help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sawka-Verhelle, D.
Right arrow Articles by Van Obberghen, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sawka-Verhelle, D.
Right arrow Articles by Van Obberghen, E.
Endocrinology Vol. 141, No. 6 1977-1988
Copyright © 2000 by The Endocrine Society

ARTICLES

Stat 5B, Activated by Insulin in a Jak-Independent Fashion, Plays a Role in Glucokinase Gene Transcription1

Dominique Sawka-Verhelle2, Sophie Tartare-Deckert, Jean-François Decaux, Jean Girard and Emmanuel Van Obberghen

Institut National de la Santé et de la Recherche Médicale U145 (D.S.-V., S.T.-D., E.V.O.), IFR 50, Avenue de Valombrose, 06107 Nice Cédex 2 France; and Centre National de la Recherche Scientifique UPR 1524 (J.-F.D., J.G.), 92190 Meudon, France

Address all correspondence and requests for reprints to: E. Van Obberghen, INSERM U145, Faculté de Médecine, avenue de Valombrose, 06107 Nice Cédex 2, France. E-mail: vanobbeg{at}unice.fr


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Stat proteins are SH2 domain-containing transcription factors that are activated by various cytokines and growth factors. In a previous work, we have identified Stat 5B as a substrate of the insulin receptor based on yeast two-hybrid and mammalian cell transfection studies. In the present study, we have approached the biological relevance of the interaction between the insulin receptor and the transcription factor Stat 5B. Firstly, we show that both insulin and insulin-like growth factor I lead to tyrosine phosphorylation of Stat 5B, and this promotes binding of the transcription factor to the ß-casein promoter containing a Stat 5 binding site. Further, we demonstrate that insulin stimulates the transcriptional activity of Stat 5B. Activation of Stat 5B by insulin appears to be Jak2-independent, whereas Jak2 is required for GH-induced Stat 5B activation. Hence the pathway by which Stat 5B is activated by insulin is different from that used by GH. In addition, by using Jak1- and Tyk2-deficient cells we exclude the involvement of both Jak1 and Tyk2 in Stat 5B activation by insulin. Taken together, our results strengthen the notion that insulin receptor can directly activate Stat 5B. More importantly, we have identified a Stat 5 binding site in the human hepatic glucokinase promoter, and we show that insulin leads to a Stat 5B-dependent increase in transcription of a reporter gene carrying this promoter. These observations favor the idea that Stat 5B plays a role in mediating the expression of the glucokinase gene induced by insulin. As a whole, our results provide evidence for the occurrence of a newly identified circuit in insulin signaling in which the cell surface receptor is directly linked to nuclear events through a transcription factor. Further, we have revealed an insulin target gene whose expression is, at least in part, dependent on Stat 5B activation and/or binding.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
POLYPEPTIDE signaling molecules such as growth factors and cytokines impact on a large series of cellular processes through interaction with their specific cell surface receptors. These biological signaling events result in changes in cell function, growth, and differentiation. Some of these effects are mediated through altered gene activity in the nucleus. The common pathway downstream of several cytokine receptors involves the Jak-Stat (signal transducers and activators of transcription) circuitry, which eventuates in Stat-induced gene expression.

The Janus kinases (Jak) are cytoplasmic tyrosine kinases phosphorylated and activated in response to cell stimulation by cytokines. So far four members have been identified: Jak1, Jak2, Jak3, and Tyk2 (1, 2, 3, 4, 5). These kinases lead to activation of Stat proteins following their phosphorylation on tyrosine (6, 7). Stats are SH2 domain-containing transcription factors found in latent form in the cytoplasm in absence of cell activation. Upon tyrosine phosphorylation, Stats dimerize and translocate to the nucleus. Finally, the Stat dimers bind to specific DNA sequences and induce gene transcription (8). Recently, several reports have suggested that serine phosphorylation also regulates the activity of some Stat proteins. Indeed, Wen et al.(9) have shown that maximal activation of transcription by Stat 1 and Stat 3 requires both tyrosine and serine phosphorylation. Among the six members of the Stat proteins (8), Stat 5 was originally identified as a mammary gland factor (MGF) that is regulated by PRL (10). It was shown that two Stat 5 genes encode Stat 5A and Stat 5B proteins that are 95% identical in amino acid sequence (11). Stat 5 proteins are known to be activated by several cytokines. In addition to PRL, Stat 5 proteins are activated by GH, erythropoietin (EPO), thrombopoietin (TPO), granulocyte macrophage colony stimulating factor (GM-CSF), and several interleukines (12, 13, 14, 15, 16, 17). Stat 5 proteins are essential mediators of PRL and GH action (12, 18, 19). They have also been implicated in cytokine control of apoptosis, growth, and differentiation (19, 20, 21, 22). It has been shown that Stat 5 is mostly activated by Jak2. Indeed, Jak2 and Stat 5 are stimulated in response to IL2, IL3, GM-CSF, PRL, EPO, TPO, and GH (12, 14, 19, 23).

Activation of Stats has also been reported to occur through receptor families different from that of the cytokines. Indeed, it has been shown that several growth factor receptors, including EGF (epidermal growth factor), HGF (hepatocyte growth factor) and PDGF (platelet-derived growth factor) receptors, which contain intrinsic tyrosine kinase activity, activate Stat 1 and Stat 3 in a Jak-independent fashion (24, 25, 26, 27). In addition, we and others have found that insulin is able to induce tyrosine phosphorylation of Stat 1, Stat 3, and Stat 5 (28, 29). The insulin receptor is composed of two extracellular {alpha}-subunits containing the ligand binding domain and two transmembrane ß-subunits, which possess tyrosine kinase activity. Upon hormone binding, the receptor becomes activated through autophosphorylation on several tyrosine residues located in the intracellular part of the ß-subunit (30). Subsequently, the activated insulin receptors transmit downstream signals via tyrosine phosphorylation of cellular substrates including IRS-proteins (insulin receptor substrate-1, -2, -3, -4), Shc (Src homology collagen), and Gab-1 (Grb-2 associated binder-1) (31, 32). Generally speaking, these phosphorylated substrates form the link between the receptors and the signaling circuitry resulting in the final effects of the hormone on metabolism affecting carbohydrates, lipids and proteins, as well as on cell growth and differentiation (32). In a previous work, we have identified Stat 5B as a substrate of the insulin receptor using the yeast two-hybrid system as a cloning technique with the insulin receptor as bait. We have found that Stat 5B interacts through its SH2 domain with receptor phosphotyrosine 960 localized in the cytoplasmic domain of the receptor (29).

Here we found that Stat 5B activated by insulin is indeed able to interact with Stat 5 binding site, which we identified in the glucokinase promoter, and induces transcription of a reporter gene placed downstream of the glucokinase promoter. Moreover, we showed that Stat 5B activation by insulin occurs in a Jak-independent fashion.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
The human IR complementary DNA (cDNA) was obtained from A. Ullrich (Munich, Germany). Human Stat 5B cDNA was a gift from W. Leonard (Bethesda, MD). The rat GH-receptor cDNA was a kind gift from N. Billestrup (Gentofte, Denmark), murine Jak2 cDNA from C. Carter-Su (Ann Arbor, Michigan) via K. Seedorf (Gentofte, Denmark) and Jak2 kinase-dead from K. Seedorf. GAS-luciferase reporter gene was provided by J. Darnell (New York, NY). NIH-IR and NIH-IGF-IR are mouse NIH-3T3 fibroblasts expressing human insulin receptor (7 x 105 receptors/cell) and IGF-I receptor (6 x 105 receptors/cell), respectively. NIH-IR was a gift from A. Ullrich and R. Lammers (Munich, Germany). The mutant cell lines 11.1 (also called U1A) and U4C were provided by S. Pellegrini (Paris, France) and I. Kerr (London, UK), respectively.

Antibody to the carboxy-terminus of Stat 5B or to the amino-terminus of Stat 5B were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Antibody to Stat 5B was from Zymed Laboratories, Inc. (San Francisco, CA) and antibodies to phosphotyrosine were from Upstate Biotechnology, Inc. (Lake Placid, NY). The anti-Jak2 antibody is a polyclonal antibody obtained from Upstate Biotechnology, Inc.. All chemical reagents were purchased from Sigma (St. Louis, MO) and enzymes were from New England Biolabs, Inc. (Beverly, MA). Culture media and oligonucleotides were from Life Technologies, Inc. (Paisley, Scotland, UK). Recombinant human insulin-like growth factor I (IGF-I) was a gift from Eli Lilly & Co. (Indianapolis, IN).

Stat 5B mutants
Stat 5B Y699F and Stat 5B H298R/S715F were obtained by site-directed mutagenesis of double-stranded DNA using the Transformer kit (CLONTECH Laboratories, Inc. Palo Alto, CA) and cloned into pSX eukaryotic expression vector. Mutants were identified by DNA sequencing. The mutant Y699F contains a phenylalanine that replaces tyrosine at position 699. The mutant H298R/S715F contains a double mutation, i.e. histidine 298 and serine 715, which are replaced by arginine and phenylalanine, respectively.

Cell culture and transfection
All cell lines used were grown in DMEM containing 10% (vol/vol) FCS at 37 C with 5% CO2. 11.1 and U4C cells were grown in presence of 250 µg/ml hygromycin and 400 µg/ml G418, respectively.

Transfections in Cos-7 cells were done by the DEAE-Dextran method. Three micrograms or 1 µg of each indicated plasmids were used for transfection in 100-mm or 35-mm dishes, respectively. For luciferase and ß-galactosidase assays, in 35-mm dishes, 0.5 µg of the luciferase reporter genes and 0.25 µg of ß-galactosidase gene were added with 1 µg of each expression plasmids. One day after transfection, cells were starved in DMEM supplemented with 0.2% (vol/vol) BSA during 16 h and then used for the different experiments described below.

11.1 and U4C cells were transiently transfected with Superfect Reagent from QIAGEN (Valencia, CA). Plasmid DNA transfections in HepG2 cells were carried out using Lipofectamine Reagent (Life Technologies, Inc.). One microgram of luciferase reporter genes and 0.5 µg of ß-galactosidase gene were transfected in 35-mm dishes. Two days after transfection, cells were starved in DMEM supplemented with 0.2% BSA and were stimulated or not with insulin 10-7 M for 6 h.

Immunoprecipitation and immunoblot analysis
HepG2, NIH-IR, and NIH-IGF-IR cells were treated for 5 min with pervanadate, 20 µM for HepG2 and NIH-IR, and 50 µM for NIH-IGF-IR. During pervanadate incubation, cells were stimulated or not with insulin (10-7 M) or IGF-I (10-7 M). Cos-7, 11.1 and U4C cells were directly incubated in absence or presence of insulin (10-7 M) or GH (1.2 x 10-10 M).

Cells were then immediately washed twice with buffer A (10 mM HEPES, pH 7.9; 1 mM EDTA; 0.1 mM EGTA; 10 mM Na4P2O7; 100 mM NaF and 2 mM sodium orthovanadate) and resuspended on ice with 400 µl/100 mm dishes or 200 µl/35 mm dishes of buffer A with 10 mM KCl; 1 mM DTT; and protease inhibitors (100 U/ml aprotinin, 1 mM phenylmethylsulfonyl fluoride, 20 µM leupeptin). Cells were lysed with 30 µl/100 mm dishes or 15 µl/35 mm dishes of 10% (vol/vol) Triton X-100 and vortexed for 30 sec. The lysates, clarified by centrifugation for 5 min at 4 C, were incubated for 3 h at 4 C with antibody to Stat 5B preadsorbed on protein-G-Sepharose. Then pellets were washed 3 times with buffer (50 mM HEPES; 150 mM NaCl; 10 mM EDTA; 10 mM Na4P2O7, 100 mM NaF and 2 mM sodium orthovanadate, pH 7.4) containing 0.1% (vol/vol) Triton X-100, resuspended as previously described (29) and separated by SDS-PAGE. Proteins were transferred to an Immobilon membrane. First, the membrane was immunoblotted with antibodies to phosphotyrosine. Proteins were revealed with chemiluminescence detection system (ECL). Thereafter, membranes were blotted with antibodies to Stat 5 and proteins were revealed by alkaline phosphatase substrate (5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT).

Preparation of nuclear extract
Cos-7, NIH-IR, NIH-IGF-IR, 11.1 and U4C cells were lysed as described above. After centrifugation, lysates were removed and pellets were solubilized in electrophoretic mobility shift assay lysis buffer (Buffer A, 400 mM NaCl, 1 mM EGTA, 1 mM DTT) and protease inhibitors (100 U/ml aprotinin, 1 mM phenylmethylsulfonyl fluoride, 20 µM leupeptin). Pellets were vortexed at 4 C for 15 min and then nuclear extracts were collected by centrifugation for 15 min at 4 C. Quantification of proteins was performed using a modified Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA) and extracts were frozen in liquid nitrogen and stored at -80 C.

Electrophoretic mobility shift assay (EMSA)
Nuclear extracts (10 to 20 µg) were incubated for 15 min at 4 C with 13 µl of buffer C (8 mM HEPES; pH 7.8, 1 mM DTT, 60 mM KCl, 2 mM EDTA, 4 mM spermidine, 0.1 mg/ml BSA, 10% (vol/vol) glycerol, 0.03% (vol/vol) NP40, 0.5% (vol/vol) Ficoll, 1 µg salmon sperm, 0.8 µg polydIdC). For supershift experiments, 1 µg of antibody to Stat 5 A/B (Santa Cruz, CA) or antibody to Stat 5 B (Zymed Laboratories, Inc., San Francisco, CA) were added to the mixture for 20 min at room temperature. Probes (3 x 105 cpm) were added and the incubation continued at 30 C for 30 min. When competition studies were performed, unlabeled double-strand oligonucleotides were added before the probe. Probes corresponded to oligonucleotides labeled with T4 polynucleotide kinase in presence of [{gamma}-32P]ATP. Sequences of ß-casein, GK WT and GK {triangleup} are AGATTTCTAGGAATTCAAATC; CCAAAATTCCTGGAAAGCAGG and CTTCCAAAAGAAAGCAGGAAC, respectively. Polyacrylamide gels (5%) containing 5% (vol/vol) glycerol and 0.25 x Tris borate/EDTA were prerun in 0.25 x Tris borate/EDTA buffer at 4 C for 90 min at 280 V. After loading of samples, the gel was run at room temperature for 3 h at 280 V. Gels were dried and autoradiographed.

Glucokinase promoter constructs
The mouse glucokinase-luciferase plasmid is the pXP2-luciferase vector (33) in which the fragment (-6011; +19 nucleotides) of the liver glucokinase promoter from mouse was subcloned (34). Human glucokinase-luciferase plasmid is the pGL3-basic vector (Promega Corp., Charbonnieres, France) in which the fragment (-1440 to +168 nucleotides from exon 1) of liver glucokinase promoter of human origin was subcloned (35). This fragment was obtained by PCR from human genomic library (CLONTECH Laboratories, Inc.; Palo Alto, CA) using the following primers (5' to 3'): GGGGTACCCATCTCTGAGGCCCTCCCCTTCTTGG CTCCCCCGGGCTCTCCGAGGGGCTAAGAGGTAG

KpnI and SmaI sites were underlined. The PCR product digested by KpnI and SmaI was subcloned into pGL3B digested with the same enzymes. The GK {triangleup} (-1368; -1363) and GK {triangleup} (-1404; -1346) are human glucokinase-luciferase reporter gene described above containing a deletion of 6 nucleotides (-1368 to -1363) and a deletion of 59 nucleotides (-1404; -1346), respectively. These mutants were generated by the QuickChange site directed mutagenesis kit (Stratagene, La Jolla, CA).

Luciferase and ß-galactosidase assays
Cos-7 cells were transfected with the insulin receptor, wild-type or mutated Stat 5B, ß-galactosidase gene under the control of the CMV promoter and the luciferase reporter gene. HepG2 cells were transfected with human glucokinase-luciferase plasmid and ß-galactosidase gene under the control of the SV40 promoter. Twenty-four hours after transfection, Cos-7 and HepG2 cells were incubated in DMEM supplemented with 0.2% (vol/vol) BSA and treated or not with insulin (10-7 M) for 16 h and 6 h, respectively. Cells were washed twice with PBS and lysed with reporter lysis buffer (Promega Corp., Madison, WI). Supernatants were used for luciferase and ß-galactosidase assays. Luciferase activity of each sample was determined by measuring luminescence of 20 µl of lysates after injection of 200 µl of luciferase assay reagent (Promega Corp.). To measure ß-galactosidase activity, 10 µl of Cos-7 cells lysates were incubated with buffer containing 1.33 mg/ml o-nitrophenyl-ß-D-galactopyranoside (ONPG), 100 mM ß-mercapto-ethanol, 2 mM MgCl2, 200 mM Na2HPO4; pH 7.3. HepG2 cell lysates were incubated with 200 µl of luminescent ß-galactosidase detection kit (CLONTECH Laboratories, Inc.; Palo Alto, CA). To correct for differences in transfection efficiencies, luciferase activities were normalized to the ß-galactosidase activities.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Stat 5B is tyrosine phosphorylated in the insulin-treated HepG2 hepatoma cell line
We have shown earlier that Stat 5B is phosphorylated on tyrosine in response to insulin in 293 cells overexpressing insulin receptors (29). As Stat 5B is expressed in insulin-sensitive tissues such as the liver, we wanted to know whether endogenous Stat 5B is phosphorylated in HepG2 cells exposed to the hormone. To do this, after insulin treatment, HepG2 cells were lysed and cytoplasmic extracts were precipitated with antibody to Stat 5B. Western blotting was then performed with antibody to phosphotyrosine. Phosphorylation of endogenous Stat 5B in HepG2 cells was detectable within 1 min of insulin stimulation but continued to increase within the time-frame studied (Fig. 1AGo). Stat 5B phosphorylation was found to be insulin dose dependent with a maximal effect seen at 10-6 M (Fig. 1BGo). Stripping of the membrane followed by blotting with antibody to Stat 5B shows that the amount of immunoprecipitated Stat 5B tested is comparable (data not shown).



View larger version (35K):
[in this window]
[in a new window]
  		Figure 1. Insulin induces tyrosine phosphorylation of Stat 5B in HepG2 cells. HepG2 cells, treated with 20 µM pervanadate for 5 min were stimulated for the indicated times (A) with insulin (10-7 M) or for 5 min at different insulin concentrations (B). Cells were solubilized and cytoplasmic extracts were subjected to precipitation with antibody to Stat 5B. After washes, the proteins were separated by SDS-PAGE, transferred to membrane, and blotted with antibody to phosphotyrosine. Western blot was revealed using ECL. Molecular weight markers are indicated as well as the band corresponding to Stat 5B.

 
Stat 5B is activated by insulin and IGF-I
Because insulin receptors and IGF-I receptors are structurally related and most insulin receptor targets are also targets of the IGF-I receptor (30, 31, 32), we looked whether Stat 5B is activated in response to IGF-I. We used NIH 3T3 cells, which express about the same number of insulin receptors (NIH-IR cells) or IGF-I receptors (NIH-IGF-IR cells) (36). First, we looked at Stat 5B phosphorylation in response to insulin and IGF-I in NIH-IR and NIH-IGF-IR, respectively. We performed on cytoplasmic extracts of treated or nontreated cells an immunoprecipitation with antibody to Stat 5B followed by blotting with antibody to phosphotyrosine (Fig 2Go). We found that endogenous Stat 5B is phosphorylated in response to insulin (Fig. 2AGo) and IGF-I (Fig. 2BGo). Next, we verified that phosphorylation of Stat 5B in response to both polypeptides leads to its activation. Using an electrophoretic mobility shift assay (EMSA) with the Stat 5 binding site found in the ß-casein promoter as a probe, we searched for formation of Stat 5-DNA complexes with nuclear extracts from insulin-treated or IGF-I-treated cells. Two protein-DNA complexes were obtained with nuclear extracts from NIH-IR and NIH-IGF-IR. Stat 5-DNA binding activity was increased when cells were stimulated by insulin for NIH-IR (Fig. 2CGo, lane 2) and IGF-I in NIH-IGF-IR (Fig. 2DGo, lane 7). Both complexes (I and II) appeared to be specific because they disappeared in presence of a large amount of unlabeled probe (lanes 3 and 8). The presence of Stat 5 in the upper protein-DNA complexes (I) was confirmed by supershift with antibodies to Stat 5A and B (lanes 4 and 9) or to Stat 5B only (lanes 5 and 10). These results indicate that complex I, induced by insulin or IGF-I in both cell lines, consists of a homodimer of Stat 5B or a heterodimer containing Stat 5B because antibody to Stat 5B generated a complete supershift of this complex. The lower complex, which is also insulin- and IGF-I-dependent (complex II), could correspond to another transcription factor which can bind to the probe.



View larger version (47K):
[in this window]
[in a new window]
  		Figure 2. Insulin and IGF-I activate Stat 5 in NIH 3T3 cells overexpressing insulin and IGF-I receptors, respectively. NIH 3T3 cell lines expressing insulin receptor (NIH-IR) or IGF-I receptor (NIH-IGF-IR) were incubated for 5 min with 20 µM and 50 µM pervanadate, respectively. Cells, stimulated with insulin (10-7 M) or IGF-I (10-7 M), were solubilized, and cytoplasmic extracts were subjected to immunoprecipitation with antibody to Stat 5B. Proteins were separated by SDS-PAGE, transferred to membrane and blotted with antibody to phosphotyrosine (A, B). Nuclear extracts, from cells treated for 5 min with 15 µM pervanadate and stimulated with insulin (10-7 M) or IGF-I (10-7 M), were preincubated in the absence (-) or presence (+) of antibody recognizing only Stat 5B (B) or antibody recognizing both Stat 5A and Stat 5B (A/B). Then, {alpha}32P-labeled oligonucleotide corresponding to Stat 5 binding site from ß-casein promoter was added. The probe was incubated alone or together with a 100-fold molar excess of unlabeled homologous oligonucleotide. The position of specific DNA-protein complexes I and II are indicated by arrows and the supershifted complexes are shown by arrowheads (C, D).

 
Stat 5B activated by insulin induces transcription of a reporter gene
Next we investigated whether Stat 5B activated by insulin is able to induce the transcription of a reporter gene. Expression vectors encoding insulin receptor, wild-type (WT) Stat 5B or mutants and a luciferase cDNA gene under the control of the GAS site (IFN {gamma}-activated site) were transiently transfected in Cos-7 cells (Fig. 3AGo). Upon insulin stimulation, WT Stat 5B induced a 1.8-fold increase in the reporter gene activity (P = 0.025). As expected, a mutant of Stat 5B, Y699F, which has lost its tyrosine phosphorylation site, was completely inactive. In contrast, the Stat 5B mutant H298R/S715F, which has previously been reported to be constitutively active (37), induced luciferase activity in absence of insulin stimulation. Next we studied tyrosine phosphorylation and DNA binding activity of the Stat 5B constructs in response to insulin in Cos-7 cells. Compared with WT, Stat 5 Y699F, which is expressed at the same level as WT (data not shown), was not tyrosine phosphorylated under insulin stimulation and did not bind to a cDNA probe containing a Stat 5 site (Fig. 3BGo). Stat 5 H298R/S715F, which constitutively induces luciferase activity, was tyrosine phosphorylated and had DNA binding activity in absence of insulin treatment (Fig. 3CGo). Despite no significant insulin-induced change in the transactivation activity of this mutant was observed, insulin increases slightly its tyrosine phosphorylation and DNA binding properties. To summarize, insulin-activated Stat 5B appears to be only phosphorylated on tyrosine 699, and is able to induce reporter gene transcription.



View larger version (24K):
[in this window]
[in a new window]
  		Figure 3. Stat 5B activated by insulin induces transcription of a luciferase reporter gene. A, Cos-7 cells were transfected with insulin receptor, wild-type (WT) or mutants of Stat 5B (Y699F, H298R/ S715F), a ß-galactosidase gene under the control of the CMV promoter and GAS-luc plasmid. Cells were treated or not with insulin (10-7 M) for 16 h. Results expressed as luciferase activity and normalized to ß-galactosidase activity are the mean ± SEM of triplicates and are representative of three independent experiments (P <= 0.025). B and C, Cos-7 cells expressing insulin receptor and Stat 5B wild-type or Y699F (B) or H298R/S715F (C) were incubated or not with insulin (10-7 M) for 5 min. Cells were solubilized, and the cytoplasmic extracts were subjected to precipitation with antibody to Stat 5B, proteins were separated by SDS-PAGE, transferred to membrane and blotted with antibody to phosphotyrosine. Proteins were visualized by ECL. Nuclear extracts were incubated with 32P-labeled oligonucleotide corresponding to Stat 5 binding site from ß-casein promoter. Gels were dried and subjected to autoradiography. The position of specific DNA-protein complexes is indicated by arrows. The mutant Y699F has the tyrosine 699 replaced by phenylalanine. The mutant H298R/S715F has both histidine and serine replaced by arginine and phenylalanine, respectively.

 
Insulin activates Stat 5B in a Jak-independent fashion
Jak2 has been found to play an important role in activation of Stat 5 in response to several cytokines and growth factors (12, 14, 38, 39). To evaluate the role of Jak2 in insulin-induced Stat 5B activation, we looked at phosphorylation of Stat 5B, in response to insulin, in presence of catalytically inactive Jak2 (Jak2 K/A). Cos-7 cells expressing Stat 5B, insulin receptor and Jak2 K/A were stimulated or not with insulin. Precipitation of Stat 5B followed by immunoblot with antibodies to phosphotyrosine was performed. Tyrosine phosphorylation of Stat 5B is unchanged in presence of Jak2 (K/A) (Fig. 4AGo). In contrast, in Cos-7 cells expressing Stat 5B and GH receptor, GH-induced phosphorylation of Stat 5B was decreased in presence of Jak2 K/A (Fig. 4BGo). Indeed, with 0.5 µg of plasmid expressing Jak2 K/A, Stat 5B tyrosine phosphorylation was decreased by 90% and was totally abolished with 1 µg of vector. This result indicates that Jak2 K/A plays a dominant negative role in Stat 5B phosphorylation induced by GH in Cos-7 cells by interfering with endogenous Jak2. We verified that Jak2 K/A was expressed at the same level in the different conditions (data not shown). Taken together, our results suggest that, in Cos-7 cells, insulin receptor phosphorylates Stat 5B through a mechanism independent of Jak2, while Jak2 is involved in the effect of GH on Stat 5B. To confirm that Jak2 is not implicated in activation of Stat 5B by insulin, EMSAs were conducted with nuclear extracts from cells treated or not with insulin or GH. Cells were transfected or not with Jak2 (K/A), insulin receptor or GH receptor and Stat 5B plasmids (Fig. 5Go). We found that Jak2 K/A did not change the ability of Stat 5B, activated by insulin, to bind to a cDNA probe (Fig. 5AGo). Indeed, a supershifted complex was observed with nuclear extracts from insulin-stimulated cells, in presence and in absence of Jak2 K/A. As anticipated from our observations made with Stat 5B phosphorylation, in cells expressing Jak2 K/A and stimulated by GH, Stat 5B was not able to bind to the cDNA probe (Fig. 5BGo).



View larger version (33K):
[in this window]
[in a new window]
  		Figure 4. Jak2 is not involved in insulin-induced Stat 5B phosphorylation. Cos-7 cells were transfected with Stat 5B, insulin receptor (A) or GH receptor (B) and different amounts of Jak2 kinase-dead (Jak2 K/A). Cells, stimulated or not with insulin (10-7 M) or GH (1.2 x 10-10 M), respectively, for 15 min, were treated as described in Fig. 1Go legend. Immunoblot with antibody to phosphotyrosine was revealed by ECL. The following immunoblot with antibody to N-terminal region of Stat 5 was revealed by alkaline phosphatase substrate (BCIP/NBT). Jak2 K/A has the lysine 882 replaced by alanine.

 


View larger version (50K):
[in this window]
[in a new window]
  		Figure 5. Jak2 is not involved in insulin-induced binding of Stat 5B to the ß-casein probe. Cos-7 cells were transfected with Stat 5B, insulin receptor (A) or GH receptor (B) and Jak2 kinase-dead (Jak2 K/A). Cells stimulated or not for 15 min with insulin (10-7 M) or GH (1.2 x 10-10 M), respectively, were solubilized. Nuclear extracts were prepared and were incubated in absence (-) or presence (+) of antibody recognizing specifically Stat 5B. Thereafter, 32P-labeled oligonucleotide corresponding to Stat 5 binding site from ß-casein promoter was added. The position of specific DNA-protein complexes is indicated by arrows, and the supershifted complexes are shown by arrowheads.

 
It has been described that Stat 5 is also activated by Jak kinases other than Jak2. Indeed, after exposure of cells to several interleukines such as IL2, IL4, IL9, and IL10, Jak1, Jak3, and Tyk2 lead to activation of Stat 5. To look whether these Jak kinases are involved in insulin-induced Stat 5B activation, we used two cell lines 11.1 (also called UA1) and U4C, which are defective in Tyk2 and Jak1, respectively (40, 41, 42). Cells were transiently transfected with expression vectors encoding insulin receptor, Stat 5B or both. Then, we analyzed Stat 5B tyrosine phosphorylation and activation in these cells in response to insulin. In U4C cells, insulin induced activation of Stat 5B because we observed a protein-DNA complex when nuclear extracts from treated cells were incubated with the ß-casein probe (Fig. 6AGo). This complex was only observed with nuclear extracts from cells expressing both Stat 5B and insulin receptor, and its occurrence was increased after insulin stimulation. It appears to contain Stat 5B because a supershift was observed with an antibody to Stat 5B. As expected, we found that Stat 5B was tyrosine phosphorylated in cells expressing the insulin receptor and that addition of insulin increased the tyrosine phosphorylation of Stat 5B (data not shown). Because insulin induced Stat 5B activation in cells lacking Jak1, we conclude that Jak1 is not involved in the insulin-induced Stat 5B activation. Similar results were obtained with 11.1 cells, which do not express Tyk2. A major protein-DNA complex was observed with nuclear extracts from stimulated cells expressing insulin receptor and Stat 5B (Fig. 6BGo). A minor complex was also observed, but it did not increase after coexpression of Stat 5B and insulin receptor. As for Stat 5B activation, we observed that insulin induced tyrosine phosphorylation only in cells expressing insulin receptor and Stat 5B (data not shown). These results indicate that Tyk2 is not involved in the activation of Stat 5B by insulin. To conclude, Jak1, Jak2, and Tyk2 do not appear to be required for Stat 5B phosphorylation and activation in response to insulin.



View larger version (35K):
[in this window]
[in a new window]
  		Figure 6. Jak1 and Tyk2 are not involved in insulin-induced Stat 5B activation. Jak1-deficient cells (U4C) (A) or Tyk2-deficient cells (11.1) (B) were transiently transfected with plasmids encoding Stat 5B and/or insulin receptor. Cells were stimulated or not with insulin 10-7 M for 15 min and then solubilized. Nuclear extracts were incubated with 32P-labeled oligonucleotide corresponding to the Stat 5 binding site from ß-casein promoter. The position of specific DNA-protein complexes is indicated by arrowheads.

 
Stat 5B activated by insulin induces murine hepatic glucokinase transcription
Because Stat 5B is phosphorylated in hepatoma cells treated with insulin (Fig. 1Go), we approached the potential role of Stat 5B in insulin action on liver-specific gene expression. Glucokinase, expressed in liver and pancreatic ß cells, is one of the major regulatory enzymes of carbohydrate metabolism (43). Previous reports have shown that transcription of glucokinase in liver is insulin dependent (44, 45). To examine whether Stat 5B is implicated in transcription of glucokinase in response to insulin, a fragment of the liver glucokinase promoter from mouse (-6011 to +19 nucleotides) was inserted in a reporter plasmid upstream of the luciferase gene. This construct was expressed in Cos-7 cells together with insulin receptor, Stat 5B WT or negative form of Stat 5B. Cells were incubated without or with 10-7 M insulin for 16 h and luciferase activities were measured (Fig. 7Go). In cells transfected with Stat 5B WT, a 2-fold induction of the reporter gene activity after insulin stimulation was observed, whereas no increase in luciferase activities was detected when cells did not express Stat 5B or expressed Stat 5B Y699F. The increase in luciferase activity observed in stimulated cells was statistically significant (P = 0.0005). These data suggest that Stat 5B plays a role in transcription of liver glucokinase gene from mouse in response to insulin.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 7. Stat 5B activated by insulin induces murine glucokinase gene transcription in Cos-7 cells. Cos-7 cells expressing insulin receptor, Stat 5B WT or Y699F were transfected with mouse glucokinase-luciferase and ß-galactosidase plasmids. Luciferase activities were measured as described in the legend to Fig. 4Go. Data are expressed as fold-induction, in terms of luciferase activity in insulin-treated cells relative to unstimulated cells. *, P <= 0.005.

 
Stat 5B binds to a consensus binding site in the human glucokinase promoter
Next we searched for a Stat 5 binding site in the human hepatic glucokinase promoter. We identified a TTC CTG GAA sequence located in the promoter region at 1368 nucleotides from exon 1 (35). Nuclear extracts from stimulated or unstimulated Cos-7 cells expressing Stat 5B and insulin receptor were tested for their ability to bind to this putative Stat 5 site (Fig. 8AGo). Stat 5B bound to glucokinase probe as well as to ß-casein probe. Complex formation was increased in insulin-stimulated cells and was supershifted by antibody to Stat 5B. Its formation was prevented when nuclear extracts were preincubated with a 100-fold molar excess of unlabeled probe. To verify that the interaction between nuclear extracts and glucokinase probe is due to the Stat 5 binding site, we deleted this probe of 6 nucleotides important for Stat 5 binding (GK{triangleup}). As expected this deletion prevented complex formation (Fig. 8BGo). Likewise, similar results were obtained when the glucokinase probe contained the two nucleotides GG of Stat 5 site mutated to TT (data not shown). Taken as a whole, our results indicate that Stat 5B activated by insulin binds to a human glucokinase site located between nucleotides -1368 to -1360.



View larger version (37K):
[in this window]
[in a new window]
  		Figure 8. Stat 5B activated by insulin binds to the Stat consensus binding site in the human glucokinase promoter. A, Starved Cos-7 cells were stimulated or not with insulin 10-7 M for 15 min. Nuclear extracts were incubated with 32P-labeled glucokinase probe or with 32P-labeled ß-casein probe. As indicated, nuclear extracts were preincubated with 100-fold molar excess of unlabeled probes or with antibody to Stat 5. The same nuclear extracts were incubated with 32P-labeled glucokinase (wt) probe or with 32P-labeled glucokinase {Delta}(-1368, -1363) probe containing a deletion of 6 nucleotides of the Stat 5 binding site (B).

 
Stat 5B activated by insulin induces human glucokinase gene transcription
Finally, we examined whether Stat 5B is involved in human glucokinase transcription in response to insulin. To do this we inserted a fragment of the human liver glucokinase promoter (-1440 to +168 nucleotides) into a reporter plasmid upstream of the luciferase gene (pGL3-GK WT) (Fig. 9AGo). This construct was expressed in HepG2 cells. Starved cells were incubated without or with 10-7 M insulin for 6 h and luciferase activities were measured (Fig. 9BGo). Addition of insulin induced a significant 1.5-fold increase in reporter gene activity driven by glucokinase promoter construct (P = 0.005). To evaluate the role of Stat 5B in this effect, we deleted the Stat 5 binding site at -1368 to -1360, and we transfected this construct into HepG2 cells. Compared with the GK WT construct, the GK {triangleup} (-1368; -1363) construct showed a lower transcriptional activity (Fig. 9CGo). However, luciferase activity obtained was higher than the one observed with the empty vector. To explain the residual activity observed with GK {triangleup} (-1368; -1363), we hypothesized that the promoter might contain other Stat binding sites. Around the bona fide Stat 5 binding site (-1368; -1360) several regions look like potential Stat 5 binding sites. To investigate whether these sites were responsible for the residual activity, we deleted the glucokinase promoter construct of a fragment of 59 nucleotides containing the true Stat 5-binding site and several candidate Stat 5 binding sites. This construct (GK{triangleup} (-1404; -1346) transfected in HepG2 cells induced a luciferase activity similar to GK{triangleup} (-1368; -1363) (Fig. 9CGo), suggesting that this region is not involved in the insulin effect seen with GK{triangleup} (-1368; -1363).



View larger version (22K):
[in this window]
[in a new window]
  		Figure 9. Stat 5B activated by insulin induces human glucokinase gene transcription in HepG2 cells. Region of human hepatic glucokinase (GK) promoter containing the Stat 5 binding site and the binding sites for transcription factors. AP1, AP1-binding site; OCT-1, Oct-1 binding site; C/EBP, C/EBP binding site; A1, liver factor A1 binding site; SREBP, sterol regulatory element-binding protein. Bases are numbered form exon 1 (A). HepG2 cells were transfected with pGL3B or pGL3B-GK WT and ß-galactosidase gene under the control of the SV40 promoter. Cells were treated or not with insulin (10-7 M) for 6 h. Luciferase activity, measured in cell lysates, was normalized to ß-galactosidase activity. A representative histogram of three independent experiments is shown (B). Luciferase reporter plasmid GK {Delta} (6 nt) is deleted of 6 nucleotides corresponding to Stat 5 binding site. GK {Delta} (59 nt) contains a deletion of 59 nucleotides containing the Stat 5 binding site. These constructs were transfected in the HepG2 cells. Cells were treated as described above. Data are expressed as fold-induction and represent the means of three independent experiments done in triplicate (C). *, P <= 0.005.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
While the Stat transcription factors are known to regulate gene expression regulated by cytokines and certain hormones, such as PRL and GH, their involvement in signaling by tyrosine kinase receptors is ill-defined. A first indication that the Jak/Stat pathway might be involved in tyrosine kinase receptor signaling came from the observation that hormones such as insulin and IGF-I stimulate Jak phosphorylation and activation (46, 47, 48). More recently, we found that Stat 5B interacts through its SH2 domain with the phosphorylated tyrosine 960 of the insulin receptor (29). We became further intrigued by the potential role of Stat in transcription of a major gene regulated by insulin, which is hepatic glucokinase. We show in the present work that insulin and IGF-I lead to tyrosine phosphorylation of Stat 5B, which then acquires the ability to go to the nucleus and activate gene transcription. Further, we provide evidence for a potential role of Stat 5B in the transcriptional effects of insulin. We have shown that Stat 5B, activated by insulin, enhances the transcription of a reporter gene placed under the control of the hepatic glucokinase promoter.

Glucokinase gene expression is cell type-specific and involves two alternative promoters that are differentially regulated (49, 50). Expression of the pancreatic islet glucokinase isoform, which is determined by the upstream promoter, is an important determinant of the insulin secretory response to glucose (51). The upstream promoter is also expressed in several other neural/neuroendocrine cell types in the brain and intestine. However, the possible functional significance of glucokinase in these locations remains to be determined (52). The downstream glucokinase promoter controls expression of the hepatic isoform, which is thought to be a rate-determining step for hepatic glucose utilization (51). The hepatic glucokinase gene is known to be strictly dependent for its transcription on the presence of insulin, and inversely to be totally repressed under the action of glucagon via the cAMP pathway (53, 54). In contrast, glucokinase gene transcription in pancreatic islets appears to be largely constitutive, although glucose acts at a posttranscriptional level to regulate islet glucokinase activity (55). The occurrence of both promoters is compatible with the fact that glucokinase is differently regulated in liver and in pancreatic ß-cells. Due to the large size of the liver promoter (34), which leads to experimental difficulties, little is known about insulin and glucagon action on regulation of hepatic glucokinase gene transcription.

In our present report, we found that Stat 5B could function as one of the factors involved in hepatic glucokinase gene transcription induced by insulin. By reporter gene studies, we showed that Stat 5B plays a role in mediating the transcriptional activation of the mouse and human glucokinase promoter in response to insulin. Further, we identified a Stat 5 binding site at -1368 to -1360 of the human liver glucokinase promoter. Importantly, insulin leads to Stat 5B interaction within this site in EMSAs and induces transcription of a reporter gene placed downstream of a glucokinase promoter fragment containing the Stat 5B binding site. This effect seems to be specific because deletion of a Stat 5B-binding site leads to a decrease in transcriptional activity. Interestingly, it is important to point out that a potential Stat5 binding site at -3139 to -3131 is also present in the region of the mouse glucokinase promoter construct.

Human glucokinase promoter constructs lacking the Stat 5 site (-1368 to -1360) still maintained a transcriptional activity in response to insulin. This suggests that insulin might activate some transcription factors other than Stat 5, involved in glucokinase gene transcription. Alternatively, insulin could induce the expression of transcription factor(s) regulating in turn the activity of the glucokinase promoter. ADD1/SREBP-1c could be such a factor. Indeed, after completion of our current study reports have appeared indicating that ADD1/SREBP-1c might be a key factor regulating insulin-induced glucokinase gene expression. To be specific, insulin stimulates ADD1/SREBP-1c expression in intact liver and hepatocytes (56, 57), and a dominant negative form of this factor inhibits the action of insulin on glucokinase expression in cultured hepatocytes (58). Further, computer-assisted examination of our promoter region revealed 3 potential SREBP binding sites, a SRE-type element at -91 to -81, and two E-box motifs at -810 to -800 and -597 to -587, respectively. According to this, binding of ADD1/SREBP-1c to one of these elements might participate in the transcriptional activation seen in response to insulin. To the best of our knowledge, the binding sites for SREBP family in the promoter have not been mapped and the mechanism by which insulin stimulates transcriptional activity of ADD1/SREBP-1c is still unknown.

In HepG2 cells we observed only a 1.5-fold stimulation of the reporter gene activity under insulin action. This "moderate" effect could be explained by the fact that only part of the promoter containing nucleotides -1440 to +168 and not the full-length promoter is subcloned in the reporter plasmid. Despite the fact that ADD1/SREBP-1c is expressed in these cells (59) and that the promoter region bears at least three binding sites for this factor, it is quite possible that other enhancers or regulatory sequences are missing. This observation could explain the lack of full-blown insulin effect on glucokinase transcription in HepG2 cells. It is also possible that the effect of insulin on glucokinase expression involves specific factors that are absent in HepG2 cells. Finally, genuine hormonal regulation of glucokinase gene transcription might require that the promoter is embedded in its "natural" chromatin environment. Considering our results as a whole, we would like to suggest that Stat 5B, in addition to ADD1/SREBP-1c, could play a role in transcription of the hepatic glucokinase gene. Whether they act synergistically or additively is not known at the present time.

Stat 5 binding sites are conserved in the promoter sequences of the milk protein genes in different species such as ß-casein (10), ß-lactoglobulin (60), and WAP (whey acidic protein) (61). These sites occur also in promoters of interferon response factor-1 (IRE-1), Fc{gamma}RI, ICAM, Fc{epsilon}RIIb, {alpha}2-macroglobulin genes (62). In addition, more recently, Stat 5 was found to play a role in gene transcription of ALS (acid-labile subunit), which is important for transport of circulating IGFs (insulin-like growth factors) (63) and transcription of antiapoptotic factor Bcl-X (19). These results suggest that the regulatory role of Stat 5 is not restricted to milk protein genes in mammary glands. Compatible with this view is our finding that Stat 5B could play a role in hepatic glucokinase gene transcription. Moreover, Stat 5B could be involved in transcription of other insulin-induced genes, since Stat 5B binding sequences are found in the genes corresponding to rat C/EBP ß and {alpha}1-acid glycoprotein (64).

Interestingly, we found that Jak2 is not implicated in activation of Stat 5B by insulin. Indeed, when a Jak2 mutant containing an inactive kinase is expressed together with the insulin receptor and Stat 5B, tyrosine phosphorylation of Stat 5B remained unchanged. Moreover, in presence of this Jak2 mutant, Stat 5B phosphorylated by insulin retained its ability to bind to a cDNA probe. Taken together these results are not in favor of a role of Jak2 in activation of Stat 5B by insulin. In contrast, Jak2 has been implicated in activation of Stat 5 in response to several polypeptides including GH and PRL (12, 14). In other words, insulin appears to activate Stat 5B using a pathway that is different from that stimulated by GH and PRL. Four members of Jak have been identified i.e. Jak1, Jak2, Jak3, and Tyk2 (1, 2, 3, 4, 5). While Jak1 and Tyk2 are widely expressed, Jak3 is found only in lymphoid and myeloid cells (5). Based on these findings, we could not exclude that Jak1 and Tyk2 or other kinases, expressed in Cos-7 cells, could be involved in activation of Stat 5B by insulin. We analyzed Stat 5B activation in response to insulin in Jak1- and Tyk2-deficient cell lines. In both cell lines, insulin is able to activate Stat 5B, indicating that similar to Jak2, Jak1 and Tyk2 are not involved in insulin-induced Stat 5B activation. This could be expected since Jak1, participating in IL-2 signaling, is expressed in Cos-7 cells at a level that does not lead to detectable induction of Stat 5 phosphorylation in response to IL-2 (65). Further, Tyk2 has been involved so far only in signaling by heteroreceptors. Indeed, Stat activation occurs through both Tyk2 and Jak1 in IL-10 and IFN signaling pathways (66) and Tyk2 and Jak2 in signaling by IL-12 (67). In these situations, activation of Stat depends on the presence and activation of both Jak kinases, which bind each chain forming the heteroreceptor. In a previous report, we have shown that Stat 5B interacts directly with the insulin receptor and that this association is dependent on the receptor tyrosine kinase activity (29). Taking these considerations together, we would like to propose that Stat 5B is directly activated by insulin receptors. A similar process might occur for EGF, PDGF, and HGF receptors. Indeed, it was found that Stat 1 and Stat 3 associate with and are directly phosphorylated by HGF and EGF receptors, respectively (24, 25). Likewise, it has been shown that activation of Stat 1 and Stat 3 by PDGF receptor is not dependent on Jak kinases (27).

While the precise role of Stat 5 in the control of glucokinase gene expression remains to be determined, our present work points to the existence of a new paradigm in insulin action on nuclear events. To be specific, the direct phosphorylation and activation of the transcription factor Stat 5 by the cell surface insulin receptor strongly indicates the occurrence of a direct cell membrane to nucleus circuit. Whether such a pathway is unique to the regulation of the glucokinase gene or whether it is involved in other nuclear effects of the hormone is not known.


   Acknowledgments
 
We thank W. Leonard for Stat 5B cDNA, J. Darnell for luciferase reporter gene construct, C. Postic and M. Magnusson (Nashville, TN) for providing the mouse glucokinase construct. We also thank S. Pellegrini (Paris, France) and I. Kerr (London, UK) for providing mutant cell lines 11.1 and U4C cells, N. Billestrup, C. Carter-Su and K. Seedorf for GH-receptor and Jak2 cDNAs. We thank V. Baron for advice, P. Peraldi for critical reading of the manuscript, and Eli Lilly & Co. for recombinant human IGF-I.


   Footnotes
 
1 The work performed in INSERM U145 was supported in part by Institut National de la Santé et de la Recherche Médicale, Association pour la Recherche sur le Cancer, La Ligue Nationale Contre le Cancer, Université de Nice Sophia-Antipolis, Groupe LIPHA-Merck & Co., Inc. (Lyon, France) and contract QLRT-1999–00674 from the EU. Back

2 Recipient of fellowships from the Ligue Nationale Contre le Cancer and Naturalia et Biologia (France). Back

Received November 2, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Firmbach-Kraft I, Byers M, Shows T, Dalla-Favera R, Krolewski JJ 1990 Tyk 2 prototype of a novel class of non-receptor tyrosine kinase genes. Oncogene 5:1329–1336[Medline]
  2. Harpur AJ, Andres AC, Ziemiecki A, Aston RR, Wilks AF 1992 Jak2, a third member of the jak family of the protein tyrosine kinase. Oncogene 7:1347–1353[Medline]
  3. Silvennoinen O, Witthuhn BA, Quelle FW, Cleveland JL, Yi T, Ihle JN 1993 Structure of the murine Jak2 protein-tyrosine kinase and its role in interleukin 3 signal transduction. Proc Natl Acad Sci USA 90:8429–8433[Abstract/Free Full Text]
  4. Wilks AF, Harpur AG, Kurban RR, Ralph SJ, Zurcher G, Ziemiecki A 1991 Two novel protein-tyrosine kinases, each with a second phosphotransferase-related catalytic domain, define a new class of protein kinase. Mol Cell Biol 11:2057–2065[Abstract/Free Full Text]
  5. Witthuhn BA, Silvennoinen O, Miure O, Lai KS, Cwik C, Liu ET, Ihle JN 1994 Involvement of the Jak-3 Janus kinase in signaling by interleukins 2 and 4 in lymphoid and myeloid cells. Nature 370:153–157[CrossRef][Medline]
  6. Finidori J, Kelly PA 1995 Cytokine receptor signalling through two novel families of transducer molecules: Janus kinases, and signal transducers and activators of transcription. J Endocrinol 147:11–23[Medline]
  7. Stahl N, Farruggella TJ, Boulton TG, Zhong Z, Darnell JJ, Yancopoulos GD 1995 Choice of STATs and other substrates specified by modular tyrosine-based motifs in cytokine receptors. Science 267:1349–1353[Abstract/Free Full Text]
  8. Ihle JN 1996 STATs: signal transducers and activators of transcription. Cell 84:331–334[CrossRef][Medline]
  9. Wen Z, Zhong Z, Darnell JJ 1995 Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82:241–50[CrossRef][Medline]
  10. Wakao H, Gouilleux F, Groner B 1994 Mammary gland factor (MGF) is a novel member of the cytokine regulated transcription factor gene family and confers the prolactin response. EMBO J 13:2182–2191[Medline]
  11. Liu X, Robinson GW, Gouilleux F, Groner B, Hennighausen L 1995 Cloning and expression of Stat 5 and an additional homologue (Stat 5B) involved in prolactin signal transduction in mouse mammary tissue. Proc Natl Acad Sci USA 92:8831–8835[Abstract/Free Full Text]
  12. Gouilleux F, Pallard C, Dusanter FI, Wakao H, Haldosen LA, Norstedt G, Levy D, Groner B 1995 Prolactin, growth hormone, erythropoietin and granulocyte-macrophage colony stimulating factor induce MGF-Stat5 DNA binding activity. EMBO J 14:2005–13[Medline]
  13. Mui AL-F, Wakao H, O’Farrell A-M, Harada N, Miyajima A 1995 Interleukin-3, granulocyte-macrophage colony stimulating factor and interleukin-5 transduce signals through two STAT5 homologs. EMBO J 14:1166–1175[Medline]
  14. Pallard C, Gouilleux F, Benit L, Cocault L, Souyri M, Levy D, Groner B, Gisselbrecht S, Dusanter FI 1995 Thrombopoietin activates a STAT5-like factor in hematopoietic cells. EMBO J 14:2847–2856[Medline]
  15. Quelle FW, Wang D, Nosaka T, Thierfelder WE, Stravopodis D, Weinstein Y, Ihle JN 1996 Erythropoietin induces activation of Stat5 through association with specific tyrosines on the receptor that are not required for a mitogenic response. Mol Cell Biol 16:1622–1631[Abstract]
  16. Sotiropoulos A, Moutoussamy S, Renaudie F, Clauss M, Kayser C, Gouilleux F, Kelly PA, Finidori J 1996 Differential activation of Stat3 and Stat5 by distinct regions of the growth hormone receptor. Mol Endocrinol 10:998–1009[Abstract]
  17. Wakao H, Harada N, Kitamura T, Mui AL, Miyajima A 1995 Interleukin 2 and erythropoietin activate STAT5/MGF via distinct pathways. EMBO J 14:2527–2535[Medline]
  18. Udy GB, Towers RP, Snell RG, Wilkins RJ, Park SH, Ram PA, Waxman DJ, Davey HW 1997 Requirement of STAT5b for sexual dimorphism of body growth rates and liver gene expression. Proc Natl Acad Sci USA 94:7239–7244[Abstract/Free Full Text]
  19. Socolovsky M, Fallon AE, Wang S, Brugnara C, Lodish HF 1999 Fetal anemia and apoptosis of red cell progenitors in Stat5a-/-5b-/- mice: a direct role for Stat5 in Bcl-X(L) induction. Cell 98:181–191[CrossRef][Medline]
  20. Iwatsuki K, Endo T, Misawa H, Yokouchi M, Matsumoto A, Ohtsubo M, Mori KJ, Yoshimura A 1997 STAT5 activation correlates with erythropoietin receptor-mediated erythroid differentiation of an erythroleukemia cell line. J Biol Chem 272:8149–8152[Abstract/Free Full Text]
  21. Mui AL, Wakao H, Kinoshita T, Kitamura T, Miyajima A 1996 Suppression of interleukin-3-induced gene expression by a C-terminal truncated Stat5: role of Stat5 in proliferation. EMBO J 15:2425–2433[Medline]
  22. Rui H, Xu J, Mehta S, Fang H, Williams J, Dong F, Grimley PM 1998 Activation of the Jak2-Stat5 signaling pathway in Nb2 lymphoma cells by an anti-apoptotic agent, aurintricarboxylic acid. J Biol Chem 273:28–32[Abstract/Free Full Text]
  23. Zhuang H, Patel SV, He TC, Sonsteby SK, Niu Z, Wojchowski DM 1994 Inhibition of erythropoietin-induced mitogenesis by a kinase-deficient form of Jak2. J Biol Chem 269:21411–21414[Abstract/Free Full Text]
  24. Boccaccio C, Ando M, Tamagnone L, Bardelli A, Michieli P, Battistini C, Comoglio PM 1998 Induction of epithelial tubules by growth factor HGF depends on the STAT pathway. Nature 391:285–288[CrossRef][Medline]
  25. Leaman DW, Pisharody S, Flickinger TW, Commane MA, Schlessinger J, Kerr IM, Levy DE, Stark GR 1996 Roles of JAKs in activation of STATs and stimulation of c-fos gene expression by epidermal growth factor. Mol Cell Biol 16:369–375[Abstract]
  26. Quelle FW, Thierfelder W, Witthuhn BA, Tang B, Cohen S, Ihle JN 1995 Phosphorylation and activation of the DNA binding activity of purified Stat1 by the Janus protein-tyrosine kinases and the epidermal growth factor receptor. J Biol Chem 270:20775–20780[Abstract/Free Full Text]
  27. Vignais ML, Sadowski HB, Watling D, Rogers NC, Gilman M 1996 Platelet-derived growth factor induces phosphorylation of multiple JAK family kinases and STAT proteins. Mol Cell Biol 16:1759–1769[Abstract]
  28. Chen J, Sadowski HB, Kohanski RA, Wang L-H 1997 Stat 5 is a physiological substrate of the insulin receptor. Proc Natl Acad Sci USA 94:2295–2300[Abstract/Free Full Text]
  29. Sawka-Verhelle D, Filloux C, Tartare-Deckert S, Mothe I, Van Obberghen E 1997 Identification of Stat 5B as a substrate of the insulin receptor. Eur J Biochem 250:411–417[Medline]
  30. Van Obberghen E 1994 Signalling through the insulin receptor and the insulin-like growth factor-I receptor. Diabetologia 37:S125–S134
  31. Pronk GJ, McGlades J, Pelicci G, Pawson T, Bos JL 1993 Insulin-induced phosphorylation of the 46- and 52-kDa Shc proteins. J Biol Chem 268:5748–5753[Abstract/Free Full Text]
  32. White MF 1998 The IRS-signalling system: a network of docking proteins that mediate insulin action. Mol Cell Biochem 182:3–11[CrossRef][Medline]
  33. Nordeen SK 1988 Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 6:454–458[Medline]
  34. Postic C, Niswender KD, Decaux JF, Parsa R, Shelton KD, Gouhot B, Pettepher CC, Granner DK, Girard J, Magnuson MA 1995 Cloning and characterization of the mouse glucokinase gene locus and identification of distal liver-specific DNase I hypersensitive sites. Genomics 29:740–750[CrossRef][Medline]
  35. Tanizawa Y, Matsutani A, Chiu KC, Permutt MA 1992 Human glucokinase gene: isolation, structural characterization, and identification of a microsatellite repeat polymorphism. Mol Endocrinol 6:1070–1081[Abstract]
  36. Tartare S, Mothe I, Kowalski CA, Breittmayer JP, Ballotti R, Van Obberghen E 1994 Signal transduction by a chimeric insulin-like growth factor-1 (IGF-1) receptor having the carboxyl-terminal domain of the insulin receptor. J Biol Chem 269:11449–11455[Abstract/Free Full Text]
  37. Onishi M, Nosaka T, Misawa K, Mui AL, Gorman D, McMahon M, Miyajima A, Kitamura T 1998 Identification and characterization of a constitutively active STAT5 mutant that promotes cell proliferation. Mol Cell Biol 18:3871–3879[Abstract/Free Full Text]
  38. Rui H, Kirken RA, Farrar WL 1994 Activation of receptor-associated tyrosine kinase JAK2 by prolactin. J Biol Chem 269:5364–5368[Abstract/Free Full Text]
  39. Sawyer ST, Penta K 1996 Association of JAK2 and Stat 5 with erythropoietin receptors. J Biol Chem 271:32430–32437[Abstract/Free Full Text]
  40. Briscoe J, Rogers NC, Witthuhn BA, Watling D, Harpur AG, Wilks AF, Stark GR, Ihle JN, Kerr IM 1996 Kinase-negative mutants of JAK1 can sustain interferon-gamma-inducible gene expression but not an antiviral state. EMBO J 15:799–809[Medline]
  41. Kohlhuber F, Rogers NC, Watling D, Feng J, Guschin D, Briscoe J, Witthuhn BA, Kotenko SV, Pestka S, Stark GR, Ihle JN, Kerr IM 1997 A JAK1/JAK2 chimera can sustain alpha and gamma interferon responses. Mol Cell Biol 17:695–706[Abstract]
  42. Pellegrini S, John J, Shearer M, Kerr IM, Stark GR 1989 Use of a selectable marker regulated by alpha interferon to obtain mutations in the signaling pathway. Mol Cell Biol 9:4605–4612[Abstract/Free Full Text]
  43. O’Brien RM, Granner DK 1996 Regulation of gene expression by insulin. Physiol Rev 76:1109–1161[Abstract/Free Full Text]
  44. Iynedjian PB, Gjinovci A, Renold AE 1988 Stimulation by insulin of glucokinase gene transcription in liver of diabetic rats. J Biol Chem 263:740–744[Abstract/Free Full Text]
  45. Magnuson MA, Andreone TL, Printz RL, Koch S, Granner DK 1989 Rat glucokinase gene: structure and regulation by insulin. Proc Natl Acad Sci USA 86:4838–4842[Abstract/Free Full Text]
  46. Giorgetti-Peraldi S, Peyrade F, Baron V, Van Obberghen E 1995 Involvement of Janus kinases in the insulin signaling pathway. Eur J Biochem 234:656–660[Medline]
  47. Gual P, Baron V, Lequoy V, Van Obberghen E 1998 Interaction of Janus kinases JAK-1 and JAK-2 with the insulin receptor and the insulin-like growth factor-1 receptor. Endocrinology 139:884–893[Abstract/Free Full Text]
  48. Saad MJ, Carvalho CR, Thirone AC, Velloso LA 1996 Insulin induces tyrosine phosphorylation of JAK2 in insulin-sensitive tissues of the intact rat. J Biol Chem 271:22100–22104[Abstract/Free Full Text]
  49. Iynedjian PB, Pilot PR, Nouspikel T, Milburn JL, Quaade C, Hughes S, Ucla C, Newgard CB 1989 Differential expression and regulation of the glucokinase gene in liver and islets of Langerhans. Proc Natl Acad Sci USA 86:7838–7842[Abstract/Free Full Text]
  50. Magnuson MA, Shelton KD 1989 An alternate promoter in the glucokinase gene is active in the pancreatic beta cell. J Biol Chem 264:15936–15942[Abstract/Free Full Text]
  51. Matschinsky F, Liang Y, Kesavan P, Wang L, Froguel P, Velho G, Cohen D, Permutt MA, Tanizawa Y, Jetton TL, Niswender K, Magnuson MA 1993 Glucokinase as pancreatic beta cell glucose sensor and diabetes gene. J Clin Invest 92:2092–2098
  52. Jetton TL, Liang Y, Pettepher CC, Zimmerman EC, Cox FG, Horvath K, Matschinsky FM, Magnuson MA 1994 Analysis of upstream glucokinase promoter activity in transgenic mice and identification of glucokinase in rare neuroendocrine cells in the brain and gut. J Biol Chem 269:3641–3654[Abstract/Free Full Text]
  53. Iynedjian PB, Jotterand D, Nouspikel T, Asfari M, Pilot PR 1989 Transcriptional induction of glucokinase gene by insulin in cultured liver cells and its repression by the glucagon-cAMP system. J Biol Chem 264:21824–21829[Abstract/Free Full Text]
  54. Nouspikel T, Iynedjian PB 1992 Insulin signalling and regulation of glucokinase gene expression in cultured hepatocytes. Eur J Biochem 210:365–373[Medline]
  55. Chen C, Hosokawa H, Bumbalo LM, Leahy JL 1994 Regulatory effects of glucose on the catalytic activity and cellular content of glucokinase in the pancreatic beta cell. Study using cultured rat islets. J Clin Invest 94:1616–1620
  56. Shimomura I, Bashmakov Y, Ikemoto S, Horton JD, Brown MS, Goldstein JL 1999 Insulin selectively increases SREBP-1c mRNA in the livers of rats with streptozotocin-induced diabetes. Proc Natl Acad Sci USA 96:13656–13661[Abstract/Free Full Text]
  57. Foretz M, Pacot C, Dugail I, Lemarchand P, Guichard C, Le Liepvre X, Berthelier-Lubrano C, Spiegelman B, Kim JB, Ferré P, Foufelle F 1999 ADD1/SREBP-1c is required in the activation of hepatic lipogenic gene expression by glucose. Mol Cell Biol 19:3760–3768[Abstract/Free Full Text]
  58. Foretz M, Guichard C, Ferré P, Foufelle F 1999 Sterol regulatory element binding protein-1c is a major mediator of insulin action on the hepatic expression of glucokinase and lipogenesis-related genes. Proc Natl Acad Sci USA 96:12737–12742[Abstract/Free Full Text]
  59. Streicher R, Kotzka J, Müller-Wieland D, Siemeister G, Munck M, Avci H, Krone W 1996 SREBP-1 mediates activation of the low density lipoprotein receptor promoter by insulin and insulin-like growth factor-I. J Biol Chem 271:7128–7133[Abstract/Free Full Text]
  60. Burdon TG, Maitland KA, Clark AJ, Wallace R, Watson CJ 1994 Regulation of the sheep beta-lactoglobulin gene by lactogenic hormones is mediated by a transcription factor that binds an interferon-gamma activation site-related element. Mol Endocrinol 8:1528–1536[Abstract]
  61. Li S, Rosen JM 1995 Nuclear factor I and mammary gland factor (STAT5) play a critical role in regulating rat whey acidic protein gene expression in transgenic mice. Mol Cell Biol 15:2063–2070[Abstract]
  62. Yoshimura M, Oka T 1989 Isolation and structural analysis of the mouse beta-casein gene. Gene 78:267–275[CrossRef][Medline]
  63. Ooi GT, Hurst KR, Poy MN, Rechler MM, Boisclair YR 1998 Binding of STAT5a and STAT5b to a single element resembling a gamma-interferon-activated sequence mediates the growth hormone induction of the mouse acid-labile subunit promoter in liver cells. Mol Endocrinol 12:675–687[Abstract/Free Full Text]
  64. Cantwell CA, Sterneck E, Johnson PF 1998 Interleukin-6-specific activation of the C/EBPdelta gene in hepatocytes is mediated by Stat3 and Sp1. Mol Cell Biol 18:2108–2117[Abstract/Free Full Text]
  65. Lin J-X, Mietz J, Modi WS, John S, Leonard WJ 1996 Cloning of human Stat 5B. J Biol Chem 271:10738–10744[Abstract/Free Full Text]
  66. Weber NR, Riley JK, Greenlund AC, Moore KW, Darnell JE, Schreiber RD 1996 Stat3 recruitment by two distinct ligand-induced, tyrosine-phosphorylated docking sites in the interleukin-10 receptor intracellular domain. J Biol Chem 271:27954–27961[Abstract/Free Full Text]
  67. Zou J, Presky DH, Wu CY, Gubler U 1997 Differential associations between the cytoplasmic regions of the interleukin-12 receptor subunits beta1 and beta2 and JAK kinases. J Biol Chem 272:6073–6077[Abstract/Free Full Text]



This article has been cited by other articles:


Home page