help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jayes, F. C. L.
Right arrow Articles by Veldhuis, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jayes, F. C. L.
Right arrow Articles by Veldhuis, J. D.
Endocrinology Vol. 141, No. 7 2377-2384
Copyright © 2000 by The Endocrine Society


ARTICLES

Calcium Ions Positively Modulate Follicle-Stimulating Hormone- and Exogenous Cyclic 3',5'-Adenosine Monophosphate-Driven Transcription of the P450scc Gene in Porcine Granulosa Cells1

F. C. L. Jayes, R. N. Day, J. C. Garmey, R. J. Urban, G. Zhang and J. D. Veldhuis

Division of Endocrinology (F.C.L.J., R.N.D., J.C.G., G.Z., J.D.V.), Department of Internal Medicine or Cell Biology (F.C.L.J.), NIH Specialized Cooperative Center in Reproduction Research, University of Virginia Health Sciences Center, Charlottesville, Virginia 22908; and Department of Medicine (R.J.U.), University of Texas Medical Branch, Galveston, Texas 77555

Address all correspondence and requests for reprints to: Johannes D. Veldhuis, M.D., Division of Endocrinology, Department of Internal Medicine, University of Virginia Health System, P.O. Box 800202, Charlottesville, Virginia 22908-0202. E-mail: jdv{at}virginia.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Given the evident modulation of FSH-induced steroidogenesis by Ca2+ in granulosa cells, we here test the hypothesis that Ca2+ controls expression of the enzymatically rate-limiting cytochrome P450scc (CYP11A) gene. To test this postulate, we quantitated the ability of Ca2+ to regulate: 1) transcriptional activity of a transiently transfected luciferase reporter gene driven by a 2.32-kb 5'-upstream fragment of the porcine P450scc gene promoter region; and 2) accumulation of endogenous P450scc transcripts in primary monolayer cultures of porcine granulosa cells. To this end, granulosa cells were stimulated for 4 h with FSH (15 ng/ml, NIDDK-oFSH-20) or 8-Bromo-cAMP (8 Br-cAMP, 1 mM) in serum-free medium containing either 1.8 mM Ca2+ or no added Ca2+ with 100 µM EGTA or 100 µM CoCl2. In the presence of extracellular Ca2+, FSH and 8 Br-cAMP stimulated expression of the transfected P450scc promoter-reporter fusion construct by 5.6 ± 1.1 and 3.6 ± 0.67-fold, respectively over Ca2+-containing unstimulated control (P <= 0.04, n = 5–6 experiments). The foregoing two agonists augmented 4-h progesterone production by cultured granulosa cells by 1.8 ± 0.11 and 1.6 ± 0.16-fold, respectively (P <= 0.001 for FSH and P <= 0.01 for 8 Br-cAMP). FSH and 8 Br-cAMP also significantly elevated endogenous P450scc transcript levels as measured by homologous solution-hybridization RNase protection assay; i.e. by 3.1 ± 0.49 and 2.9 ± 0.45-fold, respectively (P <= 0.001). In Ca2+-free/EGTA-supplemented medium, basal luciferase reporter-gene activity and endogenous P450scc messenger RNA accumulation in granulosa cells declined to 34 ± 12% and 78 ± 12%, respectively, of corresponding values in control (unstimulated Ca2+-containing) cultures. Extracellular Ca2+ deprivation inhibited the stimulatory effect of FSH (and 8 Br-cAMP) on P450scc promoter-luciferase reporter expression to 58 ± 30% (and 58 ± 23%), and restrained endogenous P450scc message accumulation to 86 ± 15% (and 96 ± 18%) of the value in Ca2+-containing control. Extracellular Ca2+ withdrawal suppressed FSH (and 8 Br-cAMP)-driven progesterone production over 4 h to basal levels but did not alter FSH-stimulated cAMP accumulation by granulosa cells. Ca2+-deprived cells exposed to serum-containing media regained P450scc responsiveness to both agonists. Antagonism of cellular uptake of Ca2+ and other divalent cations via administration of cobalt chloride (100 µM) inhibited FSH and 8 Br-cAMP’s stimulation of endogenous (but not exogenous promoter-driven) P450scc gene expression. In contrast, granulosa-cell concentrations of messenger RNA’s encoding sterol-carrier protein-2 (SCP-2) and the low density lipoprotein receptor were not altered by Ca2+ withdrawal.

In summary, uptake of extracellular Ca2+ by porcine granulosa cells significantly potentiates transactivation of the endogenously expressed and exogenously transfected P450scc gene by FSH and 8 Br-cAMP. The agonistic impact of Ca2+ on P450scc promoter activity is requisite downstream of FSH-induced cAMP second-messenger signaling.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE HYPOTHALAMO-PITUITARY-GONADAL AXIS comprises an in vivo feedback-control network supervised by both inter and intraglandular signaling. At the ovarian level, actions of the primary gonadotropic hormones, FSH and LH, govern cell proliferation, cytodifferentiation and ovulation via specialized intracellular signaling cascades (1, 2, 3). Among the well-studied signaling modes are the adenylyl cyclase-cAMP-PKA and the Ca2+-phospholipase C-inositol triphosphate-PKC transduction systems. Both of these effector pathways can be activated by LH in granulosa-luteal cells (4, 5, 6). On the other hand, FSH receptors seem to be coupled primarily to the PKA distal effector pathway (7, 8, 9, 10, 11, 12). cAMP is not solely responsible for FSH-stimulated steroidogenesis because inhibition of the cAMP signaling pathway reduces but does not abolish FSH action (13), and, conversely, steroidogenesis can be augmented in granulosa cells without increasing cAMP (14). Indeed, FSH can concomitantly drive transmembrane 45Ca2+ exchange and Ca2+ influx into granulosa cells, and thereby induce a sustained elevation in intracellular concentrations of Ca2+ ([Ca2+]i) (10, 11, 15). FSH’s activation of [Ca2+]i signaling can be distinguished readily from its stimulation of adenylyl cyclase, because neither activation nor inhibition of the cAMP/PKA pathway promotes analogous Ca2+ exchange and/or Ca2+ uptake by gonadal cells (8, 10, 11, 12, 16, 17). The ability of FSH to stimulate delayed Ca2+ entry in porcine granulosa cells is hormone specific, inasmuch as other agonists, such as LH, angiotensin II and endothelin 1, elicit mechanistically different [Ca2+]i waveforms in the same cells (18, 19, 20).

In spite of the consistent ability of FSH to promote Ca2+ influx in both testicular (Sertoli) and ovarian (granulosa) cells (8, 10, 11, 16, 21), the distal intracellular targets of this [Ca2+]i second-messenger signal are sparingly understood. Recognized steroidogenic and/or mitochondrial effects of Ca2+ in nonovarian cells include stimulation of pregnenolone biosynthesis, potentiation of mitochondrial NADP-NADPH redox cycling, and enhanced expression of the steroidogenic acute regulatory (StAR) protein and aldosterone synthase (CYP11B2) gene in normal and transformed adrenal cells (22, 23, 24, 25, 26, 27, 28, 29).

Experiments using sheep, rat, or swine granulosa-luteal cells indicate that the gonadotropin-stimulated biosynthesis of pregnenolone and progesterone is linked to Ca2+ in several ways. Augmented steroidogenesis is: dependent on the availability of extracellular Ca2+; blocked by putative inhibitors of calmodulin (e.g. trifluoperazine and the naphthalenesulfonamide, W-7); and enhanced by liposomal delivery of Ca2+-activated calmodulin or administration of the Ca2+-iontophoretic dinoflagellate toxin, maitotoxin (30, 31, 32, 33, 34, 35, 36, 37, 38). In aggregate, the foregoing data allow the conjecture that FSH-driven Ca2+ uptake by granulosa cells may enhance the expression of one or more steroidogenic genes, such as cytochrome P450scc.

Previous studies have identified negative regulation of the transfected P450scc gene promoter by the phorbol or LH-activated Ca2+-dependent phospholipase C-PKC effector pathway in target cells; e.g. in JEG placental, Y-1 adrenal, MA-10 Leydig, H295R adrenal, and human granulosa cells (39). In contradistinction to the PKC pathway stimulated by LH, we hypothesized that the [Ca2+]i signal elicited by the FSH stimulus in ovarian cells controls the expression of P450scc positively. To test this notion, we here examine regulation by Ca2+ of FSH and exogenous cAMP-stimulated P450scc gene transactivation in primary cultures of porcine granulosa cells. We use a homologous solution-hybridization RNase protection assay to monitor endogenous P450scc transcript accumulation, and a chimeric 2.32 kb 5'-upstream porcine P450scc gene promoter fragment driving a luciferase reporter to assess Ca2+-dependent control of P450scc gene transcription.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Granulosa cell cultures
Approximately 200–300 ovaries per batch were obtained from immature (55–70 kg) swine slaughtered at a local abattoir. Ovaries were removed immediately and transported to the laboratory in an iced saline solution. Granulosa cells were aspirated from 1 to 5 mm follicles, washed by centrifugation in Eagle’s MEM and plated at an initial density of 1 x 106 cells/cm2 in MEM supplemented with antibiotics, 3% FBS, porcine insulin (3 µg/ml), and FSH (10 ng/ml) to allow anchorage overnight at 37 C in 5% CO2. Approximately 21 h after seeding, medium was replaced with serum-free MEM and cells were transiently transfected or under went identical media changes. Granulosa cells were then stimulated for 4 h with vehicle, FSH or 8-Bromo-cAMP (8 Br-cAMP) in defined media containing 1.8 mM Ca2+ or lacking Ca2+ with addition of 100 µM EGTA or 100 µM CoCl2. Twelve-well culture plates were used in gene reporter-assay experiments (3 wells per treatment), and larger (6-cm diameter) culture dishes to quantitate concentrations of endogenous messenger RNA (mRNA) (two dishes per treatment). Preliminary experiments were performed to optimize the time course of the experimental set up for reporter gene expression.

To show that granulosa cells regain responsiveness and are not permanently damaged by the exposure to Ca2+-free media, we carried out some experiments in which cells were allowed to recover from the exposure to Ca2+ free/EGTA containing medium before they were treated with effector agents. Conditions differed from the main experiments in the following details: cells were cultured as described above, but not stimulated with effector agents during the 4-h period in Ca2+ free medium. Subsequently, cells were cultured for 4 h in recovery medium (MEM containing antibiotics and FBS), followed by effector treatment in serum free MEM for 4 h (optimized to detect luciferase responses) or 16 h (optimized to detect progesterone responses).

Transient transfection
Primary monolayer cultures of granulosa cells in 12-well plates were transfected for 6 h in serum-free MEM with 12 µl LipofectAMINE (Life Technologies, Inc., Grand Island, NY) and 2 µg of plasmid DNA to fix the DNA/LipofectAMINE ratio. All cells received 1 µg of a luciferase reporter plasmid driven by 2320 bp of the porcine P450scc promoter (40). In addition, some cells received 0.8 µg RSV-driven PKA ß-catalytic subunit (41) and 0.2 µg RSV-PKI (rabbit PKA inhibitor minigene) (42, 43). The filler-plasmid (pUC19) was used to make up the difference to 2 µg total transfected DNA. After incubation at 37C for 6 h in 5% CO2, the serum-free LipofectAMINE/DNA solution was replaced with MEM containing antibiotics and 3% serum for 18 h to allow cell recovery. Cultures were exposed to the effectors of interest (below) for 4 h, and then lysed (Luciferase Assay System, Promega Corp., Madison, WI) for the later assay of luciferase activity (Promega Corp., Turner TD20e luminometer) and protein (Bradford, Bio-Rad Laboratories, Inc., Hercules, CA).

Solution hybridization/RNase protection assays
Granulosa cells anchored in 6-cm dishes underwent the above media changes, but were not exposed to DNA or LipofectAMINE (sham transfection). Cells were then exposed for 4 h to effector agents (below) before media were removed for the later assay of progesterone and/or cAMP by RIA (44, 45, 46). Granulosa cells were harvested by lysis with TRI-reagent (Molecular Research Center, Inc., Cincinnati, OH) and RNA was harvested, exactly as described earlier (46, 47). A partial pig complementary DNA (cDNA) encoding the catalytically active region of the P450scc enzyme was used as template for in vitro transcription of high specific activity 32P-labeled riboprobes (45, 47) (Maxiscript Kit, Ambion, Inc., Austin, TX) and endogenous P450scc m-RNA was assayed using the RPA II Kit (Ambion, Inc.). Gels (Fig. 1Go) were quantitated using phosphorscreen autoradiography and ImageQuant software (Molecular Dynamics, Inc., Sunnyvale, CA). As an internal marker, 18S rRNA was also quantitated in each lane (45, 46).



View larger version (92K):
[in this window]
[in a new window]
 
Figure 1. Representative autoradiogram showing the impact of extracellular Ca2+ deprivation (see Materials and Methods) on the FSH or 8 Br-cAMP stimulated accumulation of endogenous P450scc mRNA as measured by RNase protection assay. 18S rRNA from the same cells served as an internal loading standard.

 
To evaluate expression of the low density lipoprotein (LDL)-receptor and sterol carrier protein (SCP-2) genes, homologous RT-PCR was applied with appropriate forward and reverse primer sequences. For the LDL receptor, the forward primer sequence was GACGAGGAGAACTGCGATGT and that for reverse primer: GGCACTCATAGCCGATCTTG. Corresponding primer sequences for SCP-2 were (forward) GGTGGTGGACGTGAAGAA and (reverse) AAGAAGGCCAACTGAGGA. The resultant PCR products were 337 bp (LDL receptor) and 135 bp (SCP-2), respectively. Quantities of specific cDNAs within the linear range of the PCR amplification curves were quantitated by picogreen dye, as described earlier (48, 49).

Effector agents
Granulosa cells were stimulated with FSH (15 ng/ml NIDDK-oFSH-20) or 8 Br-cAMP (1 mM, Sigma Corp., St. Louis, MO). These effectors were diluted in defined medium (127 mM NaCl, 5 mM KCl, 2 mM MgCl, 0.5 mM KH2PO4, 10 mM HEPES, 10 mM glucose, 0.1% BSA, 5 mM NaHCO3) containing 1.8 mM CaCl2 or 100 µM CoCl2 (to block uptake of divalent ions), or 100 µM EGTA (as a calcium chelator) because Ca2+-free medium still contains approximately 10 µM Ca2+. Before treating cells with FSH or 8 Br-cAMP all cultures were washed with PBS for 20 min. Cells to be treated in the presence of CoCl2 were washed with PBS containing 100 µM CoCl2.

Statistical analysis
All experiments were repeated 3–6 times with different batches of ovaries. Results from each experiment were expressed as fold-change relative to the Ca2+-containing vehicle stimulated controls. Data were natural-logarithm transformed and analyzed by one way ANOVA and Tukey’s HSD (honestly significantly different) post hoc test (SYSTAT Software, SPSS, Inc., Chicago, IL). Significance was construed for P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Preliminary experiments were carried out to corroborate porcine 2.32 kb P450scc promoter-driven luciferase responsiveness to FSH and cotransfected PKA, a minigene encoding the constitutively active ß catalytic subunit of PKA (41). As shown in Table 1Go, FSH and the PKA minigene each elevated luciferase expression by approximately 4.4-fold (n = 3–6 experiments). Cotransfection of PKI (42), with FSH stimulation or with PKA, inhibited luciferase expression to values no different from basal. Accordingly, the porcine 2.32 kb P450scc promoter fragment responded with expected PKA induction and PKI inhibition of FSH action.


View this table:
[in this window]
[in a new window]
 
Table 1. Responsiveness of the porcine 2.32 kb P450scc promoter-luciferase gene reporter construct to FSH and PKA in a PKI-inhibitable fashion

 
In Ca2+-replete medium, FSH and 8 Br-cAMP increased P450scc-promoter driven luciferase (Luc) activity in granulosa cells over a 4-h interval by 5.6 ± 1.1 and 3.6 ± 0.67-fold over control (n = 5–6 experiments, P <= 0.04): Fig. 2Go. Expression of endogenous P450scc mRNA, as quantitated by RNase protection assay (Fig. 1Go), was stimulated 3.1 ± 0.49 and 2.9 ± 0.45-fold by FSH and 8 Br-cAMP, respectively (P <= 0.001): Fig. 3Go. Progesterone production rose concomitantly by 1.8 ± 0.11 and 1.6 ± 0.16-fold, respectively (Fig. 4Go; P <= 0.01). Production of cAMP was increased to 166 ± 55-fold after treatment with FSH (Fig. 5Go; P <= 0.001).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 2. Extracellular Ca2+ availability is necessary for FSH (15 ng/ml) and 8 Br-cAMP (1.0 mM)-stimulated expression of a luciferase reporter gene driven by a 2.32 kb 5'-upstream promoter fragment of the (pig) P450scc gene in transiently transfected porcine granulosa cells. Granulosa cells were stimulated with the indicated effectors for 4 h. Data are the mean ± SEM (n = 3–6 separate experiments) normalized against the Ca2+-containing vehicle-stimulated control values within each experiment. *, P <= 0.04, ***, P <= 0.001 vs. control in the same medium. a P <= 0.05 vs. control in Ca2+-containing medium.

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 3. Corresponding changes in the accumulation of endogenous P450scc mRNA over 4 h in swine granulosa cells studied under the conditions described in Fig. 2Go. ***, P <= 0.001 vs. control in the same medium.

 


View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. Four-hour production of progesterone by granulosa cells incubated under the conditions shown in Fig. 2Go. **, P <= 0.01; ***, P <= 0.001 vs. control in the same medium.

 


View larger version (47K):
[in this window]
[in a new window]
 
Figure 5. Impact of EGTA or Co2+ (each at a final concentration of 100 µM) in Ca2+-free medium on FSH-stimulated cAMP accumulation over 4 h in monolayer cultures of swine granulosa cells. Data are the mean ± SEM (n = 3–5 separate experiments). Unshared superscripts denote significantly different means (P <= 0.001).

 
In Ca2+-free/EGTA-supplemented medium, basal luciferase activity (Fig. 2Go) in transfected granulosa cells declined to 34 ± 12% of Ca2+-containing control cultures (P < 0.04). Activity could not be stimulated by FSH or 8 Br-cAMP over 4 h in Ca2+-depleted/EGTA medium, wherein reporter-gene luciferase activity was 58 ± 30% and 58 ± 23% of basal (vehicle stimulated) Ca2+-containing control, respectively (P > 0.4). Basal endogenous P450scc mRNA levels (Fig. 3Go) in Ca2+-depleted/EGTA medium were only 78 ± 12% of Ca2+-containing control and were not stimulated by FSH (86 ± 15%) or 8 Br-cAMP (96 ± 18%). Ca2+ withdrawal also eliminated FSH and 8 Br-cAMP-driven increases in progesterone (Fig. 4Go), which were respectively 108 ± 7% and 106 ± 4% (P > 0.9) of control. Stimulation of cAMP production by FSH was not impaired in Ca2+-free/EGTA medium and reached 176 ± 89-fold basal (Fig. 5Go; P < 0.001). In contrast to P450scc mRNA accumulation, basal levels of endogenously expressed LDL-receptor and SCP-2 transcripts were unaffected by Ca2+ deprivation with EGTA, Co2+, or Ni2+ (Table 2Go; n = 3 experiments each). Ca2+-depleted cells that were allowed to recover after Ca2+-withdrawal for 4 h in serum-containing medium (see Materials and Methods) regained responsiveness to stimulation with FSH or 8 Br-cAMP in MEM without serum, and showed 2.2 to 3.6-fold increases in the foregoing three measures: Table 3Go.


View this table:
[in this window]
[in a new window]
 
Table 2. Ca2+ withdrawal does not alter basal expression of LDL-receptor and SCP-2 mRNA in monolayer cultures of porcine granulosa cells

 

View this table:
[in this window]
[in a new window]
 
Table 3. Recovery of granulosa cell responsiveness to stimulation with FSH or 8 Br-cAMP after previous Ca2+ deprivation for 4 h1

 
Results obtained using Ca2+-free medium supplemented with Co2+ (100 µM), which was used to block uptake of both Ca2+ and nonCa2+ divalent cations, were similar but not identical to results from Ca2+ free/EGTA media. In particular, FSH-stimulated luciferase production in Co2+-supplemented media increased 5.3 ± 1.4-fold compared with Ca2+ containing control (P < 0.012; P > 0.14 vs. control in same medium). The 8 Br-cAMP-induced response tended to increase by 3.1 ± 0.4-fold compared with Ca2+-containing control (P < 0.18; P > 0.67 vs. control in same medium).

Progesterone and cAMP accumulation from cells cultured in 12-well plates (transfection experiments) were obtained in parallel (data not shown). All values were analogous to data obtained from cells cultured in 6-cm dishes (Figs. 4Go and 5Go).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present in vitro studies imply a role for the poorly understood FSH-induced increase of intracellular Ca2+ and are consistent with the thesis that cellular Ca2+ uptake potentiates FSH (and 8 Br-cAMP)-stimulated transactivation of the P450scc gene in (porcine) granulosa cells. The cellular entry of Ca2+ positively regulated both exogenous P450scc promoter-driven luciferase activity and the FSH-stimulated accumulation of endogenous P450scc mRNA. In contrast, extracellular Ca2+ availability did not significantly modulate FSH-enhanced cAMP production in granulosa cells, thereby pointing to preservation of FSH receptor-transduced activation of adenylyl cyclase and/or phosphodiesterase activity in the face of Ca2+ withdrawal. Restraint of granulosa-cell Ca2+-uptake (e.g. with a potent and selective Ca2+ chelator, EGTA) likewise impeded stimulation of exogenous and endogenous P450scc gene expression as driven by a potent phosphodiesterase-resistant and cell-permeable analog of cAMP (8 Br-cAMP).

In the Ca2+-withdrawn milieu, neither FSH nor 8 Br-cAMP elicited expected (5.6- and 3.6-fold, respectively) transcriptional activation of a transiently transfected 2.3 kb P450scc promoter-fragment fused to a luciferase reporter gene. The latter chimeric plasmid responded by 4.4-fold to a co-transfected PKA ß-catalytic subunit minigene in a PKI-inhibitable fashion (Table 1Go). The Ca2+ dependence of FSH-stimulated transactivation of the transfected P450scc promoter-reporter construct in granulosa cells was not an artefact of the particular chimeric vector used because the accumulation of endogenous P450scc transcripts was also strongly Ca2+ dependent. Indeed, inhibition of granulosa-cell Ca2+ uptake reduced FSH’s expected stimulation of endogenous P450scc mRNA from 310% to 86%. The basal dependence of P450scc gene expression on Ca2+ uptake was specific because granulosa-cell concentrations of endogenous LDL-receptor and SCP-2 transcripts were independent of Ca2+ deprivation over the same time interval. In addition, the suppressive effect of Ca2+ withdrawal on agonist-stimulated P450scc gene transcription was reversible upon reexposure to Ca2+ (Table 3Go). Accordingly, the present experiments demonstrate a positive regulatory effect of Ca2+ on FSH-amplified expression of the (endogenous) granulosa-cell P450scc gene and on activation of an exogenous P450scc promoter.

Previous fluorescence videomicroscopic analyses of [Ca2+]i in single porcine granulosa cells have established that FSH typically elicits a slow (1–3 min onset) and sustained (5–15 min) elevation of [Ca2+]i in approximately 85% of granulosa cells (10, 11). This gonadotropin evokes an analogous [Ca2+]i signal in Sertoli cells (8, 17, 50). In contrast, LH elicits a rapid-onset biphasic (spike-and-plateau) rise in [Ca2+]i in granulosa cells (20). Thus, the FSH-stimulated [Ca2+]i waveform is gonadotropin-specific. The FSH-promoted rise in [Ca2+]i in gonadal cells is blocked by addition of (extracellular) EGTA, Co2+ or Ni2+, which points to its immediate dependence on extracellular Ca2+ uptake, as corroborated more directly in Sertoli cells by manganese quench analysis (8, 51). Accordingly, in the present experiments, we used two of these agents (EGTA and Co2+) to antagonize FSH-stimulated Ca2+ entry into granulosa cells, and thereby probe the hypothesized role of Ca2+ uptake in agonist-stimulated P450scc gene expression. To assess response specificity, we showed unaltered FSH-stimulated cAMP accumulation, reversibility of inhibited P450scc expression, and stability of 18S rRNA and both SCP-2 and LDL-receptor mRNA accumulation in the face of Ca2+ removal. Complementary studies using 8 Br-cAMP as a non-FSH receptor-dependent stimulus of the PKA pathway disclosed a strong Ca2+ dependence of 8 Br-cAMP actions as well. Thus, actions of Ca2+ are likely exerted at one or more sites that include and/or are distal to (FSH’s) activation of the PKA pathway in granulosa cells.

Other earlier investigations of Ca2+-dependent control of aldosterone synthase (CYP11B2) in adrenal cells (25, 52) are thematically consistent with our inference that expression of the P450scc gene is Ca2+ dependent. The former essential gene in mineralocorticoid biosynthesis also manifests Ca2+-dependence at the transcriptional level. Although the precise cis-acting DNA elements that confer positive regulation by Ca2+ have not yet identified in either gene, the pig P450scc gene promoter region contains several candidate cis-acting DNA sequences (40), each of which can mediate genomic effects of Ca2+ at least in other nonexcitable or excitable cell types (25, 52, 53, 54, 55). Clarifying the nature of cis-acting DNA control elements and trans-acting mechanisms that mediate the Ca2+-responsive expression of such steroid-hydroxylating genes should help in ultimately unraveling their multivariant regulation (26, 56).

The Ca2+-dependence of both FSH and 8 Br-cAMP-stimulated transactivation of the endogenous gene and exogenously transfected P450scc promoter in granulosa cells should be distinguished from previous reports of either stimulatory or inhibitory effects of various PKC effectors on the expression of several steroidogenic genes (39). For example, phorbol myristate acetate (TPA) can activate or down-regulate conventional and novel (but not atypical) PKC isotypes (57), and also positively (e.g. 3-ß hydroxysteroid dehydrogenase and sulfotransferase) or negatively (e.g. CYP17, CYP19, CYP11A1, CYP11B2) control steroidogenic gene expression (52, 58, 59, 60, 61). Although FSH is not known to stimulate PKC activity in granulosa cells (7, 8, 9, 11), effectors of the PKC pathway can significantly enhance (at 4–6 h) and then down-regulate (at 18–48 h) FSH-stimulated P450scc gene expression in ovarian cells (62, 63). Thus, the ability of Ca2+ to selectively potentiate FSH/cAMP’s stimulation of P450scc gene transcription in granulosa cells differs from PKC-associated bidirectional regulation of this and other steroidogenic genes. Studies using various inhibitors of Ca2+-activated calmodulin, Ca2+ iontophoresis and liposomal delivery of Ca2+-calmodulin currently suggest but do not prove a possible role for calmodulin and/or its kinases in Ca2+-dependent modulation of FSH action (30, 31, 32, 33, 34, 35, 36, 37, 38).

An unexpected but reproducible observation in the present experiments was that EGTA (100 µM) but not Co2+ (100 µM) consistently inhibited FSH and 8 Br-cAMP-stimulated transcription of an exogenous P450scc promoter luciferase-reporter fusion construct. On the other hand, both EGTA and Co2+ suppressed FSH/8 Br-cAMP’s stimulation of endogenous P450scc gene expression in granulosa cells (see Results). If these differences reflect the expected ability of Co2+ to impede cellular entry of multiple divalent cations (51), then the foregoing distinction could indicate that uptake of some nonCa2+ (but Co2+-inhibitable) divalent cations may partially antagonize maximal agonist-induced expression of the endogenous P450scc gene. Alternatively, EGTA may more effectively deplete intracellular Ca2+ concentrations (which may restrain both endogenous and exogenous promoter expression), whereas Co2+ may do so to a lesser degree (and thus limit only endogenous promoter expression). We optimized experimental conditions for the endpoint of reporter plasmid expression, which may overestimate gene activation due to the sensitivity of the luciferase assay and the presence of high copy numbers of the plasmid relative to the endogenous gene. It is also possible that the exogenous 2.32 kb 5'-upstream P450scc promoter fragment employed here in transcriptional assays does not contain all divalent cation-responsive regions represented in the native (endogenous) full-length P450scc gene, including a potentially inhibitory site. Cobalt ions might also enter the cell and potentially influence endogenous P450scc-mRNA accumulation, but not P450scc transcriptional activation per se and/or translation of luciferase mRNA. Lastly, in some cell types Ca2+ appears to influence transcript elongation, stabilization, processing and/or turnover (54, 55, 64).

In summary, the present experiments indicate that FSH and presumptive biochemical activation of PKA by way of 8 Br-cAMP effectively drive expression of both the endogenous gene and an exogenous P450scc promoter fragment in swine granulosa cells via Ca2+-potentiated mechanisms. Transient transfection of a pig P450scc promoter luciferase-reporter gene fusion construct in untransformed granulosa cells further indicates that Ca2+ positively regulates P450scc gene expression via transcriptional mechanisms. The present data do not exclude additional facilitative roles of other (nonCa2+) divalent cations in modulating FSH-induced gene transcription in the ovary.


    Acknowledgments
 
We thank Patsy Craig for her skillful preparation of the manuscript.


    Footnotes
 
1 This work was supported in part by an NIH Training Grant in Reproductive Neuroendocrinology (T32-DK-07646), National Research Service Award Grant 1-F32-HD-08284-01, NIH Grants HD-16393 and HD-16806, the NIH P30-HD-28934 (Center for Cellular and Molecular Reproduction), and the NIH U-54 Specialized Cooperative Centers Program in Reproductive Research (HD-96-008). Back

Received September 15, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Leung PC, Steele GL 1992 Intracellular signaling in the gonads. Endocr Rev 13:476–498[Abstract/Free Full Text]
  2. Richards JS 1994 Hormonal control of gene expression in the ovary. Endocr Rev 15:725–751[Abstract/Free Full Text]
  3. Veldhuis JDRole of extracellular calcium ions in modulating hormonally stimulated cyclic AMP generation in intact swine granulosa cells. In: Toft DO, Ryan RJ (eds) Proceedings of the Fifth Ovarian Workshop. Ovarian Workshops, Champaign, IL, 1985, pp 181–188
  4. Hertelendy F, Nemecz G, Molnar M 1989 Influence of follicular maturation on luteinizing hormone and guanosine 5'-O-thiotriphosphate-promoted breakdown of phosphoinositides and calcium mobilization in chicken granulosa cells. Biol Reprod 40:1144–1151[Abstract]
  5. Davis JS, Weakland LL, West LA, Farese RV 1986 Luteinizing hormone stimulates the formation of inositol trisphosphate and cyclic AMP in rat granulosa cells. Evidence for phospholipase C generated second messengers in the action of luteinizing hormone. Biochem J 238:597–604[Medline]
  6. Davis JS, Tedesco TA, West LA, Maroulis GB, Weakland LL 1989 Effects of human chorionic gonadotropin, prostaglandin F2 alpha and protein kinase C activators on the cyclic AMP and inositol phosphate second messenger systems in cultured human granulosa-luteal cells. Mol Cell Endocrinol 65:187–193[CrossRef][Medline]
  7. Braun AP, Schulman H 1995 The multifunctional calcium/calmodulin-dependent protein kinase: from form to function. Ann Rev Physiol 57:417–445[CrossRef][Medline]
  8. Sharma OP, Flores JA, Leong DA, Veldhuis JD 1994 Cellular basis for follicle-stimulating hormone stimulated calcium signaling in single rat Sertoli cells: dissociation from cAMP effects. Endocrinology 134:1915–1923[Abstract/Free Full Text]
  9. Gorczynska E, Handelsman D 1991 The role of calcium in follicle-stimulating hormone signal transduction in Sertoli cells. J Biol Chem 266:23739–23744[Abstract/Free Full Text]
  10. Flores JA, Veldhuis JD, Leong DA 1990 Follicle stimulating hormone evokes an increase in intracellular free calcium ion concentrations in single ovarian (granulosa) cells. Endocrinology 127:3172–3179[Abstract/Free Full Text]
  11. Flores JA, Leong DA, Veldhuis JD 1992 Is the calcium signal induced by FSH in swine granulosa cells mediated by adenosine 3',5'-cyclic monophosphate-dependent protein kinase A? Endocrinology 130:1862–1866[Abstract/Free Full Text]
  12. Grasso P, Reichert LE 1990 Follicle-stimulating hormone receptor-mediated uptake of 45Ca2+ by cultured rat Sertoli cells does not require activation of cholera toxin- or pertussis toxin-sensitive guanine nucleotide binding proteins or adenylate cyclase. Endocrinology 127:949–955[Abstract/Free Full Text]
  13. Adashi EY, Resnick CE, Jastorff A 1990 Blockade of granulosa cell differential by an antagonistic analog of adenosine 3',5'-cyclic monophosphate (cAMP): central but non-exclusive intermediary role of cAMP in follicle-stimulating hormone action. Mol Cell Endocrinol 72:1–11[CrossRef][Medline]
  14. Asem EK, Tsang BK 1988 The effect of kaurenol on steroidogenesis and cyclic adenosine monophosphate production in rat granulosa cells. Mol Cell Endocrinol 57:149–156[CrossRef][Medline]
  15. Veldhuis JD 1987 Mechanisms subserving hormone action in the ovary: role of calcium ions as assessed by steady-state calcium exchange in cultured swine granulosa cells. Endocrinology 120:445–449[Abstract/Free Full Text]
  16. Gorczynska E, Spaliviero J, Handelsman DJ 1996 Cyclic adenosine 3',5'-monophosphate-independent regulation of cytosolic calcium in Sertoli cells. Endocrinology 137:2617–2625[Abstract]
  17. Grasso P, Reichert Jr LE 1993 Induction of calcium transport into cultured rat Sertoli cells and liposomes by follicle-stimulating hormone. Recent Prog Horm Res 48:517–521
  18. Flores JA, Veldhuis JD, Leong DA 1991 Angiotensin II induces calcium release in single ovarian (granulosa) cells. Mol Cell Endocrinol 81:1–10[CrossRef][Medline]
  19. Flores JA, Quyyumi S, Leong DA, Veldhuis JD 1992 Actions of endothelin-1 on swine ovarian (granulosa) cells. Endocrinology 131:1350–1358[Abstract/Free Full Text]
  20. Flores JA, Aguirre C, Veldhuis JD 1998 Luteinizing hormone stimulates both intracellular calcium ion ([Ca2+]i) mobilization and transmembrane cation influx in single ovarian (granulosa) cells: recruitment as a cellular mechanism of LH-[Ca2+]i dose-response. Endocrinology 139:3606–3612[Abstract/Free Full Text]
  21. Gorczynska E, Spaliviero J, Handelsman DJ 1994 The relationship between 3',5'-cyclic adenosine monophosphate and calcium in mediating follicle-stimulating hormone signal transduction in Sertoli cells. Endocrinology 134:293–300[Abstract/Free Full Text]
  22. Hajnoczky G, Robb-Gaspers LD, Seitz MB, Thomas AP 1995 Decoding of cytosolic calcium oscillations in the mitochondria. Cell 82:415–424[CrossRef][Medline]
  23. Cherradi N, Rossier MF, Vallotton MB, Timberg R, Friedberg I, Orly J, Wang ZJ, Stocco DM, Capponi AM 1997 Submitochondrial distribution of three key steroidogenic proteins (steroidogenic acute regulatory protein and cytochrome P450scc and 3ß-hydroxysteroid dehydrogenase isomerase enzymes) upon stimulation by intracellular calcium in adrenal glomerulosa cells. J Biol Chem 272:7899–7907[Abstract/Free Full Text]
  24. Birmingham MK, Elliott FH, Valere PH-L 1953 The need for the presence of calcium for the stimulation in vitro of rat adrenal glands by adrenocorticotrophic hormone. Endocrinology 53:687–687
  25. Clyne CD, White PC, Rainey WE 1996 Calcium regulates human CYP11B2 transcription. Endocr Res 22:485–492[Medline]
  26. Capponi AM, Rossier MF, Davies E, Vallotton MB 1988 Calcium stimulates steroidogenesis in permeabilized bovine adrenal cortical cells. J Biol Chem 263:16113–16117[Abstract/Free Full Text]
  27. Carnegie JA, Tsang BK 1984 The calcium-calmodulin system: participation in the regulation of steroidogenesis at different stages of granulosa cell differentiation. Biol Reprod 30:515–522[Abstract]
  28. Leung PC, Minegishi T, Wang J 1988 Inhibition of follicle-stimulating hormone- and adenosine-3',5'-cyclic monophosphate-induced progesterone production by calcium and protein kinase C in the rat ovary. Am J Ob Gyn 158:350–356
  29. Marsh JM 1975 The role of cyclic AMP in gonadal function. In: Greengard P, Robison GA (eds) Advances in Cyclic Nucleotide Research. Raven Press, New York, pp 137–167
  30. Veldhuis JD, Klase PA, Demers LM, Chafouleas JG 1984 Mechanisms subserving calcium’s modulation of luteinizing hormone action in isolated swine granulosa cells. Endocrinology 114:441–449[Abstract/Free Full Text]
  31. Veldhuis JD, Klase PA 1982 Calcium ions modulate hormonally stimulated progesterone production in isolated ovarian cells. Biochem J 202:381–386[Medline]
  32. Veldhuis JD, Klase PA 1982 Mechanisms by which calcium ions regulate the steroidogenic actions of luteinizing hormone in isolated ovarian cells in vitro. Endocrinology 111:1–6[Abstract/Free Full Text]
  33. Veldhuis JD, Klase PA 1982 Role of calcium ions in the stimulatory actions of luteinizing hormone in isolated ovarian cells: studies with divalent-cation ionophores. Biochem Biophys Res Comm 104:603–610[CrossRef][Medline]
  34. Veldhuis JD, Yoshida K, DuBois W, Fields MJ 1987 Maitotoxin stimulates steroid and peptide hormone secretion by swine luteal tissue. Am J Physiol 252:E8–E12
  35. Alila HW, Davis JS, Dowd JP, Corradino RA, Hansel W 1990 Differential effects of calcium on progesterone production in small and large bovine luteal cells. J Steroid Biochem 36:687–693[CrossRef][Medline]
  36. Nishikawa T, Omura M, Suematsu S 1997 Possible involvement of calcium/calmodulin-dependent protein kinase in ACTH-induced expression of the steroidogenic acute regulatory (StAR) protein in bovine adrenal fasciculata cells. Endocr J 44:895–898[Medline]
  37. Houmard BS, Ottobre JS 1989 Progesterone and prostaglandin production by primate luteal cells collected at various stages of the luteal phase: modulation by calcium ionophore. Biol Reprod 41:401–408[Abstract]
  38. Tsang BK, Carnegie JA 1983 Calcium requirement in the gonadotropic regulation of rat granulosa cell progesterone production. Endocrinology 113:763–769[Abstract/Free Full Text]
  39. Simpson ER, Lund J, Ahlgren R, Waterman MR 1990 Regulation by cyclic AMP of the genes encoding steroidogenic enzymes: when the light finally shines. Mol Cell Endocrinol 70:C25–C28
  40. Urban RJ, Shupnik MA, Bodenburg YH 1994 Insulin-like growth factor-1 increases expression of the porcine P-450 cholesterol side chain cleavage gene through a GC-rich domain. J Biol Chem 269:25761–25769[Abstract/Free Full Text]
  41. Maurer RA 1989 Both isoforms of the cAMP-dependent protein kinase catalytic subunit can activate transcription of the prolactin gene. J Biol Chem 264:6870–6873[Abstract/Free Full Text]
  42. Day RN, Walder JA, Maurer RA 1989 A protein kinase inhibitor gene reduces both basal and multihormone-stimulated prolactin gene transcription. J Biol Chem 264:431–436[Abstract/Free Full Text]
  43. Fantozzi DA, Harootunian AT, Wen W, Taylor SS, Feramisco JR, Tsien RY, Meinkoth JL 1994 Thermostable inhibitor of cAMP-dependent protein kinase enhances the rate of export of the kinase catalytic subunit from the nucleus. J Biol Chem 269:2676–2686[Abstract/Free Full Text]
  44. Balasubramanian K, LaVoie HA, Garmey JC, Stocco DM, Veldhuis JD 1997 Regulation of porcine granulosa cell steroidogenic acute regulatory protein (StAR) by insulin-like growth factor I: synergism with follicle-stimulating hormone or protein kinase A agonist. Endocrinology 138:433–439[Abstract/Free Full Text]
  45. LaVoie HA, Garmey JC, Day RN, Veldhuis JD 1999 Concerted regulation of low density lipoprotein receptor gene expression by follicle-stimulating hormone and insulin-like growth factor I in porcine granulosa cells: promoter activation, messenger ribonucleic acid stability, and sterol feedback. Endocrinology 140:178–186[Abstract/Free Full Text]
  46. LaVoie HA, Garmey JC, Veldhuis JD 1999 Mechanisms of insulin-like growth factor I augmentation of follicle-stimulating hormone-stimulated porcine steroidogenic acute regulatory protein gene promoter activity in granulosa cells. Endocrinology 140:146–153[Abstract/Free Full Text]
  47. LaVoie HA, Benoit AM, Garmey JC, Dailey RA, Wright DJ, Veldhuis JD 1997 Coordinate developmental expression of genes regulating sterol economy and cholesterol side-chain cleavage in the porcine ovary. Biol Reprod 57:402–407[Abstract]
  48. Singer VL, Jones LJ, Yue ST, Haugland RP 1997 Characterization of PicoGreen reagent and development of a fluorescence-based solution assay for double-stranded DNA quantitation. Anal Biochem 249:228–238[CrossRef][Medline]
  49. Ahn SJ, Costa J, Emanuel JR 1996 PicoGreen quantitation of DNA: effective evaluation of samples pre- or post-PCR. Nucleic Acids Res 24:2623–2625[Free Full Text]
  50. Leung PCK, Wang J, Baimbridge JG 1989 Mechanism of action of luteinizing hormone releasing hormone in rat ovarian cells. Can J Physiol Pharmacol 67:962–967[Medline]
  51. Flores JA, Veldhuis JD 1995 Culture of ovarian granulosa cells for calcium imaging at the single cell level. In: Celis JE (ed). Cell Biology. Academic Press, pp 170–175
  52. Lehoux JG, Lefebvre A 1998 Transcriptional activity of the hamster CYP11B2 promoter in NCI-H295 cells stimulated by angiotensin II, potassium, forskolin and bisindolylmaleimide. J Mol Endocrinol 20:183–191[Abstract]
  53. Bading H, Hardingham GE, Johnson CM, Chawla S 1997 Gene regulation by nuclear and cytoplasmic calcium signals. Biochem Biophys Res Commun 236:543
  54. Bito H 1998 The role of calcium in activity-dependent neuronal gene regulation. Cell Calcium 23:143–150[CrossRef][Medline]
  55. Crabtree GR, Clipstone NA 1994 Signal transmission between the plasma membrane and nucleus of T lymphocytes. Ann Rev Biochem 63:1045–1083[CrossRef][Medline]
  56. Bird IM, Mathis JM, Mason JI, Rainey WE 1995 Ca2+-regulated expression of steroid hydroxylases in H295R human adrenocortical cells. Endocrinology 136:5677–5684[Abstract]
  57. Nishizuka Y 1995 Protein kinase C and lipid signaling for sustained cellular responses. FASEB J 9:484–496[Abstract]
  58. Begeot M, Shetty U, Kilgore M, Waterman M, Simpson ER 1993 Regulation of expression of the CYP11A (P450scc) gene in bovine ovarian luteal cells by forskolin and phorbol esters. J Biol Chem 268:17317–17325[Abstract/Free Full Text]
  59. Brentano ST, Picardo-Leonard J, Mellon SH, Moore CCD, Miller WL 1989 Tissue-specific, cyclic adenosine 3',5'-monophosphate-induced, and phorbol ester-repressed transcription from the human P450c17 promoter in mouse cells. Endocrinology 4:1972–1979
  60. McAllister JM, Hornsby PJ 1988 Dual regulation of 3 beta-hydroxysteroid dehydrogenase, 17 alpha-hydroxylase, and dehydroepiandrosterone sulfotransferase by adenosine 3',5'-monophosphate and activators of protein kinase C in cultured human adrenocortical cells. Endocrinology 122:2012–2018[Abstract/Free Full Text]
  61. Reyland ME 1993 Protein kinase C is a tonic negative regulator of steroidogenesis and steroid hydroxylase gene expression in Y1 adrenal cells and functions independently of protein kinase A. Mol Endocrinol 7:1021–1030[Abstract/Free Full Text]
  62. Lahav M, Garmey JC, Shupnik MA, Veldhuis JD 1996 Dual actions of phorbol ester on cytochrome P450 cholesterol side-chain cleavage messenger ribonucleic acid accumulation in granulosa cells. Biol Reprod 52:972–981[Abstract]
  63. Flores JA, Garmey JC, Lahav M, Veldhuis JD 1999 Mechanisms underlying endothelin’s inhibition of FSH-stimulated progesterone production by porcine ovarian granulosa cells. Mol Cell Endocrinol 156:169–178[CrossRef][Medline]
  64. Davis JRE, Vidal ME, Wilson EM, Sheppard MC 1988 Calcium dependence of prolactin mRNA accumulation in GH3 rat pituitary tumor cells. J Mol Endocrinol 1:111–116[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
R. C. Seals, R. J. Urban, N. Sekar, and J. D. Veldhuis
Up-Regulation of Basal Transcriptional Activity of the Cytochrome P450 Cholesterol Side-Chain Cleavage (CYP11A) Gene by Isoform-Specific Calcium-Calmodulin-Dependent Protein Kinase in Primary Cultures of Ovarian Granulosa Cells
Endocrinology, December 1, 2004; 145(12): 5616 - 5622.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Agoston, L. Kunz, A. Krieger, and A. Mayerhofer
Two Types of Calcium Channels in Human Ovarian Endocrine Cells: Involvement in Steroidogenesis
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4503 - 4512.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. L. H. Ireland, F. Jimenez-Krassel, M. E. Winn, D. S. Burns, and J. J. Ireland
Evidence for Autocrine or Paracrine Roles of {alpha}2-Macroglobulin in Regulation of Estradiol Production by Granulosa Cells and Development of Dominant Follicles
Endocrinology, June 1, 2004; 145(6): 2784 - 2794.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
E.V. Younglai, T. K. Kwan, C.-Y. Kwan, D.K. Lobb, and W.G. Foster
Dichlorodiphenylchloroethylene Elevates Cytosolic Calcium Concentrations and Oscillations in Primary Cultures of Human Granulosa-Lutein Cells
Biol Reprod, June 1, 2004; 70(6): 1693 - 1700.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
M. C. Henson and P. J. Chedrese
Endocrine Disruption by Cadmium, a Common Environmental Toxicant with Paradoxical Effects on Reproduction
Experimental Biology and Medicine, May 1, 2004; 229(5): 383 - 392.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
E. V. Younglai, A. C. Holloway, G. E. Lim, and W. G. Foster
Synergistic effects between FSH and 1,1-dichloro-2,2-bis(P-chlorophenyl)ethylene (P,P'-DDE) on human granulosa cell aromatase activity
Hum. Reprod., May 1, 2004; 19(5): 1089 - 1093.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Shih, S. Zhang, H. J. Cao, H.-Y. Tang, F. B. Davis, P. J. Davis, and H.-Y. Lin
Disparate Effects of Thyroid Hormone on Actions of Epidermal Growth Factor and Transforming Growth Factor-{alpha} Are Mediated by 3',5'-Cyclic Adenosine 5'-Monophosphate-Dependent Protein Kinase II
Endocrinology, April 1, 2004; 145(4): 1708 - 1717.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. D. Smida, X. P. Valderrama, M. C. Agostini, M. A. Furlan, and J. Chedrese
Cadmium Stimulates Transcription of the Cytochrome P450 Side Chain Cleavage Gene in Genetically Modified Stable Porcine Granulosa Cells
Biol Reprod, January 1, 2004; 70(1): 25 - 31.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. O. Arellano, A. Martinez-Torres, and E. Garay
Ionic Currents Activated via Purinergic Receptors in the Cumulus Cell-Enclosed Mouse Oocyte
Biol Reprod, September 1, 2002; 67(3): 837 - 846.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Manikkam, Y. Li, B. M. Mitchell, D. E. Mason, and L. C. Freeman
Potassium Channel Antagonists Influence Porcine Granulosa Cell Proliferation, Differentiation, and Apoptosis
Biol Reprod, July 1, 2002; 67(1): 88 - 98.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. K. Asem, W. Qin, and S. G. Rane
Effect of basal lamina of ovarian follicle on T- and L-type Ca2+ currents in differentiated granulosa cells
Am J Physiol Endocrinol Metab, January 1, 2002; 282(1): E184 - E196.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jayes, F. C. L.
Right arrow Articles by Veldhuis, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jayes, F. C. L.
Right arrow Articles by Veldhuis, J. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals