(final concentration 5 µM) whose sequence is antisense to
the PTHrP translation start site (lanes AS). As a control, cells were
treated with a phosphorothioated oligodeoxynucleotide with the same
sequence as the PTHrP translational start site (lanes SN). Treatment
was for 3 or 5 days, as indicated in parentheses.
AS- and SN-oligodeoxynucleotide-treated cells were compared with
untreated control cells (lane U). A, Effect on PTHrP secretion; B,
effect on cell proliferation. Each bar is the mean
± SEM of three independent experiments (six wells per
experiment). *, Significantly different from control at
P < 0.001.
|
|
Treatment with the antisense oligomer (5 µM for 3 or 5
days) decreased cell proliferation by approximately 30% (Fig. 9B
). The
sense oligomer had no significant effect on cell growth, compared with
untreated controls (Fig. 9B
). These results indicate that the net
effect of endogenous PTHrP is increased cell proliferation, consistent
with the increase in cell proliferation observed with MCF-7 cells
overexpressing the peptide (Fig. 6
).
 |
Discussion
|
|---|
Breast cancer cells secrete high levels of PTHrP, accounting for
the high prevalence of HHM in breast cancer patients (14, 15, 16). In fact,
immunohistochemical and in situ hybridization analyses have
shown that staining for PTHrP and its transcript is more prevalent in
primary breast tumors and bone metastases than in nonbone secondary
foci (14, 32, 54, 55). In cancer patients, the effects of PTHrP
on calcium levels are mediated via PTHrP entering the circulation and
activating the PTH/PTHrP receptors in classic PTH organs (such as bone
and kidney), resulting in HHM (1, 4, 13).
PTHrP regulates growth and differentiation in virtually every cell and
tissue examined (17). Studies in transgenic mice have demonstrated that
PTHrP is required for normal mammary development (41), normal
chondrocyte maturation and differentiation in the epiphyseal growth
plate (19), and normal epidermal and hair follicle development (56).
Targeted overexpression of PTHrP in the pancreatic isle leads to
increased pancreatic ß-cell mass (57). PTHrP also modulates growth in
prostate cancer cells (25), Leydig tumor cells (58), renal carcinoma
cells (26), vascular smooth muscle (23) cells, and osteoblasts (59, 60). Proliferative vs. antiproliferative effects seem to be
dependent on the cell type. For example, here, we show that in MCF-7
cells, exogenous PTHrP(134), (186), and (1139) decrease cell
proliferation (Fig. 2
). The same effects have been reported in vascular
smooth muscle cells (23). Conversely, in prostate cancer cell lines,
addition of exogenous PTHrP(134) stimulates cell proliferation
(25).
In MCF-7 cells, PTHrP exerts an antimitogenic effect when acting via
the cell surface PTH/PTHrP receptor. Thus, blocking the effects of
endogenously secreted PTHrP at the cell surface, using an anti-PTHrP
antiserum, resulted in an increased rate of proliferation of MCF-7
cells (Fig. 3
). In addition, the growth inhibitory effects of
exogenously added N-terminal PTHrP moieties were eliminated with the
same anti-PTHrP antiserum (Fig. 3
). Non-N-terminal PTHrP moieties known
not to interact with the receptor, [PTHrP(107139) and
PTHrP(27139)] had no effect on cell growth in MCF-7 cells (Fig. 2
).
Therefore, we conclude that PTHrP action through the
autocrine/paracrine pathway exerts an antiproliferative effect. These
results differ from those of Birch et al. (52), who found a
mitogenic response to PTHrP(134) in the same cell line. However,
these authors reported that such an effect could only be obtained using
quiescent MCF-7 cells, whereas our studies were carried out using
rapidly proliferating cells, more like growing breast tumors.
In addition to its well-documented effects elicited through signal
transduction cascades, recent studies have shown that PTHrP also acts
in an intracrine fashion after translocation to the nucleus or
nucleolus (23, 27, 28, 29, 30). Immunocytochemistry and immunoelectron
microscopy studies have localized PTHrP in the nuclear compartment of
MCF-7 cells (Fig. 8
), as well as in keratinocytes, chondrocytes,
osteoblasts, transfected COS cells, and vascular smooth muscle cells
(23, 27, 28, 29). Nuclear translocation is dependent on the presence of a
bipartite NLS, which consists of two clusters of basic amino acids
separated by a spacer (
10-residue) (31). The NLS is found in some
transcription factors (such as c-fos and c-jun),
various nuclear proteins (such as p53, CDC16, and Ab1), several steroid
hormone receptors [such as the thyroid ß, glucocorticoid
, and
androgen receptors (22, 31)], growth factors [such as members of the
fibroblast growth factor family (61)], and human retroviral proteins
[such as the HIV Tat protein (62)].
The NLS is responsible for targeting PTHrP to the nucleus, because
deletion of either of the basic amino acid clusters prevents nuclear
targeting in COS cells (28) and vascular smooth muscle cells (23).
Moreover, expression of the 88106 region as a fusion protein with the
ß-galactosidase gene in COS cells targets ß-galactosidase (normally
a cytosolic protein) to the nuclear compartment (28). These studies
clearly suggest that PTHrP can be targeted to the nucleus under normal
circumstances, where it has been shown to alter cell function. In our
current study, we show that overexpression of PTHrP in MCF-7 cells
results in a dramatic stimulatory effect on cell proliferation (Fig. 6
). Massfelder et al. (23) report a similar effect in
vascular smooth muscle cells, and Henderson et al. (28) have
shown that nucleolar PTHrP is associated with an inhibitory effect on
apoptosis.
The mitogenic effect of PTHrP is linked with nuclear localization in
various systems. Thus, in MCF-7 cells, the overexpressed peptide showed
a perinuclear pattern in approximately 5% of nuclei (Fig. 8
). In
contrast, very few nuclei (<1%) stained positive for PTHrP in the
parent cell line. Significantly, perinuclear staining was most often
associated with cells that were either in the process of or had just
completed cell division, indicating an involvement of PTHrP in cell
cycle regulation. Though definitive proof that the growth stimulatory
effects of PTHrP are mediated via nuclear localization of the peptide
would require deletion of the NLS, with consequent elimination of both
nuclear localization of the peptide and increased cell proliferation,
our data clearly suggest that the mitogenic effects of PTHrP are
mediated via the intracrine pathway. Similar effects were reported in
vascular smooth muscle cells (23), where approximately 5% of nuclei
from PTHrP-overexpressing cells clearly stained positive for the
peptide, and nuclear targeting was associated with dividing cells.
Although PTHrP is clearly targeted to the nucleus in a number of
systems, its precise localization seems to vary in different cell
types. Thus, the peptide showed a perinuclear localization in MCF-7
cells (Fig. 8
), a reticulated diffuse nuclear pattern in vascular
smooth muscle cells (23), and a nucleolar localization in chondrocytes
and osteoblasts (28), and in a human keratinocyte cell line (29). At
present, it is unknown whether this difference is a reflection of the
different cell types under study, or whether it depends on the
different antisera employed.
The mechanism by which nuclear accumulation of PTHrP activates the cell
cycle, thereby increasing proliferation, in MCF-7 and other cell types
(23, 28, 29), at present, is unknown. The peptide may interact with key
proteins involved in cell cycle regulation and/or with nucleic acids.
Though no specific protein interactions have been identified to date, a
recent study has shown that the peptide can interact with both
homopolymeric and total cellular RNA (63). This interaction is mediated
via a core motif localized within the NLS that is shared by other
RNA-binding proteins that are targeted to the nucleolus, such as
nucleolin (64) and the retroviral Tat (62). Because the nucleolus is
the major site for biogenesis of ribosomes, nucleolar PTHrP may
influence cellular functions by modulating ribosomal RNA synthesis,
either by affecting RNA polymerase I activity or by altering ribosome
assembly and/or function. Whether the perinuclear (in MCF-7 cells) or
diffuse nuclear [in vascular smooth muscle cells (23)] localization
of PTHrP mediates alternative intranuclear modes of action for the
peptide, at present, is unknown.
PTHrP has joined the ever-increasing list of peptide hormones and
growth factors that elicit their biological responses in a dual manner,
through interaction with cell surface receptors linked to signal
transduction cascades and through intranuclear localization. Other
examples include insulin, epidermal growth factor, platelet-derived
growth factor, fibroblast growth factors, angiogenin, and PRL (reviewed
in Ref. 65). PTHrP, which contains a signal sequence that directs the
nascent peptide to the secretory pathway, must avoid the endoplastic
reticulum and remain in the cytoplasmic compartment before its nuclear
translocation. Various potential mechanisms have been proposed, which
include use of alternative, non-AUG translational start sites,
internalization of the ligand-receptor complex by endocytosis, and
reverse translocation or dislocation from the endoplasmic reticulum
lumen to the cytoplasm (reviewed in Refs. 30, 65). Definitive proof
in favor of one or more of these mechanisms has yet to be provided.
In summary, this study shows that PTHrP produces opposing mitogenic and
antimitogenic actions in the breast cancer cell line MCF-7. This cell
line, which produces relatively low levels of the peptide, provides a
good model to study the effects of PTHrP overexpression. When acting
via the autocrine/paracrine pathway, mediated through the cell surface
PTH/PTHrP receptor, PTHrP decreases cell proliferation. Conversely,
when acting through the intracrine pathway, the peptide dramatically
stimulates cell growth. The proliferative effects of overexpressed
PTHrP seem to predominate, in that overexpression of the peptide
results in accelerated cell growth. These results were confirmed using
antisense oligodeoxynucleotide technology. Inhibition of PTHrP
synthesis using an antisense oligodeoxynucleotide, which blocks
translation of the peptide, resulted in a net decrease in MCF-7 cell
proliferation (Fig. 9
). We have preliminary data which show that PTHrP
exerts the same pattern of effects in another breast cancer cell line,
MDA-MB-231. We feel that our findings have important implications for
the role of PTHrP in breast cancer. Because PTHrP imparts a growth
advantage to breast cancer cells, controlling production of the peptide
in breast cancer may be therapeutically useful.
 |
Acknowledgments
|
|---|
We wish to thank Dr. Cary W. Cooper for supplying the anti-PTHrP
antiserum, and Dr. P. K. Seitz for help with the cAMP assay. We
also wish to thank Drs. C. W. Cooper, D. Konkel, P. K. Seitz,
and M. L. Thomas for critical reading of the manuscript.
 |
Footnotes
|
|---|
1 This work was supported by a research grant from the National
Institutes of Health. 
Received October 4, 1999.
 |
References
|
|---|
-
Burtis WJ, Wu T, Bunch C, Wysolmerski JJ, Insogna
KL, Weir EC, Broadus AE, Stewart AF 1987 Identification of a novel
17,000 dalton parathyroid hormone-like adenylate cyclase-stimulating
protein from a tumor associated with humoral hypercalcemia of
malignancy. J Biol Chem 262:71517156[Abstract/Free Full Text]
-
Moseley JM, Kubota M, Diefenbach-Jagger H, Wettenhall
REH, Kemp BE, Suva LJ, Rodda CP, Ebeling PR, Hudson PJ, Zajac JD,
Martin TJ 1987 Parathyroid hormone-related protein purified from a
human lung cancer cell line. Proc Natl Acad Sci USA 84:50485052[Abstract/Free Full Text]
-
Suva LJ, Winslow GA, Wettenhall REH, Hammonds RG,
Moseley JM, Diefenbach-Jagger H, Rodda CP, Kemp BE, Rodriguez H, Chen
EY, Hudson PJ, Martin TJ, Wood WI 1987 A parathyroid
hormone-related protein implicated in malignant hypercalcemia: cloning
and expression. Science 237:893896[Abstract/Free Full Text]
-
Broadus AE, Mangin M, Ikeda K, Insogna KL, Weir EC,
Burtis WJ, Stewart AF 1988 Humoral hypercalcemia of cancer. N
Engl J Med 319:556563[Medline]
-
Martin TJ, Moseley JM, Gillespie MT 1991 Parathyroid hormone-related protein: biochemistry and molecular
biology. Crit Rev Biochem Mol Biol 26:377395[Medline]
-
Stewart AF, Insogna KL, Broadus AE 1995 Malignancy-associated hypercalcemia. In: DeGroot L (ed) Endocrinology,
ed 3. Saunders, Philadelphia, pp 10611074
-
Stewart AF, Wu T, Goumas D, Burtis WJ, Broadus AE 1987 N-terminal amino-acid sequence of two novel tumor-derived
adenylate cyclase-stimulating proteins: identification of parathyroid
hormone-like and -unlike domains. Biochem Biophys Res Commun 146:672678[CrossRef][Medline]
-
Strewler GJ, Stern PH, Jacobs JW, Eveloff J, Klein RF,
Leung SC, Rosenblatt M, Nissenson RA 1987 Parathyroid hormone-like
protein from human renal carcinoma cells. Structural and functional
homology with parathyroid hormone. J Clin Invest 80:18031807
-
Jüppner H, Abou-Samra A-B, Uneno S, Gu W-X, Potts
Jr JT, Segre GV 1988 The parathyroid hormone-like peptide
associated with humoral hypercalcemia of malignancy and parathyroid
hormone bind to the same receptor on the plasma membrane of ROS 17/2.8
cells. J Biol Chem 263:85578560[Abstract/Free Full Text]
-
Nissenson RA, Diep D, Strewler GJ 1988 Synthetic
peptides comprising the amino-terminal sequence of a parathyroid
hormone-like protein from human malignancies. Binding to parathyroid
hormone receptors and activation of adenylate cyclase in bone cells and
kidney. J Biol Chem 263:1286612871[Abstract/Free Full Text]
-
Jüppner H, Abou-Samra A-B, Freeman M, Kong XF,
Schipani E, Richards J, Kolakowski Jr LF, Hock J, Potts Jr JT,
Kronenberg HM, Segre GV 1991 A G protein-linked receptor for
parathyroid hormone and parathyroid hormone-related peptide. Science 254:10241026[Abstract/Free Full Text]
-
Abou-Samra A-B, Jüppner H, Force T, Freeman MW,
Kong X-F, Schipani E, Urena P, Richards J, Bonventre JV, Potts JT,
Kronenberg HM, Segre GV 1992 Expression cloning of a common
receptor for parathyroid hormone and parathyroid hormone-related
peptide from rat osteoblast-like cells: a single receptor stimulates
intracellular accumulation of both cAMP and inositol triphosphates and
increases intracellular free calcium. Proc Natl Acad Sci USA 89:27322736[Abstract/Free Full Text]
-
Burtis WJ, Brady TG, Orloff JJ, Ersbak JB, Warrell RP,
Olson BR, Wu TL, Mitnick ME, Broadus AE, Stewart AF 1990 Immunochemical characterization of circulating parathyroid
hormone-related protein in patients with humoral hypercalcemia of
cancer. N Engl J Med 322:11061112[Abstract]
-
Southby J, Kissin MW, Danks JA, Hayman JA, Moseley JM,
Henderson MA, Bennett RC, Martin TJ 1990 Immunohistochemical
localization of parathyroid hormone-related protein in human breast
cancer. Cancer Res 50:77107716[Abstract/Free Full Text]
-
Ikeda K, Mangin M, Dreyer BE, Webb AC, Posillico JT,
Stewart AF, Rander NH, Weir EC, Insogna KL, Broadus AE 1988 Identification of transcripts encoding a parathyroid hormone-like
peptide in messenger RNAs from a variety of human and animal tumors
associated with humoral hypercalcemia of malignancy. J Clin Invest 81:20102016
-
Francini G, Maiolo E, Petriolo E, Paffetti P, Gonnelli
S, Aquino A 1993 Production of parathyroid hormone and parathyroid
hormone-related protein by breast cancer cells in culture. J Cancer Res
Clin Oncol 119:421425[CrossRef][Medline]
-
Philbrick WM, Wysolmerski JJ, Galbraith S, Holt E,
Orloff JJ, Yang KH, Vasavada RC, Weir EC, Broadus AE, Stewart AF 1996 Defining the role of parathyroid hormone-related protein in normal
physiology. Physiol Rev 76:127173[Abstract/Free Full Text]
-
Yang KH, Stewart AF 1996 The PTH-related protein
gene and protein products. In: Bilezikian JP, Riasz L, Rodan G (eds)
Principles of Bone Biology. Academic, San Diego, pp 347376
-
Karaplis AC, Luz A, Glowacki J, Bronson RT, Tybulewicz
VLJ, Kronenberg HM, Mulligan RC 1994 Lethal skeletal dysplasia
from targeted disruption of the parathyroid hormone-related peptide
gene. Genes Dev 8:277289[Abstract/Free Full Text]
-
Wu T, Vasavada R, Yang K, Massfelder T, Ganz M, Abbas
SK, Care AD, Stewart AF 1996 Structural and physiologic
characterization of the midregion secretory species of parathyroid
hormone-related protein. J Biol Chem 271:2437124381[Abstract/Free Full Text]
-
Plawner LL, Philbrick WM, Burtis WJ, Broadus AE, Stewart
AF 1995 Cell type-specific secretion of parathyroid
hormone-related protein via the regulated versus the constitutive
secretory pathway. J Biol Chem 270:1407814084[Abstract/Free Full Text]
-
Kaiser SM, Laneuville P, Bernier SM, Rhim JS, Kremer R,
Goltzman D 1992 Enhanced growth of a human keratinocyte cell line
induced by antisense RNA for parathyroid hormone-related peptide. J
Biol Chem 267:1362313628[Abstract/Free Full Text]
-
Massfelder T, Dann P, Wu TL, Vasavada R, Helwig J-J,
Stewart AF 1997 Opposing mitogenic and antimitogenic actions of
parathyroid hormone-related protein in vascular smooth muscle
cells: a critical role for nuclear targeting. Proc Natl Acad Sci USA 94:1363013635[Abstract/Free Full Text]
-
Henderson JE, He B, Goltzman D, Karaplis AC 1996 Constitutive expression of parathyroid hormone-related peptide (PTHrP)
stimulates growth and inhibits differentiation of CFK2 chondrocytes.
J Cell Physiol 169:3341[CrossRef][Medline]
-
Iwamura M, Abrahamsson PA, Foss KA, Wu G, Cockett AT,
Deftos LJ 1994 Parathyroid hormone-related protein: a potential
autocrine growth regulator in human prostate cancer cell lines. Urology 43:675679[CrossRef][Medline]
-
Burton PBJ, Moniz C, Knight DE 1990 Parathyroid
hormone related peptide can function as an autocrine growth factor in
human renal cell carcinoma. Biochem Biophys Res Commun 167:11341138[CrossRef][Medline]
-
Kaiser SM, Sebag M, Rhim JS, Kremer R, Goltzman D 1994 Antisense-mediated inhibition of parathyroid hormone-related
peptide production in a keratinocyte cell line impedes differentiation.
Mol Endocrinol 8:139147[Abstract/Free Full Text]
-
Henderson JE, Amikuza N, Warshawsky H, Biasotto D,
Lanske BMK, Goltzman D, Karaplis AC 1995 Nucleolar localization of
parathyroid hormone-related peptide enhances survival of chondrocytes
under conditions that promote apoptotic cell death. Mol Cell Biol 15:40644075[Abstract]
-
Lam MHC, Olsen SL, Rankin WA, Ho PWM, Martin TJ,
Gillespie MT, Moseley JM 1997 PTHrP and cell division: expression
and localization of PTHrP in a keratinocyte cell line (HaCaT) during
the cell cycle. J Cell Physiol 173:433446[CrossRef][Medline]
-
Nguyen MTA, Karaplis AC 1998 The nucleus: a target
site for parathyroid hormone-related peptide (PTHrP) action. J
Cell Biochem 70:193199[CrossRef][Medline]
-
Dingwall C, Laskey RA 1991 Nuclear targeting
sequencesa consensus? Trends Biochem Sci 16:478481[CrossRef][Medline]
-
Liapis H, Crouch EC, Grosso LE, Kitazawa S, Wick MR 1993 Expression of parathyroid like protein in normal, proliferative
and neoplastic human breast tissues. Am J Pathol 143:11691178[Abstract]
-
Budayr AA, Halloran BP, King JC, Diep D, Nissenson RA,
Strewler GJ 1989 High levels of parathyroid hormone-like protein
in milk. Proc Natl Acad Sci USA 86:71837185[Abstract/Free Full Text]
-
Thurston AW, Cole JA, Hillman LS, Im JH, Thorne PK,
Krause WJ, Jones JR, Eber SL, Forte LR 1990 Purification and
properties of parathyroid hormone-related peptide isolated from milk.
Endocrinology 126:11831190[Abstract/Free Full Text]
-
Thiede MA, Rodan GA 1988 Expression of a calcium
mobilizing parathyroid hormone-like peptide in lactating mammary
tissue. Science 242:278280[Abstract/Free Full Text]
-
Ratcliffe WA 1992 Role of parathyroid
hormone-related protein in lactation. Endocrinology 37:402404[CrossRef]
-
Khosla S, van Heerden JA, Gharib H, Jackson IT, Danks J,
Hayman JA, Martin TJ 1990 Parathyroid hormone-related protein and
hypercalcemia secondary to massive mammary hyperplasia. N Engl
J Med 322:1157[Medline]
-
Wysolmerski J, Daifotis A, Broadus A, Milstone L 1993 Overexpression of PTHrP in transgenic mice results in breast
hyperplasia. J Bone Miner Res 8:129
-
Ferrari SI, Rizzoli R, Bonjour JP 1992 Parathyroid
hormone related protein production by primary cultures of mammary
epithelial cells. J Cell Physiol 150:304311[CrossRef][Medline]
-
Wysolmerski JJ, McCaughern-Carucci JF, Daifotis AG,
Broadus AE, Philbrick WM 1995 Overexpression of parathyroid
hormone-related protein or parathyroid hormone in transgenic mice
impairs branching morphogenesis during mammary gland development.
Development 121:35393547[Abstract]
-
Wysolmerski JJ, Philbrick WM, Dunbar ME, Lanske B,
Kronenberg H, Broadus AE 1998 Rescue of the parathyroid
hormone-related protein knockout mouse demonstrates that parathyroid
hormone-related protein is essential for mammary gland development.
Development 125:12851294[Abstract]
-
Deleted in proof
-
Falzon M, Zong J 1998 The noncalcemic vitamin D
analogs EB1089 and 22-oxacalcitriol suppress serum-induced parathyroid
hormone-related peptide gene expression in a lung cancer cell line.
Endocrinology 139:10461053[Abstract/Free Full Text]
-
Yasuda T, Banville D, Hendy GN, Goltzman D 1989 Characterization of the human parathyroid hormone-like peptide gene.
J Biol Chem 264:77207725[Abstract/Free Full Text]
-
Maniatis T, Fritsch EF, Sambrook J (eds) 1989 Molecular Cloning: A Laboratory Manual, ed 2. Cold Spring Harbor
Laboratory, Cold Spring Harbor
-
Coen DM 1995 The polymerase chain reaction. In:
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA,
Struhl K (eds) Current Protocols in Molecular Biology. John Wiley and
Sons, Inc., New York, unit 1553
-
Danielson PE, Forss-Petter S, Brow MA, Calavetta L,
Douglass J, Milner RJ, Sutcliffe JG 1988 p1B15:a cDNA clone of the
rat mRNA encoding cyclophilin. DNA 7:261267[Medline]
-
Li H, Seitz PK, Thomas ML, Selvanayagam P, Rajaraman S,
Cooper CW 1995 Widespread expression of the parathyroid hormone
(PTH)-related peptide (PTHrP and the PTH/PTHrP receptor genes in
intestinal epithelial cells. Lab Invest 73:864870[Medline]
-
Fraser WD, Robinson J, Lawton R, Durham B, Gallacher SJ,
Boyle IT, Beastall GH, Logue FC 1993 Clinical and laboratory
studies of a new immunoradiometric assay for parathyroid
hormone-related protein. Clin Chem 39:414419[Abstract/Free Full Text]
-
Bradford MM 1976 A rapid and sensitive method for
the quantitation of microgram quantities of protein using the principle
of protein-dye binding. Anal Biochem 72:248253[CrossRef][Medline]
-
Yu D, Seitz PK, Selvanayagam P, Rajaraman S, Townsend Jr
CM, Cooper CW 1992 Effects of parathyroid hormone-related peptide
on adenosine 3',5'-monophosphate and ornithine decarboxylase in a human
colonic cell line. Endocrinology 130:19932000[Abstract/Free Full Text]
-
Birch MA, Carron JA, Fraser WD, Gallagher JA 1995 Parathyroid hormone (PTH)/PTH-related protein (PTHrP) receptor
expression and mitogenic responses in human breast cancer cell lines.
Br J Cancer 72:9095[Medline]
-
Seitz PK, Nickols GA, Nickols MA, McPherson MB, Cooper
CW 1990 Radioiodinated rat parathyroid hormone(134) binds to its
receptor on rat osteosarcoma cells in a manner consistent with two
classes of binding sites. J Bone Miner Res 5:353359[Medline]
-
Powell GJ, Southby J, Danks JA, Stillwell RG, Hayman JA,
Henderson MA, Bennett RC, Martin TJ 1991 Localisation of
parathyroid hormone-related protein in breast cancer metastases:
increased incidence in bone compared with other sites. Cancer Res 51:30593061[Abstract/Free Full Text]
-
Vargas SJ, Gillespie MT, Powell GJ, Southby J, Danks JA,
Moseley JM, Martin TJ 1992 Localisation of parathyroid
hormone-related protein mRNA expression in breast cancer and metastatic
lesions by in situ hybridisation. J Bone Miner Res 7:971979[Medline]
-
Wysolmerski JJ, Broadus AE, Zhou J, Fuchs E, Milstone
LM, Philbrick WM 1994 Overexpression of parathyroid
hormone-related protein in the skin of transgenic mice interferes with
hair follicle development. Proc Natl Acad Sci USA 91:11331137[Abstract/Free Full Text]
-
Vasavada R, Cavalieri C, DErcole AJ, Dann P, Burtis
WJ, Madlener AL, Zawalich W, Philbrick WM, Stewart AF 1998 Overexpression of parathyroid hormone-related protein in the pancreatic
islets of transgenic mice causes islet hyperplasia, hyperinsulinemia,
and hypoglycemia. J Biol Chem 271:12001208[Abstract/Free Full Text]
-
Rabbani SA, Gladu J, Liu B, Goltzman D 1995 Regulation in vivo of the growth of Leydig tumors by
antisense ribonucleic acid for parathyroid hormone-related peptide.
Endocrinology 136:54165422[Abstract]
-
Kano J, Sugimoto T, Fukase M, Fujita T 1991 The
activation of cyclic AMP-dependent protein kinase is directly linked to
the inhibition of osteoblast proliferation (UMR-106) by parathyroid
hormone-related protein. Biochem Biophys Res Commun 179:97101[CrossRef][Medline]
-
Li X, Drucker DJ 1993 Growth factor-like properties
of parathyroid hormone-related peptide in transformed rodent cells.
Cancer Res 53:29802986[Abstract/Free Full Text]
-
Bugler B, Amalric F, Prats H 1991 Alternative
initiation of translation determines cytoplasmic or nuclear
localization of basic fibroblast growth factor. Mol Cell Biol 11:573577[Abstract/Free Full Text]
-
Dang CV, Lee WMF 1989 Nuclear and nucleolar
targeting sequences of c-erb-A, c-myc, N-myc, p53, HSP70, and HIV tat
proteins. J Biol Chem 264:1801918023[Abstract/Free Full Text]
-
Aarts MA, Levy D, He B, Stregger S, Chen T, Richard S,
Henderson JE 1999 Parathyroid hormone-related protein interacts
with RNA. J Biol Chem 274:48324838[Abstract/Free Full Text]
-
Schmidt-Zachmann MS, Nigg EA 1993 Protein
localization to the nucleolus: a search for targeting domains in
nucleolin. J Cell Sci 105:799806[Abstract]
-
Henderson JE 1997 Nuclear targeting of secretory
proteins. Mol Cell Endocrinol 129:15[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
A. Dittmer, M. Vetter, D. Schunke, P. N. Span, F. Sweep, C. Thomssen, and J. Dittmer
Parathyroid Hormone-related Protein Regulates Tumor-relevant Genes in Breast Cancer Cells
J. Biol. Chem.,
May 26, 2006;
281(21):
14563 - 14572.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Rabbani, P. Khalili, A. Arakelian, H. Pizzi, G. Chen, and D. Goltzman
Regulation of Parathyroid Hormone-Related Peptide by Estradiol: Effect on Tumor Growth and Metastasis in Vitro and in Vivo
Endocrinology,
July 1, 2005;
146(7):
2885 - 2894.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Linforth, N. Anderson, R. Hoey, T. Nolan, S. Downey, G. Brady, L. Ashcroft, and N. Bundred
Coexpression of Parathyroid Hormone Related Protein and Its Receptor in Early Breast Cancer Predicts Poor Patient Survival
Clin. Cancer Res.,
October 1, 2002;
8(10):
3172 - 3177.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Richard, M. D. Lairmore, P. L. Green, G. Feuer, R. S. Erbe, B. Albrecht, C. D'Souza, E. T. Keller, J. Dai, and T. J. Rosol
Humoral Hypercalcemia of Malignancy : Severe Combined Immunodeficient/Beige Mouse Model of Adult T-Cell Lymphoma Independent of Human T-Cell Lymphotropic Virus Type-1 Tax Expression
Am. J. Pathol.,
June 1, 2001;
158(6):
2219 - 2228.
[Abstract]
[Full Text]
[PDF]
|
 |
|