Endocrinology Vol. 141, No. 6 1977-1988
Copyright © 2000 by The Endocrine Society
Stat 5B, Activated by Insulin in a Jak-Independent Fashion, Plays a Role in Glucokinase Gene Transcription1
Dominique Sawka-Verhelle2,
Sophie Tartare-Deckert,
Jean-François Decaux,
Jean Girard and
Emmanuel Van Obberghen
Institut National de la Santé et de la Recherche
Médicale U145 (D.S.-V., S.T.-D., E.V.O.), IFR 50, Avenue de
Valombrose, 06107 Nice Cédex 2 France; and Centre National de la
Recherche Scientifique UPR 1524 (J.-F.D., J.G.), 92190 Meudon,
France
Address all correspondence and requests for reprints to: E. Van Obberghen, INSERM U145, Faculté de Médecine, avenue de Valombrose, 06107 Nice Cédex 2, France. E-mail:
vanobbeg{at}unice.fr
 |
Abstract
|
|---|
Stat proteins are SH2 domain-containing transcription factors that are
activated by various cytokines and growth factors. In a previous work,
we have identified Stat 5B as a substrate of the insulin receptor based
on yeast two-hybrid and mammalian cell transfection studies. In the
present study, we have approached the biological relevance of the
interaction between the insulin receptor and the transcription factor
Stat 5B. Firstly, we show that both insulin and insulin-like growth
factor I lead to tyrosine phosphorylation of Stat 5B, and this promotes
binding of the transcription factor to the ß-casein promoter
containing a Stat 5 binding site. Further, we demonstrate that insulin
stimulates the transcriptional activity of Stat 5B. Activation of Stat
5B by insulin appears to be Jak2-independent, whereas Jak2 is required
for GH-induced Stat 5B activation. Hence the pathway by which Stat 5B
is activated by insulin is different from that used by GH. In addition,
by using Jak1- and Tyk2-deficient cells we exclude the involvement of
both Jak1 and Tyk2 in Stat 5B activation by insulin. Taken together,
our results strengthen the notion that insulin receptor can directly
activate Stat 5B. More importantly, we have identified a Stat 5 binding
site in the human hepatic glucokinase promoter, and we show that
insulin leads to a Stat 5B-dependent increase in transcription of a
reporter gene carrying this promoter. These observations favor the idea
that Stat 5B plays a role in mediating the expression of the
glucokinase gene induced by insulin. As a whole, our
results provide evidence for the occurrence of a newly identified
circuit in insulin signaling in which the cell surface receptor is
directly linked to nuclear events through a transcription factor.
Further, we have revealed an insulin target gene whose expression is,
at least in part, dependent on Stat 5B activation and/or binding.
 |
Introduction
|
|---|
POLYPEPTIDE signaling molecules such as
growth factors and cytokines impact on a large series of cellular
processes through interaction with their specific cell surface
receptors. These biological signaling events result in changes in cell
function, growth, and differentiation. Some of these effects are
mediated through altered gene activity in the nucleus. The common
pathway downstream of several cytokine receptors involves the Jak-Stat
(signal transducers and activators of transcription) circuitry, which
eventuates in Stat-induced gene expression.
The Janus kinases (Jak) are cytoplasmic tyrosine kinases phosphorylated
and activated in response to cell stimulation by cytokines. So far four
members have been identified: Jak1, Jak2, Jak3, and Tyk2 (1, 2, 3, 4, 5). These
kinases lead to activation of Stat proteins following their
phosphorylation on tyrosine (6, 7). Stats are SH2 domain-containing
transcription factors found in latent form in the cytoplasm in absence
of cell activation. Upon tyrosine phosphorylation, Stats dimerize and
translocate to the nucleus. Finally, the Stat dimers bind to specific
DNA sequences and induce gene transcription (8). Recently, several
reports have suggested that serine phosphorylation also regulates the
activity of some Stat proteins. Indeed, Wen et al.(9) have
shown that maximal activation of transcription by Stat 1 and Stat 3
requires both tyrosine and serine phosphorylation. Among the six
members of the Stat proteins (8), Stat 5 was originally identified as a
mammary gland factor (MGF) that is regulated by PRL (10). It was shown
that two Stat 5 genes encode Stat 5A and Stat 5B proteins
that are 95% identical in amino acid sequence (11). Stat 5 proteins
are known to be activated by several cytokines. In addition to PRL,
Stat 5 proteins are activated by GH, erythropoietin (EPO),
thrombopoietin (TPO), granulocyte macrophage colony stimulating factor
(GM-CSF), and several interleukines (12, 13, 14, 15, 16, 17). Stat 5 proteins are
essential mediators of PRL and GH action (12, 18, 19). They have also
been implicated in cytokine control of apoptosis, growth, and
differentiation (19, 20, 21, 22). It has been shown that Stat 5 is mostly
activated by Jak2. Indeed, Jak2 and Stat 5 are stimulated in response
to IL2, IL3, GM-CSF, PRL, EPO, TPO, and GH (12, 14, 19, 23).
Activation of Stats has also been reported to occur through receptor
families different from that of the cytokines. Indeed, it has been
shown that several growth factor receptors, including EGF (epidermal
growth factor), HGF (hepatocyte growth factor) and PDGF
(platelet-derived growth factor) receptors, which contain intrinsic
tyrosine kinase activity, activate Stat 1 and Stat 3 in a
Jak-independent fashion (24, 25, 26, 27). In addition, we and others have found
that insulin is able to induce tyrosine phosphorylation of Stat 1, Stat
3, and Stat 5 (28, 29). The insulin receptor is composed of two
extracellular
-subunits containing the ligand binding domain and two
transmembrane ß-subunits, which possess tyrosine kinase activity.
Upon hormone binding, the receptor becomes activated through
autophosphorylation on several tyrosine residues located in the
intracellular part of the ß-subunit (30). Subsequently, the activated
insulin receptors transmit downstream signals via tyrosine
phosphorylation of cellular substrates including IRS-proteins (insulin
receptor substrate-1, -2, -3, -4), Shc (Src homology collagen), and
Gab-1 (Grb-2 associated binder-1) (31, 32). Generally speaking, these
phosphorylated substrates form the link between the receptors and the
signaling circuitry resulting in the final effects of the hormone on
metabolism affecting carbohydrates, lipids and proteins, as well as on
cell growth and differentiation (32). In a previous work, we have
identified Stat 5B as a substrate of the insulin receptor using the
yeast two-hybrid system as a cloning technique with the insulin
receptor as bait. We have found that Stat 5B interacts through its SH2
domain with receptor phosphotyrosine 960 localized in the cytoplasmic
domain of the receptor (29).
Here we found that Stat 5B activated by insulin is indeed able to
interact with Stat 5 binding site, which we identified in the
glucokinase promoter, and induces transcription of a reporter gene
placed downstream of the glucokinase promoter. Moreover, we showed that
Stat 5B activation by insulin occurs in a Jak-independent fashion.
 |
Materials and Methods
|
|---|
Materials
The human IR complementary DNA (cDNA) was obtained from A.
Ullrich (Munich, Germany). Human Stat 5B cDNA was a gift from W.
Leonard (Bethesda, MD). The rat GH-receptor cDNA was a kind gift from
N. Billestrup (Gentofte, Denmark), murine Jak2 cDNA from C. Carter-Su
(Ann Arbor, Michigan) via K. Seedorf (Gentofte, Denmark) and
Jak2 kinase-dead from K. Seedorf. GAS-luciferase reporter gene was
provided by J. Darnell (New York, NY). NIH-IR and NIH-IGF-IR are mouse
NIH-3T3 fibroblasts expressing human insulin receptor (7 x
105 receptors/cell) and IGF-I receptor (6 x
105 receptors/cell), respectively. NIH-IR was a
gift from A. Ullrich and R. Lammers (Munich, Germany). The mutant cell
lines 11.1 (also called U1A) and U4C were provided by S. Pellegrini
(Paris, France) and I. Kerr (London, UK), respectively.
Antibody to the carboxy-terminus of Stat 5B or to the amino-terminus of
Stat 5B were purchased from Santa Cruz Biotechnology, Inc.
(Santa Cruz, CA). Antibody to Stat 5B was from Zymed Laboratories, Inc. (San Francisco, CA) and antibodies to
phosphotyrosine were from Upstate Biotechnology, Inc.
(Lake Placid, NY). The anti-Jak2 antibody is a polyclonal antibody
obtained from Upstate Biotechnology, Inc.. All chemical
reagents were purchased from Sigma (St. Louis, MO) and
enzymes were from New England Biolabs, Inc. (Beverly, MA).
Culture media and oligonucleotides were from Life Technologies, Inc. (Paisley, Scotland, UK). Recombinant human insulin-like
growth factor I (IGF-I) was a gift from Eli Lilly & Co.
(Indianapolis, IN).
Stat 5B mutants
Stat 5B Y699F and Stat 5B H298R/S715F were obtained by
site-directed mutagenesis of double-stranded DNA using the
Transformer kit (CLONTECH Laboratories, Inc. Palo Alto,
CA) and cloned into pSX eukaryotic expression vector. Mutants were
identified by DNA sequencing. The mutant Y699F contains a phenylalanine
that replaces tyrosine at position 699. The mutant H298R/S715F contains
a double mutation, i.e. histidine 298 and serine 715, which
are replaced by arginine and phenylalanine, respectively.
Cell culture and transfection
All cell lines used were grown in DMEM containing 10% (vol/vol)
FCS at 37 C with 5% CO2. 11.1 and U4C cells were
grown in presence of 250 µg/ml hygromycin and 400 µg/ml G418,
respectively.
Transfections in Cos-7 cells were done by the DEAE-Dextran method.
Three micrograms or 1 µg of each indicated plasmids were used for
transfection in 100-mm or 35-mm dishes, respectively. For luciferase
and ß-galactosidase assays, in 35-mm dishes, 0.5 µg of the
luciferase reporter genes and 0.25 µg of ß-galactosidase gene were
added with 1 µg of each expression plasmids. One day after
transfection, cells were starved in DMEM supplemented with 0.2%
(vol/vol) BSA during 16 h and then used for the different
experiments described below.
11.1 and U4C cells were transiently transfected with Superfect Reagent
from QIAGEN (Valencia, CA). Plasmid DNA transfections in
HepG2 cells were carried out using Lipofectamine Reagent (Life Technologies, Inc.). One microgram of luciferase reporter genes
and 0.5 µg of ß-galactosidase gene were transfected in 35-mm
dishes. Two days after transfection, cells were starved in DMEM
supplemented with 0.2% BSA and were stimulated or not with insulin
10-7 M for 6 h.
Immunoprecipitation and immunoblot analysis
HepG2, NIH-IR, and NIH-IGF-IR cells were treated for 5 min with
pervanadate, 20 µM for HepG2 and NIH-IR, and 50
µM for NIH-IGF-IR. During pervanadate incubation, cells
were stimulated or not with insulin (10-7
M) or IGF-I (10-7 M).
Cos-7, 11.1 and U4C cells were directly incubated in absence or
presence of insulin (10-7 M) or GH
(1.2 x 10-10 M).
Cells were then immediately washed twice with buffer A (10
mM HEPES, pH 7.9; 1 mM EDTA; 0.1 mM
EGTA; 10 mM
Na4P2O7;
100 mM NaF and 2 mM sodium orthovanadate) and
resuspended on ice with 400 µl/100 mm dishes or 200 µl/35 mm dishes
of buffer A with 10 mM KCl; 1 mM DTT; and
protease inhibitors (100 U/ml aprotinin, 1 mM
phenylmethylsulfonyl fluoride, 20 µM leupeptin). Cells
were lysed with 30 µl/100 mm dishes or 15 µl/35 mm dishes of 10%
(vol/vol) Triton X-100 and vortexed for 30 sec. The lysates, clarified
by centrifugation for 5 min at 4 C, were incubated for 3 h at 4 C
with antibody to Stat 5B preadsorbed on protein-G-Sepharose. Then
pellets were washed 3 times with buffer (50 mM HEPES; 150
mM NaCl; 10 mM EDTA; 10 mM
Na4P2O7,
100 mM NaF and 2 mM sodium orthovanadate, pH
7.4) containing 0.1% (vol/vol) Triton X-100, resuspended as previously
described (29) and separated by SDS-PAGE. Proteins were transferred to
an Immobilon membrane. First, the membrane was immunoblotted with
antibodies to phosphotyrosine. Proteins were revealed with
chemiluminescence detection system (ECL). Thereafter, membranes were
blotted with antibodies to Stat 5 and proteins were revealed by
alkaline phosphatase substrate (5-bromo-4-chloro-3-indolyl
phosphate/nitro blue tetrazolium (BCIP/NBT).
Preparation of nuclear extract
Cos-7, NIH-IR, NIH-IGF-IR, 11.1 and U4C cells were lysed as
described above. After centrifugation, lysates were removed and pellets
were solubilized in electrophoretic mobility shift assay lysis buffer
(Buffer A, 400 mM NaCl, 1 mM EGTA, 1
mM DTT) and protease inhibitors (100 U/ml aprotinin, 1
mM phenylmethylsulfonyl fluoride, 20 µM
leupeptin). Pellets were vortexed at 4 C for 15 min and then nuclear
extracts were collected by centrifugation for 15 min at 4 C.
Quantification of proteins was performed using a modified Bradford
assay (Bio-Rad Laboratories, Inc., Hercules, CA) and
extracts were frozen in liquid nitrogen and stored at -80 C.
Electrophoretic mobility shift assay (EMSA)
Nuclear extracts (10 to 20 µg) were incubated for 15 min at 4
C with 13 µl of buffer C (8 mM HEPES; pH 7.8, 1
mM DTT, 60 mM KCl, 2 mM EDTA, 4
mM spermidine, 0.1 mg/ml BSA, 10% (vol/vol) glycerol,
0.03% (vol/vol) NP40, 0.5% (vol/vol) Ficoll, 1 µg salmon sperm, 0.8
µg polydIdC). For supershift experiments, 1 µg of antibody to Stat
5 A/B (Santa Cruz, CA) or antibody to Stat 5 B (Zymed Laboratories, Inc., San Francisco, CA) were added to the mixture
for 20 min at room temperature. Probes (3 x
105 cpm) were added and the incubation continued
at 30 C for 30 min. When competition studies were performed, unlabeled
double-strand oligonucleotides were added before the probe. Probes
corresponded to oligonucleotides labeled with T4
polynucleotide kinase in presence of
[
-32P]ATP. Sequences of
ß-casein, GK WT and GK
are AGATTTCTAGGAATTCAAATC;
CCAAAATTCCTGGAAAGCAGG and CTTCCAAAAGAAAGCAGGAAC, respectively.
Polyacrylamide gels (5%) containing 5% (vol/vol) glycerol and
0.25 x Tris borate/EDTA were prerun in 0.25 x Tris
borate/EDTA buffer at 4 C for 90 min at 280 V. After loading of
samples, the gel was run at room temperature for 3 h at 280 V.
Gels were dried and autoradiographed.
Glucokinase promoter constructs
The mouse glucokinase-luciferase plasmid is the pXP2-luciferase
vector (33) in which the fragment (-6011; +19 nucleotides) of the
liver glucokinase promoter from mouse was subcloned (34). Human
glucokinase-luciferase plasmid is the pGL3-basic vector (Promega Corp., Charbonnieres, France) in which the fragment (-1440 to
+168 nucleotides from exon 1) of liver glucokinase promoter of human
origin was subcloned (35). This fragment was obtained by PCR from human
genomic library (CLONTECH Laboratories, Inc.; Palo Alto,
CA) using the following primers (5' to 3'):
GGGGTACCCATCTCTGAGGCCCTCCCCTTCTTGG
CTCCCCCGGGCTCTCCGAGGGGCTAAGAGGTAG
KpnI and SmaI sites were
underlined. The PCR product digested by KpnI and
SmaI was subcloned into pGL3B digested with the same
enzymes. The GK
(-1368; -1363) and GK
(-1404; -1346) are
human glucokinase-luciferase reporter gene described above containing a
deletion of 6 nucleotides (-1368 to -1363) and a deletion of 59
nucleotides (-1404; -1346), respectively. These mutants were
generated by the QuickChange site directed mutagenesis kit
(Stratagene, La Jolla, CA).
Luciferase and ß-galactosidase assays
Cos-7 cells were transfected with the insulin receptor,
wild-type or mutated Stat 5B, ß-galactosidase gene under the control
of the CMV promoter and the luciferase reporter gene. HepG2 cells were
transfected with human glucokinase-luciferase plasmid and
ß-galactosidase gene under the control of the SV40 promoter.
Twenty-four hours after transfection, Cos-7 and HepG2 cells were
incubated in DMEM supplemented with 0.2% (vol/vol) BSA and treated or
not with insulin (10-7 M) for
16 h and 6 h, respectively. Cells were washed twice with PBS
and lysed with reporter lysis buffer (Promega Corp.,
Madison, WI). Supernatants were used for luciferase and
ß-galactosidase assays. Luciferase activity of each sample was
determined by measuring luminescence of 20 µl of lysates after
injection of 200 µl of luciferase assay reagent (Promega Corp.). To measure ß-galactosidase activity, 10 µl of Cos-7
cells lysates were incubated with buffer containing 1.33 mg/ml
o-nitrophenyl-ß-D-galactopyranoside (ONPG), 100
mM ß-mercapto-ethanol, 2 mM
MgCl2, 200 mM
Na2HPO4; pH 7.3. HepG2 cell
lysates were incubated with 200 µl of luminescent ß-galactosidase
detection kit (CLONTECH Laboratories, Inc.; Palo Alto,
CA). To correct for differences in transfection efficiencies,
luciferase activities were normalized to the ß-galactosidase
activities.
 |
Results
|
|---|
Stat 5B is tyrosine phosphorylated in the insulin-treated HepG2
hepatoma cell line
We have shown earlier that Stat 5B is phosphorylated on tyrosine
in response to insulin in 293 cells overexpressing insulin receptors
(29). As Stat 5B is expressed in insulin-sensitive tissues such as the
liver, we wanted to know whether endogenous Stat 5B is phosphorylated
in HepG2 cells exposed to the hormone. To do this, after insulin
treatment, HepG2 cells were lysed and cytoplasmic extracts were
precipitated with antibody to Stat 5B. Western blotting was then
performed with antibody to phosphotyrosine. Phosphorylation of
endogenous Stat 5B in HepG2 cells was detectable within 1 min of
insulin stimulation but continued to increase within the time-frame
studied (Fig. 1A
). Stat 5B
phosphorylation was found to be insulin dose dependent with a maximal
effect seen at 10-6 M (Fig. 1B
).
Stripping of the membrane followed by blotting with antibody to Stat 5B
shows that the amount of immunoprecipitated Stat 5B tested is
comparable (data not shown).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 1. Insulin induces tyrosine phosphorylation of Stat
5B in HepG2 cells. HepG2 cells, treated with 20 µM
pervanadate for 5 min were stimulated for the indicated times (A) with
insulin (10-7 M) or for 5 min at different
insulin concentrations (B). Cells were solubilized and cytoplasmic
extracts were subjected to precipitation with antibody to Stat 5B.
After washes, the proteins were separated by SDS-PAGE, transferred to
membrane, and blotted with antibody to phosphotyrosine. Western blot
was revealed using ECL. Molecular weight markers are indicated as well
as the band corresponding to Stat 5B.
|
|
Stat 5B is activated by insulin and IGF-I
Because insulin receptors and IGF-I receptors are structurally
related and most insulin receptor targets are also targets of the IGF-I
receptor (30, 31, 32), we looked whether Stat 5B is activated in response
to IGF-I. We used NIH 3T3 cells, which express about the same number of
insulin receptors (NIH-IR cells) or IGF-I receptors (NIH-IGF-IR cells)
(36). First, we looked at Stat 5B phosphorylation in response to
insulin and IGF-I in NIH-IR and NIH-IGF-IR, respectively. We performed
on cytoplasmic extracts of treated or nontreated cells an
immunoprecipitation with antibody to Stat 5B followed by blotting with
antibody to phosphotyrosine (Fig 2
). We
found that endogenous Stat 5B is phosphorylated in response to insulin
(Fig. 2A
) and IGF-I (Fig. 2B
). Next, we verified that phosphorylation
of Stat 5B in response to both polypeptides leads to its activation.
Using an electrophoretic mobility shift assay (EMSA) with the Stat 5
binding site found in the ß-casein promoter as a probe, we searched
for formation of Stat 5-DNA complexes with nuclear extracts from
insulin-treated or IGF-I-treated cells. Two protein-DNA complexes were
obtained with nuclear extracts from NIH-IR and NIH-IGF-IR. Stat 5-DNA
binding activity was increased when cells were stimulated by insulin
for NIH-IR (Fig. 2C
, lane 2) and IGF-I in NIH-IGF-IR (Fig. 2D
, lane 7).
Both complexes (I and II) appeared to be specific because they
disappeared in presence of a large amount of unlabeled probe (lanes 3
and 8). The presence of Stat 5 in the upper protein-DNA complexes (I)
was confirmed by supershift with antibodies to Stat 5A and B (lanes 4
and 9) or to Stat 5B only (lanes 5 and 10). These results indicate that
complex I, induced by insulin or IGF-I in both cell lines, consists of
a homodimer of Stat 5B or a heterodimer containing Stat 5B because
antibody to Stat 5B generated a complete supershift of this complex.
The lower complex, which is also insulin- and IGF-I-dependent (complex
II), could correspond to another transcription factor which can bind to
the probe.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 2. Insulin and IGF-I activate Stat 5 in NIH 3T3 cells
overexpressing insulin and IGF-I receptors, respectively. NIH 3T3 cell
lines expressing insulin receptor (NIH-IR) or IGF-I receptor
(NIH-IGF-IR) were incubated for 5 min with 20 µM and 50
µM pervanadate, respectively. Cells, stimulated with
insulin (10-7 M) or IGF-I (10-7
M), were solubilized, and cytoplasmic extracts were
subjected to immunoprecipitation with antibody to Stat 5B. Proteins
were separated by SDS-PAGE, transferred to membrane and blotted with
antibody to phosphotyrosine (A, B). Nuclear extracts, from cells
treated for 5 min with 15 µM pervanadate and stimulated
with insulin (10-7 M) or IGF-I
(10-7 M), were preincubated in the absence
(-) or presence (+) of antibody recognizing only Stat 5B (B) or
antibody recognizing both Stat 5A and Stat 5B (A/B). Then,
32P-labeled oligonucleotide corresponding to Stat 5
binding site from ß-casein promoter was added. The probe was
incubated alone or together with a 100-fold molar excess of unlabeled
homologous oligonucleotide. The position of specific DNA-protein
complexes I and II are indicated by arrows and the
supershifted complexes are shown by arrowheads (C, D).
|
|
Stat 5B activated by insulin induces transcription of a reporter
gene
Next we investigated whether Stat 5B activated by insulin is able
to induce the transcription of a reporter gene. Expression vectors
encoding insulin receptor, wild-type (WT) Stat 5B or mutants and a
luciferase cDNA gene under the control of the GAS site (IFN
-activated site) were transiently transfected in Cos-7 cells (Fig. 3A
). Upon insulin stimulation, WT Stat 5B
induced a 1.8-fold increase in the reporter gene activity
(P = 0.025). As expected, a mutant of Stat 5B, Y699F,
which has lost its tyrosine phosphorylation site, was completely
inactive. In contrast, the Stat 5B mutant H298R/S715F, which has
previously been reported to be constitutively active (37), induced
luciferase activity in absence of insulin stimulation. Next we studied
tyrosine phosphorylation and DNA binding activity of the Stat 5B
constructs in response to insulin in Cos-7 cells. Compared with WT,
Stat 5 Y699F, which is expressed at the same level as WT (data not
shown), was not tyrosine phosphorylated under insulin stimulation and
did not bind to a cDNA probe containing a Stat 5 site (Fig. 3B
). Stat 5
H298R/S715F, which constitutively induces luciferase activity, was
tyrosine phosphorylated and had DNA binding activity in absence of
insulin treatment (Fig. 3C
). Despite no significant insulin-induced
change in the transactivation activity of this mutant was observed,
insulin increases slightly its tyrosine phosphorylation and DNA binding
properties. To summarize, insulin-activated Stat 5B appears to be only
phosphorylated on tyrosine 699, and is able to induce reporter gene
transcription.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 3. Stat 5B activated by insulin induces
transcription of a luciferase reporter gene. A, Cos-7 cells were
transfected with insulin receptor, wild-type (WT) or mutants of Stat 5B
(Y699F, H298R/ S715F), a ß-galactosidase gene under the control
of the CMV promoter and GAS-luc plasmid. Cells were treated or not with
insulin (10-7 M) for 16 h. Results
expressed as luciferase activity and normalized to ß-galactosidase
activity are the mean ± SEM of triplicates and are
representative of three independent experiments (P
0.025). B and C, Cos-7 cells expressing insulin receptor and Stat 5B
wild-type or Y699F (B) or H298R/S715F (C) were incubated or not with
insulin (10-7 M) for 5 min. Cells were
solubilized, and the cytoplasmic extracts were subjected to
precipitation with antibody to Stat 5B, proteins were separated by
SDS-PAGE, transferred to membrane and blotted with antibody to
phosphotyrosine. Proteins were visualized by ECL. Nuclear extracts were
incubated with 32P-labeled oligonucleotide corresponding to
Stat 5 binding site from ß-casein promoter. Gels were dried and
subjected to autoradiography. The position of specific DNA-protein
complexes is indicated by arrows. The mutant Y699F has the
tyrosine 699 replaced by phenylalanine. The mutant H298R/S715F has both
histidine and serine replaced by arginine and phenylalanine,
respectively.
|
|
Insulin activates Stat 5B in a Jak-independent fashion
Jak2 has been found to play an important role in activation of
Stat 5 in response to several cytokines and growth factors (12, 14, 38, 39). To evaluate the role of Jak2 in insulin-induced Stat 5B
activation, we looked at phosphorylation of Stat 5B, in response to
insulin, in presence of catalytically inactive Jak2 (Jak2 K/A). Cos-7
cells expressing Stat 5B, insulin receptor and Jak2 K/A were stimulated
or not with insulin. Precipitation of Stat 5B followed by immunoblot
with antibodies to phosphotyrosine was performed. Tyrosine
phosphorylation of Stat 5B is unchanged in presence of Jak2 (K/A) (Fig. 4A
). In contrast, in Cos-7 cells
expressing Stat 5B and GH receptor, GH-induced phosphorylation of Stat
5B was decreased in presence of Jak2 K/A (Fig. 4B
). Indeed, with 0.5
µg of plasmid expressing Jak2 K/A, Stat 5B tyrosine phosphorylation
was decreased by 90% and was totally abolished with 1 µg of vector.
This result indicates that Jak2 K/A plays a dominant negative role in
Stat 5B phosphorylation induced by GH in Cos-7 cells by interfering
with endogenous Jak2. We verified that Jak2 K/A was expressed at the
same level in the different conditions (data not shown). Taken
together, our results suggest that, in Cos-7 cells, insulin receptor
phosphorylates Stat 5B through a mechanism independent of Jak2, while
Jak2 is involved in the effect of GH on Stat 5B. To confirm that Jak2
is not implicated in activation of Stat 5B by insulin, EMSAs were
conducted with nuclear extracts from cells treated or not with insulin
or GH. Cells were transfected or not with Jak2 (K/A), insulin receptor
or GH receptor and Stat 5B plasmids (Fig. 5
). We found that Jak2 K/A did not change
the ability of Stat 5B, activated by insulin, to bind to a cDNA probe
(Fig. 5A
). Indeed, a supershifted complex was observed with nuclear
extracts from insulin-stimulated cells, in presence and in absence of
Jak2 K/A. As anticipated from our observations made with Stat 5B
phosphorylation, in cells expressing Jak2 K/A and stimulated by GH,
Stat 5B was not able to bind to the cDNA probe (Fig. 5B
).

View larger version (33K):
[in this window]
[in a new window]
|
Figure 4. Jak2 is not involved in insulin-induced Stat 5B
phosphorylation. Cos-7 cells were transfected with Stat 5B, insulin
receptor (A) or GH receptor (B) and different amounts of Jak2
kinase-dead (Jak2 K/A). Cells, stimulated or not with insulin
(10-7 M) or GH (1.2 x 10-10
M), respectively, for 15 min, were treated as described in
Fig. 1 legend. Immunoblot with antibody to phosphotyrosine was revealed
by ECL. The following immunoblot with antibody to N-terminal region of
Stat 5 was revealed by alkaline phosphatase substrate (BCIP/NBT). Jak2
K/A has the lysine 882 replaced by alanine.
|
|

View larger version (50K):
[in this window]
[in a new window]
|
Figure 5. Jak2 is not involved in insulin-induced binding of
Stat 5B to the ß-casein probe. Cos-7 cells were transfected with Stat
5B, insulin receptor (A) or GH receptor (B) and Jak2 kinase-dead (Jak2
K/A). Cells stimulated or not for 15 min with insulin
(10-7 M) or GH (1.2 x 10-10
M), respectively, were solubilized. Nuclear extracts were
prepared and were incubated in absence (-) or presence (+) of antibody
recognizing specifically Stat 5B. Thereafter, 32P-labeled
oligonucleotide corresponding to Stat 5 binding site from ß-casein
promoter was added. The position of specific DNA-protein complexes is
indicated by arrows, and the supershifted complexes are
shown by arrowheads.
|
|
It has been described that Stat 5 is also activated by Jak kinases
other than Jak2. Indeed, after exposure of cells to several
interleukines such as IL2, IL4, IL9, and IL10, Jak1, Jak3, and Tyk2
lead to activation of Stat 5. To look whether these Jak kinases are
involved in insulin-induced Stat 5B activation, we used two cell lines
11.1 (also called UA1) and U4C, which are defective in Tyk2 and Jak1,
respectively (40, 41, 42). Cells were transiently transfected with
expression vectors encoding insulin receptor, Stat 5B or both. Then, we
analyzed Stat 5B tyrosine phosphorylation and activation in these cells
in response to insulin. In U4C cells, insulin induced activation of
Stat 5B because we observed a protein-DNA complex when nuclear extracts
from treated cells were incubated with the ß-casein probe (Fig. 6A
). This complex was only observed with
nuclear extracts from cells expressing both Stat 5B and insulin
receptor, and its occurrence was increased after insulin stimulation.
It appears to contain Stat 5B because a supershift was observed with an
antibody to Stat 5B. As expected, we found that Stat 5B was tyrosine
phosphorylated in cells expressing the insulin receptor and that
addition of insulin increased the tyrosine phosphorylation of Stat 5B
(data not shown). Because insulin induced Stat 5B activation in cells
lacking Jak1, we conclude that Jak1 is not involved in the
insulin-induced Stat 5B activation. Similar results were obtained with
11.1 cells, which do not express Tyk2. A major protein-DNA complex was
observed with nuclear extracts from stimulated cells expressing insulin
receptor and Stat 5B (Fig. 6B
). A minor complex was also observed, but
it did not increase after coexpression of Stat 5B and insulin receptor.
As for Stat 5B activation, we observed that insulin induced tyrosine
phosphorylation only in cells expressing insulin receptor and Stat 5B
(data not shown). These results indicate that Tyk2 is not involved in
the activation of Stat 5B by insulin. To conclude, Jak1, Jak2, and Tyk2
do not appear to be required for Stat 5B phosphorylation and activation
in response to insulin.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 6. Jak1 and Tyk2 are not involved in insulin-induced
Stat 5B activation. Jak1-deficient cells (U4C) (A) or Tyk2-deficient
cells (11.1) (B) were transiently transfected with plasmids encoding
Stat 5B and/or insulin receptor. Cells were stimulated or not with
insulin 10-7 M for 15 min and then
solubilized. Nuclear extracts were incubated with
32P-labeled oligonucleotide corresponding to the Stat 5
binding site from ß-casein promoter. The position of specific
DNA-protein complexes is indicated by arrowheads.
|
|
Stat 5B activated by insulin induces murine hepatic glucokinase
transcription
Because Stat 5B is phosphorylated in hepatoma cells treated with
insulin (Fig. 1
), we approached the potential role of Stat 5B in
insulin action on liver-specific gene expression. Glucokinase,
expressed in liver and pancreatic ß cells, is one of the major
regulatory enzymes of carbohydrate metabolism (43). Previous reports
have shown that transcription of glucokinase in liver is insulin
dependent (44, 45). To examine whether Stat 5B is implicated in
transcription of glucokinase in response to insulin, a fragment of the
liver glucokinase promoter from mouse (-6011 to +19 nucleotides) was
inserted in a reporter plasmid upstream of the luciferase gene. This
construct was expressed in Cos-7 cells together with insulin receptor,
Stat 5B WT or negative form of Stat 5B. Cells were incubated without or
with 10-7 M insulin for 16 h
and luciferase activities were measured (Fig. 7
). In cells transfected with Stat 5B WT,
a 2-fold induction of the reporter gene activity after insulin
stimulation was observed, whereas no increase in luciferase activities
was detected when cells did not express Stat 5B or expressed Stat 5B
Y699F. The increase in luciferase activity observed in stimulated cells
was statistically significant (P = 0.0005). These data
suggest that Stat 5B plays a role in transcription of liver
glucokinase gene from mouse in response to insulin.
Stat 5B binds to a consensus binding site in the human glucokinase
promoter
Next we searched for a Stat 5 binding site in the human hepatic
glucokinase promoter. We identified a TTC CTG GAA sequence located in
the promoter region at 1368 nucleotides from exon 1 (35). Nuclear
extracts from stimulated or unstimulated Cos-7 cells expressing Stat 5B
and insulin receptor were tested for their ability to bind to this
putative Stat 5 site (Fig. 8A
). Stat 5B
bound to glucokinase probe as well as to ß-casein probe. Complex
formation was increased in insulin-stimulated cells and was
supershifted by antibody to Stat 5B. Its formation was prevented when
nuclear extracts were preincubated with a 100-fold molar excess of
unlabeled probe. To verify that the interaction between nuclear
extracts and glucokinase probe is due to the Stat 5 binding site, we
deleted this probe of 6 nucleotides important for Stat 5 binding
(GK
). As expected this deletion prevented complex formation (Fig. 8B
). Likewise, similar results were obtained when the glucokinase probe
contained the two nucleotides GG of Stat 5 site mutated to TT (data not
shown). Taken as a whole, our results indicate that Stat 5B activated
by insulin binds to a human glucokinase site located between
nucleotides -1368 to -1360.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 8. Stat 5B activated by insulin binds to the Stat
consensus binding site in the human glucokinase promoter. A, Starved
Cos-7 cells were stimulated or not with insulin 10-7
M for 15 min. Nuclear extracts were incubated with
32P-labeled glucokinase probe or with
32P-labeled ß-casein probe. As indicated, nuclear
extracts were preincubated with 100-fold molar excess of unlabeled
probes or with antibody to Stat 5. The same nuclear extracts were
incubated with 32P-labeled glucokinase (wt) probe or with
32P-labeled glucokinase (-1368, -1363) probe
containing a deletion of 6 nucleotides of the Stat 5 binding site (B).
|
|
Stat 5B activated by insulin induces human glucokinase gene
transcription
Finally, we examined whether Stat 5B is involved in human
glucokinase transcription in response to insulin. To do this we
inserted a fragment of the human liver glucokinase promoter (-1440 to
+168 nucleotides) into a reporter plasmid upstream of the
luciferase gene (pGL3-GK WT) (Fig. 9A
). This construct was expressed in
HepG2 cells. Starved cells were incubated without or with
10-7 M insulin for 6
h and luciferase activities were measured (Fig. 9B
). Addition of
insulin induced a significant 1.5-fold increase in reporter gene
activity driven by glucokinase promoter construct (P =
0.005). To evaluate the role of Stat 5B in this effect, we deleted the
Stat 5 binding site at -1368 to -1360, and we transfected this
construct into HepG2 cells. Compared with the GK WT construct, the GK
(-1368; -1363) construct showed a lower transcriptional activity
(Fig. 9C
). However, luciferase activity obtained was higher than the
one observed with the empty vector. To explain the residual activity
observed with GK
(-1368; -1363), we hypothesized that the
promoter might contain other Stat binding sites. Around the bona
fide Stat 5 binding site (-1368; -1360) several regions look
like potential Stat 5 binding sites. To investigate whether these sites
were responsible for the residual activity, we deleted the glucokinase
promoter construct of a fragment of 59 nucleotides containing the true
Stat 5-binding site and several candidate Stat 5 binding sites. This
construct (GK
(-1404; -1346) transfected in HepG2 cells induced a
luciferase activity similar to GK
(-1368; -1363) (Fig. 9C
),
suggesting that this region is not involved in the insulin effect seen
with GK
(-1368; -1363).
 |
Discussion
|
|---|
While the Stat transcription factors are known to regulate gene
expression regulated by cytokines and certain hormones, such as PRL and
GH, their involvement in signaling by tyrosine kinase receptors is
ill-defined. A first indication that the Jak/Stat pathway might be
involved in tyrosine kinase receptor signaling came from the
observation that hormones such as insulin and IGF-I stimulate Jak
phosphorylation and activation (46, 47, 48). More recently, we found that
Stat 5B interacts through its SH2 domain with the phosphorylated
tyrosine 960 of the insulin receptor (29). We became further intrigued
by the potential role of Stat in transcription of a major gene
regulated by insulin, which is hepatic glucokinase. We show in the
present work that insulin and IGF-I lead to tyrosine phosphorylation of
Stat 5B, which then acquires the ability to go to the nucleus and
activate gene transcription. Further, we provide evidence for a
potential role of Stat 5B in the transcriptional effects of insulin. We
have shown that Stat 5B, activated by insulin, enhances the
transcription of a reporter gene placed under the control of the
hepatic glucokinase promoter.
Glucokinase gene expression is cell type-specific and involves two
alternative promoters that are differentially regulated (49, 50).
Expression of the pancreatic islet glucokinase isoform, which is
determined by the upstream promoter, is an important determinant of the
insulin secretory response to glucose (51). The upstream promoter is
also expressed in several other neural/neuroendocrine cell types in the
brain and intestine. However, the possible functional significance of
glucokinase in these locations remains to be determined (52). The
downstream glucokinase promoter controls expression of the hepatic
isoform, which is thought to be a rate-determining step for hepatic
glucose utilization (51). The hepatic glucokinase gene is
known to be strictly dependent for its transcription on the presence of
insulin, and inversely to be totally repressed under the action of
glucagon via the cAMP pathway (53, 54). In contrast,
glucokinase gene transcription in pancreatic islets appears
to be largely constitutive, although glucose acts at a
posttranscriptional level to regulate islet glucokinase activity (55).
The occurrence of both promoters is compatible with the fact that
glucokinase is differently regulated in liver and in pancreatic
ß-cells. Due to the large size of the liver promoter (34), which
leads to experimental difficulties, little is known about insulin and
glucagon action on regulation of hepatic glucokinase gene
transcription.
In our present report, we found that Stat 5B could function as one of
the factors involved in hepatic glucokinase gene
transcription induced by insulin. By reporter gene studies, we showed
that Stat 5B plays a role in mediating the transcriptional activation
of the mouse and human glucokinase promoter in response to insulin.
Further, we identified a Stat 5 binding site at -1368 to -1360 of the
human liver glucokinase promoter. Importantly, insulin leads to Stat 5B
interaction within this site in EMSAs and induces transcription of a
reporter gene placed downstream of a glucokinase promoter fragment
containing the Stat 5B binding site. This effect seems to be specific
because deletion of a Stat 5B-binding site leads to a decrease in
transcriptional activity. Interestingly, it is important to point out
that a potential Stat5 binding site at -3139 to -3131 is also present
in the region of the mouse glucokinase promoter construct.
Human glucokinase promoter constructs lacking the Stat 5 site (-1368
to -1360) still maintained a transcriptional activity in response to
insulin. This suggests that insulin might activate some transcription
factors other than Stat 5, involved in glucokinase gene transcription.
Alternatively, insulin could induce the expression of transcription
factor(s) regulating in turn the activity of the glucokinase promoter.
ADD1/SREBP-1c could be such a factor. Indeed, after completion of our
current study reports have appeared indicating that ADD1/SREBP-1c might
be a key factor regulating insulin-induced glucokinase gene expression.
To be specific, insulin stimulates ADD1/SREBP-1c expression in intact
liver and hepatocytes (56, 57), and a dominant negative form of this
factor inhibits the action of insulin on glucokinase expression in
cultured hepatocytes (58). Further, computer-assisted examination of
our promoter region revealed 3 potential SREBP binding sites, a
SRE-type element at -91 to -81, and two E-box motifs at -810 to
-800 and -597 to -587, respectively. According to this, binding of
ADD1/SREBP-1c to one of these elements might participate in the
transcriptional activation seen in response to insulin. To the best of
our knowledge, the binding sites for SREBP family in the promoter have
not been mapped and the mechanism by which insulin stimulates
transcriptional activity of ADD1/SREBP-1c is still unknown.
In HepG2 cells we observed only a 1.5-fold stimulation of the reporter
gene activity under insulin action. This "moderate" effect could be
explained by the fact that only part of the promoter containing
nucleotides -1440 to +168 and not the full-length promoter is
subcloned in the reporter plasmid. Despite the fact that ADD1/SREBP-1c
is expressed in these cells (59) and that the promoter region bears at
least three binding sites for this factor, it is quite possible that
other enhancers or regulatory sequences are missing. This observation
could explain the lack of full-blown insulin effect on glucokinase
transcription in HepG2 cells. It is also possible that the effect of
insulin on glucokinase expression involves specific factors that are
absent in HepG2 cells. Finally, genuine hormonal regulation of
glucokinase gene transcription might require that the
promoter is embedded in its "natural" chromatin environment.
Considering our results as a whole, we would like to suggest that Stat
5B, in addition to ADD1/SREBP-1c, could play a role in transcription of
the hepatic glucokinase gene. Whether they act
synergistically or additively is not known at the present time.
Stat 5 binding sites are conserved in the promoter sequences of the
milk protein genes in different species such as ß-casein (10),
ß-lactoglobulin (60), and WAP (whey acidic protein) (61). These sites
occur also in promoters of interferon response factor-1 (IRE-1),
Fc
RI, ICAM, Fc
RIIb,
2-macroglobulin genes (62). In addition,
more recently, Stat 5 was found to play a role in gene transcription of
ALS (acid-labile subunit), which is important for transport of
circulating IGFs (insulin-like growth factors) (63) and transcription
of antiapoptotic factor Bcl-X (19). These results suggest that the
regulatory role of Stat 5 is not restricted to milk protein genes in
mammary glands. Compatible with this view is our finding that Stat 5B
could play a role in hepatic glucokinase gene transcription.
Moreover, Stat 5B could be involved in transcription of other
insulin-induced genes, since Stat 5B binding sequences are found in the
genes corresponding to rat C/EBP ß and
1-acid glycoprotein
(64).
Interestingly, we found that Jak2 is not implicated in activation of
Stat 5B by insulin. Indeed, when a Jak2 mutant containing an inactive
kinase is expressed together with the insulin receptor and Stat 5B,
tyrosine phosphorylation of Stat 5B remained unchanged. Moreover, in
presence of this Jak2 mutant, Stat 5B phosphorylated by insulin
retained its ability to bind to a cDNA probe. Taken together these
results are not in favor of a role of Jak2 in activation of Stat 5B by
insulin. In contrast, Jak2 has been implicated in activation of Stat 5
in response to several polypeptides including GH and PRL (12, 14). In
other words, insulin appears to activate Stat 5B using a pathway that
is different from that stimulated by GH and PRL. Four members of Jak
have been identified i.e. Jak1, Jak2, Jak3, and Tyk2 (1, 2, 3, 4, 5).
While Jak1 and Tyk2 are widely expressed, Jak3 is found only in
lymphoid and myeloid cells (5). Based on these findings, we could not
exclude that Jak1 and Tyk2 or other kinases, expressed in Cos-7 cells,
could be involved in activation of Stat 5B by insulin. We analyzed Stat
5B activation in response to insulin in Jak1- and Tyk2-deficient cell
lines. In both cell lines, insulin is able to activate Stat 5B,
indicating that similar to Jak2, Jak1 and Tyk2 are not involved in
insulin-induced Stat 5B activation. This could be expected since Jak1,
participating in IL-2 signaling, is expressed in Cos-7 cells at a level
that does not lead to detectable induction of Stat 5 phosphorylation in
response to IL-2 (65). Further, Tyk2 has been involved so far only in
signaling by heteroreceptors. Indeed, Stat activation occurs through
both Tyk2 and Jak1 in IL-10 and IFN signaling pathways (66) and Tyk2
and Jak2 in signaling by IL-12 (67). In these situations, activation of
Stat depends on the presence and activation of both Jak kinases, which
bind each chain forming the heteroreceptor. In a previous report, we
have shown that Stat 5B interacts directly with the insulin receptor
and that this association is dependent on the receptor tyrosine kinase
activity (29). Taking these considerations together, we would like to
propose that Stat 5B is directly activated by insulin receptors. A
similar process might occur for EGF, PDGF, and HGF receptors. Indeed,
it was found that Stat 1 and Stat 3 associate with and are directly
phosphorylated by HGF and EGF receptors, respectively (24, 25).
Likewise, it has been shown that activation of Stat 1 and Stat 3 by
PDGF receptor is not dependent on Jak kinases (27).
While the precise role of Stat 5 in the control of
glucokinase gene expression remains to be determined, our
present work points to the existence of a new paradigm in insulin
action on nuclear events. To be specific, the direct phosphorylation
and activation of the transcription factor Stat 5 by the cell surface
insulin receptor strongly indicates the occurrence of a direct cell
membrane to nucleus circuit. Whether such a pathway is unique to the
regulation of the glucokinase gene or whether it is involved in other
nuclear effects of the hormone is not known.
 |
Acknowledgments
|
|---|
We thank W. Leonard for Stat 5B cDNA, J. Darnell for luciferase
reporter gene construct, C. Postic and M. Magnusson (Nashville, TN) for
providing the mouse glucokinase construct. We also thank S. Pellegrini
(Paris, France) and I. Kerr (London, UK) for providing mutant cell
lines 11.1 and U4C cells, N. Billestrup, C. Carter-Su and K. Seedorf
for GH-receptor and Jak2 cDNAs. We thank V. Baron for advice, P.
Peraldi for critical reading of the manuscript, and Eli Lilly & Co. for recombinant human IGF-I.
 |
Footnotes
|
|---|
1 The work performed in INSERM U145 was supported in part by Institut
National de la Santé et de la Recherche Médicale,
Association pour la Recherche sur le Cancer, La Ligue Nationale Contre
le Cancer, Université de Nice Sophia-Antipolis, Groupe
LIPHA-Merck & Co., Inc. (Lyon, France) and contract
QLRT-199900674 from the EU. 
2 Recipient of fellowships from the Ligue Nationale Contre le Cancer
and Naturalia et Biologia (France). 
Received November 2, 1999.
 |
References
|
|---|
-
Firmbach-Kraft I, Byers M, Shows T, Dalla-Favera R,
Krolewski JJ 1990 Tyk 2 prototype of a novel class of non-receptor
tyrosine kinase genes. Oncogene 5:13291336[Medline]
-
Harpur AJ, Andres AC, Ziemiecki A, Aston RR, Wilks
AF 1992 Jak2, a third member of the jak family of the protein
tyrosine kinase. Oncogene 7:13471353[Medline]
-
Silvennoinen O, Witthuhn BA, Quelle FW, Cleveland JL,
Yi T, Ihle JN 1993 Structure of the murine Jak2 protein-tyrosine
kinase and its role in interleukin 3 signal transduction. Proc Natl
Acad Sci USA 90:84298433[Abstract/Free Full Text]
-
Wilks AF, Harpur AG, Kurban RR, Ralph SJ, Zurcher G,
Ziemiecki A 1991 Two novel protein-tyrosine kinases, each with a
second phosphotransferase-related catalytic domain, define a new class
of protein kinase. Mol Cell Biol 11:20572065[Abstract/Free Full Text]
-
Witthuhn BA, Silvennoinen O, Miure O, Lai KS, Cwik C,
Liu ET, Ihle JN 1994 Involvement of the Jak-3 Janus kinase in
signaling by interleukins 2 and 4 in lymphoid and myeloid cells. Nature 370:153157[CrossRef][Medline]
-
Finidori J, Kelly PA 1995 Cytokine receptor
signalling through two novel families of transducer molecules: Janus
kinases, and signal transducers and activators of transcription. J
Endocrinol 147:1123[Abstract/Free Full Text]
-
Stahl N, Farruggella TJ, Boulton TG, Zhong Z, Darnell
JJ, Yancopoulos GD 1995 Choice of STATs and other substrates
specified by modular tyrosine-based motifs in cytokine receptors.
Science 267:13491353[Abstract/Free Full Text]
-
Ihle JN 1996 STATs: signal transducers and
activators of transcription. Cell 84:331334[CrossRef][Medline]
-
Wen Z, Zhong Z, Darnell JJ 1995 Maximal activation
of transcription by Stat1 and Stat3 requires both tyrosine and serine
phosphorylation. Cell 82:24150[CrossRef][Medline]
-
Wakao H, Gouilleux F, Groner B 1994 Mammary gland
factor (MGF) is a novel member of the cytokine regulated transcription
factor gene family and confers the prolactin response. EMBO J 13:21822191[Medline]
-
Liu X, Robinson GW, Gouilleux F, Groner B, Hennighausen
L 1995 Cloning and expression of Stat 5 and an additional
homologue (Stat 5B) involved in prolactin signal transduction in mouse
mammary tissue. Proc Natl Acad Sci USA 92:88318835[Abstract/Free Full Text]
-
Gouilleux F, Pallard C, Dusanter FI, Wakao H, Haldosen
LA, Norstedt G, Levy D, Groner B 1995 Prolactin, growth hormone,
erythropoietin and granulocyte-macrophage colony stimulating factor
induce MGF-Stat5 DNA binding activity. EMBO J 14:200513[Medline]
-
Mui AL-F, Wakao H, OFarrell A-M, Harada N, Miyajima
A 1995 Interleukin-3, granulocyte-macrophage colony stimulating
factor and interleukin-5 transduce signals through two STAT5 homologs.
EMBO J 14:11661175[Medline]
-
Pallard C, Gouilleux F, Benit L, Cocault L, Souyri M,
Levy D, Groner B, Gisselbrecht S, Dusanter FI 1995 Thrombopoietin
activates a STAT5-like factor in hematopoietic cells. EMBO J 14:28472856[Medline]
-
Quelle FW, Wang D, Nosaka T, Thierfelder WE, Stravopodis
D, Weinstein Y, Ihle JN 1996 Erythropoietin induces activation of
Stat5 through association with specific tyrosines on the receptor that
are not required for a mitogenic response. Mol Cell Biol 16:16221631[Abstract]
-
Sotiropoulos A, Moutoussamy S, Renaudie F, Clauss M,
Kayser C, Gouilleux F, Kelly PA, Finidori J 1996 Differential
activation of Stat3 and Stat5 by distinct regions of the growth hormone
receptor. Mol Endocrinol 10:9981009[Abstract/Free Full Text]
-
Wakao H, Harada N, Kitamura T, Mui AL, Miyajima A 1995 Interleukin 2 and erythropoietin activate STAT5/MGF via distinct
pathways. EMBO J 14:25272535[Medline]
-
Udy GB, Towers RP, Snell RG, Wilkins RJ, Park SH, Ram
PA, Waxman DJ, Davey HW 1997 Requirement of STAT5b for sexual
dimorphism of body growth rates and liver gene expression. Proc Natl
Acad Sci USA 94:72397244[Abstract/Free Full Text]
-
Socolovsky M, Fallon AE, Wang S, Brugnara C, Lodish
HF 1999 Fetal anemia and apoptosis of red cell progenitors in
Stat5a-/-5b-/- mice: a direct role for Stat5 in Bcl-X(L) induction.
Cell 98:181191[CrossRef][Medline]
-
Iwatsuki K, Endo T, Misawa H, Yokouchi M, Matsumoto A,
Ohtsubo M, Mori KJ, Yoshimura A 1997 STAT5 activation correlates
with erythropoietin receptor-mediated erythroid differentiation of an
erythroleukemia cell line. J Biol Chem 272:81498152[Abstract/Free Full Text]
-
Mui AL, Wakao H, Kinoshita T, Kitamura T, Miyajima
A 1996 Suppression of interleukin-3-induced gene expression by a
C-terminal truncated Stat5: role of Stat5 in proliferation. EMBO J 15:24252433[Medline]
-
Rui H, Xu J, Mehta S, Fang H, Williams J, Dong F,
Grimley PM 1998 Activation of the Jak2-Stat5 signaling pathway in
Nb2 lymphoma cells by an anti-apoptotic agent, aurintricarboxylic acid.
J Biol Chem 273:2832[Abstract/Free Full Text]
-
Zhuang H, Patel SV, He TC, Sonsteby SK, Niu Z,
Wojchowski DM 1994 Inhibition of erythropoietin-induced
mitogenesis by a kinase-deficient form of Jak2. J Biol Chem 269:2141121414[Abstract/Free Full Text]
-
Boccaccio C, Ando M, Tamagnone L, Bardelli A, Michieli
P, Battistini C, Comoglio PM 1998 Induction of epithelial tubules
by growth factor HGF depends on the STAT pathway. Nature 391:285288[CrossRef][Medline]
-
Leaman DW, Pisharody S, Flickinger TW, Commane MA,
Schlessinger J, Kerr IM, Levy DE, Stark GR 1996 Roles of JAKs in
activation of STATs and stimulation of c-fos gene expression by
epidermal growth factor. Mol Cell Biol 16:369375[Abstract]
-
Quelle FW, Thierfelder W, Witthuhn BA, Tang B, Cohen S,
Ihle JN 1995 Phosphorylation and activation of the DNA binding
activity of purified Stat1 by the Janus protein-tyrosine kinases and
the epidermal growth factor receptor. J Biol Chem 270:2077520780[Abstract/Free Full Text]
-
Vignais ML, Sadowski HB, Watling D, Rogers NC, Gilman
M 1996 Platelet-derived growth factor induces phosphorylation of
multiple JAK family kinases and STAT proteins. Mol Cell Biol 16:17591769[Abstract]
-
Chen J, Sadowski HB, Kohanski RA, Wang L-H 1997 Stat 5 is a physiological substrate of the insulin receptor. Proc Natl
Acad Sci USA 94:22952300[Abstract/Free Full Text]
-
Sawka-Verhelle D, Filloux C, Tartare-Deckert S, Mothe I,
Van Obberghen E 1997 Identification of Stat 5B as a substrate of
the insulin receptor. Eur J Biochem 250:411417[Medline]
-
Van Obberghen E 1994 Signalling through the insulin
receptor and the insulin-like growth factor-I receptor. Diabetologia
37:S125S134
-
Pronk GJ, McGlades J, Pelicci G, Pawson T, Bos JL 1993 Insulin-induced phosphorylation of the 46- and 52-kDa Shc
proteins. J Biol Chem 268:57485753[Abstract/Free Full Text]
-
White MF 1998 The IRS-signalling system: a network
of docking proteins that mediate insulin action. Mol Cell Biochem 182:311[CrossRef][Medline]
-
Nordeen SK 1988 Luciferase reporter gene vectors
for analysis of promoters and enhancers. Biotechniques 6:454458[Medline]
-
Postic C, Niswender KD, Decaux JF, Parsa R, Shelton KD,
Gouhot B, Pettepher CC, Granner DK, Girard J, Magnuson MA 1995 Cloning and characterization of the mouse glucokinase gene locus and
identification of distal liver-specific DNase I hypersensitive sites.
Genomics 29:740750[CrossRef][Medline]
-
Tanizawa Y, Matsutani A, Chiu KC, Permutt MA 1992 Human glucokinase gene: isolation, structural characterization, and
identification of a microsatellite repeat polymorphism. Mol Endocrinol 6:10701081[Abstract/Free Full Text]
-
Tartare S, Mothe I, Kowalski CA, Breittmayer JP,
Ballotti R, Van Obberghen E 1994 Signal transduction by a chimeric
insulin-like growth factor-1 (IGF-1) receptor having the
carboxyl-terminal domain of the insulin receptor. J Biol Chem 269:1144911455[Abstract/Free Full Text]
-
Onishi M, Nosaka T, Misawa K, Mui AL, Gorman D, McMahon
M, Miyajima A, Kitamura T 1998 Identification and characterization
of a constitutively active STAT5 mutant that promotes cell
proliferation. Mol Cell Biol 18:38713879[Abstract/Free Full Text]
-
Rui H, Kirken RA, Farrar WL 1994 Activation of
receptor-associated tyrosine kinase JAK2 by prolactin. J Biol Chem 269:53645368[Abstract/Free Full Text]
-
Sawyer ST, Penta K 1996 Association of JAK2 and
Stat 5 with erythropoietin receptors. J Biol Chem 271:3243032437[Abstract/Free Full Text]
-
Briscoe J, Rogers NC, Witthuhn BA, Watling D, Harpur AG,
Wilks AF, Stark GR, Ihle JN, Kerr IM 1996 Kinase-negative mutants
of JAK1 can sustain interferon-gamma-inducible gene expression but not
an antiviral state. EMBO J 15:799809[Medline]
-
Kohlhuber F, Rogers NC, Watling D, Feng J, Guschin D,
Briscoe J, Witthuhn BA, Kotenko SV, Pestka S, Stark GR, Ihle JN, Kerr
IM 1997 A JAK1/JAK2 chimera can sustain alpha and gamma interferon
responses. Mol Cell Biol 17:695706[Abstract]
-
Pellegrini S, John J, Shearer M, Kerr IM, Stark GR 1989 Use of a selectable marker regulated by alpha interferon to obtain
mutations in the signaling pathway. Mol Cell Biol 9:46054612[Abstract/Free Full Text]
-
OBrien RM, Granner DK 1996 Regulation of gene
expression by insulin. Physiol Rev 76:11091161[Abstract/Free Full Text]
-
Iynedjian PB, Gjinovci A, Renold AE 1988 Stimulation by insulin of glucokinase gene transcription in liver of
diabetic rats. J Biol Chem 263:740744[Abstract/Free Full Text]
-
Magnuson MA, Andreone TL, Printz RL, Koch S, Granner
DK 1989 Rat glucokinase gene: structure and regulation by insulin.
Proc Natl Acad Sci USA 86:48384842[Abstract/Free Full Text]
-
Giorgetti-Peraldi S, Peyrade F, Baron V, Van Obberghen
E 1995 Involvement of Janus kinases in the insulin signaling
pathway. Eur J Biochem 234:656660[Medline]
-
Gual P, Baron V, Lequoy V, Van Obberghen E 1998 Interaction of Janus kinases JAK-1 and JAK-2 with the insulin receptor
and the insulin-like growth factor-1 receptor. Endocrinology 139:884893[Abstract/Free Full Text]
-
Saad MJ, Carvalho CR, Thirone AC, Velloso LA 1996 Insulin induces tyrosine phosphorylation of JAK2 in insulin-sensitive
tissues of the intact rat. J Biol Chem 271:2210022104[Abstract/Free Full Text]
-
Iynedjian PB, Pilot PR, Nouspikel T, Milburn JL, Quaade
C, Hughes S, Ucla C, Newgard CB 1989 Differential expression and
regulation of the glucokinase gene in liver and islets of Langerhans.
Proc Natl Acad Sci USA 86:78387842[Abstract/Free Full Text]
-
Magnuson MA, Shelton KD 1989 An alternate promoter
in the glucokinase gene is active in the pancreatic beta cell. J
Biol Chem 264:1593615942[Abstract/Free Full Text]
-
Matschinsky F, Liang Y, Kesavan P, Wang L, Froguel P,
Velho G, Cohen D, Permutt MA, Tanizawa Y, Jetton TL, Niswender K,
Magnuson MA 1993 Glucokinase as pancreatic beta cell
glucose sensor and diabetes gene. J Clin Invest 92:20922098
-
Jetton TL, Liang Y, Pettepher CC, Zimmerman EC, Cox FG,
Horvath K, Matschinsky FM, Magnuson MA 1994 Analysis of upstream
glucokinase promoter activity in transgenic mice and identification of
glucokinase in rare neuroendocrine cells in the brain and gut. J
Biol Chem 269:36413654[Abstract/Free Full Text]
-
Iynedjian PB, Jotterand D, Nouspikel T, Asfari M, Pilot
PR 1989 Transcriptional induction of glucokinase gene by insulin
in cultured liver cells and its repression by the glucagon-cAMP system.
J Biol Chem 264:2182421829[Abstract/Free Full Text]
-
Nouspikel T, Iynedjian PB 1992 Insulin signalling
and regulation of glucokinase gene expression in cultured hepatocytes.
Eur J Biochem 210:365373[Medline]
-
Chen C, Hosokawa H, Bumbalo LM, Leahy JL 1994 Regulatory effects of glucose on the catalytic activity and
cellular content of glucokinase in the pancreatic beta cell. Study
using cultured rat islets. J Clin Invest 94:16161620
-
Shimomura I, Bashmakov Y, Ikemoto S, Horton JD, Brown
MS, Goldstein JL 1999 Insulin selectively increases SREBP-1c mRNA
in the livers of rats with streptozotocin-induced diabetes. Proc Natl
Acad Sci USA 96:1365613661[Abstract/Free Full Text]
-
Foretz M, Pacot C, Dugail I, Lemarchand P, Guichard C,
Le Liepvre X, Berthelier-Lubrano C, Spiegelman B, Kim JB, Ferré
P, Foufelle F 1999 ADD1/SREBP-1c is required in the activation of
hepatic lipogenic gene expression by glucose. Mol Cell Biol 19:37603768[Abstract/Free Full Text]
-
Foretz M, Guichard C, Ferré P, Foufelle F 1999 Sterol regulatory element binding protein-1c is a major mediator
of insulin action on the hepatic expression of glucokinase and
lipogenesis-related genes. Proc Natl Acad Sci USA 96:1273712742[Abstract/Free Full Text]
-
Streicher R, Kotzka J, Müller-Wieland D,
Siemeister G, Munck M, Avci H, Krone W 1996 SREBP-1 mediates
activation of the low density lipoprotein receptor promoter by insulin
and insulin-like growth factor-I. J Biol Chem 271:71287133[Abstract/Free Full Text]
-
Burdon TG, Maitland KA, Clark AJ, Wallace R, Watson
CJ 1994 Regulation of the sheep beta-lactoglobulin gene by
lactogenic hormones is mediated by a transcription factor that binds an
interferon-gamma activation site-related element. Mol Endocrinol 8:15281536[Abstract/Free Full Text]
-
Li S, Rosen JM 1995 Nuclear factor I and mammary
gland factor (STAT5) play a critical role in regulating rat whey acidic
protein gene expression in transgenic mice. Mol Cell Biol 15:20632070[Abstract]
-
Yoshimura M, Oka T 1989 Isolation and structural
analysis of the mouse beta-casein gene. Gene 78:267275[CrossRef][Medline]
-
Ooi GT, Hurst KR, Poy MN, Rechler MM, Boisclair YR 1998 Binding of STAT5a and STAT5b to a single element resembling a
gamma-interferon-activated sequence mediates the growth hormone
induction of the mouse acid-labile subunit promoter in liver cells. Mol
Endocrinol 12:675687[Abstract/Free Full Text]
-
Cantwell CA, Sterneck E, Johnson PF 1998 Interleukin-6-specific activation of the C/EBPdelta gene in hepatocytes
is mediated by Stat3 and Sp1. Mol Cell Biol 18:21082117[Abstract/Free Full Text]
-
Lin J-X, Mietz J, Modi WS, John S, Leonard WJ 1996 Cloning of human Stat 5B. J Biol Chem 271:1073810744[Abstract/Free Full Text]
-
Weber NR, Riley JK, Greenlund AC, Moore KW, Darnell JE,
Schreiber RD 1996 Stat3 recruitment by two distinct
ligand-induced, tyrosine-phosphorylated docking sites in the
interleukin-10 receptor intracellular domain. J Biol Chem 271:2795427961[Abstract/Free Full Text]
-
Zou J, Presky DH, Wu CY, Gubler U 1997 Differential
associations between the cytoplasmic regions of the interleukin-12
receptor subunits beta1 and beta2 and JAK kinases. J Biol Chem 272:60736077[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
D. L. Kleinberg, T. L. Wood, P. A. Furth, and A. V. Lee
Growth Hormone and Insulin-Like Growth Factor-I in the Transition from Normal Mammary Development to Preneoplastic Mammary Lesions
Endocr. Rev.,
February 1, 2009;
30(1):
51 - 74.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J Weinhaus, L. E Stout, N. V Bhagroo, T C. Brelje, and R. L Sorenson
Regulation of glucokinase in pancreatic islets by prolactin: a mechanism for increasing glucose-stimulated insulin secretion during pregnancy
J. Endocrinol.,
June 1, 2007;
193(3):
367 - 381.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M Egea, I Meton, and I V Baanante
Sp1 and Sp3 regulate glucokinase gene transcription in the liver of gilthead sea bream (Sparus aurata)
J. Mol. Endocrinol.,
April 1, 2007;
38(4):
481 - 492.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Sawka-Verhelle, L. Escoubet-Lozach, A. L. Fong, K. D. Hester, S. Herzig, P. Lebrun, and C. K. Glass
PE-1/METS, an Antiproliferative Ets Repressor Factor, Is Induced by CREB-1/CREM-1 during Macrophage Differentiation
J. Biol. Chem.,
April 23, 2004;
279(17):
17772 - 17784.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Almind, R. N. Kulkarni, S. M. Lannon, and C. R. Kahn
Identification of Interactive Loci Linked to Insulin and Leptin in Mice With Genetic Insulin Resistance
Diabetes,
June 1, 2003;
52(6):
1535 - 1543.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. N. Le, R. A. Kohanski, L.-H. Wang, and H. B. Sadowski
Dual Mechanism of Signal Transducer and Activator of Transcription 5 Activation by the Insulin Receptor
Mol. Endocrinol.,
December 1, 2002;
16(12):
2764 - 2779.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Ribaux, A. Gjinovci, H. B. Sadowski, and P. B. Iynedjian
Discrimination between Signaling Pathways in Regulation of Specific Gene Expression by Insulin and Growth Hormone in Hepatocytes
Endocrinology,
October 1, 2002;
143(10):
3766 - 3772.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Emanuelli, P. Peraldi, C. Filloux, C. Chavey, K. Freidinger, D. J. Hilton, G. S. Hotamisligil, and E. Van Obberghen
SOCS-3 Inhibits Insulin Signaling and Is Up-regulated in Response to Tumor Necrosis Factor-alpha in the Adipose Tissue of Obese Mice
J. Biol. Chem.,
December 14, 2001;
276(51):
47944 - 47949.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Sadowski, T.-S. Choi, M. Le, T. T. Wheeler, L.-H. Wang, and H. B. Sadowski
Insulin Induction of SOCS-2 and SOCS-3 mRNA Expression in C2C12 Skeletal Muscle Cells Is Mediated by Stat5*
J. Biol. Chem.,
June 1, 2001;
276(23):
20703 - 20710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. A. Patel, C. E. Chalfant, J. E. Watson, J. R. Wyatt, N. M. Dean, D. C. Eichler, and D. R. Cooper
Insulin Regulates Alternative Splicing of Protein Kinase C beta II through a Phosphatidylinositol 3-Kinase-dependent Pathway Involving the Nuclear Serine/Arginine-rich Splicing Factor, SRp40, in Skeletal Muscle Cells
J. Biol. Chem.,
June 15, 2001;
276(25):
22648 - 22654.
[Abstract]
[Full Text]
[PDF]
|
 |
|