help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Minagawa, M.
Right arrow Articles by White, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Minagawa, M.
Right arrow Articles by White, J. H.
Endocrinology Vol. 141, No. 7 2410-2421
Copyright © 2000 by The Endocrine Society

ARTICLES

Dissection of Differentially Regulated (G+C)-Rich Promoters of the Human Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Gene1

Masanori Minagawa2,3, Mei Yee Kwan2, J. David Bettoun4, Fady W. Mansour, Justine Dassa, Geoffrey N. Hendy, David Goltzman and John H. White5

Departments of Physiology (J.D.B., M.Y.K., F.W.M., J.D., G.N.H., D.G., J.H.W.) and Medicine (M.M., G.N.H., D.G., J.H.W.), McGill University, Montréal, Québec H3G 1Y6, Canada; Calcium Research Laboratory and Royal Victoria Hospital (M.M., G.N.H., D.G.), McGill University, Montréal, Québec H3A 1A1, Canada; and Department of Human Genetics (G.N.H.), McGill University, Montréal, Québec H3A 1B1, Canada

Address all correspondence and requests for reprints to: Dr. John H. White, Department of Physiology, McGill University, McIntyre Building, 3655 Drummond Street, Montréal, Québec H3G 1Y6, Canada. E-mail: jwhite{at}med.mcgill.ca


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The PTH/PTH-related peptide (PTHrP) receptor (PTHR) is required for normal skeletal development, and a wide array of physiological responses mediated by PTH and PTHrP. We have previously identified three promoters, P1-P3, which control human PTHR gene transcription. P2 and P3 are (G+C)-rich, function in a number of tissues, lie within the same CpG island, and display many hallmarks of housekeeping promoters. However, they are differentially regulated during development as P2, but not P3, functions in fetal tissues. Here, we have used both stably and transiently transfected human osteoblast-like cells to delineate regions of P2 and P3 required for promoter activity. Deletion analyses performed in stably transfected cells indicated that sequences extending from -91 to -12 relative to the transcription start site were required for function of the P2 promoter. No negative regulatory elements were detected in P2. In contrast, deletion of an A-rich region of P3 extending from -147 to -115 was required for optimal basal activity, suggesting that this sequence acts as a repressor of P3. Strikingly, however, whereas the A-rich region also functioned as a negative element when inserted upstream of the (G+C)-rich P2 promoter, it enhanced expression from the thymidine kinase promoter, suggesting that its function depends on other transcription factors bound to promoter sequences. Fine deletion of P3 sequences proximal to -115 implicated Sp1 motifs and downstream initiation sites in P3 function. These studies indicate that function of P2 and P3 is controlled by ubiquitously expressed transcription factors and raise the possibility that P3 activity is repressed during fetal development.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
MANY OF THE physiological responses of PTH and PTH-related peptide (PTHrP) are transmitted through a common receptor (PTHR). The PTHR is required for normal skeletal development (1), is widely expressed, and transmits a wide range of physiological signals propagated by both PTH and PTHrP. PTH acts to tightly maintain circulating concentrations of calcium ions. PTH is released specifically from the parathyroid glands in response to a decrease in plasma calcium levels and acts on receptors expressed in kidney and bone to stimulate calcium reabsorption and increase phosphate excretion (2, 3). PTHrP can mimic many of the effects of PTH when overexpressed by cancers. However, in contrast to PTH, PTHrP is thought to act in a paracrine/autocrine manner under physiological conditions. Moreover, PTHrP is widely expressed and functions to modulate cellular growth and differentiation (4, 5, 6, 7). Binding of PTH or PTHrP to the PTHR has been shown to stimulate the production of intracellular cAMP and inositol 1,4,5 trisphosphate (8, 9, 10).

The PTHR is a G protein-coupled receptor containing seven putative transmembrane domains. Genetic studies have shown that the PTHR is most closely related to a subfamily of receptors for peptide hormones, including GH-releasing hormone, calcitonin, vasoactive intestinal peptide, and glucagon (11, 12, 13, 14, 15, 16). The 5' regulatory regions of the mouse, rat, and human PTHR genes are complex, and multiple promoters have been identified giving rise to differentially spliced transcripts (12, 17, 18, 19). Expression of the mouse PTHR gene is controlled by an upstream promoter P1, whose activity is mainly restricted to kidney. RNase protection analyses have suggested that P1 activity accounts for approximately 90% of renal PTHR transcripts in the mouse (17, 20). The downstream promoter P2 is ubiquitously active and likely accounts for the broad tissue distribution of the PTHR (12, 17, 20).

Regulation of the PTHR gene expression in human is more complex than in mouse. The P1 and P2 promoter regions and the corresponding 5' untranslated region exons are well conserved between mouse and human (18). However, the activity of P1 in human kidney is lower than in the mouse. We identified a third promoter P3 that is highly active in kidney in human, but not mouse (21). Moreover, P3-specific transcripts were also expressed in a number of human tissues other than kidney. None of the PTHR gene promoters identified in mouse or human contain a TATA box homology. Mouse and human P1 promoters contain a number of start sites spread over at least 100 bp (17, 18), and a (G+C) content of approximately 50%. Mouse and human P2 promoters are highly (G+C)-rich and contain single start-sites in regions containing Sp1 motifs (12, 18). The human P3 promoter is superficially similar to P2, as it is (G+C)-rich and contains a number of Sp1 motifs. Indeed, the human P2 and P3 promoters lie within the same CpG island. However, the two promoters are clearly regulated differently as P2 but not P3 (or P1) is active at the mid-gestational period of human development (21).

We were interested in comparing the regulatory elements required for expression of the human P2 and P3 promoters. Osteoblasts express the PTHR and are major sites of the calcium regulatory activity of PTH (2, 3, 10). In this report, we have performed a series of studies analyzing the regions of P2 and P3 required for expression in stably transfected cells human osteoblast-like cell lines HOS and SaOS-2. Increasing evidence has shown that chromatin can control the access of factors to promoter regions and that transcriptional regulators can modulate chromatin structure (22, 23, 24, 25). Other work has suggested that chromatin structure is not fully recapitulated on transiently transfected templates (26). PTHR promoter-reporter cassettes were therefore stably propagated in episomal vectors that have been shown to replicate autonomously in the form of nucleosomes (27). Our results show that minimal regions of P2 and P3 are required for activity in stably transfected cells. However, the regulation of P3 is more complex, as the proximal promoter region is composed of both positive and negative regulatory elements, which may provide insights into the complex regulation of P3 function.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Plasmid recombinants
The luciferase gene was excised from pXP2 (28) by complete digestion with BamHI and partial digestion with XbaI, and subcloning of the 1.8-kb luciferase gene fragment into BamHI-XbaI-digested pSK+ (Stratagene). In parallel, the BamHI-SalI fragment from pGRE5, containing a polyadenylylation signal (29), was subcloned in pSK+, to create pBSSK+. The luciferase gene was excised from pSK+ by digestion with EagI, end-filling with Klenow fragment, and digestion with BamHI. This fragment was inserted in pBSSK+, which had been digested with BgIII, end-filled with Klenow fragment and digested with BamHI. The luciferase gene-polyadenylylation signal was then excised with BamHI and SalI and inserted into the Epstein-Barr virus (EBV) episomal vector p220.2 (30) digested with BamHI and SalI to create pLuc-EBV. To construct a P1-luciferase reporter plasmid, a 1.6-kb BamHI-BglII fragment of P1 (-1428 to +174) was excised from a modified version of Bluescript SK+ (pSKb), in which the XbaI site was destroyed by insertion of an oligonucleotide containing a BglII site, and subcloned into the polylinker of pLuc-EBV. A P2-luciferase recombinant was obtained by excising a 1.1-kb SacI fragment (-954 to +96) from Bluescript SK+, removing the 3' protruding ends by T4 DNA polymerase treatment, and insertion into the SpeI site of pSKb (see above). The orientation of the insert was confirmed by restriction digestion and DNA sequencing. The insert was then excised as a BamHI-BglII fragment and subcloned into the polylinker pLuc-EBV. pP3Luc-EBV was created by rendering a 1.1-kb NcoI-AvrII fragment of P3 (-842 to +244) blunt-ended with Klenow fragment and subcloning it into pSKb. Insert orientation was checked by restriction digestion and DNA sequencing, and the fragment excised as a BamHI-BglII fragment and subcloned it into pLuc-EBV.

Truncated P2 and P3 promoter fragments were created by exonuclease III digestion as follows: promoter fragments in pSKb (2.5 µg) were digested upstream of promoter regions with EcoRI, and end-filled using Klenow fragment and {alpha}-phosphorothioate nucleoside triphosphates. Fragments were then digested with BamHI, which cuts downstream of EcoRI, at the 5' end of promoter fragments. Digested DNA was purified by phenol-chloroform extraction and ethanol precipitation, and resuspended DNA was treated with 300 U of exonuclease III (Amersham Pharmacia Biotech, Arlington Heights, IL) at 37 C in 60 µl final volume according to the manufacturer’s instructions. Aliquots (5 µl) were removed every 30 sec and added to 7.5 µl of S1 nuclease mix (Amersham Pharmacia Biotech) on ice. After all samples were taken, aliquots were incubated at room temperature for 30 min, and then incubated at 70 C for 10 min. DNA was purified by phenol-chloroform extraction and ethanol precipitation, and end-filled with Klenow fragment. Truncated promoter fragments were then excised with EcoRV and BglII and inserted in pLuc-EBV, which had been digested in the polylinker with Asp718 and treated with Klenow and then digested with BglII. Finer deletion analysis of the P3 promoter downstream of -115 was performed by PCR amplification of appropriate promoter fragments using 5' oligonucleotides containing Asp718 sites and a 3' oligonucleotide containing a BglII site. PCR products were digested with Asp718 and BglII and products were ligated into similarly digested pLuc-EBV. The recombinant A-rich region (ARR)-tk-Luc was constructed by inserting an ARR oligonucleotide spanning -147 to -110 and flanked by BamHI and BglII ends into the BamHI site upstream of the tk promoter in tk-Luc. All recombinants were verified by DNA sequencing.

Tissue culture and transfections
HOS and SaOS-2 cells were propagated in DMEM + 10% FBS. One day before transfection, cells were seeded in 6-well plates at approximately 35% confluence. Transfections were performed with Lipofectin (Life Technologies, Inc., Gaithersburg, MD) using 2.5 µg of plasmid DNA. If cells were transfected transiently, cells were harvested 48 h later, and extracts were prepared by resuspending cells in 200 µl of Reporter lysis buffer (Promega Corp.). If cells were maintained for stable transfections, hygromycin (170 µg/ml for HOS, or 80 µg/ml for SaOS-2) was added 72 h after transfection. Medium was changed every 48 h for 14 to 18 days. At this time, untransfected cells cultured in the presence of hygromycin were killed, and surviving transfected cells were transferred to a T75 flask, where they were grown under selective conditions until 40% confluence. At this stage, cells were split into six-well plates and grown until 80% confluence. Cells from one well were used to perform Hirt extractions (see below), and cells from three to five remaining wells were assayed individually for luciferase activity, by preparing cell extracts in 200 µl of Reporter lysis buffer (Promega Corp.). Luciferase assays were normalized for variations in protein concentration between extracts.

Analysis of plasmid copy number by Hirt extraction
Cells from one well of a six-well plate were washed twice with 4 ml of PBS, and scraped into 350 µl of water. One hundred microliters of resuspended cells were used to determine protein concentration. Hirt extractions were performed by adding 200 µl of resuspended cells to 200 µl of 20 mM Tris-HCl (pH 8.0), 2 mM EDTA, 2% SDS, 400 µg/ml proteinase K, and incubating at 37 C for 2 h. Incubations were chilled to 4 C on ice, 100 µl of 5 M NaCl were added, and incubations were continued overnight on ice. Incubations were centrifuged at 17,000 x g for 20 min at 4 C, and 400 µl of supernatant was extracted 3 times with 1:1 phenol/chloroform, ethanol precipitated, and resuspended in 100 µl of water. DNA was digested with BamHI and SalI to excise promoter-luciferase cassettes and electrophoresed on a 1% agarose gel. Southern blotting was performed as described (18) using a 540 bp probe generated from an XbaI-EcoRI fragment of the luciferase gene.

Primer extension analysis
Ten picomoles of primer P3Up2 (5'CTATGGGACCCCGGCGTCC3'), which is complementary to sequences starting 61 bp upstream of the SS exon, were labeled for 1 h at 37 C with 32P-{gamma}-ATP using T4 polynucleotide kinase. One tenth of this reaction was incubated with 10 µg of kidney total RNA or 50 µg of HOS total RNA, or 10 µg of yeast transfer RNA as a control, overnight at 55 C in 300 mM KCl, 20 mM Tris-HCl (pH 8.3), 2 mM EDTA in a final volume of 26 µl. Samples were then put on ice, and 4 µl of 25 mM Tris-HCl (pH 8.0), 60 mM MgCl2, 10 mM DTT, 5 mM dNTPs, 2 U of RNAguard (Amersham Pharmacia Biotech), and 100 U of M-MLV reverse transcriptase (Life Technologies, Inc.) were added. After 90 min at 43 C, the enzymes were inactivated for 10 min at 75 C, and the reaction was extracted once with phenol and ethanol precipitated. One quarter of the reaction was denatured for 2 min at 80 C and run on a 6% denaturing polyacrylamide gel along with a sequencing reaction as molecular weight markers.

RT-PCR analysis
Three micrograms of total RNA were precipitated, resuspended in 6 µl of 1 x DNase 1 digestion buffer (Promega Corp.) containing 0.5 U of DNase I, incubated for 15 min at 37 C and for 10 min at 75 C, and put immediately on ice. Two microliters were immediately added to 18 µl of a RT mix containing 0.5 mmol/liter of each dNTP, 5 mmol/liter of DTT, 1 mmol/liter of 6mer random primers, 75 mmol/liter of KCl, 3 mmol/liter of MgCl2 in 50 mmol/liter of Tris-HCl (pH 8.3), and the reaction was allowed to proceed for 1 h at 37 C, followed by 75 C for 10 min. For PCR detection of P1 specific transcripts, 2 µl of the RT reaction were subjected to a first round of 30 cycles of amplification consisting of 95 C for 30 sec, 56 C for 1 min, 72 C for 20 sec, using 5'AGGGAATTCAGGTCTTTTCTTGTCCCCAGC3' as the forward primer and 5'GACGTCATCTGCATCCACCAGCGC3' (hE1rev) as the reverse primer. One microliter of the first reaction was then subjected to 30 more cycles of amplification consisting of 95 C for 30 sec, 58 C for 1 min, and 72 C for 5 sec, using forward primer 5'AGTTGTGTGTCCTGGACACTACCA3' and reverse primer 5'GCCTCCCCGTGGCCAACTTGAGTC3'. PTHR and ß-actin coding sequences were detected by submitting 2 µl of the RT reaction to 24 cycles of amplification consisting of 95 C for 30 sec, 56 C for 1 min, 72 C for 25 sec. The forward primer for the PTHR was 5'CACCACTACTACTGGATTCTGGTG3', the reverse primer used was 5'GATTTCTTGATCTCGCTTGTACC3'. For ß-actin, the forward primer was 5'GCTGTGCTATCCCTGTACGC3', and the reverse primer was 5'GCCATGGTGATGACCGGC3'. All the above described reactions were performed in a 50 µl volume in 1.5 mmol/liter MgCl2, 50 mmol/liter KCl, and 10 mmol/liter Tris-HCl (pH 9.0) using 2.5 U of Taq DNA polymerase (Amersham Pharmacia Biotech). P3-specific transcripts were detected using 28 cycles of PCR, consisting of 95 C for 30 sec, 58 C for 45 sec, and 72 C for 15 sec, performed using 2 µl of RT reaction in a 50 µl volume in 0.8 mmol/liter MgCl2, 50 mmol/liter KCl and 20 mmol/liter Tris-HCl (pH 8.3) using 2.5 U of Taq DNA polymerase (Amersham Pharmacia Biotech). The forward primer was 5'ACGGAATTCCAGCCTGACGCAGCTCTGCACC3', and hE1rev (see above) was used as the reverse primer. Amplification of P2-specific transcripts was performed by subjecting 1 µl of the RT reaction to a touch-down PCR under the following conditions, 45 sec denaturation at 95 C, 20 sec elongation at 72 C and 1 min annealing starting at 58 C, down 1 C per cycle to 51 C, under which conditions 25 cycles of amplification were performed. The reaction was in 20 µl volume in 1.5 mmol/liter MgCl2, 50 mmol/liter KCl, and 10 mmol/liter Tris-HCl (pH 9.0) and in 5% formamide using 5 U of Taq DNA polymerase (Amersham Pharmacia Biotech). The forward primer was 5'GCCCGACATCCTGCAAGGC3', and the reverse primer was hE1 rev (see above). PCR reactions (2/5th to 1/10th) were run on a 2% agarose gel, transferred overnight to a nylon Hybond N+ membrane (Amersham Pharmacia Biotech) and the DNA was covalently attached by baking the membrane at 80 C under vacuum for 2 h. Membranes were prehybridized for 30 min in 6 x NET (100 mM Tris-HCl pH 7.5, 0.9 M NaCl, 6 mM EDTA), 10 x Denhardt’s, 0.5% SDS, 10 mg/ml denatured salmon sperm DNA at 62 C, and then hybridized in 6 x NET, 5 x Denhardt’s, 0.5% SDS, 1 mg/ml denatured salmon sperm DNA with 106 cpm of end-labeled oligonucleotides for 5 h at 62 C. The oligonucleotides used for probing were: 5'CCCTAGGCGGTGGCGATGGGGACC3', for P2- and P3-containing sequences, 5'CTGCAGCTTTAGGCCCGACTTG3' for P1-specific sequence, and 5'TGGCCATGAAGACAATGTAGTGGACG3' for coding sequence.

Electrophoretic mobility shift assays (EMSAs)
Nuclear extracts of HOS cells were prepared from four confluent 75 cm2 flasks using the protocol of Andrews and Faller (31). Ten picomoles of oligonucleotide were end-labeled with {gamma}-32P-ATP with T4 polynucleotide kinase (Amersham Pharmacia Biotech). For each EMSA, 2.5 µg of nuclear extract in 1 µl was incubated in 10 µl final volume of 25 mM Tris-HCl (pH 8.0), 1 mM DTT, 50 mM KCl, 0.1% NP40, 20% glycerol, and 1 µg poly deoxyinosine-deoxycytidine for 15 min at 4 C. Aliquots were further incubated for 20 min at 25 C with 105 cpm (40 fmol) of radiolabeled oligonucleotide and unlabeled competitor as indicated in the figures. Samples were electrophoresed on 5% polyacrylamide gels equilibrated in 0.5 x TBE. Gels were dried before autoradiography.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Promoter activities of the endogenous PTHR gene in human osteoblast-like cell lines HOS and SaOS-2
The 5' regulatory region of the human PTHR gene contains 3 promoter regions, P1, P2, and P3 (Fig. 1AGo). This arrangement gives rise to transcripts containing 5' untranslated regions (5'UTRs) UI/U2, U3, and U4 that are specific to P1, P2, and P3 promoters, respectively. The activities of all three promoters in kidney and human osteoblast-like cell lines HOS and SaOS-2 were surveyed by RT-PCR using primers specific to the 5'UTRs of each promoter, along with primers specific to coding sequences (see Materials and Methods for details). Amplification products were obtained with primers specific to coding sequence and P2- and P3-specific transcripts in all cases, whereas P1-specific products were detected only in kidney (Fig. 1BGo). These data show that the PTHR gene is expressed in HOS and SaOS-2 cells only from the P2 and P3 promoters.



View larger version (14K):
[in this window]
[in a new window]
  		Figure 1. Expression of PTHR promoters in HOS and SaOS-2 cells. A, Structure of the 5' regulatory region of the human PTHR gene. The P1, P2, and P3 promoters are shown, along with exons and splice patterns up to E1. The regions encompassed by PTHR promoter-luciferase recombinants tested in Fig. 2Go are indicated by open bars. B, RT-PCR analysis of promoters driving expression of the endogenous PTHR gene in kidney, and in HOS and SaOS-2 cells using PCR primers complementary to 5'UTR sequences specific to each promoter. PCR reactions were electrophoresed on a 1% agarose gel, and amplification products were analyzed by Southern blotting using 32P-labeled internal oligonucleotides (see Materials and Methods for details). PCR amplification was performed in the absence (-), or presence (+) of RT reactions.

 
Analysis of the activity of PTHR promoter-luciferase recombinants in transiently and stably transfected HOS and SaOS-2 cells
P1 activity is restricted to kidney, whereas P2- and P3-specific transcripts are widely expressed. We were interested in determining whether cell-specific expression from the three promoters could be recapitulated by transfection into HOS and SaOS-2 cells. Therefore, PTHR promoter-luciferase recombinants were constructed (Fig. 2AGo) by inserting fragments from P1, P2, and P3 promoter regions upstream of the promoter-less luciferase gene in the EBV episomal vector p220.2 (30; and see below). Transient transfection of these recombinants gave rise to significant levels of luciferase activity expressed from pP2954-220.2 and pP3842-220.2, whereas pP11428-220.2 stimulated lower levels of expression in both HOS and SaOS-2 cells (Fig. 2BGo).



View larger version (32K):
[in this window]
[in a new window]
  		Figure 2. Analysis of expression of PTHR promoter luciferase recombinants in transiently transfected HOS and SaOS-2 cells. A, PTHR promoter-luciferase recombinants tested in these studies. Only the promoter-luciferase portion of the vector is illustrated. B, Expression of PTHR promoters in transiently transfected HOS and SaOS-2 cells. Relative luciferase activities (±SEM) obtained from three to five independent sets of transfections are presented. Values were normalized to expression driven by P3, which was given a value of 100%.

 
Recent experiments have suggested that activators of transcription function in part by recruiting factors to transcriptional preinitiation complexes that act to remodel chromatin structure (22, 23, 24, 25). Preinitiation complex formation on active templates in transiently transfected cells may not require remodeling of chromatin structure (26), and, therefore, may not be fully representative of transcriptional initiation on endogenous genes. We were interested in analyzing the function in stably transfected cells of the PTHR promoter luciferase recombinants studied in Fig. 2Go. Episomal vectors have been shown to be propagated in the form of nucleosomes (27). We have successfully used the EBV episomal vector p220.2 (30) and its derivatives to stably transfect human cell lines (29, 32). Therefore, HOS and SaOS-2 cells were transfected with pP11428-220.2, pP2954-220.2, or pP3842-220.2 to test for PTHR promoter function, or the promoterless pXP2–220.2 as a negative control. Hygromycin-resistant cell lines were selected, and tested for expression levels of episomal plasmids by Hirt extraction (see Materials and Methods for details). Southern analysis of Hirt extracts of HOS cell lines showed that vector copy numbers were similar, with the exception of pP2954-220.2, which was propagated at somewhat lower levels than the other plasmids (Fig. 3AGo). Plasmid levels were more variable in SaOS-2 cells, with pP11428-220.2 and pP2954-220.2 being propagated at the highest and lowest copy numbers, respectively.



View larger version (19K):
[in this window]
[in a new window]
  		Figure 3. Analysis of expression of PTHR promoter-luciferase recombinants in stably transfected HOS and SaOS-2 cells. A, Expression levels of episomal plasmids in HOS and SaOS-2 cells. Plasmid DNA was isolated by Hirt extraction of extracts of HOS and SaOS-2 cells stably transfected with promoter-luciferase recombinants shown in Fig. 2AGo. Plasmid DNA was purified from aliquots of extract, normalized for protein concentration (see Materials and Methods), digested with BamHI and SalI to excise PTHR promoter-luciferase fragments, and subjected to agarose gel electrophoresis and Southern blotting (see Materials and Methods for details). B, Luciferase activity (±SEM) expressed in stably transfected HOS and SaOS-2 cells. Activity was normalized according to the relative copy numbers of episomal plasmids analyzed in A. Results are from four independent sets of luciferase assays.

 
Analysis of luciferase expression in the HOS and SaOS-2 lines gave similar results. Low levels of P1 activity observed in transient transfections was completely abolished in both SaOS-2 and HOS cells (Fig. 3BGo), whereas lines propagating P2 and P3 promoter sequences expressed luciferase activity. Thus, these experiments reproduce the pattern of promoter activities observed in the endogenous PTHR gene these cells, and show that the P2 and P3 regions used are sufficient to drive promoter activity in stably transfected cells.

Deletion analysis of the P2 promoter
Exonuclease III deletion analyses were performed to define the regions of P2 that contribute to promoter activity observed in HOS and SaOS-2 cells (Fig. 4AGo). Truncated P2-luciferase fragments were inserted upstream of the luciferase gene in pLuc-EBV. Stable HOS cell lines propagating each of the recombinants listed in Fig. 4AGo were selected as described above and analyzed by Hirt extraction for expression levels of plasmids (Fig. 4BGo). While relative levels of plasmids detected fluctuated somewhat from one extraction to the next, the results showed that the truncated P2-luciferase plasmids were propagated at similar copy numbers (Fig. 4BGo, and data not shown).



View larger version (32K):
[in this window]
[in a new window]
  		Figure 4. Deletion analysis of the P2 promoter region of the PTHR gene. A, Truncated P2 promoter recombinants generated by exonuclease III digestion (see Materials and Methods for details). B, Southern blotting analysis of expression levels of P2 promoter recombinants stably expressed in HOS cells. DNA extraction and Southern blotting were performed as in Fig. 3Go. C, Analysis of luciferase activity (four experiments) in extracts of HOS cells stably expressing truncated P2 promoter recombinants. D, Analysis of luciferase activity (±SEM) in extracts of HOS cells transiently transfected with the recombinants listed in A. Results of four independent experiments are shown. E, Activity of P2 promoter-luciferase recombinants in transiently transfected SaOS-2 cells. SaOS-2 cells were transiently transfected with P2 promoter recombinants and extracts of cells were assayed for luciferase activity (±SEM; 3 independent sets of experiments). F, Sequence of the proximal P2 promoter region. The 5' extremities of deletions in this region are indicated by bent arrows. The transcription initiation site is indicated by an arrowhead.

 
Analyses of luciferase activities showed that deletion of P2 sequences from -954 to -91 had little effect on P2 promoter activity (Fig. 4CGo). However, deletion from -91 to -12 largely abolished luciferase expression, indicating that sequences within region are of primary importance for promoter activity. Similar results were obtained in transiently transfected cells. However, a gradual loss of luciferase activity of approximately 2-fold was observed in transiently transfected HOS and SaOS-2 cells with successive deletions (Fig. 4Go, D and E). The importance of the -91 to -12 region was underlined by transient transfections in SaOS-2 cells (Fig. 4EGo), where deletion beyond -91 largely abolished promoter activity. These results indicate that a 79-bp region upstream of P2 is required for promoter activity (Fig. 4FGo). Moreover, the results suggest that region lying between -959 and -91 lacks sequences required for basal P2 activity in osteoblast-like cells.

Identification of a promoter-specific repressor sequence in the proximal P3 promoter
A similar deletion analysis to that presented in Fig. 4Go was performed on the P3 promoter (Fig. 5AGo). Truncated P3- luciferase recombinants were inserted in pLuc-EBV and stably transfected in HOS cells. Southern analysis of Hirt extracts showed that plasmids were propagated at similar copy numbers (Fig. 5BGo). Analysis of luciferase expression showed that deletion of sequences from -842 to -147 had no significant effect on promoter activity in stably transfected HOS cells (Fig. 5CGo). This suggested that no regulatory elements important for P3 activity lie in this region. Results from transient transfections of HOS cells largely agreed with these findings (Fig. 5DGo). However, there was a progressive loss of over 2-fold in luciferase activity observed with successive deletions from -842 to -147, which was not observed in stably transfected cells. A similar phenomenon was seen when recombinants were transiently transfected in SaOS-2 cells (Fig. 5EGo).



View larger version (29K):
[in this window]
[in a new window]
  		Figure 5. Deletion analysis of the P3 promoter region of the PTHR gene. A, Truncated P3 promoter recombinants generated by exonuclease III digestion (see Materials and Methods for details). B, Southern blotting analysis of expression levels of P3 promoter recombinants stably expressed in HOS cells. DNA extraction and Southern blotting were performed as in Fig. 3Go. C, Analysis of luciferase activity (±SEM; four experiments) in extracts of HOS cells stably expressing truncated P3 promoter recombinants. D, Analysis of luciferase activity in extracts of HOS cells transiently transfected with the recombinants listed in A. Results of four independent experiments (±SEM) are shown. E, Activity of P3 promoter-luciferase recombinants in transiently transfected SaOS-2 cells. SaOS-2 cells were transiently transfected with P3 promoter recombinants and extracts of cells were assayed for luciferase activity (± SEM; three independent sets of experiments).

 
Deletion of an ARR from -147 to -115 led to a 2- to 2.5-fold increase in luciferase activity, suggesting that this region can act as a repressor. This was observed both in stably transfected HOS cells and in transiently transfected HOS and SaOS-2 cells (Fig. 5Go, C–E). EMSAs showed that the ARR sequence (Fig. 6AGo) bound a series of factors. Three complexes, designated 1 to 3, were identified (Fig. 6BGo; arrowheads), and binding of complexes 1 and 2 to the ARR was competed by a 100-fold excess of unlabeled ARR oligonucleotide, but not a nonspecific oligonucleotide, providing evidence for specific factor(s) that recognize the ARR (Fig. 6BGo, lanes 3–5). Further analysis with a series of mutated ARR sequences (Fig. 6AGo) suggested that a string of A residues was important for formation of complexes 1 and 2, but not complex 3 (Fig. 6BGo, lanes 6–23). Complexes 1 and 2 were formed on mut1 and mut2 oligonucleotides, but not on the mut 3 oligonucleotide (Fig. 6BGo, lanes 7, 13, and 19). Similarly, unlike wild-type, mut1 and mut2 oligonucleotides, a 100-fold excess of mut3 sequences failed to completely compete for formation of complexes 1 and 2 on mut1 and mut2 (Fig. 6BGo, lanes 8–11 and 14–17).



View larger version (85K):
[in this window]
[in a new window]
  		Figure 6. Electrophoretic mobility shift assay of factors binding to an ARR oligonucleotide in nuclear extracts of HOS cells. A, The sequence of the ARR oligonucleotide is indicated, along with a series of three mutated ARR sequences. Competition experiments were performed with the ARR and mutated oligonucleotides (lanes 3, 4) or with a nonspecific oligonucleotide with the sequence 5'-GTAAAACGACGGCCAGT-3' (lane 5). Binding and competition experiments were also performed on mutated ARR sequences mut1 (lanes 6–11), mut2 (lanes 12–17) or mut3 (lanes 18–23) as indicated.

 
Function of the ARR was further analyzed by subcloning it upstream of P2, which is also (G+C)-rich, and upstream of a truncated Herpes Simplex virus thymidine kinase (tk) promoter (Fig. 7AGo). The tk promoter is not (G+C)-rich and displays significant basal activity in a wide variety of transfected cells. As a control the ARR was reinserted upstream of a P3 promoter truncated at -115 (Fig. 7AGo). The ARR significantly repressed activity of P2 and P3 promoters (Fig. 7BGo). Surprisingly, however, the ARR stimulated activity of the basal tk promoter approximately 2-fold (Fig. 7CGo), suggesting that its function depends on promoter context.



View larger version (39K):
[in this window]
[in a new window]
  		Figure 7. Analysis of the function of an ARR of P3 lying between -147 and -115. A, Schematic representation of recombinants containing ARR oligonucleotides inserted upstream of P2-, P3- or tk-luciferase recombinants. B–D, Results of six independent transient transfection experiments with P3- (B), P2- (C) and tk-luciferase recombinants (D) in HOS cells. Values were analyzed using a Student’s t test. Significant repression or activation (P < 0.01) is indicated by an asterisk.

 
Identification of downstream initiation sites and a functional SP1 site in the proximal P3 promoter
Unexpectedly, deletion from -115 to +42 of P3 only reduced luciferase activity in HOS and SaOS-2 cells to 30–40% of that observed with the pP3842-220.2 construct, suggesting the existence of additional start-sites downstream of +42 (Fig. 5Go, C–E). Therefore, we performed primer extension analysis using a primer that hybridizes within the U4 exon (see Materials and Methods for details). The upstream primer generated a pair of major extension products of 140 and 147 bases on RNA from both kidney and HOS cells (Fig. 8AGo), in excellent agreement with previous results obtained with kidney RNA (21). In addition, extension products of 38 and 28 bases were detected, which lie approximately 109 and 119 bases downstream of the site (+1) corresponding to the 147-base band, and are consistent with residual activity in promoter fragments deleted to +42 (see Fig. 9AGo for summary).



View larger version (54K):
[in this window]
[in a new window]
  		Figure 8. Analysis of downstream P3 promoter initiation sites by primer extension. A, Results of primer extension analysis of a transfer RNA control (10 µg) and RNA purified from human adult kidney (10 µg) and HOS cells (50 µg) using a primer whose 5' end lies 61 bp upstream of the U4/SS junction. Major extension products of 28, 38, 140, and 147b are indicated. Note that the relative intensities of extension products does not necessarily reflect relative initiation site usage in vivo as longer products are extended less efficiently that shorter ones.

 


View larger version (25K):
[in this window]
[in a new window]
  		Figure 9. Fine deletion analysis of the P3 promoter downstream of -115. A, Proximal sequence of the P3 promoter downstream of -147. Positions of 5' promoter deletions are indicated by bent arrows, and transcription initiation sites by arrowheads. The positions of consensus sequences for Sp1, MAZ, and ETF classes of transcription factors are indicated. The ARR between -147 and -115 of the P3 promoter is indicated in bold. B and C, Analysis of luciferase activity (±SEM; four experiments) in extracts of HOS cells transiently expressing P3 promoter recombinants truncated downstream of -115.

 
The region of P3 downstream of -115 was examined in more detail for regulatory elements. A series of finer deletions were made between -115 and +58 (Fig. 9AGo), and function of these sequences was examined in transiently transfected HOS cells. Serial deletion of P3 sequences produced a gradual loss of reporter gene expression (Fig. 9Go, B and C) to 20% of that observed with the -115 recombinant. A similar gradual loss of activity has been seen in other CpG island promoters (33). The most significant drops in activity were observed upon deletion from -27 to +16, the region containing the upstream initiation sites, and from -115 to -83. This region contains a consensus MAZ site and a series of Sp1 sites. The role of these sites in P3 function was further investigated by EMSA of oligonucleotides derived from the -115 to -83 region with HOS cell nuclear extracts (Fig. 10Go). These studies provided evidence for binding of Sp1, but not MAZ to this region. Competition experiments with the wild-type -115 to -83 sequence (Fig. 10AGo), selectively inhibited formation of a complex of low mobility (Fig. 10BGo, lanes 2–4). This complex was similarly disrupted with an oligonucleotide containing mutations in the MAZ consensus sequence, but not with sequences mutated in the consensus Sp1 site (Fig. 10BGo, lanes 5–8). The presence of Sp1 in the slow migrating complex was supported by addition of an anti-Sp1 antibody, which blocked its formation (Fig. 10CGo, lanes 1 and 2). EMSA with the oligonucleotide containing a mutated MAZ sequence gave results essentially identical to those obtained with the wild-type oligonucleotide (Fig. 10CGo, lane 3). Taken together these data provide evidence for binding of Sp1, but not MAZ, to the -115 to -83 region in HOS cell extracts, and suggest that Sp1 is important for controlling activity of the P3 promoter in HOS cells. Note also that no significant loss in residual promoter activity was observed by deletion of overlapping MAZ sites lying between +42 and +58 (Fig. 9BGo), consistent with a lack of function of MAZ sites in HOS cells.



View larger version (55K):
[in this window]
[in a new window]
  		Figure 10. EMSA of P3 promoter sequences -115 to -83 with extracts of HOS cells. A, Sequences of oligonucleotides used in these experiments containing either the wild-type sequence, or sequences containing point mutations in the consensus MAZ or Sp1 motifs. B, EMSA performed with nuclear extracts of HOS cells. Competition experiments were performed with excess unlabeled wild-type, MAZ mutant, or Sp1 mutant oligonucleotides as indicated. C, EMSA as in B performed with the wild-type sequence in the absence (lane 1) or presence (lane 2) of an anti-Sp1 antibody, or with the oligonucleotide containing the mutated MAZ motif (lane 3).

 
In conclusion, these studies have analyzed a region of approximately 2 kb of the human PTHR gene extending from 954 bp upstream of P2 to 250 bp downstream of P3 and have shown that sequences proximal to P2 and P3 are sufficient for promoter activity. The constructs used in the experiments presented did not include a 60-bp region of U3 that lies between the P2 and P3 recombinants tested here. Note, however, that an extended construct containing 1.8 kb of continuous P2 and P3 promoter sequence did not provide any evidence for enhancer sequences lying within U3 (data not shown). Thus, apart from the proximal promoter sequences defined above, our data do not provide any evidence for the existence of autonomously acting enhancer sequences lying between 954 upstream of P2 and 250 bp downstream of P3.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Stable transfection of human PTHR promoter-luciferase reporter plasmids in human osteoblast-like cells HOS and SaOS-2 recapitulated the pattern of activity of endogenous PTHR gene promoters. RT/PCR analyses showed that the widely expressed P2 and P3 promoters, but not the kidney-specific P1 promoter, were active in these cells (Fig. 1Go). Similarly, HOS and SaOS-2 lines propagating the P2- or P3-reporters expressed luciferase activity, whereas luciferase reporter plasmid carrying 1.6 kb of the P1 promoter was not functional in these cells (Fig. 3Go). Deletion analysis of the P2 and P3 promoters showed that proximal sequences within approximately 100 bp of transcription start sites were sufficient for expression of luciferase activity in stably transfected cells ( Figs. 4–7GoGoGoGo). No evidence was found for the action of elements lying between -91 and -954 of P2, or -115 and -842 of P3 in stimulation of promoter activity in stably transfected HOS cells propagated in normal serum ( Figs. 4–7GoGoGoGo).

The results of transient transfection studies with promoter deletion constructs were generally in agreement with those obtained in stably transfected cells. However, we observed a gradual loss of luciferase expression with successive 5' deletions of P3, and to a lesser degree with P2, in transiently transfected HOS and SaOS-2 cells. This suggests that the apparent contribution of distal sequences to promoter function in transiently transfected cells could arise through the nonspecific activity of transcription factors binding to naked, but not nucleosomal, DNA. As yet, few promoter sequences have been studied in this manner. These results raise the possibility that contributions to promoter activity of some putative promoter elements identified in transient transfection studies may not be significant in stably transfected cells.

Comparison of the sequences of P2 and P3 between -100 and +75 shows a remarkable similarity of organization (Figs. 4Go and 8Go). Both proximal promoter regions contain Sp1 sites along with sequence motifs recognized by the ETF family of transcriptional regulators (34, 35, 36), and the myc-associated zinc finger protein, MAZ (37, 38). Sp1 was found to be important for function of the proximal P3 promoter in HOS cells (Figs. 8Go and 9Go), whereas no evidence was found for significant function of the adjacent MAZ sequence or the ETF motif in these cells. However, it is possible that these sequences may be important for function in other cell types. Combinations of Sp1 and MAZ, or Sp1 and ETF have been found to be required for function of a number of TATA-less G+C-rich promoters required for the expression of genes encoding proteins of diverse biological function. For example, ETF and Sp1 sites have been found in the widely expressed genes encoding L-isoaspartyl methyltransferase (34), and human perlecan, which encodes a large basement membrane proteoglycan (35). MAZ has been shown to interact with the TATA-less promoters of genes encoding the serotonin 1a receptor (37), and the T-cell glycoprotein CD4 (38), as well as the TATA-containing promoters of the c-myc and insulin genes (39, 40, 41). The presence of these elements in the P2 and P3 promoters of the human PTHR gene would be consistent with the broad expression patterns of P2- and P3-specific transcripts.

While P2 and P3 share many characteristics, there are distinct functional differences between the two sequences. P3 is an unusual regulatory region as it has characteristics of both tissue specific and housekeeping promoters. P3-specific transcripts are widely although not ubiquitously expressed in the adult (21). The promoter is moderately active in most adult tissues and cell lines tested, but highly active in kidney. This raises the possibility of a tissue-specific enhancer driving elevated P3 activity in kidney. However, it is not clear in which renal cell types P3 functions. Our previous studies in rodent kidney have detected moderate levels of PTHR gene transcripts in tubular epithelial cells and in glomerular podocytes, and high levels in capillary endothelial cells and vascular smooth muscle (20). Most of these transcripts were driven by P1, the major renal promoter in mouse and rat, whereas moderate levels of P2-specific transcripts were restricted to tubular epithelial cells. It is noteworthy that only P2-specific transcripts were detected in the human renal epithelial cell line HK2 (21), and other studies have shown that P3 functions poorly in these cells in gene transfer experiments (data not shown).

The other striking difference between the two promoters lies in their different patterns of expression during development. P2-specific transcripts were detected in all tissues tested between 12 and 19 weeks fetal age of development, whereas P3 was inactive at this stage of gestation (21). This is an important stage of organ development and skeletal ossification (42). The apparent absence of P3 function in fetal osteoblasts is striking, given that P3-specific transcripts were detected in both SaOS-2 and HOS osteoblast-like osteosarcoma cell lines. This suggests that the late onset of P3 function requires either the expression of specific activator(s) expressed late in development or relief from repression. It is noteworthy in this regard that P2 and P3 lie within the same CpG island (Fig. 1Go). Generally, CpG island promoters remain free of the de novo genomic methylation that occurs at the pregastrula stage, and remain unmethylated throughout development (43). Indeed, while P3 function can be repressed in gene transfer experiments by methylation in vitro, analysis of fetal genomic DNA samples has shown that P3 is unmethylated at midgestation (44).

The observation that broadly expressed transcription factors such as Sp1 control P3 function provides support for the notion that P3 may be repressed in fetal tissues. Sp1 is expressed widely during development and controls the activity of a number of housekeeping promoters (45, 46, 47). The identification of a negative regulatory ARR lying between -147 and -115 of P3 may provide a clue to the differential regulation of P2 and P3 (Fig. 6Go). It is possible that repressor(s) binding to this element may act to block the action of widely expressed transcription factors on the P3 promoter. EMSAs with HOS cell nuclear extracts provided evidence for one or more factors interacting with the ARR (Fig. 7Go). The ARR also acts as a repressor when placed upstream of P2, which, apart from the ARR, is similar in sequence and organization to P3. Intriguingly, however, insertion of the ARR upstream of a truncated thymidine kinase promoter gave rise to a 2-fold increase in reporter gene expression, suggesting that function of the element in the context of the endogenous gene may depend on other factors binding to promoter sequences. These results also suggest that the ARR does not function like other repressor sequences that recruit histone deacetylase activity to promoters (48). If this were the case, the ARR would be expected to function as a repressor independent of promoter context. Moreover, it is unlikely that the A-rich nature of the sequence imparts a change in structure to flanking DNA that is inhibitory to transcription.

In summary, we have shown that sequences required for function of the human PTHR gene P2 and P3 promoters in stably transfected human osteoblast-like cells lie within approximately 100 bp of transcription initiation sites, and have identified a downstream initiation site of the P3 promoter. The proximal regions of P2 and P3 are similarly organized, and contain consensus motifs for Sp1, MAZ, and ETF transcription factors. However, the proximal region of P3 also contains a repressor element, which may play a role in the complex developmental regulation of P3.


   Footnotes
 
1 This work was supported by Operating Grants MT-12896 (to J.H.W.), MT-5775 (to D.G.), MT-9315 (to G.N.H.), and a grant from the National Cancer Institute (to D.G.). Back

2 These authors should be considered as equal first authors. Back

3 Recipient of a fellowship from the Royal Victoria Hospital Research Institute. Present address: Department of Pediatrics, Chiba University School of Medicine, Inohana, Chuo-ku, Chiba, Japan. Back

4 Present address: Weizmann Institute of Science, 76100 Rehovot, Israel. Back

5 Chercheur-Boursier of the Fonds de la Recherche en Santé du Québec. Back

Received September 30, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lanske B, Karaplis AC, Lee K, Luz A, Vortkamp A, Pirro A, Karperien M, Defize LHK, Ho C, Mulligan RC, Abou-Samra A, Juppner H, Segre GV, Kronenberg HM 1996 PTH/PTHrP receptor in early development and Indian hedgehog-regulated bone growth. Science 273:663–666[Abstract]
  2. Kronenberg H 1996 Parathyroid hormone: mechanism of action. In: Favus MJ (ed) Primer on Metabolic Bone Diseases and Disorders of Mineral Metabolism, ed. 3. J.B. Lippincott Co., Philadelphia, pp 68–70
  3. Goltzman D, Hendy GN 1999 Parathyroid hormone. In: Becker KL (ed) Principles and Practice of Endocrinology and Metabolism, ed. 3. J.B. Lippincott Co., Philadelphia, in press
  4. Suva LJ, Winslow GA, Wettenhall REH, Hammonds RG, Moseley JM, Diefenbach-Jagger H, Rodda CP, Kemp BE, Rodriguez H, Chen EY, Hudson PJ, Martin TJ, Wood WI 1987 A parathyroid hormone-related protein implicated in malignant hypercalcemia: cloning and expression. Science 237:893–896[Abstract/Free Full Text]
  5. Ikeda K, Mangin M, Dreyer BE, Webb AC, Posillico JT, Stewart AF, Bander NH, Weir EC, Insogna KL, Broadus AE 1988 Identification of transcripts encoding parathyroid hormone-like peptide in messenger RNAs from a variety of human and animal tumors associated with humoral hypercalcemia of malignancy. J Clin Invest 81:2010–2014
  6. Stewart AF 1996 Humoral hypercalcemia of malignancy. In: Favus MJ (ed) Primer on Metabolic Bone Diseases and Disorders of Mineral Metabolism, ed. 3. Raven Press, New York, pp 198–203
  7. Strewler GD, Nissenson RA 1996 Parathyroid hormone-related peptide. In: Favus MJ (ed) Primer on Metabolic Bone Diseases and Disorders of Mineral Metabolism, ed. 3. Raven Press, New York, pp 71–73
  8. Abou-Samra, AB, Jüppner H, Force T, Freeman MW, Kong XF, Schipani E, Urena P, Richards J, Bonventre J, Potts Jr JT, Kronenberg HM, Segre GV 1992 Expression cloning of a parathyroid hormone/parathyroid hormone related peptide receptor from rat osteoblast-like cells: a single receptor stimulates intracellular accumulation of both cyclic AMP, and inositol triphosphate and increases intracellular free calcium. Proc Natl Acad Sci USA 89:2732–2736[Abstract/Free Full Text]
  9. Juppner, H, Abou-Samra AB, Freeman M, Kong XF, Schipani E, Richards J, Kolakowski LJ, Hock J, Potts Jr JT, Kronenberg HM, Segre GV 1991 A G-protein-linked receptor for parathyroid hormone and parathyroid hormone-related peptide. Science 254:1024–1026[Abstract/Free Full Text]
  10. Schipani E, Karga H, Karaplis AC, Hellman P, Xie LY, Potts Jr JT, Kronenberg HM, Segre GV, Abou-Samra AB, Jüppner H 1993 Identical complementary deoxyribonucleic acids encode a human renal and bone parathyroid hormone (PTH)/PTH-related peptide receptor. Endocrinology 132:2157–2165[Abstract/Free Full Text]
  11. Lin SC, Lin CR, Gukovsky I, Lusis AJ, Sawchenko PE, Rosenfeld MG 1993 Molecular basis of the little mouse phenotype and implications for cell type-specific growth. Nature 364:208–213[CrossRef][Medline]
  12. McCuaig KA, Clarke JC, White JH 1994 Molecular cloning of the gene encoding the mouse parathyroid hormone/parathyroid hormone-related peptide receptor. Proc Natl Acad Sci USA 91:5051–5055[Abstract/Free Full Text]
  13. Kong XF, Schipani E, Lanske B, Joun H, Karperien M, Defize LHK, Juppner H, Potts Jr JT, Segre GV, Kronenberg HM, Abou-Samra AB 1994 The rat, mouse and human genes encoding the receptor for parathyroid hormone and parathyroid hormone related peptide are highly homologous. Biochem Biophys Res Comm 200:1290–1299[CrossRef][Medline]
  14. Maget B, Tastenoy M, Svoboda M 1994 Sequencing of eleven exons in genomic DNA encoding rat glucagon receptor and multiple alternative splicing of its mRNA. FEBS Lett 351:271–275[CrossRef][Medline]
  15. Zolnierowicz S, Cron P, Salinas-Toldo S, Fires R, Lin HY, Hemmings BA 1994 Isolation, characterization and chromosomal localization of the porcine calcitonin receptor gene. J Biol Chem 269:19530–19538[Abstract/Free Full Text]
  16. Sreedharan SP, Huang JX, Cheung MC, Goetzl EJ 1995 Structure, expression and chromosomal localization of the type I human vasoactive intestinal peptide receptor gene. Proc Natl Acad Sci USA 92:2939–2943[Abstract/Free Full Text]
  17. McCuaig KA, Lee H, Clarke JC, Assar H, Horsford J, White JH 1995 Parathyroid hormone/parathyroid hormone related peptide receptor gene transcripts are expressed from tissue-specific and ubiquitous promoters. Nucleic Acids Res 23:1948–1955[Abstract/Free Full Text]
  18. Bettoun JD, Minagawa M, Kwan MY, Lee HS, Yasuda T, Hendy GN, Goltzman D, White JH 1997 Cloning and characterization of the promoter regions of the human parathyroid hormone (PTH)/PTH-related peptide receptor gene: analysis of deoxyribonucleic acid from normal subjects and patients with pseudohypoparathyroidism type 1b. J Clin Endocrinol Metab 82:1031–1040[Abstract/Free Full Text]
  19. Joun H, Lanske B, Karperien M, Qian F, Defize L, Abou-Samra A 1997 Tissue-specific transcription start sites and alternative splicing of the parathyroid hormone (PTH)/PTH-related peptide (PTHrP) receptor gene: a new PTH/PTHrP receptor splice variant that lacks the signal peptide. Endocrinology 138:1742–1749[Abstract/Free Full Text]
  20. Amizuka N, Lee HS, Kwan MY, Arazani A, Warshawsky H, Hendy GN, Ozawa H, White JH, Goltzman D 1997 Cell-specific expression of the parathyroid hormone (PTH)/PTH-related peptide receptor gene in kidney from kidney-specific and ubiquitous promoters. Endocrinology 138:469–481[Abstract/Free Full Text]
  21. Bettoun JD, Minagawa M, Yasuda T, Hendy GN, Goodyer CG, Goltzman D, White JH 1998 Developmental upregulation of human PTH/PTHrP receptor gene expression from conserved and human-specific promoters. J Clin Invest 102:958–967[Medline]
  22. Hager GL, Archer TK 1991 In: Parker MG (ed) Nuclear Hormone Receptors: Molecular Mechanisms, Cellular Functions and Clinical Abnormalities. Academic Press, New York, pp 217–234
  23. Wolffe AP 1996 Histone deacetylase: a regulator of transcription. Science 272:371–372[CrossRef][Medline]
  24. Wolffe AP, Pruss D 1996 Targeting chromatin disruption: Transcription regulators that acetylate histones. Cell 84:817–819[CrossRef][Medline]
  25. Montminy M 1997 Transcriptional activation. Something new to hang your HAT on. Nature 687:654–655
  26. Pazin MJ, Kadonaga JT 1997 SWI2/SNF2 and related proteins: ATP-driven motors that disrupt protein-DNA interactions? Cell 89:325–328[CrossRef][Medline]
  27. Richard-Foy H, Hager GL 1987 Sequence-specific positioning of nucleosomes over the steroid-inducible MMTV promoter. EMBO J6:2321–2328
  28. Nordeen SK 1988 Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 6:454–458[Medline]
  29. Mader S, White JH 1993 A steroid-inducible promoter for the controlled overexpression of cloned genes in eukaryotic cells. Proc Natl Acad Sci USA 90:5603–5607[Abstract/Free Full Text]
  30. Yates JL, Warren N, Sugden B 1985 Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature 313:812–815[CrossRef][Medline]
  31. Andrews NC, Faller DV 1991 A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19:2499[Free Full Text]
  32. White JH, McCuaig KA, Mader S 1994 A simple and sensitive high-throughput screen for steroid agonist and antagonists. Biotechnology 12:1003–1007[CrossRef][Medline]
  33. Somma MP, Pisano C, Lavia P 1991 The housekeeping promoter from the mouse CpG island HTF9 contains multiple protein-binding elements that are functionally redundant. Nucleic Acids Res 19:2817–2824[Abstract/Free Full Text]
  34. Galus A, Lagos A, Romaniuk EA, O’Connor CM 1994 Structural analysis of transcripts for the protein L-isoaspartyl methyltransferase reveals multiple transcription initiation sites and a distinct pattern of expression in mouse testis: identification of a 5'-flanking sequence with promoter activity. Arch Biochem Biophys 312:524–533[CrossRef][Medline]
  35. Cohen IR, Grassel S, Murdoch AD, Iozzo RV 1993 Structural characterization of the complete human perlecan gene and its promoter. Proc Natl Acad Sci USA 90:10404–10408[Abstract/Free Full Text]
  36. Yasunami M, Suzuki K, Ohkubo H 1996 A novel family of TEA domain-containing transcription factors with distinct spatiotemporal expression patterns. Biochem Biophys Res Comm 228:365–370[CrossRef][Medline]
  37. Parks CL, Shenk T 1996 The serotonin 1a receptor gene contains a TATA-less promoter that respond to MAZ and Sp1. J Biol Chem 271:4417–4430[Abstract/Free Full Text]
  38. Duncan DD, Stupakoff A, Hedrick SM, Marcu KB, Siu S 1995 A Myc-associated zinc finger protein binding site is one of four important functional regions in the CD4 promoter. Mol Cell Biol 15:3179–3186[Abstract]
  39. Bossone SA, Asselin C, Patel AJ, Marcu KB 1992 MAZ, a zinc finger protein, binds to c-MYC and C2 gene sequences regulating transcriptional initiation and termination. Proc Natl Acad Sci USA 89:7452–7456[Abstract/Free Full Text]
  40. Kennedy GC, Rutter WJ 1992 Pur-1, a zinc-finger protein that binds to purine-rich sequences, transactivates an insulin promoter in heterologous cells. Proc Natl Acad Sci USA 89:11498–11502[Abstract/Free Full Text]
  41. Pyrc JJ, Moberg KH, Hall DJ 1992 Isolation of a novel cDNA encoding a zinc-finger protein that binds to two sites within the c-myc promoter. Biochemistry 31:4102–4110[CrossRef][Medline]
  42. Crelin ES 1981 Development of the musculoskeletal system. In: CIBA Clinical Symposia, vol. 31, CIBA Pharmaceutical Co., pp 2–36
  43. Razin A, Kafri T 1994 DNA methylation from embryo to adult. Prog Nucleic Acids Res Mol Biol 48:53–81[Medline]
  44. Bettoun JD, Kwan MY, Minagawa M, Alpert LC, Goodyer CG, Hendy GN, Goltzman D, White JH 2000 Methylation patterns of human parathyroid hormone (PTH)/PTH-related peptide receptor gene promoters are established several weeks prior to onset of their function. Biochem Biophys Res Commun 267:482–487[CrossRef][Medline]
  45. Saffer JD, Jackson SP, Annarella MB 1991 Developmental expression of Sp1 in the mouse. Mol Cell Biol 11:2189–2199[Abstract/Free Full Text]
  46. Marin M, Karis A, Visser P, Grosveld F, Philipsen S 1997 Transcription factor Sp1 is essential for early embryonic development but dispensable for cell growth and differentiation. Cell 89:619–628[CrossRef][Medline]
  47. Worrad DM, Schultz RM 1997 Regulation of gene expression in the preimplantation mouse embryo: temporal and spatial patterns of expression of the transcription factor Sp1. Mol Reprod Dev 46:268–277[CrossRef][Medline]
  48. Heinzel T, Lavinsky RM, Mullen TM, Soderstrom M, Laherty CD, Torchia J, Yang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW, Glass CK, Rosenfeld MG 1997 A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 387:43–48[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Clin. Endocrinol. Metab.Home page
M. Minagawa, T. Yasuda, T. Watanabe, K. Minamitani, Y. Takahashi, D. Goltzman, J. H. White, G. N. Hendy, and Y. Kohno
Association between AAAG Repeat Polymorphism in the P3 Promoter of the Human Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Gene and Adult Height, Urinary Pyridinoline Excretion, and Promoter Activity
J. Clin. Endocrinol. Metab., April 1, 2002; 87(4): 1791 - 1796.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
M. Minagawa, T. Watanabe, Y. Kohno, H. Mochizuki, G. N. Hendy, D. Goltzman, J. H. White, and T. Yasuda
Analysis of the P3 Promoter of the Human Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Gene in Pseudohypoparathyroidism Type 1b
J. Clin. Endocrinol. Metab., March 1, 2001; 86(3): 1394 - 1397.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Minagawa, M.
Right arrow Articles by White, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Minagawa, M.
Right arrow Articles by White, J. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals