Endocrinology Vol. 141, No. 7 2377-2384
Copyright © 2000 by The Endocrine Society
Calcium Ions Positively Modulate Follicle-Stimulating Hormone- and Exogenous Cyclic 3',5'-Adenosine Monophosphate-Driven Transcription of the P450scc Gene in Porcine Granulosa Cells1
F. C. L. Jayes,
R. N. Day,
J. C. Garmey,
R. J. Urban,
G. Zhang and
J. D. Veldhuis
Division of Endocrinology (F.C.L.J., R.N.D., J.C.G., G.Z., J.D.V.),
Department of Internal Medicine or Cell Biology (F.C.L.J.), NIH
Specialized Cooperative Center in Reproduction Research, University of
Virginia Health Sciences Center, Charlottesville, Virginia 22908; and
Department of Medicine (R.J.U.), University of Texas Medical Branch,
Galveston, Texas 77555
Address all correspondence and requests for reprints to: Johannes D. Veldhuis, M.D., Division of Endocrinology, Department of Internal Medicine, University of Virginia Health System, P.O. Box 800202, Charlottesville, Virginia 22908-0202. E-mail: jdv{at}virginia.edu
 |
Abstract
|
|---|
Given the evident modulation of FSH-induced steroidogenesis by
Ca2+ in granulosa cells, we here test the hypothesis that
Ca2+ controls expression of the enzymatically rate-limiting
cytochrome P450scc (CYP11A) gene. To test this postulate,
we quantitated the ability of Ca2+ to regulate: 1)
transcriptional activity of a transiently transfected luciferase
reporter gene driven by a 2.32-kb 5'-upstream fragment of the porcine
P450scc gene promoter region; and 2) accumulation of
endogenous P450scc transcripts in primary monolayer
cultures of porcine granulosa cells. To this end, granulosa cells were
stimulated for 4 h with FSH (15 ng/ml, NIDDK-oFSH-20) or
8-Bromo-cAMP (8 Br-cAMP, 1 mM) in serum-free medium
containing either 1.8 mM Ca2+ or no added
Ca2+ with 100 µM EGTA or 100 µM
CoCl2. In the presence of extracellular Ca2+,
FSH and 8 Br-cAMP stimulated expression of the transfected
P450scc promoter-reporter fusion construct by 5.6 ±
1.1 and 3.6 ± 0.67-fold, respectively over
Ca2+-containing unstimulated control (P
0.04, n = 56 experiments). The foregoing two agonists
augmented 4-h progesterone production by cultured granulosa cells by
1.8 ± 0.11 and 1.6 ± 0.16-fold, respectively
(P
0.001 for FSH and P
0.01 for 8 Br-cAMP). FSH and 8 Br-cAMP also significantly elevated
endogenous P450scc transcript levels as measured by
homologous solution-hybridization RNase protection assay;
i.e. by 3.1 ± 0.49 and 2.9 ± 0.45-fold,
respectively (P
0.001). In
Ca2+-free/EGTA-supplemented medium, basal luciferase
reporter-gene activity and endogenous P450scc messenger RNA
accumulation in granulosa cells declined to 34 ± 12% and 78
± 12%, respectively, of corresponding values in control (unstimulated
Ca2+-containing) cultures. Extracellular Ca2+
deprivation inhibited the stimulatory effect of FSH (and 8 Br-cAMP) on
P450scc promoter-luciferase reporter expression to 58
± 30% (and 58 ± 23%), and restrained endogenous
P450scc message accumulation to 86 ± 15% (and
96 ± 18%) of the value in Ca2+-containing control.
Extracellular Ca2+ withdrawal suppressed FSH (and 8
Br-cAMP)-driven progesterone production over 4 h to basal levels
but did not alter FSH-stimulated cAMP accumulation by granulosa cells.
Ca2+-deprived cells exposed to serum-containing media
regained P450scc responsiveness to both agonists.
Antagonism of cellular uptake of Ca2+ and other divalent
cations via administration of cobalt chloride (100 µM)
inhibited FSH and 8 Br-cAMPs stimulation of endogenous (but not
exogenous promoter-driven) P450scc gene expression. In
contrast, granulosa-cell concentrations of messenger RNAs encoding
sterol-carrier protein-2 (SCP-2) and the low density lipoprotein
receptor were not altered by Ca2+ withdrawal.
In summary, uptake of extracellular Ca2+ by porcine
granulosa cells significantly potentiates transactivation of the
endogenously expressed and exogenously transfected P450scc gene by FSH
and 8 Br-cAMP. The agonistic impact of Ca2+ on
P450scc promoter activity is requisite downstream of
FSH-induced cAMP second-messenger signaling.
 |
Introduction
|
|---|
THE HYPOTHALAMO-PITUITARY-GONADAL AXIS
comprises an in vivo feedback-control network supervised by
both inter and intraglandular signaling. At the ovarian level, actions
of the primary gonadotropic hormones, FSH and LH, govern cell
proliferation, cytodifferentiation and ovulation via specialized
intracellular signaling cascades (1, 2, 3). Among the well-studied
signaling modes are the adenylyl cyclase-cAMP-PKA and the
Ca2+-phospholipase C-inositol triphosphate-PKC
transduction systems. Both of these effector pathways can be activated
by LH in granulosa-luteal cells (4, 5, 6). On the other hand, FSH
receptors seem to be coupled primarily to the PKA distal effector
pathway (7, 8, 9, 10, 11, 12). cAMP is not solely responsible for FSH-stimulated
steroidogenesis because inhibition of the cAMP signaling pathway
reduces but does not abolish FSH action (13), and, conversely,
steroidogenesis can be augmented in granulosa cells without increasing
cAMP (14). Indeed, FSH can concomitantly drive transmembrane
45Ca2+ exchange and
Ca2+ influx into granulosa cells, and thereby
induce a sustained elevation in intracellular concentrations of
Ca2+
([Ca2+]i) (10, 11, 15).
FSHs activation of
[Ca2+]i signaling can be
distinguished readily from its stimulation of adenylyl cyclase, because
neither activation nor inhibition of the cAMP/PKA pathway promotes
analogous Ca2+ exchange and/or
Ca2+ uptake by gonadal cells (8, 10, 11, 12, 16, 17).
The ability of FSH to stimulate delayed Ca2+
entry in porcine granulosa cells is hormone specific, inasmuch as other
agonists, such as LH, angiotensin II and endothelin 1, elicit
mechanistically different
[Ca2+]i waveforms in the
same cells (18, 19, 20).
In spite of the consistent ability of FSH to promote
Ca2+ influx in both testicular (Sertoli) and
ovarian (granulosa) cells (8, 10, 11, 16, 21), the distal intracellular
targets of this [Ca2+]i
second-messenger signal are sparingly understood. Recognized
steroidogenic and/or mitochondrial effects of
Ca2+ in nonovarian cells include stimulation of
pregnenolone biosynthesis, potentiation of mitochondrial NADP-NADPH
redox cycling, and enhanced expression of the steroidogenic acute
regulatory (StAR) protein and aldosterone synthase (CYP11B2) gene in
normal and transformed adrenal cells (22, 23, 24, 25, 26, 27, 28, 29).
Experiments using sheep, rat, or swine granulosa-luteal cells indicate
that the gonadotropin-stimulated biosynthesis of pregnenolone and
progesterone is linked to Ca2+ in several ways.
Augmented steroidogenesis is: dependent on the availability of
extracellular Ca2+; blocked by putative
inhibitors of calmodulin (e.g. trifluoperazine and the
naphthalenesulfonamide, W-7); and enhanced by liposomal
delivery of Ca2+-activated calmodulin or
administration of the Ca2+-iontophoretic
dinoflagellate toxin, maitotoxin (30, 31, 32, 33, 34, 35, 36, 37, 38). In aggregate, the foregoing
data allow the conjecture that FSH-driven Ca2+
uptake by granulosa cells may enhance the expression of one or more
steroidogenic genes, such as cytochrome
P450scc.
Previous studies have identified negative regulation of the transfected
P450scc gene promoter by the phorbol or
LH-activated Ca2+-dependent phospholipase C-PKC
effector pathway in target cells; e.g. in JEG placental, Y-1
adrenal, MA-10 Leydig, H295R adrenal, and human granulosa cells (39).
In contradistinction to the PKC pathway stimulated by LH, we
hypothesized that the
[Ca2+]i signal elicited
by the FSH stimulus in ovarian cells controls the expression of
P450scc positively. To test this notion, we here
examine regulation by Ca2+ of FSH and exogenous
cAMP-stimulated P450scc gene transactivation in
primary cultures of porcine granulosa cells. We use a homologous
solution-hybridization RNase protection assay to monitor endogenous
P450scc transcript accumulation, and a chimeric
2.32 kb 5'-upstream porcine P450scc gene promoter
fragment driving a luciferase reporter to assess
Ca2+-dependent control of
P450scc gene transcription.
 |
Materials and Methods
|
|---|
Granulosa cell cultures
Approximately 200300 ovaries per batch were obtained from
immature (5570 kg) swine slaughtered at a local abattoir. Ovaries
were removed immediately and transported to the laboratory in an iced
saline solution. Granulosa cells were aspirated from 1 to 5 mm
follicles, washed by centrifugation in Eagles MEM and plated at an
initial density of 1 x 106
cells/cm2 in MEM supplemented with antibiotics,
3% FBS, porcine insulin (3 µg/ml), and FSH (10 ng/ml) to allow
anchorage overnight at 37 C in 5% CO2.
Approximately 21 h after seeding, medium was replaced with
serum-free MEM and cells were transiently transfected or under went
identical media changes. Granulosa cells were then stimulated for
4 h with vehicle, FSH or 8-Bromo-cAMP (8 Br-cAMP) in defined media
containing 1.8 mM Ca2+ or lacking
Ca2+ with addition of 100 µM EGTA
or 100 µM CoCl2. Twelve-well
culture plates were used in gene reporter-assay experiments (3 wells
per treatment), and larger (6-cm diameter) culture dishes to quantitate
concentrations of endogenous messenger RNA (mRNA) (two dishes per
treatment). Preliminary experiments were performed to optimize the time
course of the experimental set up for reporter gene expression.
To show that granulosa cells regain responsiveness and are not
permanently damaged by the exposure to Ca2+-free
media, we carried out some experiments in which cells were allowed to
recover from the exposure to Ca2+ free/EGTA
containing medium before they were treated with effector agents.
Conditions differed from the main experiments in the following details:
cells were cultured as described above, but not stimulated with
effector agents during the 4-h period in Ca2+
free medium. Subsequently, cells were cultured for 4 h in recovery
medium (MEM containing antibiotics and FBS), followed by effector
treatment in serum free MEM for 4 h (optimized to detect
luciferase responses) or 16 h (optimized to detect progesterone
responses).
Transient transfection
Primary monolayer cultures of granulosa cells in 12-well plates
were transfected for 6 h in serum-free MEM with 12 µl
LipofectAMINE (Life Technologies, Inc., Grand Island, NY)
and 2 µg of plasmid DNA to fix the DNA/LipofectAMINE ratio. All cells
received 1 µg of a luciferase reporter plasmid driven by 2320 bp of
the porcine P450scc promoter (40). In addition, some cells received 0.8
µg RSV-driven PKA ß-catalytic subunit (41) and 0.2 µg RSV-PKI
(rabbit PKA inhibitor minigene) (42, 43). The filler-plasmid (pUC19)
was used to make up the difference to 2 µg total transfected DNA.
After incubation at 37C for 6 h in 5% CO2,
the serum-free LipofectAMINE/DNA solution was replaced with MEM
containing antibiotics and 3% serum for 18 h to allow cell
recovery. Cultures were exposed to the effectors of interest (below)
for 4 h, and then lysed (Luciferase Assay System, Promega Corp., Madison, WI) for the later assay of luciferase activity
(Promega Corp., Turner TD20e luminometer) and protein
(Bradford, Bio-Rad Laboratories, Inc., Hercules, CA).
Solution hybridization/RNase protection assays
Granulosa cells anchored in 6-cm dishes underwent the above
media changes, but were not exposed to DNA or LipofectAMINE (sham
transfection). Cells were then exposed for 4 h to effector agents
(below) before media were removed for the later assay of progesterone
and/or cAMP by RIA (44, 45, 46). Granulosa cells were harvested by lysis
with TRI-reagent (Molecular Research Center, Inc.,
Cincinnati, OH) and RNA was harvested, exactly as described earlier
(46, 47). A partial pig complementary DNA (cDNA) encoding the
catalytically active region of the P450scc enzyme
was used as template for in vitro transcription of high
specific activity 32P-labeled riboprobes (45, 47)
(Maxiscript Kit, Ambion, Inc., Austin, TX) and endogenous
P450scc m-RNA was assayed using the RPA II Kit
(Ambion, Inc.). Gels (Fig. 1
) were quantitated using phosphorscreen
autoradiography and ImageQuant software (Molecular Dynamics, Inc., Sunnyvale, CA). As an internal marker, 18S rRNA was also
quantitated in each lane (45, 46).

View larger version (92K):
[in this window]
[in a new window]
|
Figure 1. Representative autoradiogram showing the impact of
extracellular Ca2+ deprivation (see Materials and
Methods) on the FSH or 8 Br-cAMP stimulated accumulation of
endogenous P450scc mRNA as measured by RNase protection
assay. 18S rRNA from the same cells served as an internal loading
standard.
|
|
To evaluate expression of the low density lipoprotein (LDL)-receptor
and sterol carrier protein (SCP-2) genes, homologous RT-PCR was applied
with appropriate forward and reverse primer sequences. For the LDL
receptor, the forward primer sequence was GACGAGGAGAACTGCGATGT and that
for reverse primer: GGCACTCATAGCCGATCTTG.
Corresponding primer sequences for SCP-2 were (forward)
GGTGGTGGACGTGAAGAA and (reverse) AAGAAGGCCAACTGAGGA. The resultant PCR
products were 337 bp (LDL receptor) and 135 bp (SCP-2), respectively.
Quantities of specific cDNAs within the linear range of the PCR
amplification curves were quantitated by picogreen dye, as described
earlier (48, 49).
Effector agents
Granulosa cells were stimulated with FSH (15 ng/ml
NIDDK-oFSH-20) or 8 Br-cAMP (1 mM, Sigma
Corp., St. Louis, MO). These effectors were diluted in defined medium
(127 mM NaCl, 5 mM KCl, 2 mM MgCl,
0.5 mM KH2PO4,
10 mM HEPES, 10 mM glucose, 0.1% BSA, 5
mM NaHCO3) containing 1.8
mM CaCl2 or 100 µM
CoCl2 (to block uptake of divalent ions), or 100
µM EGTA (as a calcium chelator) because
Ca2+-free medium still contains approximately 10
µM Ca2+. Before treating cells with
FSH or 8 Br-cAMP all cultures were washed with PBS for 20 min. Cells to
be treated in the presence of CoCl2 were washed
with PBS containing 100 µM
CoCl2.
Statistical analysis
All experiments were repeated 36 times with different batches
of ovaries. Results from each experiment were expressed as fold-change
relative to the Ca2+-containing vehicle
stimulated controls. Data were natural-logarithm transformed and
analyzed by one way ANOVA and Tukeys HSD (honestly significantly
different) post hoc test (SYSTAT Software, SPSS, Inc., Chicago, IL). Significance was construed for
P < 0.05.
 |
Results
|
|---|
Preliminary experiments were carried out to corroborate porcine
2.32 kb P450scc promoter-driven luciferase
responsiveness to FSH and cotransfected PKA, a minigene encoding the
constitutively active ß catalytic subunit of PKA (41). As shown in
Table 1
, FSH and the PKA minigene each
elevated luciferase expression by approximately 4.4-fold (n = 36
experiments). Cotransfection of PKI (42), with FSH stimulation or with
PKA, inhibited luciferase expression to values no different from basal.
Accordingly, the porcine 2.32 kb P450scc promoter
fragment responded with expected PKA induction and PKI inhibition of
FSH action.
View this table:
[in this window]
[in a new window]
|
Table 1. Responsiveness of the porcine 2.32 kb
P450scc promoter-luciferase gene reporter construct to FSH
and PKA in a PKI-inhibitable fashion
|
|
In Ca2+-replete medium, FSH and 8 Br-cAMP
increased P450scc-promoter driven luciferase
(Luc) activity in granulosa cells over a 4-h interval by 5.6 ±
1.1 and 3.6 ± 0.67-fold over control (n = 56 experiments,
P
0.04): Fig. 2
.
Expression of endogenous P450scc mRNA, as
quantitated by RNase protection assay (Fig. 1
), was stimulated 3.1
± 0.49 and 2.9 ± 0.45-fold by FSH and 8 Br-cAMP, respectively
(P
0.001): Fig. 3
.
Progesterone production rose concomitantly by 1.8 ± 0.11 and
1.6 ± 0.16-fold, respectively (Fig. 4
; P
0.01). Production
of cAMP was increased to 166 ± 55-fold after treatment with FSH
(Fig. 5
; P
0.001).

View larger version (47K):
[in this window]
[in a new window]
|
Figure 5. Impact of EGTA or Co2+ (each at a
final concentration of 100 µM) in Ca2+-free
medium on FSH-stimulated cAMP accumulation over 4 h in monolayer
cultures of swine granulosa cells. Data are the mean ±
SEM (n = 35 separate experiments). Unshared
superscripts denote significantly different means
(P 0.001).
|
|
In Ca2+-free/EGTA-supplemented medium, basal
luciferase activity (Fig. 2
) in transfected granulosa cells declined to
34 ± 12% of Ca2+-containing control
cultures (P < 0.04). Activity could not be stimulated
by FSH or 8 Br-cAMP over 4 h in
Ca2+-depleted/EGTA medium, wherein reporter-gene
luciferase activity was 58 ± 30% and 58 ± 23% of basal
(vehicle stimulated) Ca2+-containing control,
respectively (P > 0.4). Basal endogenous
P450scc mRNA levels (Fig. 3
) in
Ca2+-depleted/EGTA medium were only 78 ±
12% of Ca2+-containing control and were not
stimulated by FSH (86 ± 15%) or 8 Br-cAMP (96 ± 18%).
Ca2+ withdrawal also eliminated FSH and 8
Br-cAMP-driven increases in progesterone (Fig. 4
), which were
respectively 108 ± 7% and 106 ± 4% (P >
0.9) of control. Stimulation of cAMP production by FSH was not impaired
in Ca2+-free/EGTA medium and reached 176 ±
89-fold basal (Fig. 5
; P < 0.001). In contrast to
P450scc mRNA accumulation, basal levels of
endogenously expressed LDL-receptor and SCP-2 transcripts were
unaffected by Ca2+ deprivation with EGTA,
Co2+, or Ni2+ (Table 2
; n = 3 experiments each).
Ca2+-depleted cells that were allowed to recover
after Ca2+-withdrawal for 4 h in
serum-containing medium (see Materials and Methods) regained
responsiveness to stimulation with FSH or 8 Br-cAMP in MEM without
serum, and showed 2.2 to 3.6-fold increases in the foregoing three
measures: Table 3
.
View this table:
[in this window]
[in a new window]
|
Table 2. Ca2+ withdrawal does not alter basal
expression of LDL-receptor and SCP-2 mRNA in monolayer cultures of
porcine granulosa cells
|
|
View this table:
[in this window]
[in a new window]
|
Table 3. Recovery of granulosa cell responsiveness to
stimulation with FSH or 8 Br-cAMP after previous Ca2+
deprivation for 4 h1
|
|
Results obtained using Ca2+-free medium
supplemented with Co2+ (100 µM),
which was used to block uptake of both Ca2+ and
nonCa2+ divalent cations, were similar but not
identical to results from Ca2+ free/EGTA media.
In particular, FSH-stimulated luciferase production in
Co2+-supplemented media increased 5.3 ±
1.4-fold compared with Ca2+ containing control
(P < 0.012; P > 0.14 vs.
control in same medium). The 8 Br-cAMP-induced response tended to
increase by 3.1 ± 0.4-fold compared with
Ca2+-containing control (P <
0.18; P > 0.67 vs. control in same
medium).
Progesterone and cAMP accumulation from cells cultured in 12-well
plates (transfection experiments) were obtained in parallel (data not
shown). All values were analogous to data obtained from cells cultured
in 6-cm dishes (Figs. 4
and 5
).
 |
Discussion
|
|---|
The present in vitro studies imply a role for the
poorly understood FSH-induced increase of intracellular
Ca2+ and are consistent with the thesis that
cellular Ca2+ uptake potentiates FSH (and 8
Br-cAMP)-stimulated transactivation of the
P450scc gene in (porcine) granulosa cells. The
cellular entry of Ca2+ positively regulated both
exogenous P450scc promoter-driven luciferase
activity and the FSH-stimulated accumulation of endogenous
P450scc mRNA. In contrast, extracellular
Ca2+ availability did not significantly modulate
FSH-enhanced cAMP production in granulosa cells, thereby pointing to
preservation of FSH receptor-transduced activation of adenylyl cyclase
and/or phosphodiesterase activity in the face of
Ca2+ withdrawal. Restraint of granulosa-cell
Ca2+-uptake (e.g. with a potent and
selective Ca2+ chelator, EGTA) likewise impeded
stimulation of exogenous and endogenous P450scc
gene expression as driven by a potent phosphodiesterase-resistant and
cell-permeable analog of cAMP (8 Br-cAMP).
In the Ca2+-withdrawn milieu, neither FSH nor 8
Br-cAMP elicited expected (5.6- and 3.6-fold, respectively)
transcriptional activation of a transiently transfected 2.3 kb
P450scc promoter-fragment fused to a luciferase
reporter gene. The latter chimeric plasmid responded by 4.4-fold to a
co-transfected PKA ß-catalytic subunit minigene in a PKI-inhibitable
fashion (Table 1
). The Ca2+ dependence of
FSH-stimulated transactivation of the transfected
P450scc promoter-reporter construct in granulosa
cells was not an artefact of the particular chimeric vector used
because the accumulation of endogenous P450scc
transcripts was also strongly Ca2+ dependent.
Indeed, inhibition of granulosa-cell Ca2+ uptake
reduced FSHs expected stimulation of endogenous
P450scc mRNA from 310% to 86%. The basal
dependence of P450scc gene expression on
Ca2+ uptake was specific because granulosa-cell
concentrations of endogenous LDL-receptor and SCP-2 transcripts were
independent of Ca2+ deprivation over the same
time interval. In addition, the suppressive effect of
Ca2+ withdrawal on agonist-stimulated
P450scc gene transcription was reversible upon
reexposure to Ca2+ (Table 3
). Accordingly, the
present experiments demonstrate a positive regulatory effect of
Ca2+ on FSH-amplified expression of the
(endogenous) granulosa-cell P450scc gene and on
activation of an exogenous P450scc promoter.
Previous fluorescence videomicroscopic analyses of
[Ca2+]i in single porcine
granulosa cells have established that FSH typically elicits a slow
(13 min onset) and sustained (515 min) elevation of
[Ca2+]i in approximately
85% of granulosa cells (10, 11). This gonadotropin evokes an analogous
[Ca2+]i signal in Sertoli
cells (8, 17, 50). In contrast, LH elicits a rapid-onset biphasic
(spike-and-plateau) rise in
[Ca2+]i in granulosa
cells (20). Thus, the FSH-stimulated
[Ca2+]i waveform is
gonadotropin-specific. The FSH-promoted rise in
[Ca2+]i in gonadal cells
is blocked by addition of (extracellular) EGTA,
Co2+ or Ni2+, which points
to its immediate dependence on extracellular Ca2+
uptake, as corroborated more directly in Sertoli cells by manganese
quench analysis (8, 51). Accordingly, in the present experiments, we
used two of these agents (EGTA and Co2+) to
antagonize FSH-stimulated Ca2+ entry into
granulosa cells, and thereby probe the hypothesized role of
Ca2+ uptake in agonist-stimulated
P450scc gene expression. To assess response
specificity, we showed unaltered FSH-stimulated cAMP accumulation,
reversibility of inhibited P450scc expression,
and stability of 18S rRNA and both SCP-2 and LDL-receptor mRNA
accumulation in the face of Ca2+ removal.
Complementary studies using 8 Br-cAMP as a non-FSH receptor-dependent
stimulus of the PKA pathway disclosed a strong
Ca2+ dependence of 8 Br-cAMP actions as well.
Thus, actions of Ca2+ are likely exerted at one
or more sites that include and/or are distal to (FSHs) activation of
the PKA pathway in granulosa cells.
Other earlier investigations of Ca2+-dependent
control of aldosterone synthase (CYP11B2) in adrenal cells (25, 52) are
thematically consistent with our inference that expression of the
P450scc gene is Ca2+
dependent. The former essential gene in mineralocorticoid biosynthesis
also manifests Ca2+-dependence at the
transcriptional level. Although the precise cis-acting DNA
elements that confer positive regulation by Ca2+
have not yet identified in either gene, the pig
P450scc gene promoter region contains several
candidate cis-acting DNA sequences (40), each of which can
mediate genomic effects of Ca2+ at least in other
nonexcitable or excitable cell types (25, 52, 53, 54, 55). Clarifying the
nature of cis-acting DNA control elements and
trans-acting mechanisms that mediate the
Ca2+-responsive expression of such
steroid-hydroxylating genes should help in ultimately unraveling their
multivariant regulation (26, 56).
The Ca2+-dependence of both FSH and 8
Br-cAMP-stimulated transactivation of the endogenous gene and
exogenously transfected P450scc promoter in
granulosa cells should be distinguished from previous reports of either
stimulatory or inhibitory effects of various PKC effectors on the
expression of several steroidogenic genes (39). For example, phorbol
myristate acetate (TPA) can activate or down-regulate conventional
and novel (but not atypical) PKC isotypes (57), and also positively
(e.g. 3-ß hydroxysteroid dehydrogenase and
sulfotransferase) or negatively (e.g. CYP17, CYP19, CYP11A1,
CYP11B2) control steroidogenic gene expression (52, 58, 59, 60, 61). Although
FSH is not known to stimulate PKC activity in granulosa cells (7, 8, 9, 11), effectors of the PKC pathway can significantly enhance (at 46 h)
and then down-regulate (at 1848 h) FSH-stimulated
P450scc gene expression in ovarian cells (62, 63). Thus, the ability of Ca2+ to selectively
potentiate FSH/cAMPs stimulation of P450scc
gene transcription in granulosa cells differs from PKC-associated
bidirectional regulation of this and other steroidogenic genes. Studies
using various inhibitors of Ca2+-activated
calmodulin, Ca2+ iontophoresis and liposomal
delivery of Ca2+-calmodulin currently suggest but
do not prove a possible role for calmodulin and/or its kinases in
Ca2+-dependent modulation of FSH action
(30, 31, 32, 33, 34, 35, 36, 37, 38).
An unexpected but reproducible observation in the present experiments
was that EGTA (100 µM) but not Co2+
(100 µM) consistently inhibited FSH and 8
Br-cAMP-stimulated transcription of an exogenous
P450scc promoter luciferase-reporter fusion
construct. On the other hand, both EGTA and Co2+
suppressed FSH/8 Br-cAMPs stimulation of endogenous
P450scc gene expression in granulosa cells (see
Results). If these differences reflect the expected ability
of Co2+ to impede cellular entry of multiple
divalent cations (51), then the foregoing distinction could indicate
that uptake of some nonCa2+ (but
Co2+-inhibitable) divalent cations may partially
antagonize maximal agonist-induced expression of the endogenous
P450scc gene. Alternatively, EGTA may more
effectively deplete intracellular Ca2+
concentrations (which may restrain both endogenous and exogenous
promoter expression), whereas Co2+ may do so to a
lesser degree (and thus limit only endogenous promoter expression). We
optimized experimental conditions for the endpoint of reporter plasmid
expression, which may overestimate gene activation due to the
sensitivity of the luciferase assay and the presence of high copy
numbers of the plasmid relative to the endogenous gene. It is also
possible that the exogenous 2.32 kb 5'-upstream
P450scc promoter fragment employed here in
transcriptional assays does not contain all divalent cation-responsive
regions represented in the native (endogenous) full-length
P450scc gene, including a potentially inhibitory
site. Cobalt ions might also enter the cell and potentially influence
endogenous P450scc-mRNA accumulation, but not P450scc transcriptional
activation per se and/or translation of luciferase mRNA.
Lastly, in some cell types Ca2+ appears to
influence transcript elongation, stabilization, processing and/or
turnover (54, 55, 64).
In summary, the present experiments indicate that FSH and presumptive
biochemical activation of PKA by way of 8 Br-cAMP effectively drive
expression of both the endogenous gene and an exogenous
P450scc promoter fragment in swine granulosa
cells via Ca2+-potentiated mechanisms. Transient
transfection of a pig P450scc promoter
luciferase-reporter gene fusion construct in untransformed granulosa
cells further indicates that Ca2+ positively
regulates P450scc gene expression via
transcriptional mechanisms. The present data do not exclude additional
facilitative roles of other (nonCa2+) divalent
cations in modulating FSH-induced gene transcription in the ovary.
 |
Acknowledgments
|
|---|
We thank Patsy Craig for her skillful preparation of the
manuscript.
 |
Footnotes
|
|---|
1 This work was supported in part by an NIH Training Grant in
Reproductive Neuroendocrinology (T32-DK-07646), National Research
Service Award Grant 1-F32-HD-08284-01, NIH Grants HD-16393 and
HD-16806, the NIH P30-HD-28934 (Center for Cellular and Molecular
Reproduction), and the NIH U-54 Specialized Cooperative Centers Program
in Reproductive Research (HD-96-008). 
Received September 15, 1999.
 |
References
|
|---|
-
Leung PC, Steele GL 1992 Intracellular
signaling in the gonads. Endocr Rev 13:476498[Abstract/Free Full Text]
-
Richards JS 1994 Hormonal control of gene
expression in the ovary. Endocr Rev 15:725751[Abstract/Free Full Text]
-
Veldhuis JDRole of extracellular calcium ions in
modulating hormonally stimulated cyclic AMP generation in intact swine
granulosa cells. In: Toft DO, Ryan RJ (eds) Proceedings of the Fifth
Ovarian Workshop. Ovarian Workshops, Champaign, IL, 1985, pp
181188
-
Hertelendy F, Nemecz G, Molnar M 1989 Influence of
follicular maturation on luteinizing hormone and guanosine
5'-O-thiotriphosphate-promoted breakdown of
phosphoinositides and calcium mobilization in chicken granulosa cells.
Biol Reprod 40:11441151[Abstract]
-
Davis JS, Weakland LL, West LA, Farese RV 1986 Luteinizing hormone stimulates the formation of inositol trisphosphate
and cyclic AMP in rat granulosa cells. Evidence for phospholipase C
generated second messengers in the action of luteinizing hormone.
Biochem J 238:597604[Medline]
-
Davis JS, Tedesco TA, West LA, Maroulis GB, Weakland
LL 1989 Effects of human chorionic gonadotropin, prostaglandin
F2 alpha and protein kinase C activators on the
cyclic AMP and inositol phosphate second messenger systems in cultured
human granulosa-luteal cells. Mol Cell Endocrinol 65:187193[CrossRef][Medline]
-
Braun AP, Schulman H 1995 The multifunctional
calcium/calmodulin-dependent protein kinase: from form to function.
Ann Rev Physiol 57:417445[CrossRef][Medline]
-
Sharma OP, Flores JA, Leong DA, Veldhuis JD 1994 Cellular basis for follicle-stimulating hormone stimulated calcium
signaling in single rat Sertoli cells: dissociation from cAMP effects.
Endocrinology 134:19151923[Abstract/Free Full Text]
-
Gorczynska E, Handelsman D 1991 The role of
calcium in follicle-stimulating hormone signal transduction in Sertoli
cells. J Biol Chem 266:2373923744[Abstract/Free Full Text]
-
Flores JA, Veldhuis JD, Leong DA 1990 Follicle
stimulating hormone evokes an increase in intracellular free calcium
ion concentrations in single ovarian (granulosa) cells. Endocrinology 127:31723179[Abstract/Free Full Text]
-
Flores JA, Leong DA, Veldhuis JD 1992 Is the
calcium signal induced by FSH in swine granulosa cells mediated by
adenosine 3',5'-cyclic monophosphate-dependent protein kinase A?
Endocrinology 130:18621866[Abstract/Free Full Text]
-
Grasso P, Reichert LE 1990 Follicle-stimulating
hormone receptor-mediated uptake of
45Ca2+ by cultured rat
Sertoli cells does not require activation of cholera toxin- or
pertussis toxin-sensitive guanine nucleotide binding proteins or
adenylate cyclase. Endocrinology 127:949955[Abstract/Free Full Text]
-
Adashi EY, Resnick CE, Jastorff A 1990 Blockade of
granulosa cell differential by an antagonistic analog of adenosine
3',5'-cyclic monophosphate (cAMP): central but non-exclusive
intermediary role of cAMP in follicle-stimulating hormone action. Mol
Cell Endocrinol 72:111[CrossRef][Medline]
-
Asem EK, Tsang BK 1988 The effect of kaurenol on
steroidogenesis and cyclic adenosine monophosphate production in rat
granulosa cells. Mol Cell Endocrinol 57:149156[CrossRef][Medline]
-
Veldhuis JD 1987 Mechanisms subserving hormone
action in the ovary: role of calcium ions as assessed by steady-state
calcium exchange in cultured swine granulosa cells. Endocrinology 120:445449[Abstract/Free Full Text]
-
Gorczynska E, Spaliviero J, Handelsman DJ 1996 Cyclic adenosine 3',5'-monophosphate-independent regulation of
cytosolic calcium in Sertoli cells. Endocrinology 137:26172625[Abstract]
-
Grasso P, Reichert Jr LE 1993 Induction of calcium
transport into cultured rat Sertoli cells and liposomes by
follicle-stimulating hormone. Recent Prog Horm Res 48:517521
-
Flores JA, Veldhuis JD, Leong DA 1991 Angiotensin
II induces calcium release in single ovarian (granulosa) cells. Mol
Cell Endocrinol 81:110[CrossRef][Medline]
-
Flores JA, Quyyumi S, Leong DA, Veldhuis JD 1992 Actions of endothelin-1 on swine ovarian (granulosa) cells.
Endocrinology 131:13501358[Abstract/Free Full Text]
-
Flores JA, Aguirre C, Veldhuis JD 1998 Luteinizing
hormone stimulates both intracellular calcium ion
([Ca2+]i) mobilization
and transmembrane cation influx in single ovarian (granulosa) cells:
recruitment as a cellular mechanism of
LH-[Ca2+]i dose-response.
Endocrinology 139:36063612[Abstract/Free Full Text]
-
Gorczynska E, Spaliviero J, Handelsman DJ 1994 The
relationship between 3',5'-cyclic adenosine monophosphate and calcium
in mediating follicle-stimulating hormone signal transduction in
Sertoli cells. Endocrinology 134:293300[Abstract/Free Full Text]
-
Hajnoczky G, Robb-Gaspers LD, Seitz MB, Thomas AP 1995 Decoding of cytosolic calcium oscillations in the mitochondria.
Cell 82:415424[CrossRef][Medline]
-
Cherradi N, Rossier MF, Vallotton MB, Timberg R,
Friedberg I, Orly J, Wang ZJ, Stocco DM, Capponi AM 1997 Submitochondrial distribution of three key steroidogenic proteins
(steroidogenic acute regulatory protein and cytochrome P450scc and
3ß-hydroxysteroid dehydrogenase isomerase enzymes) upon stimulation
by intracellular calcium in adrenal glomerulosa cells. J Biol Chem 272:78997907[Abstract/Free Full Text]
-
Birmingham MK, Elliott FH, Valere PH-L 1953 The
need for the presence of calcium for the stimulation in vitro of rat
adrenal glands by adrenocorticotrophic hormone. Endocrinology 53:687687
-
Clyne CD, White PC, Rainey WE 1996 Calcium
regulates human CYP11B2 transcription. Endocr Res 22:485492[Medline]
-
Capponi AM, Rossier MF, Davies E, Vallotton MB 1988 Calcium stimulates steroidogenesis in permeabilized bovine adrenal
cortical cells. J Biol Chem 263:1611316117[Abstract/Free Full Text]
-
Carnegie JA, Tsang BK 1984 The calcium-calmodulin
system: participation in the regulation of steroidogenesis at different
stages of granulosa cell differentiation. Biol Reprod 30:515522[Abstract]
-
Leung PC, Minegishi T, Wang J 1988 Inhibition of
follicle-stimulating hormone- and adenosine-3',5'-cyclic
monophosphate-induced progesterone production by calcium and protein
kinase C in the rat ovary. Am J Ob Gyn 158:350356
-
Marsh JM 1975 The role of cyclic AMP in gonadal
function. In: Greengard P, Robison GA (eds) Advances in Cyclic
Nucleotide Research. Raven Press, New York, pp 137167
-
Veldhuis JD, Klase PA, Demers LM, Chafouleas JG 1984 Mechanisms subserving calciums modulation of luteinizing hormone
action in isolated swine granulosa cells. Endocrinology 114:441449[Abstract/Free Full Text]
-
Veldhuis JD, Klase PA 1982 Calcium ions modulate
hormonally stimulated progesterone production in isolated ovarian
cells. Biochem J 202:381386[Medline]
-
Veldhuis JD, Klase PA 1982 Mechanisms by which
calcium ions regulate the steroidogenic actions of luteinizing hormone
in isolated ovarian cells in vitro. Endocrinology 111:16[Abstract/Free Full Text]
-
Veldhuis JD, Klase PA 1982 Role of calcium ions in
the stimulatory actions of luteinizing hormone in isolated ovarian
cells: studies with divalent-cation ionophores. Biochem Biophys Res
Comm 104:603610[CrossRef][Medline]
-
Veldhuis JD, Yoshida K, DuBois W, Fields MJ 1987 Maitotoxin stimulates steroid and peptide hormone secretion by swine
luteal tissue. Am J Physiol 252:E8E12
-
Alila HW, Davis JS, Dowd JP, Corradino RA, Hansel W 1990 Differential effects of calcium on progesterone production in
small and large bovine luteal cells. J Steroid Biochem 36:687693[CrossRef][Medline]
-
Nishikawa T, Omura M, Suematsu S 1997 Possible
involvement of calcium/calmodulin-dependent protein kinase in
ACTH-induced expression of the steroidogenic acute regulatory (StAR)
protein in bovine adrenal fasciculata cells. Endocr J 44:895898[Medline]
-
Houmard BS, Ottobre JS 1989 Progesterone and
prostaglandin production by primate luteal cells collected at various
stages of the luteal phase: modulation by calcium ionophore. Biol
Reprod 41:401408[Abstract]
-
Tsang BK, Carnegie JA 1983 Calcium requirement in
the gonadotropic regulation of rat granulosa cell progesterone
production. Endocrinology 113:763769[Abstract/Free Full Text]
-
Simpson ER, Lund J, Ahlgren R, Waterman MR 1990 Regulation by cyclic AMP of the genes encoding steroidogenic enzymes:
when the light finally shines. Mol Cell Endocrinol 70:C25C28
-
Urban RJ, Shupnik MA, Bodenburg YH 1994 Insulin-like growth factor-1 increases expression of the porcine P-450
cholesterol side chain cleavage gene through a GC-rich domain. J
Biol Chem 269:2576125769[Abstract/Free Full Text]
-
Maurer RA 1989 Both isoforms of the cAMP-dependent
protein kinase catalytic subunit can activate transcription of the
prolactin gene. J Biol Chem 264:68706873[Abstract/Free Full Text]
-
Day RN, Walder JA, Maurer RA 1989 A protein kinase
inhibitor gene reduces both basal and multihormone-stimulated prolactin
gene transcription. J Biol Chem 264:431436[Abstract/Free Full Text]
-
Fantozzi DA, Harootunian AT, Wen W, Taylor SS, Feramisco
JR, Tsien RY, Meinkoth JL 1994 Thermostable inhibitor of
cAMP-dependent protein kinase enhances the rate of export of the kinase
catalytic subunit from the nucleus. J Biol Chem 269:26762686[Abstract/Free Full Text]
-
Balasubramanian K, LaVoie HA, Garmey JC, Stocco DM,
Veldhuis JD 1997 Regulation of porcine granulosa cell
steroidogenic acute regulatory protein (StAR) by insulin-like growth
factor I: synergism with follicle-stimulating hormone or protein kinase
A agonist. Endocrinology 138:433439[Abstract/Free Full Text]
-
LaVoie HA, Garmey JC, Day RN, Veldhuis JD 1999 Concerted regulation of low density lipoprotein receptor gene
expression by follicle-stimulating hormone and insulin-like growth
factor I in porcine granulosa cells: promoter activation, messenger
ribonucleic acid stability, and sterol feedback. Endocrinology 140:178186[Abstract/Free Full Text]
-
LaVoie HA, Garmey JC, Veldhuis JD 1999 Mechanisms
of insulin-like growth factor I augmentation of follicle-stimulating
hormone-stimulated porcine steroidogenic acute regulatory protein gene
promoter activity in granulosa cells. Endocrinology 140:146153[Abstract/Free Full Text]
-
LaVoie HA, Benoit AM, Garmey JC, Dailey RA, Wright DJ,
Veldhuis JD 1997 Coordinate developmental expression of genes
regulating sterol economy and cholesterol side-chain cleavage in the
porcine ovary. Biol Reprod 57:402407[Abstract]
-
Singer VL, Jones LJ, Yue ST, Haugland RP 1997 Characterization of PicoGreen reagent and development of a
fluorescence-based solution assay for double-stranded DNA quantitation.
Anal Biochem 249:228238[CrossRef][Medline]
-
Ahn SJ, Costa J, Emanuel JR 1996 PicoGreen
quantitation of DNA: effective evaluation of samples pre- or post-PCR.
Nucleic Acids Res 24:26232625[Free Full Text]
-
Leung PCK, Wang J, Baimbridge JG 1989 Mechanism of
action of luteinizing hormone releasing hormone in rat ovarian cells.
Can J Physiol Pharmacol 67:962967[Medline]
-
Flores JA, Veldhuis JD 1995 Culture of ovarian
granulosa cells for calcium imaging at the single cell level. In: Celis
JE (ed). Cell Biology. Academic Press, pp 170175
-
Lehoux JG, Lefebvre A 1998 Transcriptional activity
of the hamster CYP11B2 promoter in NCI-H295 cells stimulated by
angiotensin II, potassium, forskolin and bisindolylmaleimide. J Mol
Endocrinol 20:183191[Abstract]
-
Bading H, Hardingham GE, Johnson CM, Chawla S 1997 Gene regulation by nuclear and cytoplasmic calcium signals. Biochem
Biophys Res Commun 236:543
-
Bito H 1998 The role of calcium in
activity-dependent neuronal gene regulation. Cell Calcium 23:143150[CrossRef][Medline]
-
Crabtree GR, Clipstone NA 1994 Signal transmission
between the plasma membrane and nucleus of T lymphocytes. Ann Rev
Biochem 63:10451083[CrossRef][Medline]
-
Bird IM, Mathis JM, Mason JI, Rainey WE 1995 Ca2+-regulated expression of steroid hydroxylases
in H295R human adrenocortical cells. Endocrinology 136:56775684[Abstract]
-
Nishizuka Y 1995 Protein kinase C and lipid
signaling for sustained cellular responses. FASEB J 9:484496[Abstract]
-
Begeot M, Shetty U, Kilgore M, Waterman M, Simpson
ER 1993 Regulation of expression of the CYP11A
(P450scc) gene in bovine ovarian luteal cells by
forskolin and phorbol esters. J Biol Chem 268:1731717325[Abstract/Free Full Text]
-
Brentano ST, Picardo-Leonard J, Mellon SH, Moore CCD,
Miller WL 1989 Tissue-specific, cyclic adenosine
3',5'-monophosphate-induced, and phorbol ester-repressed transcription
from the human P450c17 promoter in mouse cells. Endocrinology 4:19721979
-
McAllister JM, Hornsby PJ 1988 Dual regulation of 3
beta-hydroxysteroid dehydrogenase, 17 alpha-hydroxylase, and
dehydroepiandrosterone sulfotransferase by adenosine
3',5'-monophosphate and activators of protein kinase C in cultured
human adrenocortical cells. Endocrinology 122:20122018[Abstract/Free Full Text]
-
Reyland ME 1993 Protein kinase C is a tonic
negative regulator of steroidogenesis and steroid hydroxylase gene
expression in Y1 adrenal cells and functions independently of
protein kinase A. Mol Endocrinol 7:10211030[Abstract/Free Full Text]
-
Lahav M, Garmey JC, Shupnik MA, Veldhuis JD 1996 Dual actions of phorbol ester on cytochrome P450 cholesterol side-chain
cleavage messenger ribonucleic acid accumulation in granulosa cells.
Biol Reprod 52:972981[Abstract]
-
Flores JA, Garmey JC, Lahav M, Veldhuis JD 1999 Mechanisms underlying endothelins inhibition of FSH-stimulated
progesterone production by porcine ovarian granulosa cells. Mol Cell
Endocrinol 156:169178[CrossRef][Medline]
-
Davis JRE, Vidal ME, Wilson EM, Sheppard MC 1988 Calcium dependence of prolactin mRNA accumulation in GH3 rat pituitary
tumor cells. J Mol Endocrinol 1:111116[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
R. C. Seals, R. J. Urban, N. Sekar, and J. D. Veldhuis
Up-Regulation of Basal Transcriptional Activity of the Cytochrome P450 Cholesterol Side-Chain Cleavage (CYP11A) Gene by Isoform-Specific Calcium-Calmodulin-Dependent Protein Kinase in Primary Cultures of Ovarian Granulosa Cells
Endocrinology,
December 1, 2004;
145(12):
5616 - 5622.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Agoston, L. Kunz, A. Krieger, and A. Mayerhofer
Two Types of Calcium Channels in Human Ovarian Endocrine Cells: Involvement in Steroidogenesis
J. Clin. Endocrinol. Metab.,
September 1, 2004;
89(9):
4503 - 4512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. H. Ireland, F. Jimenez-Krassel, M. E. Winn, D. S. Burns, and J. J. Ireland
Evidence for Autocrine or Paracrine Roles of {alpha}2-Macroglobulin in Regulation of Estradiol Production by Granulosa Cells and Development of Dominant Follicles
Endocrinology,
June 1, 2004;
145(6):
2784 - 2794.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E.V. Younglai, T. K. Kwan, C.-Y. Kwan, D.K. Lobb, and W.G. Foster
Dichlorodiphenylchloroethylene Elevates Cytosolic Calcium Concentrations and Oscillations in Primary Cultures of Human Granulosa-Lutein Cells
Biol Reprod,
June 1, 2004;
70(6):
1693 - 1700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Henson and P. J. Chedrese
Endocrine Disruption by Cadmium, a Common Environmental Toxicant with Paradoxical Effects on Reproduction
Experimental Biology and Medicine,
May 1, 2004;
229(5):
383 - 392.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. V. Younglai, A. C. Holloway, G. E. Lim, and W. G. Foster
Synergistic effects between FSH and 1,1-dichloro-2,2-bis(P-chlorophenyl)ethylene (P,P'-DDE) on human granulosa cell aromatase activity
Hum. Reprod.,
May 1, 2004;
19(5):
1089 - 1093.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Shih, S. Zhang, H. J. Cao, H.-Y. Tang, F. B. Davis, P. J. Davis, and H.-Y. Lin
Disparate Effects of Thyroid Hormone on Actions of Epidermal Growth Factor and Transforming Growth Factor-{alpha} Are Mediated by 3',5'-Cyclic Adenosine 5'-Monophosphate-Dependent Protein Kinase II
Endocrinology,
April 1, 2004;
145(4):
1708 - 1717.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. D. Smida, X. P. Valderrama, M. C. Agostini, M. A. Furlan, and J. Chedrese
Cadmium Stimulates Transcription of the Cytochrome P450 Side Chain Cleavage Gene in Genetically Modified Stable Porcine Granulosa Cells
Biol Reprod,
January 1, 2004;
70(1):
25 - 31.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. O. Arellano, A. Martinez-Torres, and E. Garay
Ionic Currents Activated via Purinergic Receptors in the Cumulus Cell-Enclosed Mouse Oocyte
Biol Reprod,
September 1, 2002;
67(3):
837 - 846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Manikkam, Y. Li, B. M. Mitchell, D. E. Mason, and L. C. Freeman
Potassium Channel Antagonists Influence Porcine Granulosa Cell Proliferation, Differentiation, and Apoptosis
Biol Reprod,
July 1, 2002;
67(1):
88 - 98.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. K. Asem, W. Qin, and S. G. Rane
Effect of basal lamina of ovarian follicle on T- and L-type Ca2+ currents in differentiated granulosa cells
Am J Physiol Endocrinol Metab,
January 1, 2002;
282(1):
E184 - E196.
[Abstract]
[Full Text]
[PDF]
|
 |
|