help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meijer, O. C.
Right arrow Articles by de Kloet, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meijer, O. C.
Right arrow Articles by de Kloet, E. R.
Endocrinology Vol. 141, No. 6 2192-2199
Copyright © 2000 by The Endocrine Society


ARTICLES

Differential Expression and Regional Distribution of Steroid Receptor Coactivators SRC-1 and SRC-2 in Brain and Pituitary1

O. C. Meijer, P. J. Steenbergen and E. R. de Kloet

Division of Medical Pharmacology, Leiden/Amsterdam Center for Drug Research, 2300 RA Leiden, The Netherlands

Address all correspondence and requests for reprints to: O. C. Meijer, Division of Medical Pharmacology, Leiden/Amsterdam Center for Drug Research, P.O. Box 9503, 2300 RA Leiden, The Netherlands. E-mail: o.meijer{at}lacdr.leidenuniv.nl


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Members of the p160 family of steroid receptor coactivator proteins mediate the stimulatory effects on gene transcription brought about by nuclear receptors, which comprise all steroid receptors. Using in situ hybridization we have examined the neuroanatomical distribution of the messenger RNAs (mRNAs) for two functionally distinct splice variants of Steroid Receptor Coactivator 1 (SRC-1/NCoA-1) and of Steroid Receptor Coactivator 2 (SRC-2/NCoA-2/GRIP-1/TIF-2). Transcripts encoding these coactivators show highly differential expression patterns. SRC-2 mRNA is expressed at very low levels in brain, but shows expression in the anterior pituitary. SRC-1a and 1e mRNA are expressed in many brain areas, including hippocampus, amygdala, hypothalamus, basal ganglia, and isocortex. Striking differences between SRC-1a and 1e expression were observed in several brain nuclei. Relative levels of SRC-1a mRNA were much higher in anterior pituitary, and the arcuate, paraventricular and ventromedial nucleus of the hypothalamus, the locus coeruleus and the trigeminal motor nucleus, all important targets of steroid hormones in the brain. SRC-1e mRNA showed modest elevation of relative expression in the caudal nucleus accumbens (shell), basolateral amygdala, and some thalamic nuclei. The differential and uneven neuroanatomical distribution of these coactivators may underlie diversity and cell-specificity of steroid receptor mediated signals in the brain.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE HORMONAL signals that are mediated by members of the nuclear receptor family are important for both the developing and adult nervous system. This family consists of type I receptors [estrogen receptor (ER), progesterone receptor (PR), androgen receptor (AR), mineralocorticoid receptor (MR), and glucocorticoid receptor (GR)], type II receptors [thyroid hormone receptor (TR), retinoic acid receptor (RAR), vitamin D receptor (VDR)], as well as a number of orphan receptors (1). Many of these receptor types are expressed throughout the brain, but with a high degree of regional specificity (e.g. Refs. 2, 3, 4, 5). The hormone receptors act as ligand-activated transcription factors; in many cases the activated receptors bind to hormone response elements (HREs) on the DNA and stimulate transcription of target genes (6).

The magnitude of the transcriptional activation of a given gene depends on receptor availability and ligand concentration. However, it has become clear that factors downstream of the DNA-bound steroid receptor are important determinants of the extent of transactivation caused by this type of receptors. Several proteins that potentiate the activity of nuclear receptors by acting as coactivators of transcription have recently been characterized (reviewed in Refs. 7, 8). While some of these proteins function as coactivators for many different transcription factors, the effects of the members of the p160 family or steroid receptor coactivators (SRCs) seem to be restricted to (and essential for) the nuclear receptor family (9, 10).

Steroid receptor coactivator-1 (SRC-1 or NCoA-1) stimulates transcriptional activity of many members of the nuclear receptor family (11) but not the transcriptional activity of other transcription factors tested (9, 11). Of the several splice variants of SRC-1 that have been described, SRC-1e has a shorter C-terminus than the originally described SRC-1a protein and lacks one nuclear receptor-interacting domain (the so-called NR box IV, see Fig. 1Go and Refs. 12, 13, 14). ER-mediated transcription-stimulation is differentially affected by SRC-1a and 1e in a promoter-dependent manner: overexpressed SRC1a in some cases fails to potentiate ER-mediated transcriptional stimulation, whereas SRC-1e potently stimulates transcription from EREs in all cases tested (14). In addition, in yeast two-hybrid experiments these splice variants have differential interactions with the ligand binding domains (LBD) of steroid receptors. SRC-1e was reported to interact poorly with AR and GR LBD in the presence of ligand, while ER,TR, RAR, and VDR LBDs preferred SRC-1e over SRC-1a (15). Interestingly, SRC-1 levels not only determine hormonal responses, but also appear to be subject to hormonal regulation themselves: thyroid hormone and estrogens can up- respectively down-regulate SRC-1 mRNA levels in pituitary (16).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. Diagrams of SRC-1 and 2 structure and oligonucleotides that were used. A, mSRC-1 and rSRC-2 protein are highly homologous. Both interact with nuclear receptors through LXXLL motifs that are depicted as NR boxes. SRC-1a contains 1 additional NR box in its C-terminal. Upstream targets are activated through two activation domains, AD1 and 2. Despite the high homology, the three proteins have specific characteristics. Amino acid numbers of the different domains are depicted. Drawn after (29 ). B. mRNA of SRC-1a (top) and SRC-1e (bottom) differ only in a 55 nucleotide exon (in capitals). The oligonucleotide to visualize SRC-1e mRNA is complementary to the specific sequence indicated by the dashed line. The oligonucleotide used to visualize SRC-1a mRNA is targeted to the sequences adjacent to the SRC-1e specific exon, which is continuous in SRC-1a mRNA (bold solid line). As a control for specificity of the SRC-1a oligo, a 22-mer that is complementary to sequence present in both mRNA species was used (thin solid line). No signal was observed with the control oligo.

 
Steroid receptor coactivator 2 (GRIP-1/NCoA-2/TIF2) is highly homologous to SRC-1 (17, 18). This coactivator can also mediate transcriptional activation of members of the steroid receptor superfamily. In knock-out mice for SRC-1, SRC-2 is up-regulated in some steroid target tissues and presumably compensates to some extent for the loss of SRC-1 (19). However, SRC-1 and SRC-2 are not completely functionally redundant, as these knockout mice show a clear phenotype, which includes thyroid hormone resistance (19, 20).

The distribution of SRC-1 and -2 in different regions of the brain is not known, although these proteins are likely to be important determinants of steroid signals to the brain. In the absence of members of the p160 family of coactivators, significant transactivation is unlikely to occur. Differential expression of SRC-1a and 1e in steroid target nuclei in the brain may cause differences in the potency of effects mediated by different types of steroid receptors. Finally, local regulation of expression levels of coactivators may lead to local changes in steroid sensitivity. We therefore decided to measure expression levels of SRC-1a, 1e and 2 mRNA in brain and pituitary by in situ hybridization. We find expression patterns that are specific for each coactivator, suggesting different roles for these three proteins and differences in regional sensitivity for steroid signaling in the brain.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and tissue preparation
We used male sexually mature Wistar rats weighing 200 g (Charles River Laboratories, Inc., Sulzfeld, Germany), that were group housed, had free access to water and lab chow, and were kept on a 12-h light, 12-h dark cycle (lights on at 0800 h). The rats were decapitated in the morning and the brains and pituitaries were frozen in isopentane cooled in a ethanol-dry ice bath and on dry ice, respectively, and stored at -80 C. Twenty-micrometer (brain) or 12 µm (pituitary) sections were cut on a cryostat (Reichert-Jung Frigocut 2800), and thaw-mounted on poly-L-lysine (Sigma) coated slides, and stored at -80 C for approximately 1 week. The sections were then fixed for 30 min in 4% para-formaldehyde in PBS (pH 7.4), rinsed twice in PBS, acetylated in triethanolamine (0.1 M, pH 8.0) with 0.25% acetic anhydride for 10 min, rinsed for 10 min in 2 x SSC (150 mM sodium chloride, 15 mM sodium citrate), dehydrated in an ethanol series, delipidated in chlorophorm (1 min), air dried and stored at room temperature until the hybridization.

Oligonuceotide probes
The mRNA splice variants SRC-1a and 1e differ only in a 55 nucleotides long exon which is present in SRC1e mRNA (12). Therefore, to distinguish expression of the two mRNAs, it is necessary to use end-labeled oligonucleotide probes. To visualize mRNAs, oligonucleotides were end-labeled with {alpha}-33P dATP (NEN Life Science Products, Hoofddorp, The Netherlands, 2000 Ci/mmol, 10 mCi/ml) using terminal transferase with the manufacturer’s protocol (Roche Molecular Biochemicals, Almere, The Netherlands). A 0.5-nmol oligonucleotide was labeled at molar ratio of 1:10 (oligo:label). Incorporation was typically between 50 and 75%, resulting in a tail of 5 to 7.5 A-residues per oligonucleotide.

For SRC-1a a 44-mer oligonucleotide was used that spanned the region around the exon specific for SRC-1e, i.e. complementary to nucleotides 4167–4210 of GenBank entry U64606 for mouse SRC-1a: 5' acacctgaacctgctgcacctgctggtttccatctgcgtctgtt (see Fig. 1Go). This sequence contains three mismatches with the corresponding part of the human mRNA (93% identity); likely the rat sequence is even more homologous. To control for specificity of hybridization, we used an oligonucleotide that was identical but for 7 mismatches (transversions), evenly spaced at every 6 nucleotides: 5' aAacctgCacctgAtgcacAtgctgTtttccCtctgcTtctgtG. As an alternative control we used a 22-mer that is identical to the most 5' half of the SCR-1a oligonucleotide: 5' acacctgaacctgctgcacctg. This sequence is present in both SRC-1a and 1e mRNA, and serves as a negative control for binding of the SRC-1a oligo to SRC-1e mRNA.

SRC-1e mRNA was measured with the 44-mer 5' gagctcctctagtctgtagtcaccacagagaagaactcttctgt, the reverse complement of nucleotides 4453–4496 of the GenBank entry U56920 for mouse SRC-1e. This is part of the exon specific for SRC-1e; nucleotides 4444–4495 are identical in the mouse and human gene, which makes identity to the (unpublished) rat sequence highly likely. The control oligonucleotide with mismatches was: 5'gCgctccGctagtAtgtagGcaccaAagagaCgaactAttctTt. Total SRC-1 mRNA was measured with the 44 mer 5' ctccggtaaaagccggtgcagaattttatgccgctcagtcagaga, the reverse complement to nucleotides 2071–2115 of mSRC-1a, that codes for the second NR-box which is present and identical in both splice variants.

For SRC-2 (GRIP-1/TIF2) we used the 44-mer: 5' ctataatcccatgcaagatccaaacttccacaccatgggacagcg, corresponding to nucleotides 3441–3485 of the rat gene [GenBank entry AF136943 (21)]. The control oligo was: 5' ctaGaatcccaAtgcaCgatccCcaacttAcacAatgggCcagcg.

In situ hybridization
In situ hybridization was performed essentially as described in (22). 1 x 106 dpm of labeled oligonucleotide per 100 µl hybridization mix were applied to each slide. Hybridization mix consisted of 50% formamide, 10% dextran sulfate, 4 x SSC, 25 mM sodium phosphate (pH 7.0), 1 mM Na pyrophosphate, 20 mM DTT, 5 x Denhardt’s, 100 µg/ml poly-A, 100 µg/ml sheared salmon sperm DNA. Sections were coverslipped and hybridized overnight in a moist chamber at 42 C. The next morning, coverslips were removed, rinsed in 1 x SSC at room temperature, washed twice for 30 min in 1 x SSC at 50 C, washed for 5 min in 1 x SSC at room temperature, dehydrated in an ethanol series, air dried and apposed to Kodak (Rochester, NY) X-Omat AR film for 2–4 weeks. After development of the films, some of the sections were also dipped in photographic emulsion (Ilford), exposed for 2–6 weeks, developed and counter-stained with 0.5% cresyl violet.

Analysis
Expression patterns were determined from film and dipped sections using the Paxinos & Watson, and the Swanson rat brain atlases (23, 24). Relative levels of expression presented here (Table 1Go) were determined from film in a complete series of frontal sections of 1 animal. Gray levels from each section on film were linearly redistributed, to scale from 0 to 255. Average optical density per area was determined after pseudocolor scaling, using an automated imaging program (SuperCue, Galaii, Israel). Care was taken to keep uniform index of relative expression levels by comparing scores from the same brain areas in sections at different rostro-caudal positions, with cortical and hippocampal expression levels as the most important internal references. We have in subsequent experiments consistently observed the expression patterns for SRC-1a and 1e messenger RNA (mRNA) as reported here.


View this table:
[in this window]
[in a new window]
 
Table 1. Regional distribution of SRC-1a, SRC-1e and SRC-2 in pituitary and brain

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Specificity of the probes and general expression patterns
The in situ hybridization with probes for SRC-1a, 1e, and 2 all resulted in specific signal in the anterior pituitary. In the brain, only SRC-1a and 1e probes gave strong signals, but SRC-2 mRNA was not detectable. Specificity of the probes was shown in different ways. The presence of 100-fold excess cold oligonucleotide effectively competed with the labeled oligonucleotide. Neither the labeled mismatch-oligonucleotides nor the labeled 22-mer that was directed at a common part of SRC-1a and 1e mRNA resulted in any signal, except for a very faint labeling of cerebellar lobes upon long exposure (Fig. 2Go). As we used oligonucleotides directed at the mouse SRC-1a and 1e (the rat sequence is unknown), we also hybridized the probes with mouse brain sections. This led to a hybridization pattern that was identical to that observed in rat tissue for each coactivator (Fig. 2Go). Likely mouse and rat sequences are (nearly) identical in this part of the gene. Thus, the probes allowed visualization of mRNA specifically encoding SRC-1a, 1e, and 2.



View larger version (131K):
[in this window]
[in a new window]
 
Figure 2. Specificity of hybridization with 33P labeled 44-mer oligonucleotides. A, Hybridization of a horizontal section of rat brain with a 44-mer directed at SRC-1a mRNA. B. Hybridization with a probe that contained 7 mismatches (see Materials and Methods) does not give any signal, indicating specificity for SRC-1a of the probe shown in A. C, Hybridization of a horizontal section of mouse brain leads to a very similar signal as observed in rat. D, Hybridization of the labeled SRC-1a probe does not occur in the presence of 100-fold excess cold oligonucleotide.

 
Specific expression patterns of SRC-1a and 1e in the brain
The use of SRC-1a and 1e oligonucleotides with approximately the same length of 33P labeled polyA tail, resulted in similar overall intensity of signal in the brain. Both splice variants are expressed in numerous brain nuclei (Table 1Go and Fig. 3Go). High intensity of labeling for both splice variants was observed in hippocampus, piriform cortex, entorhinal cortex, medial habenula, the subfornical organ, the choriod plexus, and cerebellar lobes. However, the relative levels of expression was dramatically different in some areas (Fig. 4Go and Table 1Go). SRC-1a mRNA levels are very high in paraventricular (PVN), ventromedial nucleus (VMH), and arcuate nucleus (ARC) of the hypothalamus, whereas SRC-1e mRNA levels in these areas are very to relatively low. Also in anterior pituitary, SRC-1a mRNA levels were relatively high, compared with the overall expression in isocortex, basal ganglia, etc. Other striking differences in relative abundance are found in midbrain areas. In the locus coeruleus, both SRC-1a and 1e are expressed, but SRC-1a mRNA levels are higher, when compared with other reticular nuclei (Figs. 3Go and 4Go). In parts of the trigeminal nucleus, SRC-1a mRNA levels are very high, while SRC-1e mRNA levels are much lower. Both in the motor trigeminal nucleus (Mo5) as well as in the mesencephalic trigeminal nucleus(Me5), high levels of specific SRC-1a mRNA labeling are observed in the magnocellular neurons (Figs. 4Go and 5Go), as is the case for the magnocellular neurons in the pontine reticular core (not shown). In the caudal shell of the nucleus accumbens (just rostral of the bed nucleus of the stria terminalis), some of the thalamic, amygdaloid and brain stem nuclei, both splice variants were presents, but SRC-1e mRNA was relatively more abundant compared with neighboring nuclei, although these differences are less pronounced.



View larger version (147K):
[in this window]
[in a new window]
 
Figure 3. Expression of SRC-1a mRNA in a series of frontal sections of the rat brain. Arc, Arcuate nucleus; Amy, amygdala complex; ChP, choroid plexus; DRN, dorsal raphe nucleus; HC, hippocampus; LC, locus coeruleus; LS, lateral septum; Me 5, mesencephalic trigeminal nucleus; Mo 5, motor nucleus of the trigeminus; MH, medial habenula; nAcc, nucleus accumbens (shell); PBN, parabrachial nucleus; PC, piriform cortex; POA, preoptic area; PVN, paraventricular nucleus of the hypothalamus; SNc, pars compacta of the substantia nigra, SON, supraoptic nucleus, VMN, ventromedial nucleus; ZI, zona incerta.

 


View larger version (147K):
[in this window]
[in a new window]
 
Figure 4. SRC-1a (A and B) and SRC-1e (C and D) show substantial differences in relative expression levels in certain brain areas. The most striking differences are very high levels of SRC-1a expression combined with low to very low SRC-1e expression in the motor trigeminal nucleus (horizontal sections A and C) and the hypothalamic PVN, VMN and arcuate nucleus (frontal sections B and D).

 


View larger version (110K):
[in this window]
[in a new window]
 
Figure 5. Higher resolution of the SRC-1a signal from sections dipped in photographic emulsion. A, Dense labeling of magnocellular neurons of the mesencephalic trigeminal nucleus (Me5) and neurons of the locus coeruleus. B, Dense labeling over magnocellular neurons of the motor nucleus of the trigeminus (Mo 5 in Fig. 3Go).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have mapped expression profiles in the brain of three members of the p160 SRC family of coactivators. We find that SRC-2 (GRIP-1/TIF-1) mRNA is expressed mainly in anterior pituitary, whereas SRC-1a and 1e are found throughout the brain. In some nuclei there is a pronounced difference in relative expression levels of SRC-1a and 1e, which suggests different functions of the splice variants and local differences in the steroid-receptor mediated signaling in these areas.

SRC-1a, 1e, and 2 are highly homologous proteins that specifically mediate transactivating effects of a wide range of nuclear receptors. They contain several LXXLL motifs (NR Boxes) that allow interactions with nuclear receptors, and two activation domains, which serve to enhance transcription (see Fig. 1Go, reviewed in Ref. 8). Stimulation of transcription by the p160 coactivators occurs through interactions with other nuclear proteins such as CBP/p300 (12, 25, 26), methyl transferases (27) and possibly direct acetylation of histones (28). The splice variants SRC-1a and SRC-1e (12) differ only in their C-terminal part. SRC-1a contains a fourth NR-box, which leads to differences in interactions with ligand binding domains of certain steroid receptors, when compared with SRC-1e (15). This may be reflected in different input (nuclear receptors)-output (downstream coactivators, etc.) characteristics for SRC-1a and 1e, as has been demonstrated for AR signaling (29). SRC-1a has also been shown to contain an additional suppressor domain in its C-terminus, which is active in the context of ER signaling (14). The present data, which show highly site specific expression of SRC-1a, 1e, and 2, suggest that, in spite of the high degree of homology between the functional domains in these proteins, they have distinct functions in vivo.

SRC-1 mRNA has earlier been shown by multiple tissue Northern blot to be expressed at high levels in cerebrum, cerebellum and pituitary total-RNA pools of adult rats (16) and during development (30). We have extended these data, to show that both splice variants of SRC-1 are widely expressed throughout the brain. We also find that there are several differences in relative expression levels in distinct nuclei of the brain, both for SRC-1a and 1e. In situ hybridization is a semiquantitative technique—even if the probes that are used are similar in length, GC content, and radioactive tail-length, it is not possible to accurately compare absolute mRNA levels for both splice variants. Kalkhoven et al. have shown by RNase protection on material from 15 different human tumor cell lines, that the ratio between SRC-1a and 1e transcripts is typically between 0.5 and 2.5 (14). Our impression from in situ hybridization is, that the abundance of both transcripts is of the same order for many brain areas, such as isocortex, caudate putamen, etc. (see Table 1Go).

Nuclear receptors are expressed widely in the brain, and SRC-1 mRNA expression is high in many areas known to contain steroid receptors. Relatively low expression levels are observed in the lateral septal area, although for example corticosteroid hormones are retained in high concentrations in this area, due to binding to mineralocorticoid and glucocorticoid receptors (5, 31). A speculation that would follow from our results is, that in this area transactivating effects of steroid receptor activation are relatively weak. Transrepression, which occurs by interference with other transcription factors through protein-protein interactions (32) is probably not dependent on the members of the p160 family, and could be the predominant mode of action in areas that do not express high levels of SRCs. It is also possible that another member of the p160 family, SRC-3/ACTR/RAC3/AIB1/TRAM-1 (8, 33) is expressed in the septum and mediates transactivation by nuclear receptors. However, this would also point to differential transmission of steroid signals in this brain area.

The most striking differences between the two splice variants are observed in the hypothalamus and in the motor and mesencephalic trigeminal nuclei, where SRC-1a mRNA is expressed at very high levels, while SRC-1e mRNA is expressed in low to undetectable amounts. The functional relevance of these findings remains as yet unknown. However, the hypothalamic nuclei where these differences occur play a central role in many important endocrine and other physiological processes, such as osmotic regulation, lactation, feeding, reproduction, and regulation of the hypothalamo-pituitary-adrenal axis. As such they are sensitive targets for glucocorticoids and estrogens (34, 35). The motor nucleus of the trigeminus has been reported to contain high levels of AR, but not ER, mRNA (36). Interestingly, SRC-1a interacts much more strongly with the AR LBD compared with SRC-1e (15). The high level of coexpression of SRC-1a (but not 1e) and AR in the trigeminal nuclei suggests in vivo relevance for the differential interactions between members of the nuclear receptor family and SRC-1 splice variants, that have been characterized in vitro (14, 15, 29).

There are many cases of cell-specific regulation of genes by steroid hormones. For example, CRF is down-regulated by corticosterone (37) and stress (38) in PVN, but up-regulated in central amygdala (CeA) and to a lesser extent in the bed nucleus of the stria terminalis (BNST) (39). These differences in glucocorticoid effects coincide with different expression levels of SRC-1 splice variants, with PVN expressing very high levels of SRC-1a, CeA being relatively enriched with SRC-1e, and BNST showing relatively modest expression of both forms of SRC-1. We speculate that such differences of coactivator expression could play a role in determining the cell specificity of steroid action. Further functional studies on promoters of steroid receptor target genes that are expressed in these nuclei are necessary to more fully interpret the differential expression patterns of the coactivators.

SRC-2 (GRIP-1/TIF2) mRNA was detected only in the anterior pituitary, and not in brain. Previously, in total brain RNA in mouse a low amount of SRC-2 mRNA was detected (19), which became up-regulated in SRC-1 knockout animals. Apparently, the abundance of SRC-2 mRNA in rat brain is too low to be detectable by end-labeled oligonucleotides. Based on the abundance of their respective mRNAs, SRC-1 splice variants seem to be the more important representatives of the p160 family of coactivators in the brain.

Interestingly, it has been shown that SRC-1 mRNA in pituitary is subject to strong hormonal regulation, and, perhaps as a consequence, this coactivator is expressed at higher levels in pituitaries of male compared with female rats (16). It is unknown whether similar hormonal regulation takes place in the brain, and whether endocrine status can also effect the ratio of SRC-1a to SRC-1e mRNAs. Hormonal regulation of coactivator expression would constitute a means to induce cellular hyper or hyposensitivity for certain steroid hormones.

In conclusion, we show that mRNA of the SRC-1a and SRC-1e is highly expressed in the rat brain. The differential and uneven neuroanatomical distribution of SRC-1a and 1e suggest functional diversity of these splice variants. Differential expression of the splice variants may underlie some of the cell-specific effects of many steroid hormones. Regulation of expression levels of these proteins by hormones or other stimuli may lead to local or generalized changes in sensitivity in the brain for many steroid hormones and vitamins.


View this table:
[in this window]
[in a new window]
 
Table 2.

 

    Acknowledgments
 
We thank Alan Chu for technical advice and Dr. Eric Kalkhoven for critical reading of the manuscript.


    Footnotes
 
1 This work was supported by an NDRF grant from The Netherlands Organization for Scientific Research (NWO). Back

Received November 12, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Beato M, Herrlich P, Schutz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 83:851–857[CrossRef][Medline]
  2. Zetterstrom RH, Lindqvist E, de Urquiza AM, Tomac A, Eriksson U, Perlmann T, Olson L 1999 Role of retinoids in the CNS: differential expression of retinoid binding proteins and receptors and evidence for presence of retinoic acid. Eur J Neurosci 11:407–416[CrossRef][Medline]
  3. McAbee MD, DonCarlos LL 1998 Ontogeny of region-specific sex differences in androgen receptor messenger ribonucleic acid expression in the rat forebrain. Endocrinology 139:1738–1745[Abstract/Free Full Text]
  4. Shughrue PJ, Lane MV, Merchenthaler I 1999 Biologically active estrogen receptor-beta: evidence from in vivo autoradiographic studies with estrogen receptor alpha-knockout mice. Endocrinology 140:2613–2620[Abstract/Free Full Text]
  5. Reul JMHM, De Kloet ER 1985 Two receptor systems for corticosterone in rat brain: microdistribution and differential occupation. Endocrinology 117:2505–2511[Abstract/Free Full Text]
  6. Truss M, Beato M 1993 Steroid hormone receptors: interaction with deoxyribonucleic acis and transcription factors. Endocr Rev 14:459–479[Abstract/Free Full Text]
  7. Torchia J, Glass C, Rosenfeld MG 1998 Co-activators and co-repressors in the integration of transcriptional responses. Curr Opin Cell Biol 10:373–383[CrossRef][Medline]
  8. McKenna NJ, Lanz RB, O’Malley BW 1999 Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20:321–344[Abstract/Free Full Text]
  9. Korzus E, Torchia J, Rose DW, Xu L, Kurokawa R, McInerney EM, Mullen TM, Glass CK, Rosenfeld MG 1998 Transcription factor-specific requirements for coactivators and their acetyltransferase functions. Science 279:703–707[Abstract/Free Full Text]
  10. Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG 1997 The transcriptional co-activator p/CIP binds CBP and mediates nuclear- receptor function. Nature 387:677–684[CrossRef][Medline]
  11. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  12. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin SC, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414[CrossRef][Medline]
  13. Takeshita A, Yen PM, Misiti S, Cardona GR, Liu Y, Chin WW 1996 Molecular cloning and properties of a full-length putative thyroid hormone receptor coactivator. Endocrinology 137:3594–3597[Abstract]
  14. Kalkhoven E, Valentine JE, Heery DM, Parker MG 1998 Isoforms of steroid receptor co-activator 1 differ in their ability to potentiate transcription by the oestrogen receptor. EMBO J 17:232–243[CrossRef][Medline]
  15. Ding XF, Anderson CM, Ma H, Hong H, Uht RM, Kushner PJ, Stallcup MR 1998 Nuclear receptor-binding sites of coactivators glucocorticoid interacting protein 1 (GRIP1) and steroid receptor coactivator 1 (SRC-1): multiple motifs with different binding specificities. Mol Endocrinol 12:302–313[Abstract/Free Full Text]
  16. Misiti S, Schomburg L, Yen PM, Chin WW 1998 Expression and hormonal regulation of coactivator and corepressor genes. Endocrinology 139:2493–2500[Abstract/Free Full Text]
  17. Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc Natl Acad Sci USA 93:4948–4952[Abstract/Free Full Text]
  18. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  19. Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai MJ, O’Malley BW 1998 Partial hormone resistance in mice with disruption of the steroid receptor coactivator-1 (SRC-1) gene. Science 279:1922–1925[Abstract/Free Full Text]
  20. Weiss RE, Xu J, Ning G, Pohlenz J, O’Malley BW, Refetoff S 1999 Mice deficient in the steroid receptor co-activator 1 (SRC-1) are resistant to thyroid hormone. EMBO J 18:1900–1904[CrossRef][Medline]
  21. Leers J, Treuter E, Gustafsson JA 1998 Mechanistic principles in NR box-dependent interaction between nuclear hormone receptors and the coactivator TIF2. Mol Cell Biol 18:6001–6013[Abstract/Free Full Text]
  22. Harvey RJ, Darlison MG 1997 In situ hybridization localization of the GABAA receptor beta 2S- and beta 2L-subunit transcripts reveals cell-specific splicing of alternate cassette exons. Neuroscience 77:361–369[CrossRef][Medline]
  23. Paxinos G, Watson C 1986 The Rat Brain in Stereotactic Coordinates. Academic Press Inc., San Diego
  24. Swanson LW 1992 Brain Maps: Structure of the Rat Brain. Elsevier, Amsterdam
  25. Hanstein B, Eckner R, DiRenzo J, Halachmi S, Liu H, Searcy B, Kurokawa R, Brown M 1996 p300 is a component of an estrogen receptor coactivator complex. Proc Natl Acad Sci USA 93:11540–11545[Abstract/Free Full Text]
  26. Yao TP, Ku G, Zhou N, Scully R, Livingston DM 1996 The nuclear hormone receptor coactivator SRC-1 is a specific target of p300. Proc Natl Acad Sci USA 93:10626–10631[Abstract/Free Full Text]
  27. Chen D, Ma H, Hong H, Koh SS, Huang SM, Schurter BT, Aswad DW, Stallcup MR 1999 Regulation of transcription by a protein methyltransferase. Science 284:2174–2177[Abstract/Free Full Text]
  28. Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1997 Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194–198[CrossRef][Medline]
  29. Ma H, Hong H, Huang SM, Irvine RA, Webb P, Kushner PJ, Coetzee GA, Stallcup MR 1999 Multiple signal input and output domains of the 160-kilodalton nuclear receptor coactivator proteins. Mol Cell Biol 19:6164–6173[Abstract/Free Full Text]
  30. Misiti S, Koibuchi N, Bei M, Farsetti A, Chin WW 1999 Expression of steroid receptor coactivator-1 mRNA in the developing mouse embryo: a possible role in olfactory epithelium development. Endocrinology 140:1957–1960[Abstract/Free Full Text]
  31. Sapolsky RM, McEwen BS, Rainbow TC 1983 Quantitative autoradiography of [3H]corticosterone receptors in rat brain. Brain Res 271:331–334[CrossRef][Medline]
  32. Gottlicher M, Heck S, Herrlich P 1998 Transcriptional cross-talk, the second mode of steroid hormone receptor action. J Mol Med 76:480–489[CrossRef][Medline]
  33. Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569–580[CrossRef][Medline]
  34. McEwen BS, Alves SE 1999 Estrogen actions in the central nervous system. Endocr Rev 20:279–307[Abstract/Free Full Text]
  35. Dallman MF, Akana SF, Strack AM, Hanson ES, Sebastian RJ 1995 The neural network that regulates energy balance is responsive to glucocorticoids and insulin and also regulates HPA axis responsivity at a site proximal to CRF neurons. Ann NY Acad Sci 771:730–742[Medline]
  36. Simerly RB, Chang C, Muramatsu M, Swanson LW 1990 Distribution of androgen and estrogen receptor mRNA-containing cells in the rat brain: an in situ hybridization study. J Comp Neurol 294:76–95[CrossRef][Medline]
  37. Makino S, Gold PW, Schulkin J 1994 Corticosterone effects on corticotropin-releasing hormone mRNA in the central nucleus of the amygdala and the parvocellular region of the paraventricular nucleus of the hypothalamus. Brain Res 640:105–112[CrossRef][Medline]
  38. Albeck DS, McKittrick CR, Blanchard DC, Blanchard RJ, Nikulina J, McEwen BS, Sakai RR 1997 Chronic social stress alters levels of corticotropin-releasing factor and arginine vasopressin mRNA in rat brain. J Neurosci 17:4895–4903[Abstract/Free Full Text]
  39. Makino S, Gold PW, Schulkin J 1994 Effects of corticosterone on CRH mRNA and content in the bed nucleus of the stria terminalis; comparison with the effects in the central nucleus of the amygdala and the paraventricular nucleus of the hypothalamus. Brain Res 657:141–149[CrossRef][Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Lachize, E. M. Apostolakis, S. van der Laan, A. M. I. Tijssen, J. Xu, E. R. de Kloet, and O. C. Meijer
Steroid receptor coactivator-1 is necessary for regulation of corticotropin-releasing hormone by chronic stress and glucocorticoids
PNAS, May 12, 2009; 106(19): 8038 - 8042.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. A. Molenda-Figueira, S. D. Murphy, K. L. Shea, N. K. Siegal, Y. Zhao, J. G. Chadwick Jr., L. A. Denner, and M. J. Tetel
Steroid Receptor Coactivator-1 from Brain Physically Interacts Differentially with Steroid Receptor Subtypes
Endocrinology, October 1, 2008; 149(10): 5272 - 5279.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
K. Abildayeva, J. F. P. Berbee, A. Blokland, P. J. Jansen, F. J. Hoek, O. Meijer, D. Lutjohann, T. Gautier, T. Pillot, J. De Vente, et al.
Human apolipoprotein C-I expression in mice impairs learning and memory functions
J. Lipid Res., April 1, 2008; 49(4): 856 - 869.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. van der Laan, S. B. Lachize, E. Vreugdenhil, E. R. de Kloet, and O. C. Meijer
Nuclear Receptor Coregulators Differentially Modulate Induction and Glucocorticoid Receptor-Mediated Repression of the Corticotropin-Releasing Hormone Gene
Endocrinology, February 1, 2008; 149(2): 725 - 732.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J.-W. Jeong, K. Y. Lee, S. J. Han, B. J. Aronow, J. P. Lydon, B. W. O'Malley, and F. J. DeMayo
The p160 Steroid Receptor Coactivator 2, SRC-2, Regulates Murine Endometrial Function and Regulates Progesterone-Independent and -Dependent Gene Expression
Endocrinology, September 1, 2007; 148(9): 4238 - 4250.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Berthiaume, M. Laplante, W. Festuccia, Y. Gelinas, S. Poulin, J. Lalonde, D. R. Joanisse, R. Thieringer, and Y. Deshaies
Depot-Specific Modulation of Rat Intraabdominal Adipose Tissue Lipid Metabolism by Pharmacological Inhibition of 11{beta}-Hydroxysteroid Dehydrogenase Type 1
Endocrinology, May 1, 2007; 148(5): 2391 - 2397.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. V. Patchev, D. Fischer, S. S. Wolf, M. Herkenham, F. Gotz, M. Gehin, P. Chambon, V. K. Patchev, and O. F. X. Almeida
Insidious adrenocortical insufficiency underlies neuroendocrine dysregulation in TIF-2 deficient mice
FASEB J, January 1, 2007; 21(1): 231 - 238.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Yoshida, Y. Iwasaki, M. Asai, S. Takayasu, T. Taguchi, K. Itoi, K. Hashimoto, and Y. Oiso
Identification of a Functional AP1 Element in the Rat Vasopressin Gene Promoter
Endocrinology, June 1, 2006; 147(6): 2850 - 2863.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J.-W. Jeong, I. Kwak, K. Y. Lee, L. D. White, X.-P. Wang, F. C. Brunicardi, B. W. O'Malley, and F. J. DeMayo
The Genomic Analysis of the Impact of Steroid Receptor Coactivators Ablation on Hepatic Metabolism
Mol. Endocrinol., May 1, 2006; 20(5): 1138 - 1152.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
M. Nishi and M. Kawata
Brain Corticosteroid Receptor Dynamics and Trafficking: Implications from Live Cell Imaging
Neuroscientist, April 1, 2006; 12(2): 119 - 133.
[Abstract] [PDF]


Home page
J. Physiol.Home page
A. Kapoor, E. Dunn, A. Kostaki, M. H. Andrews, and S. G. Matthews
Fetal programming of hypothalamo-pituitary-adrenal function: prenatal stress and glucocorticoids
J. Physiol., April 1, 2006; 572(1): 31 - 44.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. N. Winnay, J. Xu, B. W. O'Malley, and G. D. Hammer
Steroid Receptor Coactivator-1-Deficient Mice Exhibit Altered Hypothalamic-Pituitary-Adrenal Axis Function
Endocrinology, March 1, 2006; 147(3): 1322 - 1332.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Grenier, A. Trousson, A. Chauchereau, J. Cartaud, M. Schumacher, and C. Massaad
Differential Recruitment of p160 Coactivators by Glucocorticoid Receptor between Schwann Cells and Astrocytes
Mol. Endocrinol., February 1, 2006; 20(2): 254 - 267.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. M. Karssen, O. C. Meijer, A. Berry, R. Sanjuan Pinol, and E. R. de Kloet
Low Doses of Dexamethasone Can Produce a Hypocorticosteroid State in the Brain
Endocrinology, December 1, 2005; 146(12): 5587 - 5595.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. L. Hultman, N. V. Krasnoperova, S. Li, S. Du, C. Xia, J. D. Dietz, D. S. Lala, D. J. Welsch, and X. Hu
The Ligand-Dependent Interaction of Mineralocorticoid Receptor with Coactivator and Corepressor Peptides Suggests Multiple Activation Mechanisms
Mol. Endocrinol., June 1, 2005; 19(6): 1460 - 1473.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
O. C. Meijer, B. Topic, P. J. Steenbergen, G. Jocham, J. P. Huston, and M. S. Oitzl
Correlations between Hypothalamus-Pituitary-Adrenal Axis Parameters Depend on Age and Learning Capacity
Endocrinology, March 1, 2005; 146(3): 1372 - 1381.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
O. C. Meijer, E. Kalkhoven, S. van der Laan, P. J. Steenbergen, S. H. Houtman, T. F. Dijkmans, D. Pearce, and E. R. de Kloet
Steroid Receptor Coactivator-1 Splice Variants Differentially Affect Corticosteroid Receptor Signaling
Endocrinology, March 1, 2005; 146(3): 1438 - 1448.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. D. Charlier, G. F. Ball, and J. Balthazart
Inhibition of Steroid Receptor Coactivator-1 Blocks Estrogen and Androgen Action on Male Sex Behavior and Associated Brain Plasticity
J. Neurosci., January 26, 2005; 25(4): 906 - 913.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Grenier, A. Trousson, A. Chauchereau, L. Amazit, A. Lamirand, P. Leclerc, A. Guiochon-Mantel, M. Schumacher, and C. Massaad
Selective Recruitment of p160 Coactivators on Glucocorticoid-Regulated Promoters in Schwann Cells
Mol. Endocrinol., December 1, 2004; 18(12): 2866 - 2879.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Setiawan, D. Owen, L. McCabe, A. Kostaki, M. H. Andrews, and S. G. Matthews
Glucocorticoids Do Not Alter Developmental Expression of Hippocampal or Pituitary Steroid Receptor Coactivator-1 and -2 in the Late Gestation Fetal Guinea Pig
Endocrinology, August 1, 2004; 145(8): 3796 - 3803.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Mark, H. Yoshida-Komiya, M. Gehin, L. Liao, M.-J. Tsai, B. W. O'Malley, P. Chambon, and J. Xu
Partially redundant functions of SRC-1 and TIF2 in postnatal survival and male reproduction
PNAS, March 30, 2004; 101(13): 4453 - 4458.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. Obradovic, M. Tirard, Zs. Nemethy, O. Hirsch, H. Gronemeyer, and O. F. X. Almeida
DAXX, FLASH, and FAF-1 Modulate Mineralocorticoid and Glucocorticoid Receptor-Mediated Transcription in Hippocampal Cells--Toward a Basis for the Opposite Actions Elicited by Two Nuclear Receptors?
Mol. Pharmacol., March 1, 2004; 65(3): 761 - 769.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-F. Mouillet, C. Sonnenberg-Hirche, X. Yan, and Y. Sadovsky
p300 Regulates the Synergy of Steroidogenic Factor-1 and Early Growth Response-1 in Activating Luteinizing Hormone-{beta} Subunit Gene
J. Biol. Chem., February 27, 2004; 279(9): 7832 - 7839.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
H. A. Molenda, C. P. Kilts, R. L. Allen, and M. J. Tetel
Nuclear Receptor Coactivator Function in Reproductive Physiology and Behavior
Biol Reprod, November 1, 2003; 69(5): 1449 - 1457.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Pal and A. Sahu
Leptin Signaling in the Hypothalamus during Chronic Central Leptin Infusion
Endocrinology, September 1, 2003; 144(9): 3789 - 3798.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. L. Rincavage, D. P. McDonnell, and C. M. Kuhn
Expression of Functional Estrogen Receptor {beta} in Locus Coeruleus-Derived Cath.a Cells
Endocrinology, July 1, 2003; 144(7): 2829 - 2835.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
P. M. Sadow, E. Koo, O. Chassande, K. Gauthier, J. Samarut, J. Xu, B. W. O'Malley, H. Seo, Y. Murata, and R. E. Weiss
Thyroid Hormone Receptor-Specific Interactions with Steroid Receptor Coactivator-1 in the Pituitary
Mol. Endocrinol., May 1, 2003; 17(5): 882 - 894.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
E. Nishihara, H. Yoshida-Komiya, C.-S. Chan, L. Liao, R. L. Davis, B. W. O'Malley, and J. Xu
SRC-1 Null Mice Exhibit Moderate Motor Dysfunction and Delayed Development of Cerebellar Purkinje Cells
J. Neurosci., January 1, 2003; 23(1): 213 - 222.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. P. Auger, T. S. Perrot-Sinal, C. J. Auger, L. A. Ekas, M. J. Tetel, and M. M. MCCarthy
Expression of the Nuclear Receptor Coactivator, cAMP Response Element-Binding Protein, Is Sexually Dimorphic and Modulates Sexual Differentiation of Neonatal Rat Brain
Endocrinology, August 1, 2002; 143(8): 3009 - 3016.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. M. Apostolakis, M. Ramamurphy, D. Zhou, S. Onate, and B. W. O'Malley
Acute Disruption of Select Steroid Receptor Coactivators Prevents Reproductive Behavior in Rats and Unmasks Genetic Adaptation in Knockout Mice
Mol. Endocrinol., July 1, 2002; 16(7): 1511 - 1523.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Guissouma, S. M. Dupre, N. Becker, E. Jeannin, I. Seugnet, B. Desvergne, and B. A. Demeneix
Feedback on Hypothalamic TRH Transcription Is Dependent on Thyroid Hormone Receptor N Terminus
Mol. Endocrinol., July 1, 2002; 16(7): 1652 - 1666.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. A. Molenda, A. L. Griffin, A. P. Auger, M. M. McCarthy, and M. J. Tetel
Nuclear Receptor Coactivators Modulate Hormone-Dependent Gene Expression in Brain and Female Reproductive Behavior in Rats
Endocrinology, February 1, 2002; 143(2): 436 - 444.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. S. Bramlett, Y. Wu, and T. P. Burris
Ligands Specify Coactivator Nuclear Receptor (NR) Box Affinity for Estrogen Receptor Subtypes
Mol. Endocrinol., June 1, 2001; 15(6): 909 - 922.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meijer, O. C.
Right arrow Articles by de Kloet, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meijer, O. C.
Right arrow Articles by de Kloet, E. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals