| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Division of Medical Pharmacology, Leiden/Amsterdam Center for Drug Research, 2300 RA Leiden, The Netherlands
Address all correspondence and requests for reprints to: O. C. Meijer, Division of Medical Pharmacology, Leiden/Amsterdam Center for Drug Research, P.O. Box 9503, 2300 RA Leiden, The Netherlands. E-mail: o.meijer{at}lacdr.leidenuniv.nl
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The magnitude of the transcriptional activation of a given gene depends on receptor availability and ligand concentration. However, it has become clear that factors downstream of the DNA-bound steroid receptor are important determinants of the extent of transactivation caused by this type of receptors. Several proteins that potentiate the activity of nuclear receptors by acting as coactivators of transcription have recently been characterized (reviewed in Refs. 7, 8). While some of these proteins function as coactivators for many different transcription factors, the effects of the members of the p160 family or steroid receptor coactivators (SRCs) seem to be restricted to (and essential for) the nuclear receptor family (9, 10).
Steroid receptor coactivator-1 (SRC-1 or NCoA-1) stimulates
transcriptional activity of many members of the nuclear receptor family
(11) but not the transcriptional activity of other transcription
factors tested (9, 11). Of the several splice variants of SRC-1 that
have been described, SRC-1e has a shorter C-terminus than the
originally described SRC-1a protein and lacks one nuclear
receptor-interacting domain (the so-called NR box IV, see Fig. 1
and Refs. 12, 13, 14). ER-mediated
transcription-stimulation is differentially affected by SRC-1a and 1e
in a promoter-dependent manner: overexpressed SRC1a in some cases
fails to potentiate ER-mediated transcriptional stimulation, whereas
SRC-1e potently stimulates transcription from EREs in all cases tested
(14). In addition, in yeast two-hybrid experiments these splice
variants have differential interactions with the ligand binding domains
(LBD) of steroid receptors. SRC-1e was reported to interact poorly with
AR and GR LBD in the presence of ligand, while ER,TR, RAR, and VDR LBDs
preferred SRC-1e over SRC-1a (15). Interestingly, SRC-1 levels not only
determine hormonal responses, but also appear to be subject to hormonal
regulation themselves: thyroid hormone and estrogens can up-
respectively down-regulate SRC-1 mRNA levels in pituitary (16).
|
The distribution of SRC-1 and -2 in different regions of the brain is not known, although these proteins are likely to be important determinants of steroid signals to the brain. In the absence of members of the p160 family of coactivators, significant transactivation is unlikely to occur. Differential expression of SRC-1a and 1e in steroid target nuclei in the brain may cause differences in the potency of effects mediated by different types of steroid receptors. Finally, local regulation of expression levels of coactivators may lead to local changes in steroid sensitivity. We therefore decided to measure expression levels of SRC-1a, 1e and 2 mRNA in brain and pituitary by in situ hybridization. We find expression patterns that are specific for each coactivator, suggesting different roles for these three proteins and differences in regional sensitivity for steroid signaling in the brain.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Oligonuceotide probes
The mRNA splice variants SRC-1a and 1e differ only in a 55
nucleotides long exon which is present in SRC1e mRNA (12). Therefore,
to distinguish expression of the two mRNAs, it is necessary to use
end-labeled oligonucleotide probes. To visualize mRNAs,
oligonucleotides were end-labeled with 
-33P
dATP (NEN Life Science Products, Hoofddorp, The
Netherlands, 2000 Ci/mmol, 10 mCi/ml) using terminal transferase with
the manufacturer’s protocol (Roche Molecular Biochemicals, Almere, The Netherlands). A 0.5-nmol
oligonucleotide was labeled at molar ratio of 1:10 (oligo:label).
Incorporation was typically between 50 and 75%, resulting in a tail of
5 to 7.5 A-residues per oligonucleotide.
For SRC-1a a 44-mer oligonucleotide was used that spanned the
region around the exon specific for SRC-1e, i.e.
complementary to nucleotides 4167–4210 of GenBank entry U64606 for
mouse SRC-1a: 5' acacctgaacctgctgcacctgctggtttccatctgcgtctgtt (see Fig. 1
). This sequence contains three mismatches with the corresponding part
of the human mRNA (93% identity); likely the rat sequence is even more
homologous. To control for specificity of hybridization, we used an
oligonucleotide that was identical but for 7 mismatches
(transversions), evenly spaced at every 6 nucleotides: 5'
aAacctgCacctgAtgcacAtgctgTtttccCtctgcTtctgtG. As an alternative control
we used a 22-mer that is identical to the most 5' half of the SCR-1a
oligonucleotide: 5' acacctgaacctgctgcacctg. This sequence is present in
both SRC-1a and 1e mRNA, and serves as a negative control for binding
of the SRC-1a oligo to SRC-1e mRNA.
SRC-1e mRNA was measured with the 44-mer 5' gagctcctctagtctgtagtcaccacagagaagaactcttctgt, the reverse complement of nucleotides 4453–4496 of the GenBank entry U56920 for mouse SRC-1e. This is part of the exon specific for SRC-1e; nucleotides 4444–4495 are identical in the mouse and human gene, which makes identity to the (unpublished) rat sequence highly likely. The control oligonucleotide with mismatches was: 5'gCgctccGctagtAtgtagGcaccaAagagaCgaactAttctTt. Total SRC-1 mRNA was measured with the 44 mer 5' ctccggtaaaagccggtgcagaattttatgccgctcagtcagaga, the reverse complement to nucleotides 2071–2115 of mSRC-1a, that codes for the second NR-box which is present and identical in both splice variants.
For SRC-2 (GRIP-1/TIF2) we used the 44-mer: 5' ctataatcccatgcaagatccaaacttccacaccatgggacagcg, corresponding to nucleotides 3441–3485 of the rat gene [GenBank entry AF136943 (21)]. The control oligo was: 5' ctaGaatcccaAtgcaCgatccCcaacttAcacAatgggCcagcg.
In situ hybridization
In situ hybridization was performed essentially as
described in (22). 1 x 106 dpm of labeled
oligonucleotide per 100 µl hybridization mix were applied to each
slide. Hybridization mix consisted of 50% formamide, 10% dextran
sulfate, 4 x SSC, 25 mM sodium phosphate
(pH 7.0), 1 mM Na pyrophosphate, 20
mM DTT, 5 x Denhardt’s, 100 µg/ml
poly-A, 100 µg/ml sheared salmon sperm DNA. Sections were
coverslipped and hybridized overnight in a moist chamber at 42 C. The
next morning, coverslips were removed, rinsed in 1 x SSC at room
temperature, washed twice for 30 min in 1 x SSC at 50 C, washed
for 5 min in 1 x SSC at room temperature, dehydrated in an
ethanol series, air dried and apposed to Kodak (Rochester,
NY) X-Omat AR film for 2–4 weeks. After development of the films, some
of the sections were also dipped in photographic emulsion (Ilford),
exposed for 2–6 weeks, developed and counter-stained with 0.5% cresyl
violet.
Analysis
Expression patterns were determined from film and dipped
sections using the Paxinos & Watson, and the Swanson rat brain atlases
(23, 24). Relative levels of expression presented here (Table 1) were determined from film in a
complete series of frontal sections of 1 animal. Gray levels from each
section on film were linearly redistributed, to scale from 0 to 255.
Average optical density per area was determined after pseudocolor
scaling, using an automated imaging program (SuperCue, Galaii, Israel).
Care was taken to keep uniform index of relative expression levels by
comparing scores from the same brain areas in sections at different
rostro-caudal positions, with cortical and hippocampal expression
levels as the most important internal references. We have in subsequent
experiments consistently observed the expression patterns for SRC-1a
and 1e messenger RNA (mRNA) as reported here.
|
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). As we used oligonucleotides
directed at the mouse SRC-1a and 1e (the rat sequence is unknown), we
also hybridized the probes with mouse brain sections. This led to a
hybridization pattern that was identical to that observed in rat tissue
for each coactivator (Fig. 2). Likely mouse and rat sequences are
(nearly) identical in this part of the gene. Thus, the probes allowed
visualization of mRNA specifically encoding SRC-1a, 1e, and 2.
|
and Fig. 3). High intensity of labeling for both
splice variants was observed in hippocampus, piriform cortex,
entorhinal cortex, medial habenula, the subfornical organ, the choriod
plexus, and cerebellar lobes. However, the relative levels of
expression was dramatically different in some areas (Fig. 4 and Table 1). SRC-1a mRNA levels are
very high in paraventricular (PVN), ventromedial nucleus (VMH), and
arcuate nucleus (ARC) of the hypothalamus, whereas SRC-1e mRNA levels
in these areas are very to relatively low. Also in anterior pituitary,
SRC-1a mRNA levels were relatively high, compared with the overall
expression in isocortex, basal ganglia, etc. Other striking differences
in relative abundance are found in midbrain areas. In the locus
coeruleus, both SRC-1a and 1e are expressed, but SRC-1a mRNA levels are
higher, when compared with other reticular nuclei (Figs. 3 and 4). In
parts of the trigeminal nucleus, SRC-1a mRNA levels are very high,
while SRC-1e mRNA levels are much lower. Both in the motor trigeminal
nucleus (Mo5) as well as in the mesencephalic trigeminal nucleus(Me5),
high levels of specific SRC-1a mRNA labeling are observed in the
magnocellular neurons (Figs. 4 and 5), as
is the case for the magnocellular neurons in the pontine reticular core
(not shown). In the caudal shell of the nucleus accumbens (just rostral
of the bed nucleus of the stria terminalis), some of the thalamic,
amygdaloid and brain stem nuclei, both splice variants were presents,
but SRC-1e mRNA was relatively more abundant compared with neighboring
nuclei, although these differences are less pronounced.
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
SRC-1a, 1e, and 2 are highly homologous proteins that specifically
mediate transactivating effects of a wide range of nuclear receptors.
They contain several LXXLL motifs (NR Boxes) that allow interactions
with nuclear receptors, and two activation domains, which serve to
enhance transcription (see Fig. 1, reviewed in Ref. 8). Stimulation of
transcription by the p160 coactivators occurs through interactions with
other nuclear proteins such as CBP/p300 (12, 25, 26), methyl
transferases (27) and possibly direct acetylation of histones (28). The
splice variants SRC-1a and SRC-1e (12) differ only in their C-terminal
part. SRC-1a contains a fourth NR-box, which leads to differences in
interactions with ligand binding domains of certain steroid receptors,
when compared with SRC-1e (15). This may be reflected in different
input (nuclear receptors)-output (downstream coactivators, etc.)
characteristics for SRC-1a and 1e, as has been demonstrated for AR
signaling (29). SRC-1a has also been shown to contain an additional
suppressor domain in its C-terminus, which is active in the context of
ER signaling (14). The present data, which show highly site specific
expression of SRC-1a, 1e, and 2, suggest that, in spite of the high
degree of homology between the functional domains in these proteins,
they have distinct functions in vivo.
SRC-1 mRNA has earlier been shown by multiple tissue Northern blot to
be expressed at high levels in cerebrum, cerebellum and pituitary
total-RNA pools of adult rats (16) and during development (30). We have
extended these data, to show that both splice variants of SRC-1 are
widely expressed throughout the brain. We also find that there are
several differences in relative expression levels in distinct nuclei of
the brain, both for SRC-1a and 1e. In situ hybridization is
a semiquantitative technique—even if the probes that are used are
similar in length, GC content, and radioactive tail-length, it is not
possible to accurately compare absolute mRNA levels for both splice
variants. Kalkhoven et al. have shown by RNase protection on
material from 15 different human tumor cell lines, that the ratio
between SRC-1a and 1e transcripts is typically between 0.5 and 2.5
(14). Our impression from in situ hybridization is, that the
abundance of both transcripts is of the same order for many brain
areas, such as isocortex, caudate putamen, etc. (see Table 1).
Nuclear receptors are expressed widely in the brain, and SRC-1 mRNA expression is high in many areas known to contain steroid receptors. Relatively low expression levels are observed in the lateral septal area, although for example corticosteroid hormones are retained in high concentrations in this area, due to binding to mineralocorticoid and glucocorticoid receptors (5, 31). A speculation that would follow from our results is, that in this area transactivating effects of steroid receptor activation are relatively weak. Transrepression, which occurs by interference with other transcription factors through protein-protein interactions (32) is probably not dependent on the members of the p160 family, and could be the predominant mode of action in areas that do not express high levels of SRCs. It is also possible that another member of the p160 family, SRC-3/ACTR/RAC3/AIB1/TRAM-1 (8, 33) is expressed in the septum and mediates transactivation by nuclear receptors. However, this would also point to differential transmission of steroid signals in this brain area.
The most striking differences between the two splice variants are observed in the hypothalamus and in the motor and mesencephalic trigeminal nuclei, where SRC-1a mRNA is expressed at very high levels, while SRC-1e mRNA is expressed in low to undetectable amounts. The functional relevance of these findings remains as yet unknown. However, the hypothalamic nuclei where these differences occur play a central role in many important endocrine and other physiological processes, such as osmotic regulation, lactation, feeding, reproduction, and regulation of the hypothalamo-pituitary-adrenal axis. As such they are sensitive targets for glucocorticoids and estrogens (34, 35). The motor nucleus of the trigeminus has been reported to contain high levels of AR, but not ER, mRNA (36). Interestingly, SRC-1a interacts much more strongly with the AR LBD compared with SRC-1e (15). The high level of coexpression of SRC-1a (but not 1e) and AR in the trigeminal nuclei suggests in vivo relevance for the differential interactions between members of the nuclear receptor family and SRC-1 splice variants, that have been characterized in vitro (14, 15, 29).
There are many cases of cell-specific regulation of genes by steroid hormones. For example, CRF is down-regulated by corticosterone (37) and stress (38) in PVN, but up-regulated in central amygdala (CeA) and to a lesser extent in the bed nucleus of the stria terminalis (BNST) (39). These differences in glucocorticoid effects coincide with different expression levels of SRC-1 splice variants, with PVN expressing very high levels of SRC-1a, CeA being relatively enriched with SRC-1e, and BNST showing relatively modest expression of both forms of SRC-1. We speculate that such differences of coactivator expression could play a role in determining the cell specificity of steroid action. Further functional studies on promoters of steroid receptor target genes that are expressed in these nuclei are necessary to more fully interpret the differential expression patterns of the coactivators.
SRC-2 (GRIP-1/TIF2) mRNA was detected only in the anterior pituitary, and not in brain. Previously, in total brain RNA in mouse a low amount of SRC-2 mRNA was detected (19), which became up-regulated in SRC-1 knockout animals. Apparently, the abundance of SRC-2 mRNA in rat brain is too low to be detectable by end-labeled oligonucleotides. Based on the abundance of their respective mRNAs, SRC-1 splice variants seem to be the more important representatives of the p160 family of coactivators in the brain.
Interestingly, it has been shown that SRC-1 mRNA in pituitary is subject to strong hormonal regulation, and, perhaps as a consequence, this coactivator is expressed at higher levels in pituitaries of male compared with female rats (16). It is unknown whether similar hormonal regulation takes place in the brain, and whether endocrine status can also effect the ratio of SRC-1a to SRC-1e mRNAs. Hormonal regulation of coactivator expression would constitute a means to induce cellular hyper or hyposensitivity for certain steroid hormones.
In conclusion, we show that mRNA of the SRC-1a and SRC-1e is highly expressed in the rat brain. The differential and uneven neuroanatomical distribution of SRC-1a and 1e suggest functional diversity of these splice variants. Differential expression of the splice variants may underlie some of the cell-specific effects of many steroid hormones. Regulation of expression levels of these proteins by hormones or other stimuli may lead to local or generalized changes in sensitivity in the brain for many steroid hormones and vitamins.
|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received November 12, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  S. Lachize, E. M. Apostolakis, S. van der Laan, A. M. I. Tijssen, J. Xu, E. R. de Kloet, and O. C. Meijer Steroid receptor coactivator-1 is necessary for regulation of corticotropin-releasing hormone by chronic stress and glucocorticoids PNAS, May 12, 2009; 106(19): 8038 - 8042. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. A. Molenda-Figueira, S. D. Murphy, K. L. Shea, N. K. Siegal, Y. Zhao, J. G. Chadwick Jr., L. A. Denner, and M. J. Tetel Steroid Receptor Coactivator-1 from Brain Physically Interacts Differentially with Steroid Receptor Subtypes Endocrinology, October 1, 2008; 149(10): 5272 - 5279. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Abildayeva, J. F. P. Berbee, A. Blokland, P. J. Jansen, F. J. Hoek, O. Meijer, D. Lutjohann, T. Gautier, T. Pillot, J. De Vente, et al. Human apolipoprotein C-I expression in mice impairs learning and memory functions J. Lipid Res., April 1, 2008; 49(4): 856 - 869. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. van der Laan, S. B. Lachize, E. Vreugdenhil, E. R. de Kloet, and O. C. Meijer Nuclear Receptor Coregulators Differentially Modulate Induction and Glucocorticoid Receptor-Mediated Repression of the Corticotropin-Releasing Hormone Gene Endocrinology, February 1, 2008; 149(2): 725 - 732. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-W. Jeong, K. Y. Lee, S. J. Han, B. J. Aronow, J. P. Lydon, B. W. O'Malley, and F. J. DeMayo The p160 Steroid Receptor Coactivator 2, SRC-2, Regulates Murine Endometrial Function and Regulates Progesterone-Independent and -Dependent Gene Expression Endocrinology, September 1, 2007; 148(9): 4238 - 4250. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Berthiaume, M. Laplante, W. Festuccia, Y. Gelinas, S. Poulin, J. Lalonde, D. R. Joanisse, R. Thieringer, and Y. Deshaies Depot-Specific Modulation of Rat Intraabdominal Adipose Tissue Lipid Metabolism by Pharmacological Inhibition of 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Endocrinology, May 1, 2007; 148(5): 2391 - 2397. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. V. Patchev, D. Fischer, S. S. Wolf, M. Herkenham, F. Gotz, M. Gehin, P. Chambon, V. K. Patchev, and O. F. X. Almeida Insidious adrenocortical insufficiency underlies neuroendocrine dysregulation in TIF-2 deficient mice FASEB J, January 1, 2007; 21(1): 231 - 238. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Yoshida, Y. Iwasaki, M. Asai, S. Takayasu, T. Taguchi, K. Itoi, K. Hashimoto, and Y. Oiso Identification of a Functional AP1 Element in the Rat Vasopressin Gene Promoter Endocrinology, June 1, 2006; 147(6): 2850 - 2863. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-W. Jeong, I. Kwak, K. Y. Lee, L. D. White, X.-P. Wang, F. C. Brunicardi, B. W. O'Malley, and F. J. DeMayo The Genomic Analysis of the Impact of Steroid Receptor Coactivators Ablation on Hepatic Metabolism Mol. Endocrinol., May 1, 2006; 20(5): 1138 - 1152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Nishi and M. Kawata Brain Corticosteroid Receptor Dynamics and Trafficking: Implications from Live Cell Imaging Neuroscientist, April 1, 2006; 12(2): 119 - 133. [Abstract] [PDF]
|
|
|
|
 |
|
 A. Kapoor, E. Dunn, A. Kostaki, M. H. Andrews, and S. G. Matthews Fetal programming of hypothalamo-pituitary-adrenal function: prenatal stress and glucocorticoids J. Physiol., April 1, 2006; 572(1): 31 - 44. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. N. Winnay, J. Xu, B. W. O'Malley, and G. D. Hammer Steroid Receptor Coactivator-1-Deficient Mice Exhibit Altered Hypothalamic-Pituitary-Adrenal Axis Function Endocrinology, March 1, 2006; 147(3): 1322 - 1332. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Grenier, A. Trousson, A. Chauchereau, J. Cartaud, M. Schumacher, and C. Massaad Differential Recruitment of p160 Coactivators by Glucocorticoid Receptor between Schwann Cells and Astrocytes Mol. Endocrinol., February 1, 2006; 20(2): 254 - 267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Karssen, O. C. Meijer, A. Berry, R. Sanjuan Pinol, and E. R. de Kloet Low Doses of Dexamethasone Can Produce a Hypocorticosteroid State in the Brain Endocrinology, December 1, 2005; 146(12): 5587 - 5595. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Hultman, N. V. Krasnoperova, S. Li, S. Du, C. Xia, J. D. Dietz, D. S. Lala, D. J. Welsch, and X. Hu The Ligand-Dependent Interaction of Mineralocorticoid Receptor with Coactivator and Corepressor Peptides Suggests Multiple Activation Mechanisms Mol. Endocrinol., June 1, 2005; 19(6): 1460 - 1473. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. C. Meijer, B. Topic, P. J. Steenbergen, G. Jocham, J. P. Huston, and M. S. Oitzl Correlations between Hypothalamus-Pituitary-Adrenal Axis Parameters Depend on Age and Learning Capacity Endocrinology, March 1, 2005; 146(3): 1372 - 1381. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. C. Meijer, E. Kalkhoven, S. van der Laan, P. J. Steenbergen, S. H. Houtman, T. F. Dijkmans, D. Pearce, and E. R. de Kloet Steroid Receptor Coactivator-1 Splice Variants Differentially Affect Corticosteroid Receptor Signaling Endocrinology, March 1, 2005; 146(3): 1438 - 1448. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. D. Charlier, G. F. Ball, and J. Balthazart Inhibition of Steroid Receptor Coactivator-1 Blocks Estrogen and Androgen Action on Male Sex Behavior and Associated Brain Plasticity J. Neurosci., January 26, 2005; 25(4): 906 - 913. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Grenier, A. Trousson, A. Chauchereau, L. Amazit, A. Lamirand, P. Leclerc, A. Guiochon-Mantel, M. Schumacher, and C. Massaad Selective Recruitment of p160 Coactivators on Glucocorticoid-Regulated Promoters in Schwann Cells Mol. Endocrinol., December 1, 2004; 18(12): 2866 - 2879. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Setiawan, D. Owen, L. McCabe, A. Kostaki, M. H. Andrews, and S. G. Matthews Glucocorticoids Do Not Alter Developmental Expression of Hippocampal or Pituitary Steroid Receptor Coactivator-1 and -2 in the Late Gestation Fetal Guinea Pig Endocrinology, August 1, 2004; 145(8): 3796 - 3803. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mark, H. Yoshida-Komiya, M. Gehin, L. Liao, M.-J. Tsai, B. W. O'Malley, P. Chambon, and J. Xu Partially redundant functions of SRC-1 and TIF2 in postnatal survival and male reproduction PNAS, March 30, 2004; 101(13): 4453 - 4458. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Obradovic, M. Tirard, Zs. Nemethy, O. Hirsch, H. Gronemeyer, and O. F. X. Almeida DAXX, FLASH, and FAF-1 Modulate Mineralocorticoid and Glucocorticoid Receptor-Mediated Transcription in Hippocampal Cells--Toward a Basis for the Opposite Actions Elicited by Two Nuclear Receptors? Mol. Pharmacol., March 1, 2004; 65(3): 761 - 769. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-F. Mouillet, C. Sonnenberg-Hirche, X. Yan, and Y. Sadovsky p300 Regulates the Synergy of Steroidogenic Factor-1 and Early Growth Response-1 in Activating Luteinizing Hormone-{beta} Subunit Gene J. Biol. Chem., February 27, 2004; 279(9): 7832 - 7839. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. A. Molenda, C. P. Kilts, R. L. Allen, and M. J. Tetel Nuclear Receptor Coactivator Function in Reproductive Physiology and Behavior Biol Reprod, November 1, 2003; 69(5): 1449 - 1457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Pal and A. Sahu Leptin Signaling in the Hypothalamus during Chronic Central Leptin Infusion Endocrinology, September 1, 2003; 144(9): 3789 - 3798. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. L. Rincavage, D. P. McDonnell, and C. M. Kuhn Expression of Functional Estrogen Receptor {beta} in Locus Coeruleus-Derived Cath.a Cells Endocrinology, July 1, 2003; 144(7): 2829 - 2835. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. M. Sadow, E. Koo, O. Chassande, K. Gauthier, J. Samarut, J. Xu, B. W. O'Malley, H. Seo, Y. Murata, and R. E. Weiss Thyroid Hormone Receptor-Specific Interactions with Steroid Receptor Coactivator-1 in the Pituitary Mol. Endocrinol., May 1, 2003; 17(5): 882 - 894. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Nishihara, H. Yoshida-Komiya, C.-S. Chan, L. Liao, R. L. Davis, B. W. O'Malley, and J. Xu SRC-1 Null Mice Exhibit Moderate Motor Dysfunction and Delayed Development of Cerebellar Purkinje Cells J. Neurosci., January 1, 2003; 23(1): 213 - 222. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. P. Auger, T. S. Perrot-Sinal, C. J. Auger, L. A. Ekas, M. J. Tetel, and M. M. MCCarthy Expression of the Nuclear Receptor Coactivator, cAMP Response Element-Binding Protein, Is Sexually Dimorphic and Modulates Sexual Differentiation of Neonatal Rat Brain Endocrinology, August 1, 2002; 143(8): 3009 - 3016. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Apostolakis, M. Ramamurphy, D. Zhou, S. Onate, and B. W. O'Malley Acute Disruption of Select Steroid Receptor Coactivators Prevents Reproductive Behavior in Rats and Unmasks Genetic Adaptation in Knockout Mice Mol. Endocrinol., July 1, 2002; 16(7): 1511 - 1523. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Guissouma, S. M. Dupre, N. Becker, E. Jeannin, I. Seugnet, B. Desvergne, and B. A. Demeneix Feedback on Hypothalamic TRH Transcription Is Dependent on Thyroid Hormone Receptor N Terminus Mol. Endocrinol., July 1, 2002; 16(7): 1652 - 1666. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. A. Molenda, A. L. Griffin, A. P. Auger, M. M. McCarthy, and M. J. Tetel Nuclear Receptor Coactivators Modulate Hormone-Dependent Gene Expression in Brain and Female Reproductive Behavior in Rats Endocrinology, February 1, 2002; 143(2): 436 - 444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Bramlett, Y. Wu, and T. P. Burris Ligands Specify Coactivator Nuclear Receptor (NR) Box Affinity for Estrogen Receptor Subtypes Mol. Endocrinol., June 1, 2001; 15(6): 909 - 922. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
