Endocrinology Vol. 141, No. 7 2557-2566
Copyright © 2000 by The Endocrine Society
A Targeted Partial Invalidation of the Insulin-Like Growth Factor I Receptor Gene in Mice Causes a Postnatal Growth Deficit1
Martin Holzenberger2,
Patricia Leneuve,
Ghislaine Hamard,
Bertrand Ducos,
Laurence Perin,
Michel Binoux and
Yves Le Bouc
U-515 INSERM, Hôpital Saint-Antoine (M.H., P.L., B.D., L.P.,
M.B., Y.L.B.), 75571 Paris; and U-380, INSERM, Faculté de
Médecine Cochin-Port Royal (G.H.), 75014 Paris, France
Address all correspondence and requests for reprints to: Dr. Martin Holzenberger, U-515, INSERM, Hôpital Saint-Antoine, 75571 Paris Cedex 12, France. E-mail: holzenberger{at}st-antoine.inserm.fr
 |
Abstract
|
|---|
The insulin-like growth factor (IGF) system is a major regulator of
somatic growth in vertebrates. Both ligands (IGF-I and IGF-II) signal
via the same IGF receptor (IGF-IR). Classical IGF-IR invalidation is
lethal at birth, so that conditional models are needed to study the
postnatal role of this receptor. To establish a genetically inducible
invalidation of IGF-IR, we targeted the IGF-IR gene using a construct
that introduced a neomycin resistance cassette into intron 2, leaving
the rest of the gene intact. This neomycin resistance cassette
interfered with the processing of the primary transcript, resulting in
there being 12% fewer IGF-binding sites at the cell surface in
heterozygous mice and 41% fewer in homozygous mice. Hetero- and
homozygous offspring grew more slowly than their wild-type littermates.
This difference was noticeable from 4 weeks after birth and was
significant from 5 weeks after birth in males. In females, the effect
on postnatal growth of insertion of the neo cassette was
not significant. In males, IGF-I levels increased moderately (+26%)
but significantly, indicating effective feedback regulation of the IGF
system. IGF-binding protein-4 (IGFBP-4) levels, estimated by Western
ligand blotting, were low in homozygotes (-38%), whereas IGFBP-1, -2,
and -3 levels were unaffected. In females, IGF-I and IGFBP-1, -2, -3,
and -4 levels did not differ significantly among heterozygous,
homozygous, and wild-type animals. We investigated the molecular
mechanism involved and characterized two RNA-splicing events that could
account for the decrease in IGF-IR. The phenotype of these mice
developed exclusively postnatally, and body proportions were
maintained. IGF-IRneo mice constitute a new model for human postnatal
growth deficiency.
 |
Introduction
|
|---|
INSULIN-LIKE growth factor type 1 receptor
(IGF-IR) controls proliferation and differentiation in many tissues and
cell types. IGF-IR is a transmembrane tyrosine kinase receptor that
transduces signals corresponding to two ligands, IGF-I and IGF-II. Both
ligands and the IGF-IR are structurally related to insulin and the
insulin receptor, respectively (for reviews see Refs. 1, 2). The
bioavailability of IGF-I and IGF-II is regulated by six IGF-binding
proteins (IGFBPs) and by the mannose-6-phosphate receptor (type 2 IGF
receptor), which contains binding sites for IGF-II (for reviews see
Refs. 3, 4).
The functions of the IGF system in vivo have been
investigated by transgenic ligand overproduction using ubiquitous and
tissue-specific promoters. The ubiquitous overproduction of IGF-I leads
to postnatal overgrowth (5). Tissue-specific overproduction of IGF-I
leads to overgrowth of the targeted organ only, despite higher levels
of circulating IGF-I (6). Similar results have been obtained with
IGF-II (7). IGFs play important roles in the central nervous system
(8), where IGF overproduction increases myelin content (9) and
stimulates brain growth in a region-dependent fashion (10). Similarly,
the transgenic overproduction of IGF-I in myocytes causes muscle
overgrowth (11). However, as IGF is known to have both endocrine and
paracrine functions, the results of transgenic gain of function
experiments may not represent the full spectrum of IGF activity
in vivo.
Classical inactivation of the receptor results in a potent loss of
function model, in which the effects of IGF action can be directly
related to specific target cells. The phenotype, however, is strongly
cumulative, with significant effects on growth from embryonic day 11
onward, birth weights only 45% those of the wild-type (WT), and
perinatal death due to respiratory failure (12, 13). To study the
function of IGF signaling in the target tissues in vivo, we
initiated a program to inactivate the IGF-IR genetically in a
conditional, inducible, tissue-specific, partial, or mosaic manner
using the Cre-loxP system (14, 15).
Here, we report the development of the principal component of the
model, the IGF-IRlox mouse, and describe a phenotype that appears to
result from a genetically fixed reduction in the number of functional
IGF-IR due to the insertion of a neomycin resistance cassette into the
IGF-IR gene. We describe the phenotype and the effects on the other
components of the IGF system. We also explore the molecular mechanism
responsible for this partial receptor invalidation.
 |
Materials and Methods
|
|---|
Construction of the targeting vector for homologous
recombination
To target the IGF-IR locus, we used a genomic region between the
SalI site 4.3 kb upstream from exon 3 and the
BamHI site 850 bp downstream from exon 3 (Fig. 1A
). A neomycin selection cassette,
driven by a PGK promoter and equipped with loxP sites on
both sides, was inserted into the EcoRI site 154 bp upstream
from exon 3. A third loxP site, associated with an
I-SceI site, was inserted into the HindIII site
350 bp downstream from exon 3. The BamHI site 0.5 kb
downstream from HindIII was used to insert a PGK
promoter-driven TK (thymidine kinase) cassette. The TK and
neo genes were inserted in the opposite orientation to the
IGF-IR gene. This construct was amplified in a 2.9-kb plasmid backbone
(details of the construction process can be obtained from the authors).
The entire exon 3, the RNA splice lariat region, and the three
loxP sites that had been designed for this construct and
assembled from synthetic oligonucleotides, were sequenced (Sequenase
2.0, United States Biochemical Corp., Cleveland, OH). The
linearized construct was then used to electroporate the mouse embryonic
stem (ES) cells.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 1. Schematic representation of IGF-IR gene
targeting and ES cell selection. A, In ES cells, we replaced the
wild-type exon 3 with a floxed exon 3 connected to a floxed
neo cassette. We checked that integration was correct
using nested PCR (positions of external and internal primers are
indicated by arrowheads), and Southern hybridization
with an internal (IP) and an external (EP) probe.
Triangles represent loxP sites. Diagrams
are not to scale. B, Examples of clones carrying the correct
integration on the short arm side (no. 13 and 45) as tested by PCR
(expected amplicon size, 800 bp). A construct with a 150-bp deletion,
diluted by mixing with WT genomic DNA, served as a positive control
(C+). C, Southern hybridization testing integration on the long arm
side. Clones 13 and 45 show the expected band at 4.6 kb in addition to
the WT allele at 5.4 kb. Clone 13 had integrated additional material in
a nonhomologous fashion and was eliminated. The slightly stronger
intensity of the WT band is due to the presence of a few wild-type ES
cells at this early stage of selection. D, Confirmation of clone 45 by
Southern hybridization on the short arm side. The double band indicates
correct exon replacement. B, BamHI; E,
EcoRI; E3, exon 3; H, HindIII; Hc,
HincII; I, I-SceI; M, DNA molecular size
marker; N, neomycin resistance cassette; TK, thymidine kinase cassette.
|
|
ES cell manipulation
Male ES cells of 129/Sv origin (a gift from A. K. Voss,
MPI, Gottingen, Germany) (16) were cultured on SNL feeder cells (a gift
from A. Bradley, Baylor College of Medicine, Houston, TX) (17) in M15
medium supplemented with 15% FCS (Sigma, St. Louis, MO).
We electroporated ES cells at passages 10 and 11 under standard
conditions (18) using a Gene Pulser (Bio-Rad Laboratories, Inc., Richmond, CA), and performed positive/negative selection
using 200 µg/ml G418 (Sigma) and 500 ng/ml gancyclovir
(Roche, Indianapolis, IN). Genomic DNA from ES cell clones
(19) was tested by nested PCR for the correct integration of the short
arm, downstream from IGF-IR exon 3 (outer primers, 5'-3',
TGCTATACGAAGTTATAGGG and AAATGTAATCTTTGGTTTGA; inner primers,
AAGTTATAGGGATAACAGGG and TTTGATCCAGCAGTCAGC). Positive clones were
confirmed by probing a genomic Southern blot with an external probe
(HincII digest for the short arm), and an internal probe
(HindIII digest for the long arm, upstream from exon 3). All
restriction enzymes were obtained from New England Biolabs (Beverly,
MA). We microinjected the targeted ES cells into B57BL/6 blastocysts
using a micromanipulator Transferman equipped with Celltram injectors
(Eppendorf, Hamburg, Germany) and implanted the
resulting transgenic blastocysts into pseudopregnant females
(IFFA-Credo, LArbresle, France).
Animals
We obtained several germline chimeras that transmitted the
mutation in a 129/Sv genetic background. We also crossed these germline
chimeras with C57BL/6 females to generate a population with a mixed
genetic background. Mice heterozygous for the mutated receptor were
mated to create a population consisting of WT, heterozygous, and
homozygous animals. Mice were housed in standard conditions (25 C, 12-h
light, 12-h dark cycle, water/food ad libitum), and pups
were weaned at 25 days. Body weight (±0.1 g) was measured weekly.
Blood samples (100200 µl) were taken by retroorbital puncture using
Pasteur pipettes prerinsed with 0.5 M EDTA, and
plasma samples were stored at -20 C.
IGF-IRneo mice were crossed with an EIIa-Cre transgenic line
to excise the floxed regions in vivo. EIIa-Cre,
used here in a 129/Sv genetic background, produces the recombinase
ubiquitously, but at moderate levels during early development. In the
F1 generation we searched for partial
(neo) and total (neo and exon 3) excisions by
Southern blotting. In the F2 generation, we
identified animals that had inherited an allele with either
neo excision (IGF-IRlox) or total excision
(IGF-IRex3-). Total excision is the equivalent
of the classical IGF-IR knockout (KO) (12, 13). Animals of these two
types were then mated to produce homozygous IGF-IRlox and
IGF-IRex3-/-.
Detection of the targeted receptor gene in mice by Southern
blot
DNA was prepared from 10-day-old animals using standard
procedures. Tail biopsy samples were digested overnight with proteinase
K (Eurobio, Les Ulis, France) and centrifuged, and the
supernatant was mixed with an equal volume of isopropanol. The
precipitate was washed with 75% ethanol, dried, and resuspended in 10
mmol Tris (pH 8.0). DNA (8 µg) from each animal was digested with
HincII, subjected to electrophoresis in a 1.0% agarose gel,
transferred to Nylon membranes (Hybond+,
Amersham Pharmacia Biotech, Aylesbury, UK) by capillary
action, and hybridized with a genomic probe (radiolabeled using
Rediprime, Amersham Pharmacia Biotech) that recognized a
0.8-kb intronic region directly upstream from the inserted neomycin
resistance cassette. The expected fragments were 2.4 kb for the
wild-type IGF-IR and 4.3 kb for the targeted IGF-IRneo allele.
Receptor binding assays
Recombinant human IGF-I (rhIGF-I; GroPep Pty. Ltd.,
Adelaide, Australia) was labeled with 125I
(Amersham Pharmacia Biotech) using the chloramine-T method
(SA,
100 µCi/µg). All chemicals were obtained from
Sigma. Crude membranes were prepared from whole brain as
previously described (20). After decapitation, brains were quickly
removed, and homogenized. The homogenate was centrifuged twice at 4 C;
the pellet was resuspended, and the suspension was immediately used for
binding assays. Proteins were measured using the bicinchoninic acid
protein assay from Pierce Chemical Co. (Rockford, IL).
Binding assays were performed in 0.5 ml 50 mM Tris-HCl
buffer containing the membrane preparation (300 µg protein) and the
iodinated ligand. Nonspecific binding was determined in the presence of
200 nM rhIGF-I. Competition experiments were performed
using 1520 pM [125I]rhIGF-I and
various amounts of unlabeled rhIGF-I. Incubation was stopped after 120
min at 25 C (by which time steady state had been reached), and the
mixture was centrifuged. The pellet was washed twice and counted in a
-counter (1275 MiniGamma, LKB Wallac, Turku,
Finland).
IGF-I assay
Plasma samples (1025 µl) were incubated in 0.01
M HCl for 30 min at room temperature and ultrafiltered
using Centricon 30 columns (Amicon, Millipore Corp.,
Bedford, MA). The ultrafiltrate was lyophilized, resuspended in
0.1 M phosphate buffer and 1 mg/ml BSA (pH 7.4) and
incubated for 2 days with [125I]rhIGF-I (3000
cpm/tube) and a polyclonal antihuman IGF-I antibody (dilution, 1:120
000) that cross-reacts with murine IGF-I (21, 22) (a gift from J.
Closset, CHU, Liège, Belgium). Samples were tested at five
concentrations, each in duplicate (22). After incubation, free and
bound IGFs were separated using albumin-coated charcoal, as previously
described (23). The detection threshold of the assay was 12 ng/ml
plasma. Intraassay variation was 5%, and interassay variation was
10%.
Western ligand blotting of IGFBPs
Plasma samples (3 µl/animal) were subjected to 12.5%
nonreducing PAGE (24). Proteins were electrotransferred onto
nitrocellulose membranes and incubated with
[125I]IGF-I and -II (500,000 cpm each). Blots
were washed and placed against x-ray film (Eastman Kodak Co., Rochester, NY) at -80 C. A pooled normal sample was
included on each gel to make it possible to compare different
experiments. Western ligand blots were quantified using a STORM 850
PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA)
and ImageQuant 5.0 software.
RT-PCR, amplicon subcloning, and sequencing
To detect the splicing of sequences from the neomycin resistance
cassette into mature IGF-IR transcripts, we extracted total RNA (25)
from the brain of an adult homozygous IGF-IRneo male and produced first
strand complementary DNA using Moloney murine leukemia virus reverse
transcriptase (Life Technologies, Inc.) following the
manufacturers instructions. In a final reaction volume of 20 µl we
used 500 ng RNA and 20 µg/ml of a reverse complementary
oligonucleotide (5'-GAAGGACAAGGAGACCAAG-3') corresponding to a region
within exon 5 of the receptor gene. All oligonucleotides used were
obtained from Genset (Paris, France). We added 0.5 µl of the
RT products to a tube containing 50 µl of a PCR mixture. The upstream
PCR oligonucleotide corresponded to a sequence in exon 2
(5'-GAAGACCACCATCAACAAT-3'); the downstream oligonucleotide
(5'-ACCACCAAGCGAAACATC-3') was designed to anneal within the neomycin
resistance cassette such that the 5'-half of the cassette (
1 kb)
could be tested for splice events. PCR cycling was as follows: 10 min
at 94 C denaturation/enzyme activation step, 40 PCR cycles (94 C for 1
min, 58 C for 1 min, 72 C for 1.5 min), and a final 7-min elongation
step, performed in a thermal cycler (model 480, Perkin-Elmer Corp.) using AmpliTaq Gold (PE). Amplification products were
separated on 1.2% agarose gels, and the regions containing the bands
of interest were cut out for DNA electroelution. The recovered
amplification products were blunted with Pfu DNA polymerase
and inserted into PCR-Script Amp SK+ (Stratagene).
Minipreps (QIAGEN, Hilden, Germany) from
ampicillin-resistant clones were screened based on their restriction
enzyme digestion profiles, and selected clones were sequenced
(GenomeExpress, Paris, France), using T3 and T7 primers.
 |
Results
|
|---|
Production of mice with the targeted insertion of a neomycin
resistance cassette in intron 2
Targeting of the IGF-IR in ES cells by homologous
recombination. We targeted ES cells using the described
replacement construct and tested the correct integration of the short
arm by PCR. Five of the 66 neomycin-resistant clones were PCR positive
(2 of which are shown in Fig. 1B
) and were tested by Southern blotting
with an internal probe for the long arm and an external probe for the
short arm (Fig. 1
, C and D). One clone (no. 45) showing the expected
profile was then tested with additional probes covering the entire
targeted region confirming correct integration. The karyotype of this
clone was normal, showing a mean of 40.0 ± 0.12
(±SEM) chromosomes in 31 metaphase spreads analyzed and no
evidence of chromosome translocation or loss (results not shown).
Passage of the mutation into the germline. Blastocyst
injections of clone 45 yielded 16 male chimeras, 8 of which had
98100% agouti coat color. Their germline transmission rate was
85100%. Two of the 100% chimeras were used to establish a
heterozygous F1 population of this mouse line
that we named IGF-IRneo. The frequency of transmission of the targeted
allele was 49% (n = 171), independently of genetic background
(129/Sv, or F1 of crosses between 129/Sv and
C57BL/6).
Fertility and reproduction of IGF-IRneo mice. Crosses of
heterozygous IGF-IRneo generated 43% heterozygous, 29% homozygous,
and 28% wild-type animals in a total of 61 animals. These frequencies
are within the limits of variability expected for normal Mendelian
inheritance. Litter size was normal (a mean of 8.1 pups/litter ±
1.4 SD), and newborns began to suckle within hours of
birth. Two pups died within the first 24 h; 1 was wild-type, and
the other homozygous IGF-IRneo. We observed no difference between pure
(129/Sv) and mixed (F1 between C57BL/6 and
129/Sv) backgrounds. Homozygous IGF-IRneo were fertile when mated
together (females from 7 weeks and males from 8 weeks onward) and
produced homozygous litters of normal size (7.0 ± 1.0
pups/litter). Fourteen of the 15 homozygous females were fertile. All
11 homozygous males that we tested were fertile.
Postnatal growth of IGF-IRneo mice
At 10 days of age there was no difference in weight between WT
animals and those hetero- and homozygous for IGF-IRneo and no
differences between males and females (as is normal at this age). At 4
weeks of age, we observed a 5% difference in weight between males and
females (for WT, homozygous, and heterozygous IGF-IRneo taken
together); such a difference is normal. However, we also found that the
differences in weight among males of homozygous, heterozygous, and
wild-type genotypes were increasing. Between 4 and 6 weeks after birth
the growth curves of the males continued to separate, such that at 6
weeks, the order of mean body weight was (from lowest to highest):
homozygous females < heterozygous females < wild-type
females < homozygous males < heterozygous males <
wild-type males (Fig. 2A
). This order did
not change between 6 and 9 weeks. Differences were greatest at 8 and 9
weeks after birth for the male group; mutant homozygous males were
87%, and heterozygous males were 92% of the weight of the WT males.
Weight differences progressed little thereafter and stabilized at 83%
of WT weight in mutant homozygous adults at 5 months of age (91% for
heterozygotes; Fig. 2B
). Homozygous adults gained 4.3 g in weight
from 9 weeks to 5 months of age, which is somewhat less than the weight
gained by 129/Sv wild-type (6.8 g) and IGF-IRneo heterozygotes (6.7 g).
For the females, weight differences were greatest at 6 weeks of age,
with homozygotes being 93% and heterozygotes 97% the weight of WT
females. We ceased to study weight differences between homozygous and
WT females once they had had their first litter. Note that
F2 animals were genotyped on day 10 by Southern
blotting (Fig. 2C
). The WT and IGF-IRneo bands were similar in
intensity after passage of the mutation into the germline, indicating
that the two alleles were equally represented in DNA from the targeted
mouse genome.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 2. Postnatal growth of IGF-IRneo mice. A,
Growth curves for male and female F2 animals (n = 61)
between 3 and 9 weeks of age, separated into WT, heterozygous, and
homozygous IGF-IRneo groups. The significance of differences was
assessed using the Mann-Whitney test. Error bars have been omitted for
better readability. B, Growth deficit in hetero- and homozygous
IGF-IRneo males and females relative to the WT. The mean body weights
of the hetero- and homozygous groups (shown in A) are expressed as a
percentage of the corresponding WT value. After 9 weeks, all homozygous
females had been used for breeding. C, Example of IGF-IR genotyping.
HincII-digested tail DNA (8 µg) was Southern blotted
and hybridized with an intron 2-specific probe. The lower
band indicates the WT IGF-IR allele; the upper
band shows the targeted IGF-IRneo allele. Hm, Homozygous
IGF-IRneo; Ht, heterozygous IGF-IRneo.
|
|
Postnatal growth of IGF-IRneo mice is proportional. Twelve
males (four wild-type, four heterozygous, and four homozygous animals)
from four different litters were killed and dissected at 10 weeks of
age, and brain, liver, kidney, and bones (femur) were weighed to reveal
possible differences in the growth of particular tissues (Fig. 3
). In homozygous IGF-IRneo males these
organs were 10% lighter than those of WT animals. These differences
were significant for the brain and liver, but not so for the other
tissues, possibly due to the small number of observations. Heterozygous
animals showed approximately half the growth retardation of homozygous
animals.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 3. Brain, kidney, liver, and bone (femur) from male
hetero- and homozygous IGF-IRneo and WT IGF-IR mice were dissected and
weighed to detect potential organ-specific growth deficits. Data,
including total body weight, are expressed as a percentage of the WT
value (±SEM). *, P < 0.05.
|
|
Regulation of IGF system proteins in IGF-IRneo mice
As insertion of the neo cassette affected the postnatal
growth, we wanted to know to what extent the synthesis of the various
IGF system components had been affected.
Receptor binding assay. We assessed receptor binding in whole
brain extracts, as the brain is known to be rich in IGF-IR in young
adult animals. We used the brains of four wild-type, four heterozygous,
and four homozygous males (the same mice used to check that growth was
proportional) and those of two WT and two homozygous females.
[125I]IGF-I binding was specific and saturable,
and receptor affinity did not depend on genotype
(Kd range, 0.470.60 nM). The number
of IGF-I-binding sites per cell, however, was lower in hetero- and
homozygous animals than in WT (Fig. 4
and
Table 1
). The mean number of specific
binding sites in IGF-IRneo homozygotes was only 59% of that in the WT
(P < 0.01), whereas in heterozygotes it was 88% (not
significant). The number of receptors did not depend on gender, and the
decrease in number was similar for male and female homozygotes. From
our data, we estimate the mean number of receptor binding sites to be
8 x 105/cell in WT and 5 x
105/cell in homozygous IGF-IRneo brains, all cell
types included.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 4. Inhibition of specific binding of 15
pM [125I]IGF-I by unlabeled IGF-I from WT,
heterozygous, and homozygous mouse brain cell membranes. The data are
from one of four experiments, with reactions at each concentration
carried out in triplicate. Nonspecific binding was evaluated using 200
nM unlabeled IGF-I. Inset, Comparison of
total specific binding of [125I]IGF-I to cell membranes
of the three different genotypes (four animals each). a,
P < 0.05 vs. wild-type; b,
P < 0.05 vs. the heterozygous group
(by Mann-Whitney test). Hm, Homozygous IGF-IRneo; Ht, heterozygous
IGF-IRneo.
|
|
Determination of plasma IGF-I and IGFBPs. Circulating IGF-I
levels in adult (12-week-old) female IGF-IRneo mice (heterozygous or
homozygous) did not differ significantly from WT levels (Table 2
). However, in adult males homozygous
for IGF-IRneo, the mean plasma IGF-I concentration was 26% higher than
that in WT (P < 0.05). Plasma IGFBP-1, -2, -3, and -4
concentrations, estimated by Western ligand blotting (Fig. 5
), did not differ significantly in
hetero- and homozygous IGF-IRneo females from those in the WT animals
(Table 2
). Adult homozygous IGF-IRneo males had significantly lower
plasma IGFBP-4 concentrations than WT animals (P <
0.01), but plasma IGFBP-1, -2, and -3 concentrations were similar to
those in the WT.

View larger version (81K):
[in this window]
[in a new window]
|
Figure 5. Representative examples of Western ligand blot
(WLB) profiles used to estimate the plasma concentrations of IGFBP-1 to
-4 from males and females of different genotypes. A pool of human
plasma served as the quantitative standard. Male and female samples
were processed under slightly different conditions, so that direct
comparison of experimental results between sexes is not possible. WLBs
were analyzed using phosphorimager technology, and quantitative results
are summarized in Table 2 . Hom, Homozygous IGF-IRneo; Het, heterozygous
IGF-IRneo.
|
|
Evidence for altered splicing of the IGF-IR primary transcript
Interference of the inserted bacterial neomycin sequences with the
normal splicing of the primary receptor transcript may be responsible
for the decrease in the number of IGF-binding sites. To show that
aberrant splicing does indeed occur, we searched for
neo/receptor splice junctions by RT-PCR. Using PCR primer
pairs, with the upstream primer corresponding to exon 2 of the receptor
complementary DNA, and the downstream primer corresponding to
neo sequences, we obtained RT-PCR products of the expected
size, with one major band. We checked that this band corresponded to
sequences from the receptor-coding region fused to neo
sequences by subcloning the band and studying its restriction enzyme
profile. Seven clones had integrated fragments of the correct size.
Comparison of their restriction enzyme digestion profiles showed that
there were two different exon 2/neo fusions. The corresponding plasmid
inserts were sequenced, and both were found to contain distinct
junctions between the 3'-end of exon 2 and sequences from the
neo cassette (Fig. 6
). Once
RNA splicing has begun in the reverse neo sequence, there
are two possibilities. 1) RNA splicing of the neo sequence
continues until the 3'-end of exon 3 is reached and then splices into
exon 4, and so forth. The resulting messenger RNA (mRNA) contains
normal 5'- and 3'-untranslated regions (UTR) and additional sequences
from neo. Whatever the splice site (827, 842, or other
positions in the neo open reading frame), the stop codons in
the reverse neo will invariably produce invalidating
truncations of the translation products (see Fig. 6
for details). 2)
RNA splicing may leave the neo sequence before exon 3 is
reached, then continue normally by accepting the 5'-end of exon 3, and
so on. Again, mRNAs will contain normal 5'- and 3'-receptor UTR and
additional neo sequences of various lengths. Most of these
mRNAs will produce receptor proteins truncated in the region
corresponding to neo, exon 3, or exon 4, and the rest will
have random insertions between exons 2 and 3; thus, none of them is
likely to contribute to IGF signaling.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 6. Identification of two aberrant RNA splice events
for the IGF-IRneo allele. A, Constitutive splicing of exon 3 is
disturbed by the neo cassette. Due to imperfect splice
sites in the DNA of bacterial origin, a certain proportion of primary
transcripts transmit fragments from the neo cassette
into the mature receptor RNA. Note that the neo gene was
inserted in the receptor gene in the opposite orientation. B, Two
splice variants between exon 2 and neo (splice sites at
nucleotides 827 and 842 of the neo open reading frame)
were isolated by RT-PCR cloning and characterized by sequencing. The
positions of the RT-PCR primers are indicated by
arrowheads (A). Data were obtained from the negative
strand for 842 and the positive strand for 827. The predicted
consequences at the protein level are indicated. We found no products
involving the splice site at position 800, described by Jacks et
al. (33 ). neo, Neomycin resistance cassette; nt, nucleotides;
ORF, open reading frame; PGK, phosphoglycerol kinase promoter; amino
acids in IUPAC (International Union of Pure and Applied
Chemistry) code.
|
|
Selective excision of the neomycin resistance cassette by the
transgene EIIa-Cre. If the attenuated IGF-IRneo allele was
responsible for the postnatal growth deficit (a so-called hypomorphic
allele), then the selective elimination of neo by
Cre recombination should restore WT growth. We crossed
IGF-IRneo with the mosaic balancer mouse EIIa-Cre (26). To maintain the
genetic background of our line, we used EIIa-Cre in a 129/Sv
background. We used Southern blotting to select animals that had
undergone recombination of the loxP sites flanking the
neo cassette, but that had conserved the floxed exon 3 of
IGF-IR. Mice from this new line, called IGF-IRlox, were devoid of the
neo cassette and simply carried two functional
loxP sites, one on either side of exon 3. Homo- and
heterozygous IGF-IRlox mice were weighed at 6 weeks and did not differ
from WT littermates in terms of body weight (females, 23.9 ± 0.6,
23.4 ± 0.4, 23.2 ± 0.4; males, 26.8 ± 0.6, 26.9
± 0.5, 27.8 ± 0.2; order: homozygous, heterozygous, WT;
±SEM; total n = 53). This experiment also
generated individuals that had lost exon 3 together with the
neo cassette, a deletion that completely disrupts the
IGF-IR. IGF-IRex3-/- mice, homozygous for this
deletion, had features of the classical IGF-IR KO phenotype (13) (Fig. 7
). Their birth weight was 50.3% that of
heterozygous and WT littermates. All homozygous animals were born alive
but unable to breath. They invariably died within the first few minutes
of extrauterine life. They had generalized hypotrophia, with
particularly underdeveloped intercostal muscles. We performed
receptor binding assays with end-gestational embryos; IGF-IR binding
was undetectable in homozygous IGF-IRex3-/-
embryos (n = 2), whereas in heterozygous
IGF-IRex3- (n = 5) and WT (n = 3)
embryos it was 113 ± 53 (±SEM) and
221 ± 66 fmol/mg protein, respectively.

View larger version (81K):
[in this window]
[in a new window]
|
Figure 7. Excision of exon 3 (by EIIa-Cre) produces
the phenotype of the classical IGF-IR knockout. A, Schematic
representation of the Cre recombination events. The
excision of exon 3, which codes for the IGF ligand domain, causes a
frame shift, which, in turn, creates a stop codon in exon 4. B, Animals
that had lost both the neo cassette and exon 3
(heterozygous IGF-IRex3-) were crossed. One quarter of the
offspring (27%; n = 30) died at birth and had the classical
IGF-IR KO phenotype. C, IGF-IRex3-/- animals identified
by Southern hybridization. The upper band corresponds to
the WT, and the lower band corresponds to the complete
excision of the floxed regions (IGF-IRex3-). D and E,
Sagittal sections from IGF-IRex3-/- mice at birth (E)
showing a smaller brain, shorter snout, and smaller body than WT (D). F
and G, Sagittal sections from the thoracic wall show severely
underdeveloped intercostal muscles (IM) in newborn
IGF-IRex3-/- (G) relative to WT (F) animals. H and I,
Lung tissue from a WT newborn (H) that had breathed for several hours
after birth compared with an IGF-IRex3-/- lung. FI,
x50 magnification. B, Bronchiole; C3/C4, ribs 3 and 4; E3, exon 3; Hm
KO, homozygous IGF-IRex3-/-; Ht KO, heterozygous
IGF-IRex3-; IM, intercostal muscle; M, DNA molecular size
marker; V, blood vessel.
|
|
 |
Discussion
|
|---|
The IGF system has been studied using transgenic gain or loss of
function models, in which circulating and tissue levels of IGFs and
IGFBPs were modified (for review see Ref. 27). The disruption of the
IGF-II gene (28) showed that this ligand is an important regulator of
embryonic, but not of postnatal, growth. Studies with the conventional
KO mutant for the IGF-I gene (29, 30, 31) have shown that ante- and
postnatal growth strongly depend on the availability of IGF-I.
Recently, Yakar et al. (32) abolished postnatal IGF-I
production in the liver using conditional gene-targeting. The resulting
animals had low plasma IGF-I concentrations, with the IGF-I present
presumably generated from nonhepatic tissues. Surprisingly, the
postnatal growth of these liver-specific IGF-I KO mice did not differ
significantly from that of control mice, suggesting that IGFs from
nonhepatic sources may be sufficient to sustain normal growth. Studies
with the classical KO mutant for IGF-IR have shown that a complete
disruption of the receptor is not viable ex utero (12, 13).
We studied the postnatal role of the IGF-I receptor by altering its
functional levels, using a conditional gene-targeting strategy. This
has advantages over dominant negative approaches, because overproduced
inactive forms of IGF-IR heterodimers may interact with the
structurally similar insulin receptor. It is also preferable to the use
of ligand analogs and blocking antibodies, which may have concomitant
nonspecific effects. The IGF-IRneo mouse described here is the first
transgenic model in which the IGF-I receptor is ubiquitously
down-regulated, facilitating studies of the consequences for postnatal
growth. Although this insertional mutation is genetically fixed, its
effects on somatic growth were exclusively postnatal. These results
provide direct evidence that postnatal and, in particular, pubertal
growth in mice involves mediation by the IGF-IR.
In homozygous IGF-IRneo mice, we observed 41% fewer than normal
receptors (in brain tissue) and a growth deficit of 13% in young adult
males (6% in females). We investigated whether aberrant RNA splicing
due to cryptic RNA splice sites in neo occurred with the
IGF-IRneo allele and found evidence that this was indeed the case.
Other studies have shown that aberrant neo splicing occurs
in the adult and embryo, and that it is not specific for a particular
gene, developmental stage, or tissue (33, 34, 35). The insertion of
bacterial DNA into mammalian genes interferes with normal expression in
a stochastic fashion, and the gene product appears to be invalidated at
the translational level due to aberrant RNA splicing. We found that
neo insertion reduced receptor density and growth in
heterozygous and homozygous animals. The effect on growth retardation
and receptor density in heterozygotes was about half that in
homozygotes. This is important, as it may shed light on certain aspects
of IGF-IR gene regulation.
As the IGF-IR is expressed in a biallelic fashion (unlike IGF-II and
the mannose-6-phosphate/IGF type 2 receptor, which are reciprocally
imprinted genes in the mouse) (28, 36), we conclude that in IGF-IRneo,
there is little or no compensation of receptor expression at the
transcriptional and/or posttranscriptional levels. The same seems also
to apply to our heterozygous IGF-IRex3- mice.
This differs from the observations of Liu and colleagues using
classical IGF-IR KO animals (12, 13). In heterozygous classical KO
animals, they found normal levels of receptor mRNA and normal growth,
suggesting effective up-regulation of the second (intact, WT) allele,
probably involving feedback control via the receptor mRNA or protein.
This implies that a single functional WT allele of the IGF receptor is
sufficient to assure normal expression and growth. Classical IGF-IR KO
was achieved by partial ablation of IGF-IR exon 3 and neo
insertion into exon 3. As neo and the receptor gene were in
the same orientation, all IGF-IR transcripts were truncated by
polyadenylation upstream from exon 3. In this study, the neo
insertion that created the IGF-IRneo mutation was intronic. Thus, all
of the mature receptor mRNAs would have their 3'-UTRs and some simply
contain additional neo sequences in the coding region. Thus,
decreasing intact receptor mRNA levels seems to increase the production
of the second, WT receptor allele. The 5'- and 3'-UTRs of the IGF-IR
are unusually large (>1 and >5 kb, respectively) and are well
conserved even between distant species (37, 38, 39). It is therefore
possible that the UTRs of IGF-IR contain elements that efficiently
regulate receptor gene expression and/or mRNA stability.
The relatively modest effects on postnatal growth of this partial
receptor invalidation were sufficient to increase the plasma IGF-I
concentration (and decrease the plasma IGFBP-4 concentration) in
males, but not in females. This suggests that a decrease in the number
of receptors has a more pronounced effect on growth regulation in males
than in females. A significant growth deficit also seems to be
necessary to provoke an IGF system response. It also shows that the
relationship between the number of IGF-IR and postnatal growth is not
simply proportional.
In IGF-IRneo mice, various tissues are attained to a very similar
degree, whether they produce the receptor in large numbers under normal
conditions (kidney, brain) or in small numbers (e.g. liver).
Thus, it may be misleading to assess the functional importance of this
growth factor system for the development of a given tissue from the
local physiological expression levels of its receptor. IGF-IRneo mice
developed normally until 3 weeks after birth. Similarly, as the number
of receptors in most tissues is higher during embryogenesis and early
postnatal life than during later postnatal life, one would expect a
relative lack of receptors to affect growth primarily early in life.
This is clearly not the case, but the number of receptors does become
limiting for growth later in postnatal life, when circulating IGF-I
levels peak, and physiological receptor expression has already been
down-regulated (40). Thus, high levels of IGF-IR do not seem to be a
prerequisite for the development of a loss of function phenotype. We
conclude that the functional deficit due to the partial invalidation of
the receptor is minimal during embryogenesis but becomes relevant
during postnatal growth.
High plasma IGF-I concentrations in homozygous IGF-IRneo males indicate
that a lack of receptors on the target cells effectively triggers IGF
ligand regulation and may reflect the activation of GH-IGF feedback.
Both hypothalamic and pituitary sites are targets for IGF-I, which
reduces GH synthesis and secretion (41). In
IGF-I-/- mice, the pituitary gland exhibits
ultrastructural signs of somatotropic stimulation (42). Selective IGF-I
gene deletion in the liver, which results in a substantial reduction in
the circulating IGF-I concentration, markedly increases the serum GH
concentration (32). The high plasma IGF-I concentration in our
homozygous IGF-IRneo males can therefore be interpreted as resulting
from an increase in GH production due to hypothalamic and/or pituitary
IGF-IR deficiency. Higher plasma IGF-I concentrations may also result
from peripheral responses in paracrine regulation.
In Western ligand blots, there was no difference in the IGFBP profiles
of IGF-IRneo and WT females. In males, it was not possible to detect
any increase in IGFBP-3 by Western ligand blotting. The IGFBP-3
concentration normally changes after the IGF-I concentration. Studies
in transgenic mice have shown that IGFBP-4 is a functional antagonist
of IGF-I in vivo (43). The observed down-regulation of
IGFBP-4 may therefore be an additional compensatory mechanism by which
receptor-deficient males try to promote growth. The overproduction of
IGF-I in transgenic animals increases tissue-specific IGFBP-5
production, but does not affect IGFBP-4 levels (44). This suggests that
IGFBP-4 regulation is not secondary to an increase in IGF-I levels, but
may be more directly related to the lack of physiological IGF-IR
concentrations. In light of the lack of available data (for review, see
Ref. 45), more experiments are clearly needed to investigate this
further.
These and other findings suggest that the IGF system of the mouse is
particularly required during later postnatal growth, but can no longer
compensate at this point for the defect caused by the IGF-IRneo allele
in males. We conclude that unimpaired, WT expression of the IGF-IR is
necessary if male mice are to attain their normal body weight, and that
a partial reduction in IGF signaling effectively reduces the
probability that males will achieve their full growth potential.
Females, in contrast, seem more able to tolerate the relative lack of
IGF receptors during postnatal growth.
The somatotropic axis is sexually dimorphic in mammals. It is therefore
tempting to interpret the observed growth retardation as a consequence
of sex-related differences in GH secretion patterns and changes in
other growth mediators (for reviews, see Refs. 46, 47). However,
although gender-related differences in growth correlate with
circulating IGF-I levels in some species, in many others they do not
(46). Similarly, GH-mediated growth effects of androgens, at least on
an endocrine level, are also unlikely to account for males being more
sensitive to a decrease in IGF-IR levels than females. There is,
however, increasing evidence that the growth-promoting effects of
androgens result from direct effects on peripheral target cells,
involving cooperation with IGF signaling or stimulation of the
synthesis of IGF system components. Zung et al. (48) found
that testosterone-induced weight gain is not mediated by hepatic IGF-I
expression or high plasma IGF-I concentrations. Testosterone did,
however, significantly increase GH receptor mRNA levels in the
epiphyseal growth plate. This mechanism may, in turn, increase
peripheral GH sensitivity and subsequently increase local IGF
production and signaling. The importance of the IGF-I produced by
peripheral tissues has been demonstrated by the conditional KO of IGF-I
in hepatocytes (32). Similarly, androgens increase IGF-I expression and
selectively decrease IGFBP-4 in a human osteoblastic cell line (49), a
mechanism that may also explain on a paracrine/autocrine level why
males are more affected by a decrease in the number of IGF-IR than
females. Future experiments using conditional genetic approaches may
further clarify some of these aspects.
Both mouse models presented here, IGF-IRneo and IGF-IRlox, are useful
for conditional gene invalidation (32, 50). The advantage of IGF-IRlox
is that postnatal growth of the mutants is indistinguishable from that
of the WT, even in males, so subtle phenotypes may be studied. The
advantage of IGF-IRneo is that during Cre recombination of
the floxed regions, two intermediate recombination products (selective
loss of neo and selective loss of exon 3) may form, thereby
creating partial gene excision patterns that provide information about
the recombination kinetics of the particular Cre transgene
used. The presence of intermediate products indicates low level
Cre expression, marks the initial phase of Cre
recombination, and is characteristic for progressive cumulative genomic
Cre recombination. A lack of intermediate products, in
contrast, is associated with Cre transgenes that produce
rapid invalidation through high level recombinase expression.
We have shown herein that a functional deficit of the IGF-IR affects
the postnatal growth of males more than that of females. Floxed IGF-IR
mice offer new perspectives for the in vivo study of IGF
signaling. Combinations of floxed IGF-IR mice with other Cre
transgenic lines (Holzenberger, M., M. Leneuve, R. Zaoui, and Y. Le
Bouc, manuscript in preparation) show that this receptor can be
specifically invalidated at various developmental stages, in many
tissues, and also in terminally differentiated cells in the adult
organism.
 |
Acknowledgments
|
|---|
We thank Argiris Efstratiadis for providing mouse IGF receptor
genomic clones, Richard Mortensen for the pNTK vector, Anne Voss for
the gift of ES cell line MPI-II, and Pascale Briant for providing
access to the microinjection facilities at the Institut Cochin de
Génétique Moléculaire (Paris, France). Heiner
Westphal kindly provided the EIIa-Cre transgenic mouse.
 |
Footnotes
|
|---|
1 This work was supported by INSERM and the University of Paris
VI. 
2 Supported by a European Community Research Grant and a Novo Nordisk
Fellowship. 
Received November 2, 1999.
 |
References
|
|---|
-
White MF, Kahn CR 1994 The insulin signalling
system. J Biol Chem 269:14[Free Full Text]
-
Blakesley VA, Butler AA, Koval AP, Okubo Y, LeRoith
D 1999 IGF-I receptor function: transducing the IGF-1 signal into
intracellular events. In: Rosenfeld R, Roberts Jr C (eds) The IGF
System. Humana Press, Totowa, pp 143164
-
Jones JI, Clemmons DR 1995 Insulin-like growth
factors and their binding proteins: biological actions. Endocr Rev 16:334[CrossRef][Medline]
-
Martin JL, Baxter RC 1999 IGF binding proteins and
extracellular matrix. In: Rosenfeld R, Roberts Jr C (eds) The IGF
System. Humana Press, Totowa, pp 227256
-
Mathews LS, Hammer RE, Behringer RR, DErcole AJ, Bell
GI, Brinster RL, Palmiter RD 1988 Growth enhancement of transgenic
mice expressing human insulin-like growth factor I. Endocrinology 123:28272833[Abstract]
-
Reiss K, Cheng W, Ferber A, Kajstura J, Li P, Li B,
Olivetti G, Homcy CJ, Baserga R, Anversa P 1996 Overexpression of
IGF-I in the heart is coupled with myocyte proliferation in transgenic
mice. Proc Natl Acad Sci USA 93:86308635[Abstract/Free Full Text]
-
Wolf E, Kramer R, Blum WF, Foll J, Brem G 1994 Consequences of postnatally elevated insulin-like growth factor-II in
transgenic mice: endocrine changes and effects on body and organ
growth. Endocrinology 135:18771994[Abstract]
-
Leventhal PS, Russell JW, Feldman EL 1999 IGFs and
the nervous system. In: Rosenfeld R, Roberts Jr C (eds) The IGF System.
Humana Press, Totowa, pp 425456
-
Carson MJ, Behringer RR, Brinster RL, McMorris FA 1993 Insulin-like growth factor I increases brain growth and central
nervous system myelination in transgenic mice. Neuron 10:729740[CrossRef][Medline]
-
Ye P, Carson J, DErcole AJ 1995 Insulin-like
growth factor-I influences the initiation of myelination: studies of
anterior commissure of transgenic mice. Neurosci Lett 201:235238[CrossRef][Medline]
-
Coleman ME, DeMayo F, Yin KC, Lee HM, Geske R,
Montgomery C, Schwartz RJ 1995 Myogenic vector expression of
insulin-like growth factor I stimulates muscle cell differentiation and
myofiber hypertrophy in transgenic mice. J Biol Chem 270:1210912116[Abstract/Free Full Text]
-
Baker J, Liu J-P, Robertson EJ, Efstratiadis A 1993 Role of insulin-like growth factors in embryonic and postnatal growth.
Cell 75:7382[CrossRef][Medline]
-
Liu J-P, Baker J, Perkins AS, Robertson EJ, Efstratiadis
A 1993 Mice carrying null mutations of the genes encoding
insulin-like growth factor I (IGF-1) and type 1 IGF receptor (Igf1r).
Cell 75:5972[Medline]
-
Marth JD 1996 Recent advances in gene mutagenesis
by site-directed recombination. J Clin Invest 97:19992002[Medline]
-
Kühn R, Schwenk F, Aguet M, Rajewsky K 1995 Inducible gene targeting in mice. Science 269:14271429[Abstract/Free Full Text]
-
Voss AK, Thomas T, Gruss P 1997 Germ line chimeras
from female ES cells. Exp Cell Res 230:4549[CrossRef][Medline]
-
McMahon AP, Bradley A 1990 The Wnt-1 (int-1
proto-oncogene) is required for development of a large region of the
mouse brain. Cell 62:10731085[CrossRef][Medline]
-
Wurst W, Joyner AL 1993 Production of targeted
embryonic stem cells clones. In: Joyner A (ed) Gene Targeting. A
Practical Approach. IRL Press at Oxford University Press, Oxford, pp
3361
-
Ramirez-Solis R, Rivera-Perez J, Wallace JD, Wims M,
Zheng H, Bradley A 1992 Genomic DNA microextraction: a method to
screen numerous samples. Anal Biochem 201:331335[CrossRef][Medline]
-
Durieux C, Ruiz-Gayo M, Corringer PJ, Bergeron F, Ducos
B, Roques BP 1992 [3H]pBC 264, a suitable probe for studying
cholecystokinin-B receptors: binding characteristics in rodent brains
and comparison with [3H]SNF 8702. Mol Pharmacol 41:10891095[Abstract]
-
Gay E, Seurin D, Babajko S, Doublier S, Cazillis M,
Binoux M 1997 Liver-specific expression of human insulin-like
growth factor binding protein-1 in transgenic mice: repercussions in
reproduction, ante- and perinatal mortality and postnatal growth.
Endocrinology 138:29372947[Abstract/Free Full Text]
-
Bessone S, Vidal F, Le Bouc Y, Epelbaum J, Bluet-Pajot
MT, Darmon M 1999 EMK protein kinase-null mice: dwarfism and
hypofertility associated with alterations in the somatotrope and
prolactin pathways. Dev Biol 214:87101[CrossRef][Medline]
-
Binoux M, Seurin D, Lassarre C, Gourmelen M 1984 Preferential measurement of insulin-like growth factor (IGF) I-related
peptides in serum with the aid of IGF binding proteins (IGFBPs)
produced by rat liver in culture. Estimation of serum IGFBP levels.
J Clin Endocrinol Metab 59:453462[Abstract]
-
Hossenlopp P, Seurin D, Segovia-Quinson B, Hardouin S,
Binoux M 1986 Analysis of serum insulin-like growth factor binding
proteins using Western blotting: use of the method for titration of the
binding protein and competitive binding studies. Anal Biochem 154:138143[CrossRef][Medline]
-
Chomczynski P, Sacchi N 1987 Single-step method of
RNA isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Anal Biochem 162:156159[Medline]
-
Lakso M, Pichel JG, Gorman JR, Sauer B, Okamoto Y, Lee
E, Alt FW, Westphal H 1996 Efficient in vivo manipulation of mouse
genomic sequences at the zygote stage. Proc Natl Acad Sci USA 93:58605865[Abstract/Free Full Text]
-
DErcole AJ 1999 Actions of IGF system proteins
from studies of transgenic and gene knockout models. In: Rosenfeld R,
Roberts Jr C (eds) The IGF System. Humana Press, Totowa, pp
545577
-
De Chiara TM, Efstratiadis A, Robertson EJ 1990 A
growth-deficiency phenotype in heterozygous mice carrying an
insulin-like growth factor II gene disrupted by targeting. Nature 345:7880[CrossRef][Medline]
-
Powell-Braxton L, Hollingshead P, Giltinan D, Pitts-Meek
S, Stewart T 1993b Inactivation of the IGF-I gene in mice results
in perinatal lethality. Ann NY Acad Sci 692:300301
-
Powell-Braxton L, Hollingshead P, Warburton C, Dowd M,
Pitts-Meek S, Dalton D, Gillett N, Stewart TA 1993a IGF-I is
required for normal embryonic growth in mice. Genes Dev
12B:26092617
-
Wang J, Zhou J, Powell-Braxton L, Bondy C 1999 Effects of Igf1 gene deletion on postnatal growth patterns.
Endocrinology 140:33913394[Abstract/Free Full Text]
-
Yakar S, Liu JL, Stannard B, Butler A, Accili D, Sauer
B, LeRoith D 1999 Normal growth and development in the absence of
hepatic insulin-like growth factor I. Proc Natl Acad Sci USA 96:73277329
-
Jacks T, Shih TS, Schmitt EM, Bronson RT, Bernards A,
Weinberg RA 1994 Tumour predisposition in mice heterozygous for a
targeted mutation in Nf1. Nat Genet 7:353361[CrossRef][Medline]
-
Meyers EN, Lewandoski M, Martin GR 1998 An Fgf8
mutant allelic series generated by Cre- and Flp-mediated recombination.
Nat Genet 18:136141[CrossRef][Medline]
-
Nagy A, Moens C, Ivanyi E, Pawling J, Gertsenstein M,
Hadjantonakis AK, Pirity M, Rossant J 1998 Dissecting the role of
N-myc in development using a single targeting vector to generate a
series of alleles. Curr Biol 8:661664[CrossRef][Medline]
-
Lau MM, Stewart HCE, Liu Z, Bhatt H, Rotwein P 1994 Loss of the imprinted IGF-2/cation-independent mannose 6-phosphate
receptor results in fetal overgrowth and perinatal lethality. Genes Dev 8:29532963[Abstract/Free Full Text]
-
Ullrich A, Gray A, Tam AW, Yang-Feng T, Tsubokawa M,
Collins C, Henzel W, Le Bon T, Kathuria S, Chen E, Jacobs S, Francke U,
Ramachandran J, Fujitu-Yamaguchi Y 1986 Insulin-like
growth factor I receptor primary structure: comparison with insulin
receptor suggests structural determinants that define functional
specificity. EMBO J 10:25032512
-
Lowe Jr WL, Adamo M, Werner H, Roberts Jr CT, LeRoith
D 1989 Regulation by fasting of rat insulin-like growth factor I
and its receptor. Effects on gene expression and binding. J Clin
Invest 2:619626
-
Holzenberger M, Lapointe F, Leibovici M, Ayer-Le
Lièvre C 1996 The avian IGF type 1 receptor: cDNA analysis
and in situ hybridization reveal conserved sequence elements and
expression patterns relevant for the development of the nervous system.
Dev Brain Res 97:7687[CrossRef][Medline]
-
Werner H, Woloschak M, Adamo M, Shen-Orr Z, Roberts Jr
CT, LeRoith D 1989 Developmental regulation of the rat
insulin-like growth factor I receptor gene. Proc Natl Acad Sci
USA:74517545
-
Giustina A, Veldhuis JD 1998 Pathophysiology of the
neuroregulation of growth hormone secretion in experimental animals and
the human. Endocr Rev 19:717797[Abstract/Free Full Text]
-
Stefaneanu L, Powell-Braxton L, Won W,
Chandrashekar V, Bartke A 1999 Somatotroph and lactotroph
changes in the adenohypophyses of mice with disrupted insulin-like
growth factor I gene. Endocrinology 140:38813889[Abstract/Free Full Text]
-
Wang J, Niu W, Witte DP, Chernausek SD, Nikiforov YE,
Clemens TL, Sharifi B, Strauch AR, Fagin JA 1998 Overexpression of
insulin-like growth factor-binding protein-4 (IGFBP-4) in smooth muscle
cells of transgenic mice through a smooth muscle alpha-actin-IGFBP-4
fusion gene induces smooth muscle hypoplasia. Endocrinology 139:26052614[Abstract/Free Full Text]
-
Ye P, DErcole J 1998 Insulin-like growth factor I
(IGF-I) regulates IGF binding protein-5 gene expression in the brain.
Endocrinology 139:6571[Abstract/Free Full Text]
-
Rajaram S, Baylink DJ, Mohan S 1997 Insulin-like
growth factor-binding proteins in serum and other biological
fluids:regulation and functions. Endocr Rev 18:801831[Abstract/Free Full Text]
-
Gatford KL, Egan AR, Clarke IJ, Owens PC 1998 Sexual dimorphism of the somatotrophic axis. J Endocrinol 157:373389[CrossRef][Medline]
-
Mauras N, Rogol AD, Haymond MW, Veldhuis JD 1996 Sex steroids, growth hormone, insulin-like growth factor-1:
neuroendocrine and metabolic regulation in puberty. Horm Res 45:7480[Medline]
-
Zung A, Phillip M, Chalew SA, Palese T, Kowarski AA,
Zadik Z 1999 Testosterone effect on growth and growth mediators of
the GH-IGF-I axis in the liver and epiphyseal growth plate of juvenile
rats. J Mol Endocrinol 23:209221[Abstract]
-
Gori F, Hofbauer LC, Conover CA, Khosla S 1999 Effects of androgens on the insulin-like growth factor system in an
androgen-responsive human osteoblastic cell line. Endocrinology 140:55795586[Abstract/Free Full Text]
-
Brüning JC, Michael MD, Winnay JN, Hayashi T,
Horsch D, Accili D, Goodyear LJ, Kahn CR 1998 A muscle-specific
insulin receptor knockout exhibits features of the metabolic syndrome
of NIDDM without altering glucose tolerance. Mol Cell 2:559569[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
P Froment, M Vigier, D Negre, I Fontaine, J Beghelli, F L Cosset, M Holzenberger, and P Durand
Inactivation of the IGF-I receptor gene in primary Sertoli cells highlights the autocrine effects of IGF-I
J. Endocrinol.,
September 1, 2007;
194(3):
557 - 568.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M J E Walenkamp and J M Wit
Genetic disorders in the GH IGF-I axis in mouse and man
Eur. J. Endocrinol.,
August 1, 2007;
157(suppl_1):
S15 - S26.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Cheng and J. Du
Mechanical Stretch Simulates Proliferation of Venous Smooth Muscle Cells Through Activation of the Insulin-Like Growth Factor-1 Receptor
Arterioscler. Thromb. Vasc. Biol.,
August 1, 2007;
27(8):
1744 - 1751.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. G. Laustsen, S. J. Russell, L. Cui, A. Entingh-Pearsall, M. Holzenberger, R. Liao, and C. R. Kahn
Essential Role of Insulin and Insulin-Like Growth Factor 1 Receptor Signaling in Cardiac Development and Function
Mol. Cell. Biol.,
March 1, 2007;
27(5):
1649 - 1664.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. E. Walenkamp, H. J. van der Kamp, A. M. Pereira, S. G. Kant, H. A. van Duyvenvoorde, M. F. Kruithof, M. H. Breuning, J. A. Romijn, M. Karperien, and J. M. Wit
A Variable Degree of Intrauterine and Postnatal Growth Retardation in a Family with a Missense Mutation in the Insulin-Like Growth Factor I Receptor
J. Clin. Endocrinol. Metab.,
August 1, 2006;
91(8):
3062 - 3070.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Raile, J. Klammt, A. Schneider, A. Keller, S. Laue, R. Smith, R. Pfaffle, J. Kratzsch, E. Keller, and W. Kiess
Clinical and Functional Characteristics of the Human Arg59Ter Insulin-Like Growth Factor I Receptor (IGF1R) Mutation: Implications for a Gene Dosage Effect of the Human IGF1R
J. Clin. Endocrinol. Metab.,
June 1, 2006;
91(6):
2264 - 2271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. D. Gagliardi, E. Y. W. Kuo, S. Raulic, G. F. Wagner, and G. E. DiMattia
Human stanniocalcin-2 exhibits potent growth-suppressive properties in transgenic mice independently of growth hormone and IGFs
Am J Physiol Endocrinol Metab,
January 1, 2005;
288(1):
E92 - E105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Entingh-Pearsall and C. R. Kahn
Differential Roles of the Insulin and Insulin-like Growth Factor-I (IGF-I) Receptors in Response to Insulin and IGF-I
J. Biol. Chem.,
September 3, 2004;
279(36):
38016 - 38024.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Okubo, K. Siddle, H. Firth, S. O'Rahilly, L. C. Wilson, L. Willatt, T. Fukushima, S.-I. Takahashi, C. J. Petry, T. Saukkonen, et al.
Cell Proliferation Activities on Skin Fibroblasts from a Short Child with Absence of One Copy of the Type 1 Insulin-Like Growth Factor Receptor (IGF1R) Gene and a Tall Child with Three Copies of the IGF1R Gene
J. Clin. Endocrinol. Metab.,
December 1, 2003;
88(12):
5981 - 5988.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Leneuve, S. Colnot, G. Hamard, F. Francis, M. N |