help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, L.
Right arrow Articles by Smith, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, L.
Right arrow Articles by Smith, J. W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
Endocrinology Vol. 141, No. 6 2033-2042
Copyright © 2000 by The Endocrine Society


ARTICLES

Identification of ADAM 31: A Protein Expressed in Leydig Cells and Specialized Epithelia1

Limin Liu and Jeffrey W. Smith

Program on Cell Adhesion at the Cancer Research Center, The Burnham Institute, La Jolla, California 92037

Address all correspondence and requests for reprints to: Dr. Jeffrey W. Smith, Program on Cell Adhesion at the Cancer Research Center, The Burnham Institute, 10901 North Torrey Pines Road, La Jolla, California 92037. E-mail: jsmith{at}burnham-inst.org


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A family of proteins containing a disintegrin and metalloproteinase domain (ADAMs) has been identified recently. Here, we report the identification of a novel member of the ADAM protein family from mouse. This protein is designated ADAM 31. The complementary DNA sequence of ADAM 31 predicts a transmembrane protein with metalloproteinase, disintegrin, cysteine-rich, and cytoplasmic domains. Messenger RNA encoding ADAM 31 was most abundant in testes, but was also detected in many other tissues. More significantly, the antibodies raised against ADAM 31 reveal that the protein has a unique and restricted expression pattern. ADAM 31 is expressed in Leydig cells of the testes, but unlike many other ADAMs, it is not found on developing sperm. Furthermore, ADAM 31 is highly expressed on four types of specialized epithelia: the cauda epididymidis, the vas deferens, the convoluted tubules of the kidney, and the parietal cells of the stomach.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SEVERAL GENES THAT code for a disintegrin and metalloproteinase domain (ADAMs) have been cloned in the last six years (1, 2, 3). To date, thirty ADAMs have been identified from a number of species ranging from Drosophila to human. Although the metalloproteinase (MP) and disintegrin domains are hallmarks of the ADAMs, these proteins often have epidermal growth factor-like repeats and cysteine-rich domains. Most ADAMs are transmembrane proteins with short cytoplasmic tails. However, a few ADAMs are subjected to alternative splicing, which leads to their secretion (4, 5). Another subset of ADAMs contains a short sequence with homology to viral fusion proteins (6, 7, 8).

ADAMs have a number of different biological functions. For example, two of the first ADAMs, ADAM 1 and ADAM 2, are involved in fertilization. ADAM 1 and ADAM 2, which were originally named fertilin-{alpha} and -ß, exist as a heterodimer on the sperm surface. The disintegrin domain of ADAM 2 binds to the {alpha}6ß1 integrin on the egg surface (9, 10). This interaction is a key step in fertilization.

Another function of the ADAMs is illustrated by ADAM 17, which is also called tumor necrosis factor-{alpha}-converting enzyme (TACE). TACE processes pro-TNF{alpha}, releasing a soluble and active form of the proinflammatory cytokine TNF{alpha} (11, 12). It appears that other ADAMs may also exhibit such a processing function by virtue of their MP domain (13, 14, 15, 16). It is this property that has led to the idea that ADAMs may be a class of shedases, enzymes responsible for the liberation of membrane proteins from the cell surface (17, 18).

ADAMs are also involved in development. ADAM 10, which is also known as Kuzbanian, is essential for proper development in Drosophila (15, 19, 20). Although a precise biochemical role for Kuzbanian has not been defined, it does participate in the activation of Notch (14).

The objective of the present study was to determine whether additional ADAMs could be identified. Homology-based PCR led to the identification of a novel mouse ADAM designated ADAM 31. Although the messenger RNA (mRNA) encoding ADAM 31 can be detected by PCR in many tissues, the protein has a restricted pattern of expression. ADAM 31 is preferentially expressed on Leydig cells of the testes. It is not detected on developing sperm. This finding suggests that ADAM 31 may play a role in supporting testicular function. Interestingly, ADAM 31 is also expressed on four types of specialized epithelia: the caudal region of the epididymis, the vas deferens, gastric parietal cells, and the convoluted tubules of the kidney.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells
The mouse macrophage cell line RAW 264.7 (TIB-71, American Type Culture Collection, Manassas, VA) was used in this study.

PCR
Homology PCR was used to amplify ADAM genes. Complementary DNA (cDNA) was obtained by RT of RNA from mouse bone marrow cells or from RNA extracted from RAW 267.4 cells. RT was primed with oligo(deoxythymidine) [oligo(dT)], and first strand cDNA was amplified by PCR using the following degenerate primers: RSD GAR SAG TGT GAY TGT GG (DIS1) and GCA AWW TTC WGG RAR RTC RCA (DIS2) (21). These primers were designed based on conserved sequences within the disintegrin domain of known ADAMs. Other PCR reactions were performed with the 3FU13 (GCC TTG ATG TGC CAG TCA GTA G), 3FD6 (CCA AAT CTC GAT GCC AAC CAA AG), 3FU9 (TTC TGC CTG CAC AGA GGT TAT GG), and 3FD13 (CCA GTT GGG TGG CTC AGA CAT TA) primers as noted in Results. Amplification of homology PCR was performed by denaturing at 95 C for 30 sec, annealing at 48 C for 60 sec, and extension at 72 C for 10 min. This was repeated for 35 cycles. The resulting cDNA fragments were cloned into pCR2.1 (Invitrogen, Carlsbad, CA) and sequenced by automated DNA sequencing using the ABI sequence kit (Perkin-Elmer Corp., Palo Alto, CA).

To assess the expression of ADAM 31, total RNA was isolated from mouse tissues by extraction with RNAzol (Life Technologies, Inc., Gaithersburg, MD). Single stranded cDNA was reverse transcribed by Supertranscriptase II (Life Technologies, Inc.) using an oligo(dT) primer. PCR was performed to amplify a cDNA fragment encoding ADAM 31. Primers 3FU3 (GCTGCTTGTAGTTTTGGGCTC) and 3FD4 (TACAGAGTTCCCCCAAGAGCAT) were used for this amplification. Total RNA that was not subjected to first strand cDNA synthesis served as a negative control in all PCR reactions. A 10-µl sample of each of the resulting PCR products was electrophoresed on 0.8% agarose gels, stained with ethidium bromide, and visualized under UV irradiation.

Northern blotting
A mouse multiple tissue Northern (MTN) blot (CLONTECH Laboratories, Inc., Palo Alto, CA) was probed as described by the manufacturer. In brief, the MTN blot was prehybridized in ExpressHyb (CLONTECH Laboratories, Inc.) at 68 C for 30 min, and hybridized with a 400-bp ADAM 31 cDNA probe. The cDNA fragment used as a probe for Northern analysis was excised from EST clone 760784 by BglI and NotI. This cDNA fragment corresponds to the portion of ADAM 31 extending from the middle of the cysteine-rich domain to the transmembrane domain. The blot was probed with 2 x 106 cpm/ml at 68 C for 1 h. Then the blot was washed in 2 x SSC/0.05% SDS at room temperature for 15 min twice and in 0.1 x SSC/0.1% SDS at 60 C for 15 min three times. Finally, the blot was exposed to Kodak x-ray film (Eastman Kodak Co., Rochester, NY). After hybridization with the ADAM 31 cDNA probe, the blot was stripped and reprobed with 32P-labeled mouse ß-actin cDNA probe to confirm equal loading of polyadenylated RNA in each lane of the blot.

Antibody production
Two polyclonal antibodies (BUR 61 and BUR 92) were raised against ADAM 31. A cDNA fragment encoding the ecto-domain of ADAM 31 was cloned into the pET28 vector (Novagen, Madison, WI). The recombinant ecto-domain of ADAM 31 was expressed in Escherichia coli BL21. Inclusion bodies containing the ecto-domain were solubilized in 8 M urea, diluted in PBS, and then used to immunize rabbit BUR 61. A recombinant fragment corresponding to the cytoplasmic tail of ADAM 31 (ADAM 31 Cyto) was expressed as a His-tagged protein using pET15 (Novagen). The protein was purified with His.Bind resin (Novagen) as described by the manufacturer. Purified ADAM 31 Cyto was used to immunize rabbit BUR 92. Total IgG was purified on protein A-Sepharose (Pharmacia Biotech, Piscataway, NJ) and was then fractionated further on an affinity column containing recombinant ADAM 31 Cyto.

Enzyme-linked immunosorbent assay (ELISA)
Antisera and purified IgG were tested for the ability to bind to antigen using ELISA. Briefly, antigen (50 ng/well) was coated into 96-well microtiter plates. Plates were blocked with 10 mg/ml BSA in TBS (10 mM Tris, 150 mM NaCl, and 0.2% Tween 20, pH 7.8). Immobilized antigen was incubated with anti-ADAM 31 antibodies at the indicated concentrations for 1 h. Plates were washed three times with 100 µl TBS and then incubated with horseradish peroxidase (HRP)-conjugated goat antirabbit IgG (Bio-Rad Laboratories, Inc., Hercules, CA) at a 1:10,000 dilution for 1 h at 4 C. Plates were washed three times with TBS, and color was developed using o-phenylenediamine (0.4 mg/ml) as the substrate. The reaction was stopped by the addition of 50 µl 4 N H2SO4.

Western blotting
The full-length ADAM 31 protein was translated in vitro with the TNT reticulocyte lysate system (Promega Corp., Madison, WI). A sample of the translated material was separated on SDS-PAGE and transferred to a polyvinylidene fluoride (PVDF) membrane. The blot was probed with BUR 61 antiserum. Bound antibody was detected with HRP-conjugated goat antirabbit IgG and then visualized with enhanced chemiluminescence (NEN Life Science Products, Boston, MA).

Immunohistochemistry
Mouse tissues were fixed in Bouin’s solution and embedded in paraffin. Five-micron tissue sections were sequentially deparaffinized by sequential incubations in xylene, then incubations in 100%, 95%, and 70% ethanol; PBS; and water. Endogenous peroxidase was blocked by incubating in 0.3% hydrogen peroxide for 30 min. Antigen was retrieved by boiling the sections in 0.2 M sodium acetate (pH 4.6) in a microwave for 5 min. Sections were blocked by incubation in 0.1 M Tris-HCl (pH 7.5) containing 5% nonfat milk, 2% BSA, and 10% normal goat serum. The ADAM 31 protein was detected by incubation with affinity-purified polyclonal antibody or antiserum as noted. The bound IgG was detected by HRP-conjugated goat antirabbit IgG (ABC kit, Vector Laboratories, Inc., Burlington, Canada) as described by the manufacturer. Competition was performed by incubating BUR 92 IgG with a 20-fold molar excess of antigen (ADAM 31 Cyto) or with the homologous domain of TACE before incubation with the tissue sections. Color was developed with 3,3-diaminobenzidine. Sections were counterstained with Harris hematoxylin solution.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning of ADAM 31
The objective of this study was to identify novel ADAM genes. Homology PCR was used to amplify ADAMs from mouse bone marrow. Five cDNA fragments with open reading frames were amplified. Four of these were identical to a sequence tag that was recently cloned and named ADAM 25 (22, 23). These were not pursued further. One of the PCR products (Fig. 1Go, fragment 1) had a sequence identical to a mouse EST clone 760784 (Fig. 1Go, fragment 2). This EST clone was obtained from Research Genetics, Inc. (Hunstville, AL), and sequenced. The EST clone encodes the MP, disintegrin, cysteine-rich, and transmembrane domains of ADAM 31, but it lacks the 5'- and 3'-ends of the gene. Several complementary strategies were taken to obtain the full-length cDNA of ADAM31. We screened a mouse genomic BAC library and identified five clones that hybridized with the cDNA fragment of ADAM 31 (BAC clones 310C8, 29O10, 459O3, 466N21, and 271N13; Research Genetics, Inc.). PCR and sequence analysis showed each of these BAC clones to harbor the ADAM 31 gene. Therefore, one BAC clone (310C8; Fig. 1Go, fragment 3) was chosen for further characterization. Sequencing of 310C8 showed that the region immediately upstream of the MP domain was homologous to the pro-domain and signal sequence of other ADAMs. Similarly, the 3'-end of the BAC clone codes for a transmembrane domain and a cytoplasmic sequence and contains a stop codon. However, no introns were evident in the sequence of the BAC clone.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Cloning strategy for ADAM 31. ADAM 31 was cloned in a stepwise fashion. A cDNA corresponding to the disintegrin domain was cloned by homology-based PCR (fragment 1). The sequence of the remainder of the gene was deduced from an EST clone (fragment 2), a BAC clone (fragment 3), and two additional PCR steps (fragments 4 and 5). The domain structure of the protein is shown at the top. PD, Pro-domain; MTP, metalloproteinase domain; DIS, disintegrin domain; CR, cystine-rich domain; TM, transmembrane domain; CT, cytoplasmic tail.

 
To verify that the BAC clone corresponds to the coding sequence of ADAM 31, PCR reactions were performed with RNA extracted from the mouse macrophage cell line RAW 264.7. RT-PCR was performed using primers of 3FU13 and 3FD6 that were designed from the sequence of the BAC clone. To prevent the amplification of genomic DNA in these reactions, the RNA sample was digested with deoxyribonuclease I before reverse transcription. A 1-kb cDNA fragment (Fig. 1Go, fragment 4) was amplified. No amplification was observed in control samples. The sequence of the PCR fragment is identical to the sequence of the BAC 310C8, confirming that the ADAM 31 gene lacks introns in the 5'-end of the coding sequence.

A similar approach was used to verify that sequence of the 3'-end of the BAC clone corresponds to coding sequence. A 440-bp PCR fragment was obtained from RAW 264.7 cell RNA using primers of 3FU9 and 3FD13 designed from the BAC sequence (Fig. 1Go, fragment 5). The sequence of this PCR fragment was identical to that of the BAC clone. Together, these findings reveal the complete nucleotide sequence of ADAM 31 (Fig. 2Go) and show that the gene lacks introns. The full-length cDNA was obtained by ligating segments of cDNA fragment 4, EST clone 760784, and cDNA fragment 5.



View larger version (79K):
[in this window]
[in a new window]
 
Figure 2. DNA sequence and predicted amino acid sequence of ADAM 31. The cDNA sequence of ADAM 31 was obtained by automated sequencing of the cDNAs shown in Fig. 1Go. This sequence was used to predict the protein sequence of ADAM 31 (shown in single letter code below the nucleotide sequence). The cDNA sequence has been deposited in GenBank under accession no. AF 251559.

 
The protein sequence of ADAM 31 was deduced from the cDNA sequence and was then aligned with three related human ADAMs (Fig. 3Go). ADAM 31 has 41%, 51%, and 70% amino acid sequence identity with human ADAM 26, ADAM 20, and ADAM 21, respectively (23, 24).



View larger version (86K):
[in this window]
[in a new window]
 
Figure 3. Alignment of ADAM 31 with human ADAM 20, ADAM 21, and ADAM 26. The predicated amino acid sequences of human ADAM20 (GenBank no. AF029899), human ADAM 21 (GenBank no. AF029900), and ADAM26/testase 3 (GenBank no. AF167404) were aligned with ADAM31 using the ClustW program. Identical residues are shaded. The catalytic site of MP is in boldface.

 
Transcriptional expression profile of ADAM 31
The expression of mRNA encoding ADAM 31 was investigated using Northern blotting and RT-PCR. A 400-bp fragment of the ADAM 31 cDNA, labeled with 32P, was used to probe a blot of mRNA isolated from a variety of mouse tissues (Fig. 4AGo). Two transcripts from the testes hybridized with the ADAM 31 probe. The predominant transcript is 3 kb, and based on the sequence of the coding region, this transcript is likely to represent full-length ADAM 31. A minor band of approximately 2.5 kb also hybridized with the probe, and this may represent an alternatively spliced transcript. The message for ADAM 31 could not be detected by Northern blotting in the other tissues. However, RT-PCR of ADAM 31 showed that lower levels of the mRNA are expressed in many tissues. (Fig. 4BGo). The expression of message for ß-actin was used to control for mRNA levels in both experiments. No substantial differences in the levels of ß-actin mRNA were observed among the various samples.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 4. The mRNA expression profile of ADAM 31. A, The expression of mRNA encoding ADAM 31 was examined by Northern blot. Northern analysis was performed with a MTN blot purchased from CLONTECH Laboratories, Inc. The blot, was probed with 32P-labeled cDNA of ADAM 31 (upper panel). Hybridization of the same blot with 32P-labeled cDNA encoding ß-actin showed that similar levels of message were present in each lane (lower panel). B, The expression of message encoding ADAM 31 was also measured with RT-PCR. Total RNA was reverse transcribed with an oligo(dT) primer and then amplified with primers that anneal to the region of ADAM 31 encoding the disintegrin domain. Amplified samples were analyzed on agarose gels (upper panel). RT-PCR of sister samples of RNA with primers for ß-actin yielded similar levels of amplified product (lower panel).

 
Production of antibodies against ADAM 31
Recombinant protein fragments encompassing the cytoplasmic tail of ADAM 31 and a larger fragment encompassing the ecto-domain of ADAM 31 were expressed as His-tagged proteins in E. coli. The recombinant proteins were purified on Ni2+ affinity columns and used to immunize rabbits. Rabbit BUR 61 was immunized with the entire ecto-domain protein, and BUR 92 was immunized with the recombinant cytoplasmic domain. Both antisera bound to their respective antigens in ELISA, whereas preimmune sera showed no reactivity (data not shown). As an additional test of the specificity of the antisera, they were tested for the ability to recognize ADAM 31 in Western blot (Fig. 5Go). ADAM 31 cDNA was translated in vitro using a rabbit reticulocyte system. Translated protein was separated by SDS-PAGE, blotted to PVDF, and then probed with antiserum. Although BUR 92 recognized antigen poorly on blots (not shown), the antisera from rabbit BUR 61 bound to an 86-kDa band that corresponded to the predicted mass of full-length ADAM 31. One other band with a mass of 55 kDa was recognized poorly and is likely to correspond to an incompletely translated fragment or an autocatalytically processed from of ADAM 31. Highly specific IgG fractions were generated by affinity chromatography on antigen affinity columns. Nonbinding of flow-through IgG was also retained as a negative control. These fractions of IgG were used for much of the immunohistochemical analysis described below.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 5. Production and affinity purification of antibodies against ADAM 31. The ability of BUR 61, raised against the ADAM 31 ecto-domain, to recognize in vitro-translated ADAM 31 was tested by Western blotting. Samples of ADAM 31 translated by a rabbit reticulocyte lysate were separated on SDS-PAGE and electrophoretically transferred to a PVDF membrane. The blot was probed with preimmune (lane 1) and immune (lane 2) antisera. Bands were detected by HRP-conjugated goat antirabbit IgG and visualized by chemiluminescence.

 
Analysis of the expression of ADAM 31 in testes by immunohistochemistry
A comprehensive collection of mouse tissues was fixed in Bouin’s solution and embedded in paraffin. Sections from each of these tissues were probed with the polyclonal antibodies against ADAM 31. The vast majority of mouse tissues were devoid of specific staining for ADAM 31. Five tissues showed strong staining of the protein, including the testes, epididymis, vas deferens, kidney, and gastric mucosa.

In the testes, ADAM 31 is predominantly expressed in Leydig cells in the interstitial space (Fig. 6AGo). Antisera against both recombinant fragments of ADAM 31 (BUR92 and BUR61) showed identical staining patterns. Preimmune antisera did not stain the tissue (data not shown). To verify the specificity of this staining, sections of the testes were probed with affinity-purified and flow-through IgG from rabbit BUR 92. Affinity-purified IgG stained Leydig cells of the testes in a pattern identical to the antiserum (Fig. 6AGo), but flow-through IgG failed to stain the tissue (Fig. 6BGo). A higher magnification of these sections (Fig. 6CGo) revealed that the affinity-purified antibody weakly stained Sertoli cells and spermatogonia. Unlike other ADAMs expressed in the testes, there was no detectable expression on sperm, although we cannot exclude low levels of expression on early spermatocytes. A control section stained with flow-through IgG and photographed at the same magnification is also shown (Fig. 6DGo).



View larger version (166K):
[in this window]
[in a new window]
 
Figure 6. Staining of ADAM 31 in Leydig cells with affinity-purified IgG. The ability of affinity-purified BUR 92 IgG (A) and nonbinding flow-through IgG (B) to bind to ADAM 31 in testes is shown. Two similar sections (C and D), viewed at x100, illustrate specific staining of Leydig cells (LC), Sertoli cells (SC), and the surrounding spermatogonium (SG). The positions of spermatids (ST) and primary spermatocytes (PS) are also noted. As an additional control, the binding of affinity-purified IgG was challenged by incubation with 2.5 µg/ml of the recombinant cytoplasmic domain from ADAM 31 (E) or 5 µg/ml of the corresponding domain from TACE (F). All sections were counterstained with hematoxylin.

 
Additional experiments were conducted to determine whether staining of the tissue by BUR 92 IgG could be competed by incubation with soluble antigen. In these competition studies the recombinant cytoplasmic tail of TACE was used as a negative control. When incubated with the ADAM 31 Cyto protein before tissue staining, the IgG failed to bind to Leydig cells (Fig. 6EGo). The corresponding fragment of TACE had no effect on the specific staining of Leydig cells by BUR 92 IgG (Fig. 6FGo).

Expression of ADAM 31 in epithelia of the epididymis and vas deferens
The ADAM 31 protein is also expressed in the cauda section of the epididymis. Affinity-purified BUR 92 IgG stained the epithelia of the cauda epididymidis (Fig. 7AGo), but showed only weak staining of the initial segment of the epididymis (Fig. 7BGo). In both cases, specific staining could be blocked by incubation with the recombinant ADAM 31 (Fig. 7Go, C and D). ADAM 31 is also expressed in the epithelia of vas deferens (Fig. 7EGo). Flow-through IgG did not stain this tissue (Fig. 7FGo).



View larger version (167K):
[in this window]
[in a new window]
 
Figure 7. Expression of ADAM 31 in epididymis and vas deferens. Paraffin sections of mouse cauda epididymidis (A) and caput epididymidis (B) were stained with affinity-purified BUR 92 IgG. In both cases the staining could be blocked by preincubation of the IgG with recombinant ADAM 31 Cyto (C and D). The epithelia within the vas deferens (E) is also stained by BUR 92 IgG, but not by preimmune IgG (F). Cell types are noted as follows: Sp, sperm; Ep, epithelia; CT, connective tissue; SM, smooth muscle.

 
Expression of ADAM 31 in epithelia of the kidney and stomach
The ADAM 31 protein was detected in epithelia of the kidney and stomach. The epithelia of the convoluted tubules of the kidney was stained by affinity-purified BUR 92 IgG (Fig. 8AGo), but not by preimmune IgG (Fig. 8BGo). In the stomach, ADAM 31 was exclusively localized in the parietal cells of gastric mucosa (Fig. 8CGo). Flow-through IgG did not stain the parietal cells (Fig. 8DGo). Staining of the kidney and stomach with BUR 92 IgG could be competitively blocked by recombinant antigen (not shown).



View larger version (159K):
[in this window]
[in a new window]
 
Figure 8. Expression of ADAM 31 in epithelia of the kidney and stomach. Paraffin-embedded sections of mouse kidney were stained with BUR 92 IgG (A) or preimmune IgG (B). Photographs were taken with a x20 objective. Sections were counterstained with hematoxylin. CT, Convoluted tubule; LH, loop of Henle; GL, glomerulus. Similarly, the stomach was stained with BUR 92 IgG (C) or preimmune IgG (D). Cell types within the stomach are noted as follows: PC, parietal cells; SME, surface mucosa epithelia; and CC, chief cells.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have identified a novel mouse gene, ADAM 31. Like other members of the ADAM gene family, ADAM 31 codes for a pro-domain, a MP domain, a disintegrin domain, a cystine-rich domain, a transmembrane domain, and a short cytoplasmic tail. Within the metalloproteinase domain, ADAM 31 contains the consensus catalytic sequence of HEXXHXXHD, indicating that it is likely to exhibit metalloproteinase activity. ADAM 31 also contains a disintegrin domain that is defined by a highly conserved cysteine spacing. However, this disintegrin domain lacks an RGD or any other defined adhesion motif, and is not predicted to be involved in integrin-mediated binding by an RGD-like motif.

Interestingly, the ADAM 31 gene lacks introns. Although in some cases, the lack of introns can be indicative of a pseudogene, as has been shown with other ADAMs (25), ADAM 31 is clearly expressed as mRNA and protein. Thus, ADAM 31 is analogous to human ADAM 20 and ADAM 21, which also lack introns, but are not pseudogenes (24, 25). ADAM 31 is most homologous to human ADAM 21, exhibiting 70% amino acid sequence identity with this protein. Both ADAM 31 and ADAM 21 are also expressed in the testes. More information on the function of each protein and on the expression pattern of ADAM 21 will be required to determine whether ADAM 31 is the mouse ortholog of human ADAM 21. The evolutionary relationship between ADAM 31 and the other known mouse ADAMs was gauged by constructing a phylogenetic tree. This analysis shows that ADAM 31 belongs to the sub-family of ADAMs that includes ADAMs 24–26 (testases).

Although the cDNA for ADAM 31 was cloned from mouse bone marrow cells, we did not detect the expression of the protein on bone marrow by immunohistochemistry. This lack of detection may result from low level expression on a subpopulation of cells in bone marrow or could indicate that mRNA expression levels do not necessarily coincide with protein expression. Like several other ADAMs, mRNA encoding ADAM 31 was most abundant in the testes, but this information does not accurately illustrate the expression pattern of the ADAM 31 protein. The ADAM31 protein is expressed in the testes, but is found in the Leydig cells rather than on developing spermatocytes or mature sperm. This finding suggests that ADAM 31 may have a role in supporting testicular function, but also draws a contrast with ADAM 1, ADAM 2, and ADAM 3, which are found on the sperm surface and are involved in sperm-egg interactions during fertilization.

ADAM 31 is also highly expressed in four types of specialized epithelia and is the first ADAM we are aware of that exhibits this pattern of expression. The expression pattern of ADAM 31 in the epididymis is intriguing because it is regionalized. This could be important clinically because abnormalities in the epididymal epithelium can result in infertility (26). High levels of ADAM 31 are only found in the cauda of the epididymis. Sperm within the testes or in the caput of epididymidis are not motile. The acquisition of motility and the ability to fertilize eggs coincide with the transit of the sperm to the cauda (27), where relocation of the sperm is accompanied by proteolytic processing. Proteins on the sperm surface involved in sperm-egg interactions, including ADAM 1, ADAM 2, and ADAM 3, are all proteolytically cleaved in the cauda (28, 29, 30). Because ADAM 31 contains a MP domain and is localized at the position within the epididymis where sperm become mature, it seems reasonable to hypothesize that this ADAM may have a role in the proteolytic cascade involved in the final maturation of the sperm.

ADAM 31 is also expressed in three other epithelia: the vas deferens, the convoluted tubules of the kidney, and the parietal cells of the stomach. Given that the ADAM family has only recently been discovered, there are few biochemical paradigms to draw from that might suggest how ADAM 31 functions within these tissues. One common feature of these epithelia is their secretory function, particularly as it relates to establishing and maintaining gradients of ions and nutrients. For example, the renal convoluted tubule transports sodium, potassium, and H+ to regulate the salt balance. The parietal cells of the stomach establish and maintain a gradient of HCl such that the pH within the stomach is below 2.5. This extreme ionic environment is essential for proper digestion within the stomach. The epididymal epithelium also establishes gradients that could be considered extreme. For example, the epithelium of caudal epididymis maintains gradients of inositol, carnitine, and glucose, presumably to support the sperm. Together, these observations suggest that ADAM 31 may be involved in functions associated with establishing and maintaining gradients of ions or nutrients. A test of this hypothesis will await information from a genetic knockout animal.


    Acknowledgments
 
The authors thank Dr. Stan Krajewski for help in analysis of histological data; Drs. Herve LeCalvez, Coleen Miller, Emily Chen, and Steven Kridel for helpful discussions; and Kristie Quinones and Xiaokun Xiao for technical assistance.


    Footnotes
 
1 This work was supported by NIH Grants CA-69036 and AR-42750 (to J.W.S.). Back

Received November 11, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Wolfsberg TG, Primakoff P, Myles DG, White JM 1995 ADAM, a novel family of membrane proteins containing a disintegrin and metalloprotease domain: multipotential functions in cell-cell and cell-matrix interactions. J Cell Biol 131:275–278[Free Full Text]
  2. Wolfsberg TG, Straight PD, Gerena RL, Huovila AP, Primakoff P, Myles DG White JM 1995 ADAM, a widely distributed and developmentally regulated gene family encoding membrane proteins with a disintegrin and metalloprotease domain. Dev Biol 169:378–383[CrossRef][Medline]
  3. Wolfsberg TG, White JM 1996 ADAMs in fertilization and development. Dev Biol 180:389–401[CrossRef][Medline]
  4. Gilpin BJ, Loechel F, Mattei MG, Engvall E, Albrechtsen R, Wewer UM 1998 A novel, secreted form of human ADAM 12 (meltrin {alpha}) provokes myogenesis in vivo. J Biol Chem 273:157–166[Abstract/Free Full Text]
  5. Yavari R, Adida C, Bray-Ward P, Brines M, Xu T 1998 Human metalloprotease-disintegrin Kuzbanian regulates sympathoadrenal cell fate in development and neoplasia. Hum Mol Genet 7:1161–1167[Abstract/Free Full Text]
  6. Blobel CP, Wolfsberg TG, Turck CW, Myles DG, Primakoff P, White JM 1992 A potential fusion peptide and an integrin ligand domain in a protein active in sperm-egg fusion. Nature 356:248–252[CrossRef][Medline]
  7. Huovila APJ, Almeida EA, White JM 1996 ADAMs and cell fusion. Curr Opin Cell Biol 8:692–699[CrossRef][Medline]
  8. Yagami-Hiromasa T, Sato T, Kurisaki T, Kamijo K, Nabeshima Y, Fujisawa-Sehara A 1995 A metalloprotease-disintegrin participating in myoblast fusion. Nature 377:652–656[CrossRef][Medline]
  9. Chen MS, Almeida EAC, Huovila AJ, Takahashi T, Shaw LM, Mercurio AM, White JM 1999 Evidence that distict states of the integrin {alpha}6ß1 interaction with laminin and ADAM. J Cell Biol 144:549–561[Abstract/Free Full Text]
  10. Almeida EA, Huovila AP, Sutherland AE, Stephens LE, Calarco PG, Shaw LM, Mercurio AM, Sonnenberg A, Primakoff P, Myles DG, White JM 1995 Mouse egg integrin {alpha}6ß1 functions as a sperm receptor. Cell 81:1095–1104[CrossRef][Medline]
  11. Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Wolfson MF, Castner BJ, Stocking KL, Reddy P, Srinivasan S, Nelson N, Boiani N, Schooley KA, Gerhart M, Davis R, Fitzner JN, Johnson RS, Paxton RJ, March CJ, Cerretti DP 1997 A metalloproteinase disintegrin that releases tumour-necrosis factor-{alpha} from cells. Nature 385:729–736[CrossRef][Medline]
  12. Moss ML, Jin SL, Milla ME, Burkhart W, Carter HL, Chen WJ, Clay WC, Didsbury JR, Hassler D, Hoffman CR, Kost TA, Lambert MH, Leesnitzer MA, McCauley P, McGeehan G, Mitchell J, Moyer M, Pahel G, Rocque W, Overton LK, Schoenen F, Seaton T, Su JL, Warner J, Willard D, Becherer JD 1997 Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factor-{alpha}. Nature 385:733–736[CrossRef][Medline]
  13. Roghani M, Becherer JD, Moss ML, Atherton, RE Erdjument-Bromage H, Arribas J, Blackburn RK, Weskamp G, Tempst P, Blobel CP 1999 Metalloprotease-disintegrin MDC9: intracellular maturation and catalytic activity. J Biol Chem 274:3531–3540[Abstract/Free Full Text]
  14. Qi H, Rand M, Wu X, Sestan N, Wang W, Rackic P, Xu T, Artavanis-Tsakonas S 1999 Processing of the notch ligand Dalta by the metalloprotease Kuzbanian. Science 283:91–94[Abstract/Free Full Text]
  15. Pan D, Rubin GM 1997 Kuzbanian controls proteolytic processing of Notch and mediates lateral inhibition during Drosophila and vertebrate neurogenesis. Cell 90:271–280[CrossRef][Medline]
  16. Loechel F, Gilpin BJ, Engvall E, Albrechtsen R, Wewer UM 1998 Human ADAM 12 (meltrin {alpha}) is an active metalloprotease. J Biol Chem 273:16993–16997[Abstract/Free Full Text]
  17. Peschon JJ 1998 An essential role for ecto-domain shedding in mammalian development. Science 282:1281–1284[Abstract/Free Full Text]
  18. Werb Z, Yan Y 1998 A cellular striptease act. Science. 282:1279–1280
  19. Rooke J, Pan D, Xu T, Rubin GM 1996 KUZ, a conserved metalloprotease-disintegrin protein with two roles in Drosophila neurogenesis. Science 273:1227–1231[Abstract]
  20. Fambrough D, Pan D, Rubin GM, Goodman CS 1996 The cell surface metalloprotease/disintegrin Kuzbanian is required for axonal extension in Drosophila. Proc Natl Acad Sci USA 93:13233–13238[Abstract/Free Full Text]
  21. Perry AC, Jones R, Hall L 1995 Analysis of transcripts encoding novel members of the mammalian metalloprotease-like, disintegrin-like, cysteine-rich (MDC) protein family and their expression in reproductive and non-reproductive monkey tissues. Biochem J 312:239–244
  22. Weskamp G, Blobel CP 1994 A family of cellular proteins related to snake venom disintegrins. Proc Natl Acad Sci USA 91:2748–2751[Abstract/Free Full Text]
  23. Zhu G, Lin Y, Myles DG, Primakoff P 1999 Identification of four novel ADAMs with potential roles in spermatogenesis and fertilization. Gene 234:227–237[CrossRef][Medline]
  24. van Huijsduijnen RH 1998 ADAM20 and 21: two novel human testis-specific membrane metallopreteases with similarity to fertilin A. Gene 206:273–282[CrossRef][Medline]
  25. Poindexter K, Nelson N, DuBose RF, Black RA, Cerretti DP 1999 The identification of seven metalloprotease-disintegrin (ADAM) genes from genomic library. Gene 237:61–70[CrossRef][Medline]
  26. Sonnenberg-Riethmacher E, Walter B, Riethcher D, Godecke S, Birchmeier C 1996 The c-ros tyrosine kinase receptor controls regionalization and differentiation of epithelial cells in the epididymis. Gene Dev 10:1184–1193[Abstract/Free Full Text]
  27. Turner TT 1995 On the epididymis and its role in the development of the fertile ejaculate. J Androl 16:292–298[Free Full Text]
  28. Hunnicutt G, Koppel DE, Myles DG 1997 Analysis of the process of localization of fertilin to the sperm posterior head plasma membrane domain during sperm maturation in the epididymis. Dev Biol 191:146–159[CrossRef][Medline]
  29. Lum L, Blobel CP 1997 Evidence for distinct serine protease activities with a potential role in processing the sperm protein fertilin. Dev Biol 191:131–145[CrossRef][Medline]
  30. Perry ACF, Jones R, Barker PJ, Hall L 1992 A mammalian epididymal protein with remarkable sequence similarity to snake venom haemorrhage peptides. Biochem J 286:671–675



This article has been cited by other articles:


Home page
ReproductionHome page
S. Mazaud Guittot, A. Verot, F. Odet, M.-A. Chauvin, and B. le Magueresse-Battistoni
A comprehensive survey of the laminins and collagens type IV expressed in mouse Leydig cells and their regulation by LH/hCG
Reproduction, April 1, 2008; 135(4): 479 - 488.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, L.
Right arrow Articles by Smith, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, L.
Right arrow Articles by Smith, J. W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals