| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Pharmacology and Toxicology, and Sealy Center for Molecular Science, University of Texas Medical Branch, Galveston, Texas 77555
Address all correspondence and requests for reprints to: Miriam Falzon, Ph.D., Department of Pharmacology and Toxicology, 10th and Market Streets, The University of Texas Medical Branch, Galveston, Texas 77555-1031. E-mail: mfalzon{at}utmb.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although initially discovered in malignancies, PTHrP is now known to be produced by most cells and tissues in the body (6, 17, 18, 19). Unlike PTH, PTHrP does not circulate in appreciable amounts in normal subjects but is thought to exert its effects in an autocrine/paracrine manner. After translation, PTHrP enters the secretory pathway; during its transit, the peptide is proteolytically cleaved at basic residues, to yield a family of mature secretory forms of the peptide (17, 18, 20, 21). In view of its widespread distribution in normal cells, functions unrelated to calcium homeostasis have been ascribed to PTHrP, including modulation of cell growth and differentiation. Indeed, the peptide has now been shown to modulate growth in normal cells such as keratinocytes (22), vascular smooth muscle cells (23), and chondrocytes (24) and in transformed cells such as prostate cancer (25) and renal carcinoma (26) cells.
In addition to effects that are mediated via signal transduction cascades initiated at membrane receptors, there is evidence for an intracellular role for PTHrP in cell cycle progression and apoptosis (27, 28, 29). The PTHrP molecule contains a midregion nuclear localization sequence (NLS) that localizes PTHrP to the nucleus or nucleolus (22, 23, 28, 30). The NLS comprises multibasic clusters in the 88–106 region, similar to nuclear or nucleolar localization signals found in viral and mammalian transcription factors (31). In fact, PTHrP has been localized in the nucleus/nucleolus of chondrocytes, transfected COS cells, and vascular smooth muscle cells (23, 28). Deletion of the NLS prevents this targeting (23, 28), and expression of the multibasic 87–106 region as a fusion protein with the ß-galactosidase gene directs the ß-galactosidase protein to the nucleolus (28).
Most breast cancer cells secrete higher levels of PTHrP than do normal breast cells (1, 7). PTHrP is also closely linked to normal mammary gland function and is expressed by human breast epithelium (32). It is found in considerable amounts in the milk of several mammalian species, including human (33, 34, 35). Its expression is enhanced during lactation, when the mammary gland is in a proliferative state and mobilization and transfer of calcium to the milk are required (36). In fact, PTHrP is thought to control the proliferation/differentiation that is linked to the compensatory growth of the mammary gland during lactation (37, 38). Primary cultures of mammary epithelial cells from lactating rats secrete PTHrP in vitro (39). Studies in transgenic mice have shown the involvement of the peptide in branching morphogenesis of the mammary gland, again indicating active participation of the peptide in normal mammary development (40). The biological relevance of PTHrP in the breast is further underscored by studies in knockout mice, where the absence of PTHrP leads to mammary epithelial cell degeneration (41).
It has thus been suggested that production of PTHrP by breast carcinomas may reflect uncontrolled activation in the tumor cells of pathways normally operative in lactation (37). Therefore, the effects of PTHrP on breast cancer cell growth are of both biological and clinical significance. We were interested in studying the growth effects of PTHrP in the breast cancer cell line, MCF-7. Here, we report that PTHrP exerts opposing mitogenic and antimitogenic effects, depending on whether it is acting via the intracrine or autocrine/paracrine pathways, respectively, and that the net effect of PTHrP overexpression in MCF-7 cells is accelerated cell growth.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmids and oligonucleotides
The PTHrP constructs expressing PTHrP in the sense or antisense
orientation were constructed by cloning hPTHrP complementary DNA (cDNA)
coding for amino acids -5 to +139 (a generous gift from Dr. W. I.
Wood, Genentech, Inc., South San Francisco, CA) in the
expression vectors pCDNA3.1 (+) or (-) (Invitrogen, San
Diego, CA), respectively [(+) and (-) refer to the orientation of the
multiple cloning site within the vector, relative to the direction of
transcription from the T7 promoter]. These constructs, as well as
pCDNA3.1(+) as the empty vector control, were transfected into MCF-7
cells by the calcium phosphate coprecipitation technique. The DNA
template used to prepare the sense and antisense probes for Northern
blot analysis was a 231-bp DNA fragment spanning exons 3 and 4 of the
hPTHrP gene (43, 44).
A phosphorothioated antisense oligodeoxynucleotide was used to inhibit PTHrP production in MCF-7 cells. This oligomer (5' CCGCTGCATCGTCTC 3'; Genosys, Woodlands, TX) is complimentary to the translation start site of the PTHrP gene. A phosphorothioated sense oligodeoxynucleotide (5' GAGACGATGCAGCGG 3'), whose sequence spans the PTHrP translation start site, was used as negative control. These oligomers were used to treat MCF-7 cells, as described below.
Cell culture and stable transfection
MCF-7 cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and were grown at
37 C in a humidified 95% O2-5%
CO2 atmosphere in DMEM (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% FBS (Atlanta
Biologicals, Norcross, GA) and L-glutamine. For cell
proliferation experiments, cells were grown in the amount of FBS
specified in the Results section.
MCF-7 cells were stably transfected by the calcium phosphate coprecipitation technique, according to the manufacturer’s specifications (Promega Corp., Madison, WI). Two days after transfection, 600 µg/ml G418 (Geneticin; Life Technologies, Inc./BRL) was added, and resistant clones were selected. Single clones of stably transfected cells, isolated by limiting dilution in 96-well plates, were transferred to individual flasks and cultured in medium containing 150 µg/ml G418. Individual clones were tested for PTHrP production using an immunoradiometric assay (described below), and endogenous and transfected messenger RNAs (mRNAs) were detected by Northern blot analysis (also described below).
Northern blot analysis
Total RNA was isolated using RNA STAT-60 (Tel-Test
‘B’, Friendswood, TX), and mRNA was prepared using the mRNA Isolator
kit (CLONTECH Laboratories, Inc., Palo Alto, CA). RNA gel
electrophoresis was performed under standard conditions (45) using 15
µg of total RNA or 2 µg of mRNA. The RNA was then blotted onto
nitrocellulose (Schleicher & Schuell, Inc., Keene, NH) by
capillary action. Probes for hybridization were prepared by the
asymmetric PCR (46). The PCR template was a 231-bp DNA fragment
spanning exons 3 and 4 of the hPTHrP gene (43, 44). To detect
endogenous RNA and RNA produced by the transfected sense PTHrP
construct, an antisense probe was prepared using the downstream primer
from exon 4 of the hPTHrP gene (5'-GTTAGGGGACACCTCCGAGGT-3'). RNA
produced as a result of transfection with the antisense PTHrP construct
was detected using the upstream primer (5'- CTGGTTCAGCAGTGGAGCGTC-3')
from exon 3 of the hPTHrP gene, to prepare a sense probe. The blots
were prehybridized for 30 min and hybridized for 2 h in Expresshyb
(CLONTECH Laboratories, Inc.) at 68 C. After
hybridization, the blots were washed twice in 2 x SSC (1 x
SSC is 0.15 M NaCl plus 0.15 M sodium citrate),
0.05% SDS for 15 min at room temperature, and then twice in 0.1
x SSC, 0.1% SDS at 65 C for 30 min. The washed membranes were exposed
to Kodak X-Omat film (Eastman Kodak Co.,
Rochester, NY), at -70 C, with intensifying screens.
To control for equal RNA loading and transfer, the membranes were also probed with a DNA fragment containing cyclophilin sequences (47), labeled by the random primer extension reaction using a multiprime labeling kit (Amersham Pharmacia Biotech, Arlington Heights, IL). After autoradiography, the intensities of the bands representing PTHrP and cyclophilin were evaluated using the Sigmagel program (Jandel Scientific, San Rafael, CA).
PCR
PCR was used to confirm the integrity of the transfected sense
and antisense PTHrP and of the transfected empty vector control.
Genomic DNA from transfected cells was prepared using DNA Isolator
(Tel-Test ‘B’), per the manufacturer’s specifications.
PCR was carried out using the following primers: upstream, the T7
primer (5' TAATACGACTCACTATAGGG 3'); and downstream, the pCDNA3.1
reverse primer (5' TAGAAGGCACAGTCGAGG 3'). These primers recognize
sequences within the pCDNA3.1 vector. After initial denaturation of the
template at 94 C for 5 min, PCR was carried out for 30 cycles as
follows: denaturing at 94 C for 30 sec, annealing at 60 C for 45 sec,
and extension at 72 C for 45 sec. After gel electrophoresis to assess
its size, the PCR product was sequenced to ascertain the integrity of
the insert.
Immunoprecipitation
Rabbit antiserum to human recombinant PTHrP(-5 to +139) was
used to immunoprecipitate PTHrP secreted into the culture medium. This
antiserum shows the same pattern of immunostaining using skin or
gastrointestinal tissues, as does a rabbit antiserum to synthetic
hPTHrP(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), and staining could be abolished by prior adsorption of
the antiserum with its antigen (48). This antiserum to recombinant
PTHrP has not yet been fully characterized with synthetic PTHrP
fragments to determine the major epitopes that it recognizes (48).
The antiserum-antigen (PTHrP) complex contained in the conditioned medium was immunoprecipitated using staphylococcal protein A-Sepharose beads (Sigma). A 100-µl aliquot of protein A beads (10% vol/vol in 0.02 M disodium hydrogen phosphate, 0.015 M sodium chloride) was added, and the mixture was incubated overnight at 4 C with rocking. The beads were then collected by centrifugation at 10,000 x g for 15 sec at 4 C. The supernatant was collected, concentrated, and analyzed for PTHrP by the radioimmunometric assay described below. Immunoprecipitation of conditioned medium from cell cultures to which preimmune rabbit serum was added served as control.
Immunoassay for secreted PTHrP
The amount of PTHrP secreted into the culture medium was
measured using a immunoradiometric sandwich assay (Nichols Institute Diagnostics, San Juan Capistrano, CA), as previously
described (43). Single clones of transfected cells and control
(untransfected) cells were plated in 24-well dishes (5 x
104 cells/well). The medium was replaced after
24 h. Conditioned medium was collected after a further 5 days and
frozen at -80 C for future use, and the cell number was determined
using a Coulter counter. Before assay, aliquots of the conditioned
medium (range, 0.4–1 ml, calculated to represent conditioning by the
same number of cells) were concentrated to 0.2 ml by acetone
precipitation. This concentration procedure did not cause a significant
loss of PTHrP (
95% recovery). Similarly concentrated unconditioned
medium (never exposed to cells) served as a negative control. The assay
was carried out per the manufacturer’s specifications. The detection
limit of the assay is 0.7 pmol/liter (49).
PTHrP immunocytochemistry
PTHrP was detected using an avidin-biotin-immunoperoxidase
method (Vector Laboratories, Inc., Burlingame, CA). Cells
grown on Lab-Tek chamber slides (Nalge Nunc International,
Naperville, IL) were washed with cold PBS, fixed in acetone for 10 min
at -20 C, washed again with PBS, and then treated with 2% hydrogen
peroxide for 5 min at room temperature to inactivate endogenous
peroxidase. Labeling was carried out using a kit from Oncogene Research
Products (Cambridge, MA), per the manufacturer’s specifications. Cells
were first preincubated with diluted normal horse serum for 20 min at
room temperature, followed by primary antibody (anti-PTHrP mouse
monoclonal IgG) for 60 min at room temperature. Control cells received
no primary antibody. After washing in cold PBS, cells were treated with
biotinylated antimouse secondary antibody for 30 min at room
temperature. The cells were washed again in PBS and then treated with
avidin-biotin-horseradish peroxidase complex (Vector Laboratories, Inc.) for 30 min at room temperature. After
washing with PBS, cells were exposed to diaminobenzidine for 5
min. The percentage of cells whose nuclei stained positively were
counted in a blinded fashion by two observers using computerized
histomorphometry (Optimus Corp., Bothell, WA).
Measurement of intracellular cAMP levels
MCF-7 cells were plated into 24-well dishes, at 5 x
104 cells/well, in DMEM containing 10% FBS. When
the cells were nearly confluent, the medium was removed and replaced
with PBS containing 1 mM calcium chloride, 15% NuSerum
(Collaborative Biomedical Products, Bedford, MA), 1 mM
magnesium chloride, 20 mM HEPES, 85 U/ml
Trasylol (FBA Pharmaceuticals, New York, NY), 0.2% BSA,
0.1% glucose, and 1 µM isobutylmethylxanthine
(IBMX, Sigma), and the indicated concentrations of
hPTHrP(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), hPTH(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), bPTH(3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), [Leu11,
D-Trp12]hPTHrP-(7–34) amide,
[Asn10,
Leu11]hPTHrP-(7–34) amide, salmon calcitonin,
or secretin. Incubation was carried out for 15 min at room temperature.
After removal of medium, cells were rinsed twice with 1 ml ice-cold
PBS, and 500 µl cold 10% trichloroacetic acid was added. After
centrifugation, trichloroacetic acid supernatants were frozen at -70 C
until assayed for cAMP. Cell precipitates were dissolved in 1
N sodium hydroxide, and protein was measured by the
Bradford assay (50) (Bio-Rad Laboratories, Inc., Hercules,
CA). The RIA for cAMP was carried out as previously described (51). For
assay, aliquots of supernatant were neutralized with calcium carbonate
and acetylated to increase sensitivity.
125I-succinylated cAMP was purchased from
Amersham Pharmacia Biotech, and goat antiserum to
succinylated cAMP (kindly provided by Dr. G. A. Nickols, Monsanto,
St. Louis, MO) was used at a final dilution of 1:200,000.
Experimental design; cell proliferation
To measure the effects of added PTHrP peptides on cell
proliferation, MCF-7 cells were plated into 24-well dishes at
104 cells/well in medium containing 10% FBS. In
some experiments, cells were transferred to medium containing 2.5%
serum after 24 h. After a further 24 h, cells were treated
with the different hPTHrP peptides, forskolin, 8Br-cAMP or TPA at the
indicated concentrations for the indicated time intervals. Control
cells received an equivalent volume of vehicle. Cells were counted
after 3 or 5 days of treatment. When cells were treated with peptides
for 5 days, the growth medium was replaced with fresh
peptide-containing medium after 3 days. The cells were then trypsinized
and counted in a Coulter counter (Coulter Electronics Inc., Hialeah, FL).
Anti-PTHrP(-5 to +139) antiserum was used to neutralize secreted PTHrP and exogenously added PTHrP(1–34) or (1–86). Cells were plated into 24-well dishes at 104 cells/well in medium containing 10% FBS. After 24 h, cells were transferred to medium containing 2.5% FBS (day 0). Cells were then treated with anti-PTHrP antiserum or preimmune rabbit serum as control (final concentration 2% vol/vol), with or without 10-7 M PTHrP(1–34) or PTHrP(1–86). After 72 h, the cell culture medium was collected for immunoprecipitation, the supernatant was assayed for PTHrP by the immunoradiometric assay, and cells were then trypsinized and counted.
To measure the effects of over- or underexpression of PTHrP on cell proliferation, cells were plated into 24-well dishes at 104 cells/well in medium containing 10% serum, then transferred to medium containing 2.5% serum after 24 h (day 0). Cells were then trypsinized and counted at days 1, 3, 5, and 8.
Anti-PTHrP(-5 to +139) antiserum was used to neutralize secreted PTHrP in sense PTHrP- or empty vector-transfected cells. Cells were plated into 24-well dishes at 104 cells/well in medium containing 10% FBS. After 24 h, cells were transferred to medium containing 2.5% serum (day 0), and anti-PTHrP antiserum was added in concentrations (% vol/vol) ranging from 0.5–5%. Preimmune rabbit serum was used as control. At days 1, 3, 5, and 8, the cell culture medium was collected for immunoprecipitation, the supernatant was assayed for PTHrP by immunoassay, and the cells were then trypsinized and counted.
To measure the effects of inhibition of PTHrP synthesis on MCF-7 cell proliferation, cells were plated into 24-well dishes at 104 cells/well in medium containing 10% serum, then transferred to 2.5% serum after 24 h. After a further 24 h, the cells were treated with either antisense or sense phosphorothioated oligonucleotide (in a concentration range of 1–5 µM). Three or 5 days after treatment, the culture medium was collected for measurement of secreted PTHrP by the immunoradiometric assay. Cells were then trypsinized for counting.
Thymidine incorporation assay
For these experiments, cells were plated in 24-well plates at
104 cells/well in medium containing 10% FBS.
After 24 h, cells were transferred to medium containing 2.5%
serum. In some experiments, cells were treated with the indicated
hPTHrP fragments (10-7 M). After 3
days (when exogenous peptides were added) or 8 days (when comparing
sense PTHrP-, antisense PTHrP- and empty vector-transfected cells) in
culture, the cells were pulse-treated with
[3H]thymidine (0.2 µCi/ml) for 2 h. To
determine [3H]thymidine incorporation, the cell
monolayer was washed twice with PBS, and a fraction of the cells was
counted with a Coulter counter. The nucleic acids in the rest of the
cell fraction were precipitated with trichloroacetic acid and
solubilized with sodium hydroxide for scintillation counting. The
results were expressed as counts per number of cells.
Statistics
Numerical data are presented as the mean ±
SEM. Data were analyzed by ANOVA, with t tests,
to determine the statistical significance of differences.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and Table 1). The ability of hPTHrP(1–34) and
hPTH(1–34) to induce a cAMP response in MCF-7 cells was dose-related
between 0.1 and 100 nM; cAMP production reached a plateau
at 10 nM with both peptides (Fig. 1). The
ED50 for PTH(1–34) in the ROS 17/2.8 (rat
osteosarcoma) cell line, which is a classical positive control for
PTH/PTHrP receptor studies, is 3 nM (53), a value
similar to that obtained in MCF-7 cells (Fig. 1). This indicates that
PTH/PTHrP receptors behave in a classical manner in MCF-7 cells. In
contrast, the structurally unrelated peptides salmon calcitonin and
secretin, as well as hPTHrP(107–139), which do not interact with the
PTH/PTHrP receptor, had no effect on cAMP production, even at 1
µM (Table 1). Similarly, two PTHrP antagonists,
[Leu11,
D-Trp12]hPTHrP-(7–34) amide and
[Asn10,
Leu11]hPTHrP-(7–34) amide, and the PTH
antagonist bPTH(3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34), did not increase cAMP in these cells (Table 1).
|
|
). The two peptides were equipotent,
with peak inhibition (40% decrease in cell number after 3 days
treatment) occurring with concentrations of 10-7
M or higher (Fig. 2A). Concentrations of
10-8 M and lower produced proportionately
smaller effects for each peptide (Fig. 2A). MCF-7 cells exposed to
hPTHrP(1–34) or (1–86) in culture medium containing 10% serum
required higher concentrations of PTHrP(1–34) or (1–86) for growth
inhibition, such that a 35% decrease in cell number was observed with
10-6 M peptide (data not
shown).
|
). Again, the effects on cell
growth were greater when the culture medium contained 2.5% serum, as
opposed to 10% serum (data not shown).
Growth inhibition was also observed in cells exposed to 8Br-cAMP and
forskolin (Fig. 2A), supporting the idea that the growth effects may be
cAMP-mediated and that the PTH/PTHrP receptor is coupled to adenylyl
cyclase in MCF-7 cells. TPA also inhibited cell growth (Fig. 2A),
suggesting that the receptor may also be coupled to phospholipase C in
these cells.
PTHrP(1–16) did not affect cell growth (Fig. 2B), presumably because
this peptide does not interact with the cell surface PTH/PTHrP
receptor. Similarly, hPTHrP(27–139) and (107–139), which lack the N
terminus, had no effect on cell growth (Fig. 2B).
Exposing MCF-7 cells to hPTHrP(1–34), (1–86), or (1–139) for 5 days
produced slightly larger inhibition of cell growth (10% greater
effect), compared with the 3-day treatment (data not shown).
hPTHrP(1–16), (27–139), and (107–139) still produced no effect after
a 5-day treatment (data not shown).
These results were confirmed using the [3H]thymidine incorporation assay. PTHrP(1–34), (1–86), and (1–139), at a concentration of 10-7 M, decreased thymidine incorporation by 35–50% after 3 days of treatment; whereas PTHrP(1–16), (27–139), and (107–139) had no effect (data not shown).
PTHrP antibody neutralizes the effects of added peptides
Anti-PTHrP(-5 to +139) antiserum was used to confirm the
growth-inhibitory effects of added PTHrP peptides on MCF-7 cells.
Secreted PTHrP was neutralized with 2% (vol/vol) antiserum, and the
PTHrP-antiserum complex was removed by immunoprecipitation.
Immunoradiometric measurement of PTHrP in the culture medium detected
negligible residual amounts of PTHrP after 3 days in culture ( 80%
decrease). Neutralization of endogenously produced and secreted PTHrP
resulted in an increase of approximately 20% in MCF-7 cell growth
(Fig. 3), presumably because the
endogenous peptide inhibits MCF-7 cell growth. The antiserum also
neutralized the effects of added hPTHrP(1–34) and (1–86), such that a
10-7 M concentration of each of the
peptides did not inhibit cell proliferation (Fig. 3). In contrast, each
of the peptides inhibited MCF-7 cell proliferation by approximately
40% in the presence of preimmune serum (Fig. 3). Preimmune serum alone
(2% vol/vol) had no effect on cell growth (Fig. 3). These results
confirm that added PTHrP peptides affect cell growth by acting at the
cell surface and that endogenous PTHrP acting at the cell surface
inhibits MCF-7 cell growth.
|
, where data are shown for two clones
per treatment). Equivalent quantities of endogenous PTHrP transcript
were observed in sense PTHrP- and empty vector-transfected MCF-7 cells.
However, the endogenous transcript was not detected in cells
transfected with a vector expressing antisense PTHrP mRNA (Fig. 4A).
Untransfected MCF-7 cells expressed the same level of transcript as
sense and empty vector transfectants (data not shown). Transfected
sense PTHrP mRNA was only detected in cells transfected with the sense
PTHrP expression construct (Fig. 4B). This transcript was not detected
in empty vector- or antisense PTHrP-transfected cells (Fig. 4B)
[longer exposure of blots from empty vector and sense
PTHrP-transfected cells showed the presence of endogenous RNA (data not
shown)]. The antisense transcript was only expressed in
antisense-transfected cells, and it was absent in both sense PTHrP- and
empty vector-transfected cells (Fig. 4C).
|
, a 176-bp amplimer was detected in
empty vector-transfected cells, and a 678-bp amplimer, corresponding to
vector plus PTHrP sequences, was detected in cells transfected with
sense and antisense PTHrP-expression constructs. No amplimer was
detected in untransfected cells (data not shown).
PTHrP secretion was measured by immunoassay, where data are again shown
for two clones per treatment. The amount of PTHrP secreted by control
cells is 1.3 ± 0.04 pM. Transfection with the sense
construct produced a significant increase in PTHrP production, whereas
transfection with the antisense construct decreased PTHrP production
(Fig. 5). PTHrP secretion from the empty
vector-transfected cells was not significantly different from that of
untransfected cells (Fig. 5).
|
. The proliferation rate of MCF-7 clones
overexpressing PTHrP was more rapid than that of empty
vector-transfected cells, such that, after 8 days in culture, the cell
number of the two PTHrP-overexpressing clones was about twice that of
the empty vector-transfected clones. On the other hand, the growth rate
of two antisense PTHrP-transfected clones was significantly less than
that of the empty vector-transfected clones. The rate of proliferation
of untransfected MCF-7 cells was the same as that of the
vector-transfected clones (data not shown).
|
Neutralization of secreted PTHrP does not affect the increased cell
proliferation of sense PTHrP-transfected cells
To establish a role for nuclear PTHrP in the increased rate of
proliferation of sense PTHrP-transfected cells, secreted PTHrP was
neutralized with increasing amounts of anti-PTHrP(-5 to +139)
antiserum. Immunoradiometric measurement of PTHrP in culture
medium from sense PTHrP- and empty vector-transfected MCF-7 cells
(after immunoprecipitation of the PTHrP-antiserum complex) confirmed
that there was negligible free PTHrP in the culture medium (Fig. 7A). Preimmune serum had no effect on
secreted PTHrP levels (Fig. 7A). Anti-PTHrP antiserum did not eliminate
the growth advantage of sense PTHrP-transfected MCF-7 cells over the
empty vector-transfected counterparts. Thus, the rate of proliferation
of sense PTHrP-transfected cells was still significantly higher than
that of vector-transfected cells (Fig. 7B). In fact, anti-PTHrP
antiserum-treated sense PTHrP-transfected cells proliferated
approximately 15–20% faster than the same cells not exposed to
anti-PTHrP antiserum, presumably because the anti-PTHrP antiserum
neutralized secreted PTHrP, which normally has a growth-inhibitory
effect on MCF-7 cells (Fig. 3). Preimmune serum had no effect on cell
growth (Fig. 7C). These results suggest that PTHrP accelerates cell
growth via an intracrine mechanism in these transfected cells.
|
). Cytoplasmic staining was present in
all the cells, whereas perinuclear staining was present in
approximately 5% of nuclei. Perinuclear staining was most often
associated with cells in the process of, or just completing, cell
division (Fig. 8A). Empty vector-transfected cells showed less intense
cytoplasmic staining, and perinuclear staining was observed in less
than 1% of nuclei (Fig. 8B). Again, perinuclear staining was observed
in cells that were dividing or that had just completed cell division.
Control untransfected cells showed the same pattern of staining as
vector-transfected cells (data not shown). Antisense PTHrP-transfected
cells showed no cytoplasmic or perinuclear staining (Fig. 8C). Cells
stained in the absence of primary antibody showed no cytoplasmic or
nuclear staining (data not shown).
|
). Treatment
with the latter oligomer had no effect on PTHrP secretion, compared
with an untreated control (Fig. 9A).
|
). The
sense oligomer had no significant effect on cell growth, compared with
untreated controls (Fig. 9B). These results indicate that the net
effect of endogenous PTHrP is increased cell proliferation, consistent
with the increase in cell proliferation observed with MCF-7 cells
overexpressing the peptide (Fig. 6). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
PTHrP regulates growth and differentiation in virtually every cell and
tissue examined (17). Studies in transgenic mice have demonstrated that
PTHrP is required for normal mammary development (41), normal
chondrocyte maturation and differentiation in the epiphyseal growth
plate (19), and normal epidermal and hair follicle development (56).
Targeted overexpression of PTHrP in the pancreatic isle leads to
increased pancreatic ß-cell mass (57). PTHrP also modulates growth in
prostate cancer cells (25), Leydig tumor cells (58), renal carcinoma
cells (26), vascular smooth muscle (23) cells, and osteoblasts (59, 60). Proliferative vs. antiproliferative effects seem to be
dependent on the cell type. For example, here, we show that in MCF-7
cells, exogenous PTHrP(1–34), (1–86), and (1–139) decrease cell
proliferation (Fig. 2). The same effects have been reported in vascular
smooth muscle cells (23). Conversely, in prostate cancer cell lines,
addition of exogenous PTHrP(1–34) stimulates cell proliferation
(25).
In MCF-7 cells, PTHrP exerts an antimitogenic effect when acting via
the cell surface PTH/PTHrP receptor. Thus, blocking the effects of
endogenously secreted PTHrP at the cell surface, using an anti-PTHrP
antiserum, resulted in an increased rate of proliferation of MCF-7
cells (Fig. 3). In addition, the growth inhibitory effects of
exogenously added N-terminal PTHrP moieties were eliminated with the
same anti-PTHrP antiserum (Fig. 3). Non-N-terminal PTHrP moieties known
not to interact with the receptor, [PTHrP(107–139) and
PTHrP(27–139)] had no effect on cell growth in MCF-7 cells (Fig. 2).
Therefore, we conclude that PTHrP action through the
autocrine/paracrine pathway exerts an antiproliferative effect. These
results differ from those of Birch et al. (52), who found a
mitogenic response to PTHrP(1–34) in the same cell line. However,
these authors reported that such an effect could only be obtained using
quiescent MCF-7 cells, whereas our studies were carried out using
rapidly proliferating cells, more like growing breast tumors.
In addition to its well-documented effects elicited through signal
transduction cascades, recent studies have shown that PTHrP also acts
in an intracrine fashion after translocation to the nucleus or
nucleolus (23, 27, 28, 29, 30). Immunocytochemistry and immunoelectron
microscopy studies have localized PTHrP in the nuclear compartment of
MCF-7 cells (Fig. 8), as well as in keratinocytes, chondrocytes,
osteoblasts, transfected COS cells, and vascular smooth muscle cells
(23, 27, 28, 29). Nuclear translocation is dependent on the presence of a
bipartite NLS, which consists of two clusters of basic amino acids
separated by a spacer (10-residue) (31). The NLS is found in some
transcription factors (such as c-fos and c-jun),
various nuclear proteins (such as p53, CDC16, and Ab1), several steroid
hormone receptors [such as the thyroid ß, glucocorticoid 
, and
androgen receptors (22, 31)], growth factors [such as members of the
fibroblast growth factor family (61)], and human retroviral proteins
[such as the HIV Tat protein (62)].
The NLS is responsible for targeting PTHrP to the nucleus, because
deletion of either of the basic amino acid clusters prevents nuclear
targeting in COS cells (28) and vascular smooth muscle cells (23).
Moreover, expression of the 88–106 region as a fusion protein with the
ß-galactosidase gene in COS cells targets ß-galactosidase (normally
a cytosolic protein) to the nuclear compartment (28). These studies
clearly suggest that PTHrP can be targeted to the nucleus under normal
circumstances, where it has been shown to alter cell function. In our
current study, we show that overexpression of PTHrP in MCF-7 cells
results in a dramatic stimulatory effect on cell proliferation (Fig. 6). Massfelder et al. (23) report a similar effect in
vascular smooth muscle cells, and Henderson et al. (28) have
shown that nucleolar PTHrP is associated with an inhibitory effect on
apoptosis.
The mitogenic effect of PTHrP is linked with nuclear localization in
various systems. Thus, in MCF-7 cells, the overexpressed peptide showed
a perinuclear pattern in approximately 5% of nuclei (Fig. 8). In
contrast, very few nuclei (<1%) stained positive for PTHrP in the
parent cell line. Significantly, perinuclear staining was most often
associated with cells that were either in the process of or had just
completed cell division, indicating an involvement of PTHrP in cell
cycle regulation. Though definitive proof that the growth stimulatory
effects of PTHrP are mediated via nuclear localization of the peptide
would require deletion of the NLS, with consequent elimination of both
nuclear localization of the peptide and increased cell proliferation,
our data clearly suggest that the mitogenic effects of PTHrP are
mediated via the intracrine pathway. Similar effects were reported in
vascular smooth muscle cells (23), where approximately 5% of nuclei
from PTHrP-overexpressing cells clearly stained positive for the
peptide, and nuclear targeting was associated with dividing cells.
Although PTHrP is clearly targeted to the nucleus in a number of
systems, its precise localization seems to vary in different cell
types. Thus, the peptide showed a perinuclear localization in MCF-7
cells (Fig. 8), a reticulated diffuse nuclear pattern in vascular
smooth muscle cells (23), and a nucleolar localization in chondrocytes
and osteoblasts (28), and in a human keratinocyte cell line (29). At
present, it is unknown whether this difference is a reflection of the
different cell types under study, or whether it depends on the
different antisera employed.
The mechanism by which nuclear accumulation of PTHrP activates the cell cycle, thereby increasing proliferation, in MCF-7 and other cell types (23, 28, 29), at present, is unknown. The peptide may interact with key proteins involved in cell cycle regulation and/or with nucleic acids. Though no specific protein interactions have been identified to date, a recent study has shown that the peptide can interact with both homopolymeric and total cellular RNA (63). This interaction is mediated via a core motif localized within the NLS that is shared by other RNA-binding proteins that are targeted to the nucleolus, such as nucleolin (64) and the retroviral Tat (62). Because the nucleolus is the major site for biogenesis of ribosomes, nucleolar PTHrP may influence cellular functions by modulating ribosomal RNA synthesis, either by affecting RNA polymerase I activity or by altering ribosome assembly and/or function. Whether the perinuclear (in MCF-7 cells) or diffuse nuclear [in vascular smooth muscle cells (23)] localization of PTHrP mediates alternative intranuclear modes of action for the peptide, at present, is unknown.
PTHrP has joined the ever-increasing list of peptide hormones and growth factors that elicit their biological responses in a dual manner, through interaction with cell surface receptors linked to signal transduction cascades and through intranuclear localization. Other examples include insulin, epidermal growth factor, platelet-derived growth factor, fibroblast growth factors, angiogenin, and PRL (reviewed in Ref. 65). PTHrP, which contains a signal sequence that directs the nascent peptide to the secretory pathway, must avoid the endoplastic reticulum and remain in the cytoplasmic compartment before its nuclear translocation. Various potential mechanisms have been proposed, which include use of alternative, non-AUG translational start sites, internalization of the ligand-receptor complex by endocytosis, and reverse translocation or dislocation from the endoplasmic reticulum lumen to the cytoplasm (reviewed in Refs. 30, 65). Definitive proof in favor of one or more of these mechanisms has yet to be provided.
In summary, this study shows that PTHrP produces opposing mitogenic and
antimitogenic actions in the breast cancer cell line MCF-7. This cell
line, which produces relatively low levels of the peptide, provides a
good model to study the effects of PTHrP overexpression. When acting
via the autocrine/paracrine pathway, mediated through the cell surface
PTH/PTHrP receptor, PTHrP decreases cell proliferation. Conversely,
when acting through the intracrine pathway, the peptide dramatically
stimulates cell growth. The proliferative effects of overexpressed
PTHrP seem to predominate, in that overexpression of the peptide
results in accelerated cell growth. These results were confirmed using
antisense oligodeoxynucleotide technology. Inhibition of PTHrP
synthesis using an antisense oligodeoxynucleotide, which blocks
translation of the peptide, resulted in a net decrease in MCF-7 cell
proliferation (Fig. 9). We have preliminary data which show that PTHrP
exerts the same pattern of effects in another breast cancer cell line,
MDA-MB-231. We feel that our findings have important implications for
the role of PTHrP in breast cancer. Because PTHrP imparts a growth
advantage to breast cancer cells, controlling production of the peptide
in breast cancer may be therapeutically useful.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received October 4, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  A. Dittmer, M. Vetter, D. Schunke, P. N. Span, F. Sweep, C. Thomssen, and J. Dittmer Parathyroid Hormone-related Protein Regulates Tumor-relevant Genes in Breast Cancer Cells J. Biol. Chem., May 26, 2006; 281(21): 14563 - 14572. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Rabbani, P. Khalili, A. Arakelian, H. Pizzi, G. Chen, and D. Goltzman Regulation of Parathyroid Hormone-Related Peptide by Estradiol: Effect on Tumor Growth and Metastasis in Vitro and in Vivo Endocrinology, July 1, 2005; 146(7): 2885 - 2894. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Linforth, N. Anderson, R. Hoey, T. Nolan, S. Downey, G. Brady, L. Ashcroft, and N. Bundred Coexpression of Parathyroid Hormone Related Protein and Its Receptor in Early Breast Cancer Predicts Poor Patient Survival Clin. Cancer Res., October 1, 2002; 8(10): 3172 - 3177. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Richard, M. D. Lairmore, P. L. Green, G. Feuer, R. S. Erbe, B. Albrecht, C. D'Souza, E. T. Keller, J. Dai, and T. J. Rosol Humoral Hypercalcemia of Malignancy : Severe Combined Immunodeficient/Beige Mouse Model of Adult T-Cell Lymphoma Independent of Human T-Cell Lymphotropic Virus Type-1 Tax Expression Am. J. Pathol., June 1, 2001; 158(6): 2219 - 2228. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
) in the
presence of isobutylmetylxanthine, as describe in Materials and
Methods. Each point is the mean ±
SEM of three independent experiments (three wells per
treatment). The amount of protein was 18.4 ± 0.7 µg/well.
, Transfected with empty
vector alone; 
, sense PTHrP transfectants; 
,
, antisense
PTHrP transfectants. Each point is the mean ±
SEM of three independent experiments (six wells per
experiment). *, Significantly different from control (empty vector
transfectant) at P < 0.001; #, significantly
different from control at P < 0.05.
