help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Falzon, M.
Right arrow Articles by Du, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Falzon, M.
Right arrow Articles by Du, P.
Endocrinology Vol. 141, No. 5 1882-1892
Copyright © 2000 by The Endocrine Society

ARTICLES

Enhanced Growth of MCF-7 Breast Cancer Cells Overexpressing Parathyroid Hormone-Related Peptide1

Miriam Falzon and Pingfeng Du

Department of Pharmacology and Toxicology, and Sealy Center for Molecular Science, University of Texas Medical Branch, Galveston, Texas 77555

Address all correspondence and requests for reprints to: Miriam Falzon, Ph.D., Department of Pharmacology and Toxicology, 10th and Market Streets, The University of Texas Medical Branch, Galveston, Texas 77555-1031. E-mail: mfalzon{at}utmb.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PTH-related peptide (PTHrP) is a secreted protein produced by breast cancer cells both in vivo and in vitro. Because of its structural similarity to PTH at the amino terminus, the two proteins interact with a common cell surface receptor, the PTH/PTHrP receptor. When overproduced by tumor cells, PTHrP enters the circulation, giving rise to the common paraneoplastic syndrome of humoral hypercalcemia of malignancy. Although initially discovered in malignancies, PTHrP is now known to be produced by most cells and tissues in the body. It acts as an autocrine and paracrine mediator of cell proliferation and differentiation, effects which are mediated via the PTH/PTHrP receptor. Recent evidence also has shown that, directly after translation, PTHrP is able to enter the nucleus and/or nucleolus and influence cell cycle progression and apoptosis. In this study, we have either overproduced PTHrP or inhibited endogenous PTHrP production in the breast cancer cell line, MCF-7. Overexpression of PTHrP was associated with an increase in mitogenesis, whereas inhibiting endogenous PTHrP production resulted in decreased cell proliferation. The overexpressed peptide targeted to the perinuclear space. In contrast, PTHrP interaction with the cell surface PTH/PTHrP receptor resulted in decreased cell proliferation in the same cell line. This latter effect is dependent on interaction with the receptor, in that exogenously added PTHrP moieties known not to interact with the receptor had no effect on cell growth. Furthermore, neutralization of added peptide with an anti-PTHrP antiserum completely abolished the growth inhibitory effects. In contrast, this antibody has no effect on the increased proliferation rate of the MCF-7 transfectants that overexpress PTHrP, compared with control cells. The net effect of autocrine/paracrine and intracrine effects of PTHrP in MCF-7 cells overproducing the peptide is accelerated cell growth. These findings have critical implications regarding the role of PTHrP in breast cancer, and they suggest that controlling PTHrP production in breast cancer may be useful therapeutically.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
PTH-RELATED peptide (PTHrP) was originally identified as the causative agent of humoral hypercalcemia of malignancy (HHM), one of the most frequent paraneoplastic syndromes (1, 2, 3, 4, 5, 6). The amino terminus of PTHrP shares structural similarity to PTH (7, 8); and consequently, the two peptides interact with a common G protein-coupled cell surface receptor, the PTH/PTHrP receptor (9, 10, 11, 12). Hence, when tumor-derived PTHrP enters the circulation, it activates receptors in classic PTH-sensitive organs, such as bone and kidney, and elicits PTH-like activity that gives rise to HHM (1, 4, 13). Malignancy-associated hypercalcemia is a very common complication in breast cancer patients, because breast cancers frequently secrete high levels of PTHrP (14, 15, 16).

Although initially discovered in malignancies, PTHrP is now known to be produced by most cells and tissues in the body (6, 17, 18, 19). Unlike PTH, PTHrP does not circulate in appreciable amounts in normal subjects but is thought to exert its effects in an autocrine/paracrine manner. After translation, PTHrP enters the secretory pathway; during its transit, the peptide is proteolytically cleaved at basic residues, to yield a family of mature secretory forms of the peptide (17, 18, 20, 21). In view of its widespread distribution in normal cells, functions unrelated to calcium homeostasis have been ascribed to PTHrP, including modulation of cell growth and differentiation. Indeed, the peptide has now been shown to modulate growth in normal cells such as keratinocytes (22), vascular smooth muscle cells (23), and chondrocytes (24) and in transformed cells such as prostate cancer (25) and renal carcinoma (26) cells.

In addition to effects that are mediated via signal transduction cascades initiated at membrane receptors, there is evidence for an intracellular role for PTHrP in cell cycle progression and apoptosis (27, 28, 29). The PTHrP molecule contains a midregion nuclear localization sequence (NLS) that localizes PTHrP to the nucleus or nucleolus (22, 23, 28, 30). The NLS comprises multibasic clusters in the 88–106 region, similar to nuclear or nucleolar localization signals found in viral and mammalian transcription factors (31). In fact, PTHrP has been localized in the nucleus/nucleolus of chondrocytes, transfected COS cells, and vascular smooth muscle cells (23, 28). Deletion of the NLS prevents this targeting (23, 28), and expression of the multibasic 87–106 region as a fusion protein with the ß-galactosidase gene directs the ß-galactosidase protein to the nucleolus (28).

Most breast cancer cells secrete higher levels of PTHrP than do normal breast cells (1, 7). PTHrP is also closely linked to normal mammary gland function and is expressed by human breast epithelium (32). It is found in considerable amounts in the milk of several mammalian species, including human (33, 34, 35). Its expression is enhanced during lactation, when the mammary gland is in a proliferative state and mobilization and transfer of calcium to the milk are required (36). In fact, PTHrP is thought to control the proliferation/differentiation that is linked to the compensatory growth of the mammary gland during lactation (37, 38). Primary cultures of mammary epithelial cells from lactating rats secrete PTHrP in vitro (39). Studies in transgenic mice have shown the involvement of the peptide in branching morphogenesis of the mammary gland, again indicating active participation of the peptide in normal mammary development (40). The biological relevance of PTHrP in the breast is further underscored by studies in knockout mice, where the absence of PTHrP leads to mammary epithelial cell degeneration (41).

It has thus been suggested that production of PTHrP by breast carcinomas may reflect uncontrolled activation in the tumor cells of pathways normally operative in lactation (37). Therefore, the effects of PTHrP on breast cancer cell growth are of both biological and clinical significance. We were interested in studying the growth effects of PTHrP in the breast cancer cell line, MCF-7. Here, we report that PTHrP exerts opposing mitogenic and antimitogenic effects, depending on whether it is acting via the intracrine or autocrine/paracrine pathways, respectively, and that the net effect of PTHrP overexpression in MCF-7 cells is accelerated cell growth.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
Synthetic human (h) PTHrP(1–16), hPTHrP(1–34), hPTHrP(1–86), hPTHrP(107–139), and hPTH(1–34) were purchased from Bachem (Torrance, CA). Synthetic [Leu11, D-Trp12]hPTHrP-(7–34) amide and [Asn10, Leu11]hPTHrP-(7–34) amide, and the PTH antagonist bovine (b) PTH(3–34) were purchased from Peninsula Laboratories, Inc. (Belmont, CA). Recombinant PTHrP(1–139) was prepared by the IMPACT (Intein Mediated Purification with an Affinity Chitin-binding Tag) method (New England Biolabs, Inc., Beverly, MA) (Wu, C., P. K. Seitz, and M. Falzon, manuscript submitted). Peptide stocks (10-4 M) were prepared in 10 mM acetic acid. Forskolin, 8-bromo-cAMP (8Br-cAMP), and tetradecanoyl phorbol 13-acetate (TPA) were purchased from Sigma (St. Louis, MO). Rabbit antiserum to recombinant hPTHrP([-5 to +139) was kindly provided by Dr. C. W. Cooper (University of Texas Medical Branch).

Plasmids and oligonucleotides
The PTHrP constructs expressing PTHrP in the sense or antisense orientation were constructed by cloning hPTHrP complementary DNA (cDNA) coding for amino acids -5 to +139 (a generous gift from Dr. W. I. Wood, Genentech, Inc., South San Francisco, CA) in the expression vectors pCDNA3.1 (+) or (-) (Invitrogen, San Diego, CA), respectively [(+) and (-) refer to the orientation of the multiple cloning site within the vector, relative to the direction of transcription from the T7 promoter]. These constructs, as well as pCDNA3.1(+) as the empty vector control, were transfected into MCF-7 cells by the calcium phosphate coprecipitation technique. The DNA template used to prepare the sense and antisense probes for Northern blot analysis was a 231-bp DNA fragment spanning exons 3 and 4 of the hPTHrP gene (43, 44).

A phosphorothioated antisense oligodeoxynucleotide was used to inhibit PTHrP production in MCF-7 cells. This oligomer (5' CCGCTGCATCGTCTC 3'; Genosys, Woodlands, TX) is complimentary to the translation start site of the PTHrP gene. A phosphorothioated sense oligodeoxynucleotide (5' GAGACGATGCAGCGG 3'), whose sequence spans the PTHrP translation start site, was used as negative control. These oligomers were used to treat MCF-7 cells, as described below.

Cell culture and stable transfection
MCF-7 cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and were grown at 37 C in a humidified 95% O2-5% CO2 atmosphere in DMEM (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% FBS (Atlanta Biologicals, Norcross, GA) and L-glutamine. For cell proliferation experiments, cells were grown in the amount of FBS specified in the Results section.

MCF-7 cells were stably transfected by the calcium phosphate coprecipitation technique, according to the manufacturer’s specifications (Promega Corp., Madison, WI). Two days after transfection, 600 µg/ml G418 (Geneticin; Life Technologies, Inc./BRL) was added, and resistant clones were selected. Single clones of stably transfected cells, isolated by limiting dilution in 96-well plates, were transferred to individual flasks and cultured in medium containing 150 µg/ml G418. Individual clones were tested for PTHrP production using an immunoradiometric assay (described below), and endogenous and transfected messenger RNAs (mRNAs) were detected by Northern blot analysis (also described below).

Northern blot analysis
Total RNA was isolated using RNA STAT-60 (Tel-Test ‘B’, Friendswood, TX), and mRNA was prepared using the mRNA Isolator kit (CLONTECH Laboratories, Inc., Palo Alto, CA). RNA gel electrophoresis was performed under standard conditions (45) using 15 µg of total RNA or 2 µg of mRNA. The RNA was then blotted onto nitrocellulose (Schleicher & Schuell, Inc., Keene, NH) by capillary action. Probes for hybridization were prepared by the asymmetric PCR (46). The PCR template was a 231-bp DNA fragment spanning exons 3 and 4 of the hPTHrP gene (43, 44). To detect endogenous RNA and RNA produced by the transfected sense PTHrP construct, an antisense probe was prepared using the downstream primer from exon 4 of the hPTHrP gene (5'-GTTAGGGGACACCTCCGAGGT-3'). RNA produced as a result of transfection with the antisense PTHrP construct was detected using the upstream primer (5'- CTGGTTCAGCAGTGGAGCGTC-3') from exon 3 of the hPTHrP gene, to prepare a sense probe. The blots were prehybridized for 30 min and hybridized for 2 h in Expresshyb (CLONTECH Laboratories, Inc.) at 68 C. After hybridization, the blots were washed twice in 2 x SSC (1 x SSC is 0.15 M NaCl plus 0.15 M sodium citrate), 0.05% SDS for 15 min at room temperature, and then twice in 0.1 x SSC, 0.1% SDS at 65 C for 30 min. The washed membranes were exposed to Kodak X-Omat film (Eastman Kodak Co., Rochester, NY), at -70 C, with intensifying screens.

To control for equal RNA loading and transfer, the membranes were also probed with a DNA fragment containing cyclophilin sequences (47), labeled by the random primer extension reaction using a multiprime labeling kit (Amersham Pharmacia Biotech, Arlington Heights, IL). After autoradiography, the intensities of the bands representing PTHrP and cyclophilin were evaluated using the Sigmagel program (Jandel Scientific, San Rafael, CA).

PCR
PCR was used to confirm the integrity of the transfected sense and antisense PTHrP and of the transfected empty vector control. Genomic DNA from transfected cells was prepared using DNA Isolator (Tel-Test ‘B’), per the manufacturer’s specifications. PCR was carried out using the following primers: upstream, the T7 primer (5' TAATACGACTCACTATAGGG 3'); and downstream, the pCDNA3.1 reverse primer (5' TAGAAGGCACAGTCGAGG 3'). These primers recognize sequences within the pCDNA3.1 vector. After initial denaturation of the template at 94 C for 5 min, PCR was carried out for 30 cycles as follows: denaturing at 94 C for 30 sec, annealing at 60 C for 45 sec, and extension at 72 C for 45 sec. After gel electrophoresis to assess its size, the PCR product was sequenced to ascertain the integrity of the insert.

Immunoprecipitation
Rabbit antiserum to human recombinant PTHrP(-5 to +139) was used to immunoprecipitate PTHrP secreted into the culture medium. This antiserum shows the same pattern of immunostaining using skin or gastrointestinal tissues, as does a rabbit antiserum to synthetic hPTHrP(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), and staining could be abolished by prior adsorption of the antiserum with its antigen (48). This antiserum to recombinant PTHrP has not yet been fully characterized with synthetic PTHrP fragments to determine the major epitopes that it recognizes (48).

The antiserum-antigen (PTHrP) complex contained in the conditioned medium was immunoprecipitated using staphylococcal protein A-Sepharose beads (Sigma). A 100-µl aliquot of protein A beads (10% vol/vol in 0.02 M disodium hydrogen phosphate, 0.015 M sodium chloride) was added, and the mixture was incubated overnight at 4 C with rocking. The beads were then collected by centrifugation at 10,000 x g for 15 sec at 4 C. The supernatant was collected, concentrated, and analyzed for PTHrP by the radioimmunometric assay described below. Immunoprecipitation of conditioned medium from cell cultures to which preimmune rabbit serum was added served as control.

Immunoassay for secreted PTHrP
The amount of PTHrP secreted into the culture medium was measured using a immunoradiometric sandwich assay (Nichols Institute Diagnostics, San Juan Capistrano, CA), as previously described (43). Single clones of transfected cells and control (untransfected) cells were plated in 24-well dishes (5 x 104 cells/well). The medium was replaced after 24 h. Conditioned medium was collected after a further 5 days and frozen at -80 C for future use, and the cell number was determined using a Coulter counter. Before assay, aliquots of the conditioned medium (range, 0.4–1 ml, calculated to represent conditioning by the same number of cells) were concentrated to 0.2 ml by acetone precipitation. This concentration procedure did not cause a significant loss of PTHrP (~95% recovery). Similarly concentrated unconditioned medium (never exposed to cells) served as a negative control. The assay was carried out per the manufacturer’s specifications. The detection limit of the assay is 0.7 pmol/liter (49).

PTHrP immunocytochemistry
PTHrP was detected using an avidin-biotin-immunoperoxidase method (Vector Laboratories, Inc., Burlingame, CA). Cells grown on Lab-Tek chamber slides (Nalge Nunc International, Naperville, IL) were washed with cold PBS, fixed in acetone for 10 min at -20 C, washed again with PBS, and then treated with 2% hydrogen peroxide for 5 min at room temperature to inactivate endogenous peroxidase. Labeling was carried out using a kit from Oncogene Research Products (Cambridge, MA), per the manufacturer’s specifications. Cells were first preincubated with diluted normal horse serum for 20 min at room temperature, followed by primary antibody (anti-PTHrP mouse monoclonal IgG) for 60 min at room temperature. Control cells received no primary antibody. After washing in cold PBS, cells were treated with biotinylated antimouse secondary antibody for 30 min at room temperature. The cells were washed again in PBS and then treated with avidin-biotin-horseradish peroxidase complex (Vector Laboratories, Inc.) for 30 min at room temperature. After washing with PBS, cells were exposed to diaminobenzidine for 5 min. The percentage of cells whose nuclei stained positively were counted in a blinded fashion by two observers using computerized histomorphometry (Optimus Corp., Bothell, WA).

Measurement of intracellular cAMP levels
MCF-7 cells were plated into 24-well dishes, at 5 x 104 cells/well, in DMEM containing 10% FBS. When the cells were nearly confluent, the medium was removed and replaced with PBS containing 1 mM calcium chloride, 15% NuSerum (Collaborative Biomedical Products, Bedford, MA), 1 mM magnesium chloride, 20 mM HEPES, 85 U/ml Trasylol (FBA Pharmaceuticals, New York, NY), 0.2% BSA, 0.1% glucose, and 1 µM isobutylmethylxanthine (IBMX, Sigma), and the indicated concentrations of hPTHrP(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), hPTH(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), bPTH(3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), [Leu11, D-Trp12]hPTHrP-(7–34) amide, [Asn10, Leu11]hPTHrP-(7–34) amide, salmon calcitonin, or secretin. Incubation was carried out for 15 min at room temperature. After removal of medium, cells were rinsed twice with 1 ml ice-cold PBS, and 500 µl cold 10% trichloroacetic acid was added. After centrifugation, trichloroacetic acid supernatants were frozen at -70 C until assayed for cAMP. Cell precipitates were dissolved in 1 N sodium hydroxide, and protein was measured by the Bradford assay (50) (Bio-Rad Laboratories, Inc., Hercules, CA). The RIA for cAMP was carried out as previously described (51). For assay, aliquots of supernatant were neutralized with calcium carbonate and acetylated to increase sensitivity. 125I-succinylated cAMP was purchased from Amersham Pharmacia Biotech, and goat antiserum to succinylated cAMP (kindly provided by Dr. G. A. Nickols, Monsanto, St. Louis, MO) was used at a final dilution of 1:200,000.

Experimental design; cell proliferation
To measure the effects of added PTHrP peptides on cell proliferation, MCF-7 cells were plated into 24-well dishes at 104 cells/well in medium containing 10% FBS. In some experiments, cells were transferred to medium containing 2.5% serum after 24 h. After a further 24 h, cells were treated with the different hPTHrP peptides, forskolin, 8Br-cAMP or TPA at the indicated concentrations for the indicated time intervals. Control cells received an equivalent volume of vehicle. Cells were counted after 3 or 5 days of treatment. When cells were treated with peptides for 5 days, the growth medium was replaced with fresh peptide-containing medium after 3 days. The cells were then trypsinized and counted in a Coulter counter (Coulter Electronics Inc., Hialeah, FL).

Anti-PTHrP(-5 to +139) antiserum was used to neutralize secreted PTHrP and exogenously added PTHrP(1–34) or (1–86). Cells were plated into 24-well dishes at 104 cells/well in medium containing 10% FBS. After 24 h, cells were transferred to medium containing 2.5% FBS (day 0). Cells were then treated with anti-PTHrP antiserum or preimmune rabbit serum as control (final concentration 2% vol/vol), with or without 10-7 M PTHrP(1–34) or PTHrP(1–86). After 72 h, the cell culture medium was collected for immunoprecipitation, the supernatant was assayed for PTHrP by the immunoradiometric assay, and cells were then trypsinized and counted.

To measure the effects of over- or underexpression of PTHrP on cell proliferation, cells were plated into 24-well dishes at 104 cells/well in medium containing 10% serum, then transferred to medium containing 2.5% serum after 24 h (day 0). Cells were then trypsinized and counted at days 1, 3, 5, and 8.

Anti-PTHrP(-5 to +139) antiserum was used to neutralize secreted PTHrP in sense PTHrP- or empty vector-transfected cells. Cells were plated into 24-well dishes at 104 cells/well in medium containing 10% FBS. After 24 h, cells were transferred to medium containing 2.5% serum (day 0), and anti-PTHrP antiserum was added in concentrations (% vol/vol) ranging from 0.5–5%. Preimmune rabbit serum was used as control. At days 1, 3, 5, and 8, the cell culture medium was collected for immunoprecipitation, the supernatant was assayed for PTHrP by immunoassay, and the cells were then trypsinized and counted.

To measure the effects of inhibition of PTHrP synthesis on MCF-7 cell proliferation, cells were plated into 24-well dishes at 104 cells/well in medium containing 10% serum, then transferred to 2.5% serum after 24 h. After a further 24 h, the cells were treated with either antisense or sense phosphorothioated oligonucleotide (in a concentration range of 1–5 µM). Three or 5 days after treatment, the culture medium was collected for measurement of secreted PTHrP by the immunoradiometric assay. Cells were then trypsinized for counting.

Thymidine incorporation assay
For these experiments, cells were plated in 24-well plates at 104 cells/well in medium containing 10% FBS. After 24 h, cells were transferred to medium containing 2.5% serum. In some experiments, cells were treated with the indicated hPTHrP fragments (10-7 M). After 3 days (when exogenous peptides were added) or 8 days (when comparing sense PTHrP-, antisense PTHrP- and empty vector-transfected cells) in culture, the cells were pulse-treated with [3H]thymidine (0.2 µCi/ml) for 2 h. To determine [3H]thymidine incorporation, the cell monolayer was washed twice with PBS, and a fraction of the cells was counted with a Coulter counter. The nucleic acids in the rest of the cell fraction were precipitated with trichloroacetic acid and solubilized with sodium hydroxide for scintillation counting. The results were expressed as counts per number of cells.

Statistics
Numerical data are presented as the mean ± SEM. Data were analyzed by ANOVA, with t tests, to determine the statistical significance of differences.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
MCF-7 cells express functional PTH/PTHrP receptors
MCF-7 cells express the PTH/PTHrP receptor (52). To assess whether these receptors are functional, we measured cAMP accumulation in response to hPTHrP(1–34) and hPTH(1–34). MCF-7 cells showed an increase in cAMP production in response to both peptides (Fig. 1Go and Table 1Go). The ability of hPTHrP(1–34) and hPTH(1–34) to induce a cAMP response in MCF-7 cells was dose-related between 0.1 and 100 nM; cAMP production reached a plateau at 10 nM with both peptides (Fig. 1Go). The ED50 for PTH(1–34) in the ROS 17/2.8 (rat osteosarcoma) cell line, which is a classical positive control for PTH/PTHrP receptor studies, is 3 nM (53), a value similar to that obtained in MCF-7 cells (Fig. 1Go). This indicates that PTH/PTHrP receptors behave in a classical manner in MCF-7 cells. In contrast, the structurally unrelated peptides salmon calcitonin and secretin, as well as hPTHrP(107–139), which do not interact with the PTH/PTHrP receptor, had no effect on cAMP production, even at 1 µM (Table 1Go). Similarly, two PTHrP antagonists, [Leu11, D-Trp12]hPTHrP-(7–34) amide and [Asn10, Leu11]hPTHrP-(7–34) amide, and the PTH antagonist bPTH(3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), did not increase cAMP in these cells (Table 1Go).



View larger version (16K):
[in this window]
[in a new window]
  		Figure 1. Dose-dependent cAMP response of MCF-7 cells. Cells were exposed to hPTHrP(1–34) (•) or hPTH(1–34) ({blacktriangleup}) in the presence of isobutylmetylxanthine, as describe in Materials and Methods. Each point is the mean ± SEM of three independent experiments (three wells per treatment). The amount of protein was 18.4 ± 0.7 µg/well.

 

View this table:
[in this window]
[in a new window]
  		Table 1. cAMP response of MCF-7 breast cancer cells to hPTHrP(1–34), hPTH(1–34), PTHrP analogs, and peptides unrelated structurally to PTHrP

 
Exogenously added PTHrP peptides decrease cell proliferation
The rate of proliferation of parental MCF-7 cells in culture medium to which PTHrP peptides had been added was examined. Addition of hPTHrP(1–34) and (1–86) to cells cultured in 2.5% serum decreased cell proliferation in a concentration-dependent manner (Fig. 2AGo). The two peptides were equipotent, with peak inhibition (~40% decrease in cell number after 3 days treatment) occurring with concentrations of 10-7 M or higher (Fig. 2AGo). Concentrations of 10-8 M and lower produced proportionately smaller effects for each peptide (Fig. 2AGo). MCF-7 cells exposed to hPTHrP(1–34) or (1–86) in culture medium containing 10% serum required higher concentrations of PTHrP(1–34) or (1–86) for growth inhibition, such that a 35% decrease in cell number was observed with 10-6 M peptide (data not shown).



View larger version (26K):
[in this window]
[in a new window]
  		Figure 2. Effects of exogenously added PTHrP peptides on MCF-7 cell proliferation. Cells were plated in 10% FBS at a density of 104 cells/well, in 24-well dishes, then transferred to 2.5% serum after 24 h. Treatment was initiated after a further 24 h. After 72 h, cells were trypsinized, and cell numbers were determined using a Coulter counter. C, Control (no treatment). The numbers along the x-axis indicate the molar concentrations of the various treatments [PTHrP moieties, forskolin, 8-bromo-cAMP (8Br-cAMP), or TPA] employed. A, PTHrP moieties that are known to interact with the cell surface PTH/PTHrP receptor; B, peptides which do not interact with the receptor; *, significantly different from control at P < 0.001; #, significantly different from control at P < 0.05.

 
We also examined the effects of recombinant hPTHrP(1–139) on MCF-7 cell proliferation. This peptide showed approximately the same profile as the N-terminal fragments hPTHrP(1–34) and (1–86), reducing the cell number by approximately 50% at a concentration of 10-8 M (Fig. 2AGo). Again, the effects on cell growth were greater when the culture medium contained 2.5% serum, as opposed to 10% serum (data not shown).

Growth inhibition was also observed in cells exposed to 8Br-cAMP and forskolin (Fig. 2AGo), supporting the idea that the growth effects may be cAMP-mediated and that the PTH/PTHrP receptor is coupled to adenylyl cyclase in MCF-7 cells. TPA also inhibited cell growth (Fig. 2AGo), suggesting that the receptor may also be coupled to phospholipase C in these cells.

PTHrP(1–16) did not affect cell growth (Fig. 2BGo), presumably because this peptide does not interact with the cell surface PTH/PTHrP receptor. Similarly, hPTHrP(27–139) and (107–139), which lack the N terminus, had no effect on cell growth (Fig. 2BGo).

Exposing MCF-7 cells to hPTHrP(1–34), (1–86), or (1–139) for 5 days produced slightly larger inhibition of cell growth (~10% greater effect), compared with the 3-day treatment (data not shown). hPTHrP(1–16), (27–139), and (107–139) still produced no effect after a 5-day treatment (data not shown).

These results were confirmed using the [3H]thymidine incorporation assay. PTHrP(1–34), (1–86), and (1–139), at a concentration of 10-7 M, decreased thymidine incorporation by 35–50% after 3 days of treatment; whereas PTHrP(1–16), (27–139), and (107–139) had no effect (data not shown).

PTHrP antibody neutralizes the effects of added peptides
Anti-PTHrP(-5 to +139) antiserum was used to confirm the growth-inhibitory effects of added PTHrP peptides on MCF-7 cells. Secreted PTHrP was neutralized with 2% (vol/vol) antiserum, and the PTHrP-antiserum complex was removed by immunoprecipitation. Immunoradiometric measurement of PTHrP in the culture medium detected negligible residual amounts of PTHrP after 3 days in culture (~ 80% decrease). Neutralization of endogenously produced and secreted PTHrP resulted in an increase of approximately 20% in MCF-7 cell growth (Fig. 3Go), presumably because the endogenous peptide inhibits MCF-7 cell growth. The antiserum also neutralized the effects of added hPTHrP(1–34) and (1–86), such that a 10-7 M concentration of each of the peptides did not inhibit cell proliferation (Fig. 3Go). In contrast, each of the peptides inhibited MCF-7 cell proliferation by approximately 40% in the presence of preimmune serum (Fig. 3Go). Preimmune serum alone (2% vol/vol) had no effect on cell growth (Fig. 3Go). These results confirm that added PTHrP peptides affect cell growth by acting at the cell surface and that endogenous PTHrP acting at the cell surface inhibits MCF-7 cell growth.



View larger version (29K):
[in this window]
[in a new window]
  		Figure 3. Effects of neutralizing secreted and exogenous PTHrP on cell proliferation in MCF-7 cells. Cells were plated, at 104 cells/well in 24-well dishes, in medium containing 10% FBS, then transferred to 2.5% FBS after 24 h. After a further 24 h, anti-PTHrP(-5 to +139) antiserum was added to a final concentration of 2% vol/vol, in the presence or absence of PTHrP(1–34) or PTHrP(1–86). Control cells received preimmune serum. After 72 h, cells were trypsinized, and the cell number was determined in a Coulter counter. Each bar is the mean ± SEM of three independent experiments (four wells per experiment), after subtracting the background value. *, Significantly different from control at P < 0.001; #, significantly different from control at P < 0.05.

 
Establishment of cell lines over- or underexpressing PTHrP
The effect of transfection with a construct expressing PTHrP mRNA in the antisense orientation on the endogenous PTHrP mRNA levels was examined by Northern blot analysis (Fig. 4AGo, where data are shown for two clones per treatment). Equivalent quantities of endogenous PTHrP transcript were observed in sense PTHrP- and empty vector-transfected MCF-7 cells. However, the endogenous transcript was not detected in cells transfected with a vector expressing antisense PTHrP mRNA (Fig. 4AGo). Untransfected MCF-7 cells expressed the same level of transcript as sense and empty vector transfectants (data not shown). Transfected sense PTHrP mRNA was only detected in cells transfected with the sense PTHrP expression construct (Fig. 4BGo). This transcript was not detected in empty vector- or antisense PTHrP-transfected cells (Fig. 4BGo) [longer exposure of blots from empty vector and sense PTHrP-transfected cells showed the presence of endogenous RNA (data not shown)]. The antisense transcript was only expressed in antisense-transfected cells, and it was absent in both sense PTHrP- and empty vector-transfected cells (Fig. 4CGo).



View larger version (30K):
[in this window]
[in a new window]
  		Figure 4. Characterization of MCF-7 cells over- or under-expressing PTHrP. Northern blot analysis of mRNA to detect endogenous transcript (A) or total RNA to detect transfected transcript (B and C), and PCR analysis of genomic DNA (D) from cells transfected with a vector expressing sense PTHrP mRNA (SN), antisense PTHrP mRNA (AS), or the vector control (V). In (A), (B), and (C), the probe was prepared by asymmetric PCR of a cDNA fragment spanning exons 3 and 4 of the hPTHrP gene, as described in Materials and Methods. The position of the 28 S and 18 S ribosomal bands is indicated. Top panel, PTHrP mRNA; bottom panel, cyclophilin mRNA. Two clones each are shown for vector, sense, and antisense transfectants. In (D), PCR was carried out using genomic DNA and the T7 and pCDNA3 reverse primers, described in Materials and Methods. The arrows point to the PCR product (176 bp for V and 678 bp for SN and AS).

 
The presence and integrity of the integrated PTHrP sense- and antisense-transfected sequences, as well as the integrity of the transfected vector sequences, were confirmed by carrying out PCR on genomic DNA. As shown in Fig. 4DGo, a 176-bp amplimer was detected in empty vector-transfected cells, and a 678-bp amplimer, corresponding to vector plus PTHrP sequences, was detected in cells transfected with sense and antisense PTHrP-expression constructs. No amplimer was detected in untransfected cells (data not shown).

PTHrP secretion was measured by immunoassay, where data are again shown for two clones per treatment. The amount of PTHrP secreted by control cells is 1.3 ± 0.04 pM. Transfection with the sense construct produced a significant increase in PTHrP production, whereas transfection with the antisense construct decreased PTHrP production (Fig. 5Go). PTHrP secretion from the empty vector-transfected cells was not significantly different from that of untransfected cells (Fig. 5Go).



View larger version (17K):
[in this window]
[in a new window]
  		Figure 5. PTHrP secretion by sense and antisense PTHrP transfectants. Conditioned medium from MCF-7 cells transfected with a vector expressing either sense or antisense PTHrP was collected after 5 days in culture and concentrated; secreted PTHrP was measured by the immunoradiometric sandwich assay. U, Untransfected (parent) cells; V, empty vector-transfected cells; AS, cells expressing antisense PTHrP; SN, cells expressing sense PTHrP. Two independent clones are shown for each transfectant. Each bar is the mean ± SEM of four wells, obtained after subtracting the background value, represented by unconditioned medium (not exposed to cells). Asterisks, Significant differences from untreated (P < 0.001).

 
PTHrP overexpression increases cell proliferation
The growth rates of cells stably transfected with PTHrP(-5 to +139) in the sense or antisense orientation are shown in Fig. 6Go. The proliferation rate of MCF-7 clones overexpressing PTHrP was more rapid than that of empty vector-transfected cells, such that, after 8 days in culture, the cell number of the two PTHrP-overexpressing clones was about twice that of the empty vector-transfected clones. On the other hand, the growth rate of two antisense PTHrP-transfected clones was significantly less than that of the empty vector-transfected clones. The rate of proliferation of untransfected MCF-7 cells was the same as that of the vector-transfected clones (data not shown).



View larger version (18K):
[in this window]
[in a new window]
  		Figure 6. Proliferation of MCF-7 cells over- or underexpressing PTHrP. Cells were plated in 10% FBS at a density of 104 cells/well in 24-well dishes, then transferred to 2.5% serum after 24 h. At the indicated time intervals, cells were trypsinized, and cell numbers were determined using a Coulter counter. Two independent clones per transfectant are shown (open and closed symbols). •, {circ}, Transfected with empty vector alone; {blacktriangleup},{triangleup}, sense PTHrP transfectants; {blacksquare},{square}, antisense PTHrP transfectants. Each point is the mean ± SEM of three independent experiments (six wells per experiment). *, Significantly different from control (empty vector transfectant) at P < 0.001; #, significantly different from control at P < 0.05.

 
The differences in the rate of proliferation of the sense- and antisense-transfected cells, compared with empty vector-transfected cells, was confirmed using the [3H]thymidine incorporation assay. After 8 days in culture, sense PTHrP increased (whereas antisense PTHrP decreased) thymidine incorporation, compared with vector-transfected clones (data not shown).

Neutralization of secreted PTHrP does not affect the increased cell proliferation of sense PTHrP-transfected cells
To establish a role for nuclear PTHrP in the increased rate of proliferation of sense PTHrP-transfected cells, secreted PTHrP was neutralized with increasing amounts of anti-PTHrP(-5 to +139) antiserum. Immunoradiometric measurement of PTHrP in culture medium from sense PTHrP- and empty vector-transfected MCF-7 cells (after immunoprecipitation of the PTHrP-antiserum complex) confirmed that there was negligible free PTHrP in the culture medium (Fig. 7AGo). Preimmune serum had no effect on secreted PTHrP levels (Fig. 7AGo). Anti-PTHrP antiserum did not eliminate the growth advantage of sense PTHrP-transfected MCF-7 cells over the empty vector-transfected counterparts. Thus, the rate of proliferation of sense PTHrP-transfected cells was still significantly higher than that of vector-transfected cells (Fig. 7BGo). In fact, anti-PTHrP antiserum-treated sense PTHrP-transfected cells proliferated approximately 15–20% faster than the same cells not exposed to anti-PTHrP antiserum, presumably because the anti-PTHrP antiserum neutralized secreted PTHrP, which normally has a growth-inhibitory effect on MCF-7 cells (Fig. 3Go). Preimmune serum had no effect on cell growth (Fig. 7CGo). These results suggest that PTHrP accelerates cell growth via an intracrine mechanism in these transfected cells.



View larger version (17K):
[in this window]
[in a new window]
  		Figure 7. Effects of neutralizing secreted PTHrP on cell proliferation of PTHrP-overexpressing MCF-7 cells. A, Effect of addition of PTHrP antiserum or preimmune serum on free secreted PTHrP levels. Sense PTHrP transfectants were plated in 24-well plates at 104 cells/well in medium containing 10% FBS. After 24 h, cells were transferred to medium containing 2.5% FBS, and the indicated concentrations of PTHrP(-5 to +139) antiserum or preimmune serum were added (day 0). After 5 days in culture, the culture medium was collected for immunoprecipitation, the supernatant was concentrated, and PTHrP was measured by immunoassay. Two independent clones, represented by the open and closed bars, are shown. Each bar is the mean ± SEM of three independent experiments (three wells per antiserum concentration), after subtracting the background value, represented by unconditioned medium (not exposed to cells). B and C, Effect of treatment with anti-PTHrP antiserum to deplete secreted PTHrP (B) or preimmune serum as control (C) on cell proliferation. At the indicated time intervals, cells were trypsinized, and cell numbers were determined using a Coulter counter. Two independent clones per transfectant are shown (open and closed symbols). •, {circ}, Transfected with empty vector; {blacktriangleup},{triangleup}, sense PTHrP transfectants; {blacksquare},{square}, sense PTHrP transfectants cultured in the presence of anti-PTHrP antiserum (3% vol/vol). Each point is the mean ± SEM of three independent experiments (three wells per experiment). *, Significantly different from control (vector transfectant) at P < 0.001.

 
Overexpressed PTHrP targets to the nucleus
Immunocytochemistry was used to detect the presence of PTHrP in the transfected and control MCF-7 cells. PTHrP-overexpressing cells showed both nuclear and cytoplasmic staining (Fig. 8AGo). Cytoplasmic staining was present in all the cells, whereas perinuclear staining was present in approximately 5% of nuclei. Perinuclear staining was most often associated with cells in the process of, or just completing, cell division (Fig. 8AGo). Empty vector-transfected cells showed less intense cytoplasmic staining, and perinuclear staining was observed in less than 1% of nuclei (Fig. 8BGo). Again, perinuclear staining was observed in cells that were dividing or that had just completed cell division. Control untransfected cells showed the same pattern of staining as vector-transfected cells (data not shown). Antisense PTHrP-transfected cells showed no cytoplasmic or perinuclear staining (Fig. 8CGo). Cells stained in the absence of primary antibody showed no cytoplasmic or nuclear staining (data not shown).



View larger version (75K):
[in this window]
[in a new window]
  		Figure 8. Immunocytochemical staining for PTHrP in PTHrP-overexpressing MCF-7 cells. A, Cells overexpressing PTHrP show both nuclear and cytoplasmic staining. Note that nuclear staining showed a perinuclear localization, and that the most prominent nuclei occur in cells that have just undergone, or are undergoing, cell division. B, Empty vector-transfected cells show less intense cytoplasmic staining. Nuclear staining was observed in less than 1% of nuclei but was still seen in dividing cells. C, Antisense-PTHrP transfectants showed no cytoplasmic or nuclear staining.

 
Inhibition of PTHrP production decreases cell proliferation
Further proof that the overall effect of endogenously produced PTHrP is increased MCF-7 cell proliferation was obtained using antisense oligodeoxynucleotide technology. To inhibit PTHrP production, MCF-7 cells were treated with a phosphorothioated antisense oligonucleotide spanning the translational start site of the PTHrP gene. After 3 or 5 days of treatment, immunoradiometric measurement of PTHrP in culture medium showed a decrease in PTHrP secretion of 65 and 80%, respectively, compared with cells treated with a oligomer having the sense sequence (Fig. 9AGo). Treatment with the latter oligomer had no effect on PTHrP secretion, compared with an untreated control (Fig. 9AGo).



View larger version (23K):
[in this window]
[in a new window]
  		Figure 9. Effect of inhibition of PTHrP production on MCF-7 cell proliferation. Cells were plated at 104 cells/well in 24-well dishes in medium containing 10% FBS. After 24 h, they were transferred to 2.5% FBS. After a further 24 h, cells were treated with a phosphorothioated oligodeoxynucleotide (final concentration 5 µM) whose sequence is antisense to the PTHrP translation start site (lanes AS). As a control, cells were treated with a phosphorothioated oligodeoxynucleotide with the same sequence as the PTHrP translational start site (lanes SN). Treatment was for 3 or 5 days, as indicated in parentheses. AS- and SN-oligodeoxynucleotide-treated cells were compared with untreated control cells (lane U). A, Effect on PTHrP secretion; B, effect on cell proliferation. Each bar is the mean ± SEM of three independent experiments (six wells per experiment). *, Significantly different from control at P < 0.001.

 
Treatment with the antisense oligomer (5 µM for 3 or 5 days) decreased cell proliferation by approximately 30% (Fig. 9BGo). The sense oligomer had no significant effect on cell growth, compared with untreated controls (Fig. 9BGo). These results indicate that the net effect of endogenous PTHrP is increased cell proliferation, consistent with the increase in cell proliferation observed with MCF-7 cells overexpressing the peptide (Fig. 6Go).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Breast cancer cells secrete high levels of PTHrP, accounting for the high prevalence of HHM in breast cancer patients (14, 15, 16). In fact, immunohistochemical and in situ hybridization analyses have shown that staining for PTHrP and its transcript is more prevalent in primary breast tumors and bone metastases than in nonbone secondary foci (14, 32, 54, 55). In cancer patients, the effects of PTHrP on calcium levels are mediated via PTHrP entering the circulation and activating the PTH/PTHrP receptors in classic PTH organs (such as bone and kidney), resulting in HHM (1, 4, 13).

PTHrP regulates growth and differentiation in virtually every cell and tissue examined (17). Studies in transgenic mice have demonstrated that PTHrP is required for normal mammary development (41), normal chondrocyte maturation and differentiation in the epiphyseal growth plate (19), and normal epidermal and hair follicle development (56). Targeted overexpression of PTHrP in the pancreatic isle leads to increased pancreatic ß-cell mass (57). PTHrP also modulates growth in prostate cancer cells (25), Leydig tumor cells (58), renal carcinoma cells (26), vascular smooth muscle (23) cells, and osteoblasts (59, 60). Proliferative vs. antiproliferative effects seem to be dependent on the cell type. For example, here, we show that in MCF-7 cells, exogenous PTHrP(1–34), (1–86), and (1–139) decrease cell proliferation (Fig. 2Go). The same effects have been reported in vascular smooth muscle cells (23). Conversely, in prostate cancer cell lines, addition of exogenous PTHrP(1–34) stimulates cell proliferation (25).

In MCF-7 cells, PTHrP exerts an antimitogenic effect when acting via the cell surface PTH/PTHrP receptor. Thus, blocking the effects of endogenously secreted PTHrP at the cell surface, using an anti-PTHrP antiserum, resulted in an increased rate of proliferation of MCF-7 cells (Fig. 3Go). In addition, the growth inhibitory effects of exogenously added N-terminal PTHrP moieties were eliminated with the same anti-PTHrP antiserum (Fig. 3Go). Non-N-terminal PTHrP moieties known not to interact with the receptor, [PTHrP(107–139) and PTHrP(27–139)] had no effect on cell growth in MCF-7 cells (Fig. 2Go). Therefore, we conclude that PTHrP action through the autocrine/paracrine pathway exerts an antiproliferative effect. These results differ from those of Birch et al. (52), who found a mitogenic response to PTHrP(1–34) in the same cell line. However, these authors reported that such an effect could only be obtained using quiescent MCF-7 cells, whereas our studies were carried out using rapidly proliferating cells, more like growing breast tumors.

In addition to its well-documented effects elicited through signal transduction cascades, recent studies have shown that PTHrP also acts in an intracrine fashion after translocation to the nucleus or nucleolus (23, 27, 28, 29, 30). Immunocytochemistry and immunoelectron microscopy studies have localized PTHrP in the nuclear compartment of MCF-7 cells (Fig. 8Go), as well as in keratinocytes, chondrocytes, osteoblasts, transfected COS cells, and vascular smooth muscle cells (23, 27, 28, 29). Nuclear translocation is dependent on the presence of a bipartite NLS, which consists of two clusters of basic amino acids separated by a spacer (~10-residue) (31). The NLS is found in some transcription factors (such as c-fos and c-jun), various nuclear proteins (such as p53, CDC16, and Ab1), several steroid hormone receptors [such as the thyroid ß, glucocorticoid {alpha}, and androgen receptors (22, 31)], growth factors [such as members of the fibroblast growth factor family (61)], and human retroviral proteins [such as the HIV Tat protein (62)].

The NLS is responsible for targeting PTHrP to the nucleus, because deletion of either of the basic amino acid clusters prevents nuclear targeting in COS cells (28) and vascular smooth muscle cells (23). Moreover, expression of the 88–106 region as a fusion protein with the ß-galactosidase gene in COS cells targets ß-galactosidase (normally a cytosolic protein) to the nuclear compartment (28). These studies clearly suggest that PTHrP can be targeted to the nucleus under normal circumstances, where it has been shown to alter cell function. In our current study, we show that overexpression of PTHrP in MCF-7 cells results in a dramatic stimulatory effect on cell proliferation (Fig. 6Go). Massfelder et al. (23) report a similar effect in vascular smooth muscle cells, and Henderson et al. (28) have shown that nucleolar PTHrP is associated with an inhibitory effect on apoptosis.

The mitogenic effect of PTHrP is linked with nuclear localization in various systems. Thus, in MCF-7 cells, the overexpressed peptide showed a perinuclear pattern in approximately 5% of nuclei (Fig. 8Go). In contrast, very few nuclei (<1%) stained positive for PTHrP in the parent cell line. Significantly, perinuclear staining was most often associated with cells that were either in the process of or had just completed cell division, indicating an involvement of PTHrP in cell cycle regulation. Though definitive proof that the growth stimulatory effects of PTHrP are mediated via nuclear localization of the peptide would require deletion of the NLS, with consequent elimination of both nuclear localization of the peptide and increased cell proliferation, our data clearly suggest that the mitogenic effects of PTHrP are mediated via the intracrine pathway. Similar effects were reported in vascular smooth muscle cells (23), where approximately 5% of nuclei from PTHrP-overexpressing cells clearly stained positive for the peptide, and nuclear targeting was associated with dividing cells. Although PTHrP is clearly targeted to the nucleus in a number of systems, its precise localization seems to vary in different cell types. Thus, the peptide showed a perinuclear localization in MCF-7 cells (Fig. 8Go), a reticulated diffuse nuclear pattern in vascular smooth muscle cells (23), and a nucleolar localization in chondrocytes and osteoblasts (28), and in a human keratinocyte cell line (29). At present, it is unknown whether this difference is a reflection of the different cell types under study, or whether it depends on the different antisera employed.

The mechanism by which nuclear accumulation of PTHrP activates the cell cycle, thereby increasing proliferation, in MCF-7 and other cell types (23, 28, 29), at present, is unknown. The peptide may interact with key proteins involved in cell cycle regulation and/or with nucleic acids. Though no specific protein interactions have been identified to date, a recent study has shown that the peptide can interact with both homopolymeric and total cellular RNA (63). This interaction is mediated via a core motif localized within the NLS that is shared by other RNA-binding proteins that are targeted to the nucleolus, such as nucleolin (64) and the retroviral Tat (62). Because the nucleolus is the major site for biogenesis of ribosomes, nucleolar PTHrP may influence cellular functions by modulating ribosomal RNA synthesis, either by affecting RNA polymerase I activity or by altering ribosome assembly and/or function. Whether the perinuclear (in MCF-7 cells) or diffuse nuclear [in vascular smooth muscle cells (23)] localization of PTHrP mediates alternative intranuclear modes of action for the peptide, at present, is unknown.

PTHrP has joined the ever-increasing list of peptide hormones and growth factors that elicit their biological responses in a dual manner, through interaction with cell surface receptors linked to signal transduction cascades and through intranuclear localization. Other examples include insulin, epidermal growth factor, platelet-derived growth factor, fibroblast growth factors, angiogenin, and PRL (reviewed in Ref. 65). PTHrP, which contains a signal sequence that directs the nascent peptide to the secretory pathway, must avoid the endoplastic reticulum and remain in the cytoplasmic compartment before its nuclear translocation. Various potential mechanisms have been proposed, which include use of alternative, non-AUG translational start sites, internalization of the ligand-receptor complex by endocytosis, and reverse translocation or dislocation from the endoplasmic reticulum lumen to the cytoplasm (reviewed in Refs. 30, 65). Definitive proof in favor of one or more of these mechanisms has yet to be provided.

In summary, this study shows that PTHrP produces opposing mitogenic and antimitogenic actions in the breast cancer cell line MCF-7. This cell line, which produces relatively low levels of the peptide, provides a good model to study the effects of PTHrP overexpression. When acting via the autocrine/paracrine pathway, mediated through the cell surface PTH/PTHrP receptor, PTHrP decreases cell proliferation. Conversely, when acting through the intracrine pathway, the peptide dramatically stimulates cell growth. The proliferative effects of overexpressed PTHrP seem to predominate, in that overexpression of the peptide results in accelerated cell growth. These results were confirmed using antisense oligodeoxynucleotide technology. Inhibition of PTHrP synthesis using an antisense oligodeoxynucleotide, which blocks translation of the peptide, resulted in a net decrease in MCF-7 cell proliferation (Fig. 9Go). We have preliminary data which show that PTHrP exerts the same pattern of effects in another breast cancer cell line, MDA-MB-231. We feel that our findings have important implications for the role of PTHrP in breast cancer. Because PTHrP imparts a growth advantage to breast cancer cells, controlling production of the peptide in breast cancer may be therapeutically useful.


   Acknowledgments
 
We wish to thank Dr. Cary W. Cooper for supplying the anti-PTHrP antiserum, and Dr. P. K. Seitz for help with the cAMP assay. We also wish to thank Drs. C. W. Cooper, D. Konkel, P. K. Seitz, and M. L. Thomas for critical reading of the manuscript.


   Footnotes
 
1 This work was supported by a research grant from the National Institutes of Health. Back

Received October 4, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Burtis WJ, Wu T, Bunch C, Wysolmerski JJ, Insogna KL, Weir EC, Broadus AE, Stewart AF 1987 Identification of a novel 17,000 dalton parathyroid hormone-like adenylate cyclase-stimulating protein from a tumor associated with humoral hypercalcemia of malignancy. J Biol Chem 262:7151–7156[Abstract/Free Full Text]
  2. Moseley JM, Kubota M, Diefenbach-Jagger H, Wettenhall REH, Kemp BE, Suva LJ, Rodda CP, Ebeling PR, Hudson PJ, Zajac JD, Martin TJ 1987 Parathyroid hormone-related protein purified from a human lung cancer cell line. Proc Natl Acad Sci USA 84:5048–5052[Abstract/Free Full Text]
  3. Suva LJ, Winslow GA, Wettenhall REH, Hammonds RG, Moseley JM, Diefenbach-Jagger H, Rodda CP, Kemp BE, Rodriguez H, Chen EY, Hudson PJ, Martin TJ, Wood WI 1987 A parathyroid hormone-related protein implicated in malignant hypercalcemia: cloning and expression. Science 237:893–896[Abstract/Free Full Text]
  4. Broadus AE, Mangin M, Ikeda K, Insogna KL, Weir EC, Burtis WJ, Stewart AF 1988 Humoral hypercalcemia of cancer. N Engl J Med 319:556–563[Medline]
  5. Martin TJ, Moseley JM, Gillespie MT 1991 Parathyroid hormone-related protein: biochemistry and molecular biology. Crit Rev Biochem Mol Biol 26:377–395[Medline]
  6. Stewart AF, Insogna KL, Broadus AE 1995 Malignancy-associated hypercalcemia. In: DeGroot L (ed) Endocrinology, ed 3. Saunders, Philadelphia, pp 1061–1074
  7. Stewart AF, Wu T, Goumas D, Burtis WJ, Broadus AE 1987 N-terminal amino-acid sequence of two novel tumor-derived adenylate cyclase-stimulating proteins: identification of parathyroid hormone-like and -unlike domains. Biochem Biophys Res Commun 146:672–678[CrossRef][Medline]
  8. Strewler GJ, Stern PH, Jacobs JW, Eveloff J, Klein RF, Leung SC, Rosenblatt M, Nissenson RA 1987 Parathyroid hormone-like protein from human renal carcinoma cells. Structural and functional homology with parathyroid hormone. J Clin Invest 80:1803–1807
  9. Jüppner H, Abou-Samra A-B, Uneno S, Gu W-X, Potts Jr JT, Segre GV 1988 The parathyroid hormone-like peptide associated with humoral hypercalcemia of malignancy and parathyroid hormone bind to the same receptor on the plasma membrane of ROS 17/2.8 cells. J Biol Chem 263:8557–8560[Abstract/Free Full Text]
  10. Nissenson RA, Diep D, Strewler GJ 1988 Synthetic peptides comprising the amino-terminal sequence of a parathyroid hormone-like protein from human malignancies. Binding to parathyroid hormone receptors and activation of adenylate cyclase in bone cells and kidney. J Biol Chem 263:12866–12871[Abstract/Free Full Text]
  11. Jüppner H, Abou-Samra A-B, Freeman M, Kong XF, Schipani E, Richards J, Kolakowski Jr LF, Hock J, Potts Jr JT, Kronenberg HM, Segre GV 1991 A G protein-linked receptor for parathyroid hormone and parathyroid hormone-related peptide. Science 254:1024–1026[Abstract/Free Full Text]
  12. Abou-Samra A-B, Jüppner H, Force T, Freeman MW, Kong X-F, Schipani E, Urena P, Richards J, Bonventre JV, Potts JT, Kronenberg HM, Segre GV 1992 Expression cloning of a common receptor for parathyroid hormone and parathyroid hormone-related peptide from rat osteoblast-like cells: a single receptor stimulates intracellular accumulation of both cAMP and inositol triphosphates and increases intracellular free calcium. Proc Natl Acad Sci USA 89:2732–2736[Abstract/Free Full Text]
  13. Burtis WJ, Brady TG, Orloff JJ, Ersbak JB, Warrell RP, Olson BR, Wu TL, Mitnick ME, Broadus AE, Stewart AF 1990 Immunochemical characterization of circulating parathyroid hormone-related protein in patients with humoral hypercalcemia of cancer. N Engl J Med 322:1106–1112[Abstract]
  14. Southby J, Kissin MW, Danks JA, Hayman JA, Moseley JM, Henderson MA, Bennett RC, Martin TJ 1990 Immunohistochemical localization of parathyroid hormone-related protein in human breast cancer. Cancer Res 50:7710–7716[Abstract/Free Full Text]
  15. Ikeda K, Mangin M, Dreyer BE, Webb AC, Posillico JT, Stewart AF, Rander NH, Weir EC, Insogna KL, Broadus AE 1988 Identification of transcripts encoding a parathyroid hormone-like peptide in messenger RNAs from a variety of human and animal tumors associated with humoral hypercalcemia of malignancy. J Clin Invest 81:2010–2016
  16. Francini G, Maiolo E, Petriolo E, Paffetti P, Gonnelli S, Aquino A 1993 Production of parathyroid hormone and parathyroid hormone-related protein by breast cancer cells in culture. J Cancer Res Clin Oncol 119:421–425[CrossRef][Medline]
  17. Philbrick WM, Wysolmerski JJ, Galbraith S, Holt E, Orloff JJ, Yang KH, Vasavada RC, Weir EC, Broadus AE, Stewart AF 1996 Defining the role of parathyroid hormone-related protein in normal physiology. Physiol Rev 76:127–173[Abstract/Free Full Text]
  18. Yang KH, Stewart AF 1996 The PTH-related protein gene and protein products. In: Bilezikian JP, Riasz L, Rodan G (eds) Principles of Bone Biology. Academic, San Diego, pp 347–376
  19. Karaplis AC, Luz A, Glowacki J, Bronson RT, Tybulewicz VLJ, Kronenberg HM, Mulligan RC 1994 Lethal skeletal dysplasia from targeted disruption of the parathyroid hormone-related peptide gene. Genes Dev 8:277–289[Abstract/Free Full Text]
  20. Wu T, Vasavada R, Yang K, Massfelder T, Ganz M, Abbas SK, Care AD, Stewart AF 1996 Structural and physiologic characterization of the midregion secretory species of parathyroid hormone-related protein. J Biol Chem 271:24371–24381[Abstract/Free Full Text]
  21. Plawner LL, Philbrick WM, Burtis WJ, Broadus AE, Stewart AF 1995 Cell type-specific secretion of parathyroid hormone-related protein via the regulated versus the constitutive secretory pathway. J Biol Chem 270:14078–14084[Abstract/Free Full Text]
  22. Kaiser SM, Laneuville P, Bernier SM, Rhim JS, Kremer R, Goltzman D 1992 Enhanced growth of a human keratinocyte cell line induced by antisense RNA for parathyroid hormone-related peptide. J Biol Chem 267:13623–13628[Abstract/Free Full Text]
  23. Massfelder T, Dann P, Wu TL, Vasavada R, Helwig J-J, Stewart AF 1997 Opposing mitogenic and antimitogenic actions of parathyroid hormone-related protein in vascular smooth muscle cells: a critical role for nuclear targeting. Proc Natl Acad Sci USA 94:13630–13635[Abstract/Free Full Text]
  24. Henderson JE, He B, Goltzman D, Karaplis AC 1996 Constitutive expression of parathyroid hormone-related peptide (PTHrP) stimulates growth and inhibits differentiation of CFK2 chondrocytes. J Cell Physiol 169:33–41[CrossRef][Medline]
  25. Iwamura M, Abrahamsson PA, Foss KA, Wu G, Cockett AT, Deftos LJ 1994 Parathyroid hormone-related protein: a potential autocrine growth regulator in human prostate cancer cell lines. Urology 43:675–679[CrossRef][Medline]
  26. Burton PBJ, Moniz C, Knight DE 1990 Parathyroid hormone related peptide can function as an autocrine growth factor in human renal cell carcinoma. Biochem Biophys Res Commun 167:1134–1138[CrossRef][Medline]
  27. Kaiser SM, Sebag M, Rhim JS, Kremer R, Goltzman D 1994 Antisense-mediated inhibition of parathyroid hormone-related peptide production in a keratinocyte cell line impedes differentiation. Mol Endocrinol 8:139–147[Abstract]
  28. Henderson JE, Amikuza N, Warshawsky H, Biasotto D, Lanske BMK, Goltzman D, Karaplis AC 1995 Nucleolar localization of parathyroid hormone-related peptide enhances survival of chondrocytes under conditions that promote apoptotic cell death. Mol Cell Biol 15:4064–4075[Abstract]
  29. Lam MHC, Olsen SL, Rankin WA, Ho PWM, Martin TJ, Gillespie MT, Moseley JM 1997 PTHrP and cell division: expression and localization of PTHrP in a keratinocyte cell line (HaCaT) during the cell cycle. J Cell Physiol 173:433–446[CrossRef][Medline]
  30. Nguyen MTA, Karaplis AC 1998 The nucleus: a target site for parathyroid hormone-related peptide (PTHrP) action. J Cell Biochem 70:193–199[CrossRef][Medline]
  31. Dingwall C, Laskey RA 1991 Nuclear targeting sequences—a consensus? Trends Biochem Sci 16:478–481[CrossRef][Medline]
  32. Liapis H, Crouch EC, Grosso LE, Kitazawa S, Wick MR 1993 Expression of parathyroid like protein in normal, proliferative and neoplastic human breast tissues. Am J Pathol 143:1169–1178[Abstract]
  33. Budayr AA, Halloran BP, King JC, Diep D, Nissenson RA, Strewler GJ 1989 High levels of parathyroid hormone-like protein in milk. Proc Natl Acad Sci USA 86:7183–7185[Abstract/Free Full Text]
  34. Thurston AW, Cole JA, Hillman LS, Im JH, Thorne PK, Krause WJ, Jones JR, Eber SL, Forte LR 1990 Purification and properties of parathyroid hormone-related peptide isolated from milk. Endocrinology 126:1183–1190[Abstract]
  35. Thiede MA, Rodan GA 1988 Expression of a calcium mobilizing parathyroid hormone-like peptide in lactating mammary tissue. Science 242:278–280[Abstract/Free Full Text]
  36. Ratcliffe WA 1992 Role of parathyroid hormone-related protein in lactation. Endocrinology 37:402–404
  37. Khosla S, van Heerden JA, Gharib H, Jackson IT, Danks J, Hayman JA, Martin TJ 1990 Parathyroid hormone-related protein and hypercalcemia secondary to massive mammary hyperplasia. N Engl J Med 322:1157[Medline]
  38. Wysolmerski J, Daifotis A, Broadus A, Milstone L 1993 Overexpression of PTHrP in transgenic mice results in breast hyperplasia. J Bone Miner Res 8:129
  39. Ferrari SI, Rizzoli R, Bonjour JP 1992 Parathyroid hormone related protein production by primary cultures of mammary epithelial cells. J Cell Physiol 150:304–311[CrossRef][Medline]
  40. Wysolmerski JJ, McCaughern-Carucci JF, Daifotis AG, Broadus AE, Philbrick WM 1995 Overexpression of parathyroid hormone-related protein or parathyroid hormone in transgenic mice impairs branching morphogenesis during mammary gland development. Development 121:3539–3547[Abstract]
  41. Wysolmerski JJ, Philbrick WM, Dunbar ME, Lanske B, Kronenberg H, Broadus AE 1998 Rescue of the parathyroid hormone-related protein knockout mouse demonstrates that parathyroid hormone-related protein is essential for mammary gland development. Development 125:1285–1294[Abstract]
  42. Deleted in proof
  43. Falzon M, Zong J 1998 The noncalcemic vitamin D analogs EB1089 and 22-oxacalcitriol suppress serum-induced parathyroid hormone-related peptide gene expression in a lung cancer cell line. Endocrinology 139:1046–1053[Abstract/Free Full Text]
  44. Yasuda T, Banville D, Hendy GN, Goltzman D 1989 Characterization of the human parathyroid hormone-like peptide gene. J Biol Chem 264:7720–7725[Abstract/Free Full Text]
  45. Maniatis T, Fritsch EF, Sambrook J (eds) 1989 Molecular Cloning: A Laboratory Manual, ed 2. Cold Spring Harbor Laboratory, Cold Spring Harbor
  46. Coen DM 1995 The polymerase chain reaction. In: Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (eds) Current Protocols in Molecular Biology. John Wiley and Sons, Inc., New York, unit 1553
  47. Danielson PE, Forss-Petter S, Brow MA, Calavetta L, Douglass J, Milner RJ, Sutcliffe JG 1988 p1B15:a cDNA clone of the rat mRNA encoding cyclophilin. DNA 7:261–267[Medline]
  48. Li H, Seitz PK, Thomas ML, Selvanayagam P, Rajaraman S, Cooper CW 1995 Widespread expression of the parathyroid hormone (PTH)-related peptide (PTHrP and the PTH/PTHrP receptor genes in intestinal epithelial cells. Lab Invest 73:864–870