help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Holzenberger, M.
Right arrow Articles by Le Bouc, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holzenberger, M.
Right arrow Articles by Le Bouc, Y.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Growth Disorders
Hazardous Substances DB
*NEOMYCIN
Endocrinology Vol. 141, No. 7 2557-2566
Copyright © 2000 by The Endocrine Society


ARTICLES

A Targeted Partial Invalidation of the Insulin-Like Growth Factor I Receptor Gene in Mice Causes a Postnatal Growth Deficit1

Martin Holzenberger2, Patricia Leneuve, Ghislaine Hamard, Bertrand Ducos, Laurence Perin, Michel Binoux and Yves Le Bouc

U-515 INSERM, Hôpital Saint-Antoine (M.H., P.L., B.D., L.P., M.B., Y.L.B.), 75571 Paris; and U-380, INSERM, Faculté de Médecine Cochin-Port Royal (G.H.), 75014 Paris, France

Address all correspondence and requests for reprints to: Dr. Martin Holzenberger, U-515, INSERM, Hôpital Saint-Antoine, 75571 Paris Cedex 12, France. E-mail: holzenberger{at}st-antoine.inserm.fr


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The insulin-like growth factor (IGF) system is a major regulator of somatic growth in vertebrates. Both ligands (IGF-I and IGF-II) signal via the same IGF receptor (IGF-IR). Classical IGF-IR invalidation is lethal at birth, so that conditional models are needed to study the postnatal role of this receptor. To establish a genetically inducible invalidation of IGF-IR, we targeted the IGF-IR gene using a construct that introduced a neomycin resistance cassette into intron 2, leaving the rest of the gene intact. This neomycin resistance cassette interfered with the processing of the primary transcript, resulting in there being 12% fewer IGF-binding sites at the cell surface in heterozygous mice and 41% fewer in homozygous mice. Hetero- and homozygous offspring grew more slowly than their wild-type littermates. This difference was noticeable from 4 weeks after birth and was significant from 5 weeks after birth in males. In females, the effect on postnatal growth of insertion of the neo cassette was not significant. In males, IGF-I levels increased moderately (+26%) but significantly, indicating effective feedback regulation of the IGF system. IGF-binding protein-4 (IGFBP-4) levels, estimated by Western ligand blotting, were low in homozygotes (-38%), whereas IGFBP-1, -2, and -3 levels were unaffected. In females, IGF-I and IGFBP-1, -2, -3, and -4 levels did not differ significantly among heterozygous, homozygous, and wild-type animals. We investigated the molecular mechanism involved and characterized two RNA-splicing events that could account for the decrease in IGF-IR. The phenotype of these mice developed exclusively postnatally, and body proportions were maintained. IGF-IRneo mice constitute a new model for human postnatal growth deficiency.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
INSULIN-LIKE growth factor type 1 receptor (IGF-IR) controls proliferation and differentiation in many tissues and cell types. IGF-IR is a transmembrane tyrosine kinase receptor that transduces signals corresponding to two ligands, IGF-I and IGF-II. Both ligands and the IGF-IR are structurally related to insulin and the insulin receptor, respectively (for reviews see Refs. 1, 2). The bioavailability of IGF-I and IGF-II is regulated by six IGF-binding proteins (IGFBPs) and by the mannose-6-phosphate receptor (type 2 IGF receptor), which contains binding sites for IGF-II (for reviews see Refs. 3, 4).

The functions of the IGF system in vivo have been investigated by transgenic ligand overproduction using ubiquitous and tissue-specific promoters. The ubiquitous overproduction of IGF-I leads to postnatal overgrowth (5). Tissue-specific overproduction of IGF-I leads to overgrowth of the targeted organ only, despite higher levels of circulating IGF-I (6). Similar results have been obtained with IGF-II (7). IGFs play important roles in the central nervous system (8), where IGF overproduction increases myelin content (9) and stimulates brain growth in a region-dependent fashion (10). Similarly, the transgenic overproduction of IGF-I in myocytes causes muscle overgrowth (11). However, as IGF is known to have both endocrine and paracrine functions, the results of transgenic gain of function experiments may not represent the full spectrum of IGF activity in vivo.

Classical inactivation of the receptor results in a potent loss of function model, in which the effects of IGF action can be directly related to specific target cells. The phenotype, however, is strongly cumulative, with significant effects on growth from embryonic day 11 onward, birth weights only 45% those of the wild-type (WT), and perinatal death due to respiratory failure (12, 13). To study the function of IGF signaling in the target tissues in vivo, we initiated a program to inactivate the IGF-IR genetically in a conditional, inducible, tissue-specific, partial, or mosaic manner using the Cre-loxP system (14, 15).

Here, we report the development of the principal component of the model, the IGF-IRlox mouse, and describe a phenotype that appears to result from a genetically fixed reduction in the number of functional IGF-IR due to the insertion of a neomycin resistance cassette into the IGF-IR gene. We describe the phenotype and the effects on the other components of the IGF system. We also explore the molecular mechanism responsible for this partial receptor invalidation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Construction of the targeting vector for homologous recombination
To target the IGF-IR locus, we used a genomic region between the SalI site 4.3 kb upstream from exon 3 and the BamHI site 850 bp downstream from exon 3 (Fig. 1AGo). A neomycin selection cassette, driven by a PGK promoter and equipped with loxP sites on both sides, was inserted into the EcoRI site 154 bp upstream from exon 3. A third loxP site, associated with an I-SceI site, was inserted into the HindIII site 350 bp downstream from exon 3. The BamHI site 0.5 kb downstream from HindIII was used to insert a PGK promoter-driven TK (thymidine kinase) cassette. The TK and neo genes were inserted in the opposite orientation to the IGF-IR gene. This construct was amplified in a 2.9-kb plasmid backbone (details of the construction process can be obtained from the authors). The entire exon 3, the RNA splice lariat region, and the three loxP sites that had been designed for this construct and assembled from synthetic oligonucleotides, were sequenced (Sequenase 2.0, United States Biochemical Corp., Cleveland, OH). The linearized construct was then used to electroporate the mouse embryonic stem (ES) cells.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 1. Schematic representation of IGF-IR gene targeting and ES cell selection. A, In ES cells, we replaced the wild-type exon 3 with a floxed exon 3 connected to a floxed neo cassette. We checked that integration was correct using nested PCR (positions of external and internal primers are indicated by arrowheads), and Southern hybridization with an internal (IP) and an external (EP) probe. Triangles represent loxP sites. Diagrams are not to scale. B, Examples of clones carrying the correct integration on the short arm side (no. 13 and 45) as tested by PCR (expected amplicon size, 800 bp). A construct with a 150-bp deletion, diluted by mixing with WT genomic DNA, served as a positive control (C+). C, Southern hybridization testing integration on the long arm side. Clones 13 and 45 show the expected band at 4.6 kb in addition to the WT allele at 5.4 kb. Clone 13 had integrated additional material in a nonhomologous fashion and was eliminated. The slightly stronger intensity of the WT band is due to the presence of a few wild-type ES cells at this early stage of selection. D, Confirmation of clone 45 by Southern hybridization on the short arm side. The double band indicates correct exon replacement. B, BamHI; E, EcoRI; E3, exon 3; H, HindIII; Hc, HincII; I, I-SceI; M, DNA molecular size marker; N, neomycin resistance cassette; TK, thymidine kinase cassette.

 
ES cell manipulation
Male ES cells of 129/Sv origin (a gift from A. K. Voss, MPI, Gottingen, Germany) (16) were cultured on SNL feeder cells (a gift from A. Bradley, Baylor College of Medicine, Houston, TX) (17) in M15 medium supplemented with 15% FCS (Sigma, St. Louis, MO). We electroporated ES cells at passages 10 and 11 under standard conditions (18) using a Gene Pulser (Bio-Rad Laboratories, Inc., Richmond, CA), and performed positive/negative selection using 200 µg/ml G418 (Sigma) and 500 ng/ml gancyclovir (Roche, Indianapolis, IN). Genomic DNA from ES cell clones (19) was tested by nested PCR for the correct integration of the short arm, downstream from IGF-IR exon 3 (outer primers, 5'-3', TGCTATACGAAGTTATAGGG and AAATGTAATCTTTGGTTTGA; inner primers, AAGTTATAGGGATAACAGGG and TTTGATCCAGCAGTCAGC). Positive clones were confirmed by probing a genomic Southern blot with an external probe (HincII digest for the short arm), and an internal probe (HindIII digest for the long arm, upstream from exon 3). All restriction enzymes were obtained from New England Biolabs (Beverly, MA). We microinjected the targeted ES cells into B57BL/6 blastocysts using a micromanipulator Transferman equipped with Celltram injectors (Eppendorf, Hamburg, Germany) and implanted the resulting transgenic blastocysts into pseudopregnant females (IFFA-Credo, L’Arbresle, France).

Animals
We obtained several germline chimeras that transmitted the mutation in a 129/Sv genetic background. We also crossed these germline chimeras with C57BL/6 females to generate a population with a mixed genetic background. Mice heterozygous for the mutated receptor were mated to create a population consisting of WT, heterozygous, and homozygous animals. Mice were housed in standard conditions (25 C, 12-h light, 12-h dark cycle, water/food ad libitum), and pups were weaned at 25 days. Body weight (±0.1 g) was measured weekly. Blood samples (100–200 µl) were taken by retroorbital puncture using Pasteur pipettes prerinsed with 0.5 M EDTA, and plasma samples were stored at -20 C.

IGF-IRneo mice were crossed with an EIIa-Cre transgenic line to excise the floxed regions in vivo. EIIa-Cre, used here in a 129/Sv genetic background, produces the recombinase ubiquitously, but at moderate levels during early development. In the F1 generation we searched for partial (neo) and total (neo and exon 3) excisions by Southern blotting. In the F2 generation, we identified animals that had inherited an allele with either neo excision (IGF-IRlox) or total excision (IGF-IRex3-). Total excision is the equivalent of the classical IGF-IR knockout (KO) (12, 13). Animals of these two types were then mated to produce homozygous IGF-IRlox and IGF-IRex3-/-.

Detection of the targeted receptor gene in mice by Southern blot
DNA was prepared from 10-day-old animals using standard procedures. Tail biopsy samples were digested overnight with proteinase K (Eurobio, Les Ulis, France) and centrifuged, and the supernatant was mixed with an equal volume of isopropanol. The precipitate was washed with 75% ethanol, dried, and resuspended in 10 mmol Tris (pH 8.0). DNA (8 µg) from each animal was digested with HincII, subjected to electrophoresis in a 1.0% agarose gel, transferred to Nylon membranes (Hybond+, Amersham Pharmacia Biotech, Aylesbury, UK) by capillary action, and hybridized with a genomic probe (radiolabeled using Rediprime, Amersham Pharmacia Biotech) that recognized a 0.8-kb intronic region directly upstream from the inserted neomycin resistance cassette. The expected fragments were 2.4 kb for the wild-type IGF-IR and 4.3 kb for the targeted IGF-IRneo allele.

Receptor binding assays
Recombinant human IGF-I (rhIGF-I; GroPep Pty. Ltd., Adelaide, Australia) was labeled with 125I (Amersham Pharmacia Biotech) using the chloramine-T method (SA, ~100 µCi/µg). All chemicals were obtained from Sigma. Crude membranes were prepared from whole brain as previously described (20). After decapitation, brains were quickly removed, and homogenized. The homogenate was centrifuged twice at 4 C; the pellet was resuspended, and the suspension was immediately used for binding assays. Proteins were measured using the bicinchoninic acid protein assay from Pierce Chemical Co. (Rockford, IL).

Binding assays were performed in 0.5 ml 50 mM Tris-HCl buffer containing the membrane preparation (300 µg protein) and the iodinated ligand. Nonspecific binding was determined in the presence of 200 nM rhIGF-I. Competition experiments were performed using 15–20 pM [125I]rhIGF-I and various amounts of unlabeled rhIGF-I. Incubation was stopped after 120 min at 25 C (by which time steady state had been reached), and the mixture was centrifuged. The pellet was washed twice and counted in a {gamma}-counter (1275 MiniGamma, LKB Wallac, Turku, Finland).

IGF-I assay
Plasma samples (10–25 µl) were incubated in 0.01 M HCl for 30 min at room temperature and ultrafiltered using Centricon 30 columns (Amicon, Millipore Corp., Bedford, MA). The ultrafiltrate was lyophilized, resuspended in 0.1 M phosphate buffer and 1 mg/ml BSA (pH 7.4) and incubated for 2 days with [125I]rhIGF-I (3000 cpm/tube) and a polyclonal antihuman IGF-I antibody (dilution, 1:120 000) that cross-reacts with murine IGF-I (21, 22) (a gift from J. Closset, CHU, Liège, Belgium). Samples were tested at five concentrations, each in duplicate (22). After incubation, free and bound IGFs were separated using albumin-coated charcoal, as previously described (23). The detection threshold of the assay was 1–2 ng/ml plasma. Intraassay variation was 5%, and interassay variation was 10%.

Western ligand blotting of IGFBPs
Plasma samples (3 µl/animal) were subjected to 12.5% nonreducing PAGE (24). Proteins were electrotransferred onto nitrocellulose membranes and incubated with [125I]IGF-I and -II (500,000 cpm each). Blots were washed and placed against x-ray film (Eastman Kodak Co., Rochester, NY) at -80 C. A pooled normal sample was included on each gel to make it possible to compare different experiments. Western ligand blots were quantified using a STORM 850 PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA) and ImageQuant 5.0 software.

RT-PCR, amplicon subcloning, and sequencing
To detect the splicing of sequences from the neomycin resistance cassette into mature IGF-IR transcripts, we extracted total RNA (25) from the brain of an adult homozygous IGF-IRneo male and produced first strand complementary DNA using Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.) following the manufacturer’s instructions. In a final reaction volume of 20 µl we used 500 ng RNA and 20 µg/ml of a reverse complementary oligonucleotide (5'-GAAGGACAAGGAGACCAAG-3') corresponding to a region within exon 5 of the receptor gene. All oligonucleotides used were obtained from Genset (Paris, France). We added 0.5 µl of the RT products to a tube containing 50 µl of a PCR mixture. The upstream PCR oligonucleotide corresponded to a sequence in exon 2 (5'-GAAGACCACCATCAACAAT-3'); the downstream oligonucleotide (5'-ACCACCAAGCGAAACATC-3') was designed to anneal within the neomycin resistance cassette such that the 5'-half of the cassette (~1 kb) could be tested for splice events. PCR cycling was as follows: 10 min at 94 C denaturation/enzyme activation step, 40 PCR cycles (94 C for 1 min, 58 C for 1 min, 72 C for 1.5 min), and a final 7-min elongation step, performed in a thermal cycler (model 480, Perkin-Elmer Corp.) using AmpliTaq Gold (PE). Amplification products were separated on 1.2% agarose gels, and the regions containing the bands of interest were cut out for DNA electroelution. The recovered amplification products were blunted with Pfu DNA polymerase and inserted into PCR-Script Amp SK+ (Stratagene). Minipreps (QIAGEN, Hilden, Germany) from ampicillin-resistant clones were screened based on their restriction enzyme digestion profiles, and selected clones were sequenced (GenomeExpress, Paris, France), using T3 and T7 primers.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Production of mice with the targeted insertion of a neomycin resistance cassette in intron 2
Targeting of the IGF-IR in ES cells by homologous recombination. We targeted ES cells using the described replacement construct and tested the correct integration of the short arm by PCR. Five of the 66 neomycin-resistant clones were PCR positive (2 of which are shown in Fig. 1BGo) and were tested by Southern blotting with an internal probe for the long arm and an external probe for the short arm (Fig. 1Go, C and D). One clone (no. 45) showing the expected profile was then tested with additional probes covering the entire targeted region confirming correct integration. The karyotype of this clone was normal, showing a mean of 40.0 ± 0.12 (±SEM) chromosomes in 31 metaphase spreads analyzed and no evidence of chromosome translocation or loss (results not shown).

Passage of the mutation into the germline. Blastocyst injections of clone 45 yielded 16 male chimeras, 8 of which had 98–100% agouti coat color. Their germline transmission rate was 85–100%. Two of the 100% chimeras were used to establish a heterozygous F1 population of this mouse line that we named IGF-IRneo. The frequency of transmission of the targeted allele was 49% (n = 171), independently of genetic background (129/Sv, or F1 of crosses between 129/Sv and C57BL/6).

Fertility and reproduction of IGF-IRneo mice. Crosses of heterozygous IGF-IRneo generated 43% heterozygous, 29% homozygous, and 28% wild-type animals in a total of 61 animals. These frequencies are within the limits of variability expected for normal Mendelian inheritance. Litter size was normal (a mean of 8.1 pups/litter ± 1.4 SD), and newborns began to suckle within hours of birth. Two pups died within the first 24 h; 1 was wild-type, and the other homozygous IGF-IRneo. We observed no difference between pure (129/Sv) and mixed (F1 between C57BL/6 and 129/Sv) backgrounds. Homozygous IGF-IRneo were fertile when mated together (females from 7 weeks and males from 8 weeks onward) and produced homozygous litters of normal size (7.0 ± 1.0 pups/litter). Fourteen of the 15 homozygous females were fertile. All 11 homozygous males that we tested were fertile.

Postnatal growth of IGF-IRneo mice
At 10 days of age there was no difference in weight between WT animals and those hetero- and homozygous for IGF-IRneo and no differences between males and females (as is normal at this age). At 4 weeks of age, we observed a 5% difference in weight between males and females (for WT, homozygous, and heterozygous IGF-IRneo taken together); such a difference is normal. However, we also found that the differences in weight among males of homozygous, heterozygous, and wild-type genotypes were increasing. Between 4 and 6 weeks after birth the growth curves of the males continued to separate, such that at 6 weeks, the order of mean body weight was (from lowest to highest): homozygous females < heterozygous females < wild-type females < homozygous males < heterozygous males < wild-type males (Fig. 2AGo). This order did not change between 6 and 9 weeks. Differences were greatest at 8 and 9 weeks after birth for the male group; mutant homozygous males were 87%, and heterozygous males were 92% of the weight of the WT males. Weight differences progressed little thereafter and stabilized at 83% of WT weight in mutant homozygous adults at 5 months of age (91% for heterozygotes; Fig. 2BGo). Homozygous adults gained 4.3 g in weight from 9 weeks to 5 months of age, which is somewhat less than the weight gained by 129/Sv wild-type (6.8 g) and IGF-IRneo heterozygotes (6.7 g). For the females, weight differences were greatest at 6 weeks of age, with homozygotes being 93% and heterozygotes 97% the weight of WT females. We ceased to study weight differences between homozygous and WT females once they had had their first litter. Note that F2 animals were genotyped on day 10 by Southern blotting (Fig. 2CGo). The WT and IGF-IRneo bands were similar in intensity after passage of the mutation into the germline, indicating that the two alleles were equally represented in DNA from the targeted mouse genome.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. Postnatal growth of IGF-IRneo mice. A, Growth curves for male and female F2 animals (n = 61) between 3 and 9 weeks of age, separated into WT, heterozygous, and homozygous IGF-IRneo groups. The significance of differences was assessed using the Mann-Whitney test. Error bars have been omitted for better readability. B, Growth deficit in hetero- and homozygous IGF-IRneo males and females relative to the WT. The mean body weights of the hetero- and homozygous groups (shown in A) are expressed as a percentage of the corresponding WT value. After 9 weeks, all homozygous females had been used for breeding. C, Example of IGF-IR genotyping. HincII-digested tail DNA (8 µg) was Southern blotted and hybridized with an intron 2-specific probe. The lower band indicates the WT IGF-IR allele; the upper band shows the targeted IGF-IRneo allele. Hm, Homozygous IGF-IRneo; Ht, heterozygous IGF-IRneo.

 
Postnatal growth of IGF-IRneo mice is proportional. Twelve males (four wild-type, four heterozygous, and four homozygous animals) from four different litters were killed and dissected at 10 weeks of age, and brain, liver, kidney, and bones (femur) were weighed to reveal possible differences in the growth of particular tissues (Fig. 3Go). In homozygous IGF-IRneo males these organs were 10% lighter than those of WT animals. These differences were significant for the brain and liver, but not so for the other tissues, possibly due to the small number of observations. Heterozygous animals showed approximately half the growth retardation of homozygous animals.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 3. Brain, kidney, liver, and bone (femur) from male hetero- and homozygous IGF-IRneo and WT IGF-IR mice were dissected and weighed to detect potential organ-specific growth deficits. Data, including total body weight, are expressed as a percentage of the WT value (±SEM). *, P < 0.05.

 
Regulation of IGF system proteins in IGF-IRneo mice
As insertion of the neo cassette affected the postnatal growth, we wanted to know to what extent the synthesis of the various IGF system components had been affected.

Receptor binding assay. We assessed receptor binding in whole brain extracts, as the brain is known to be rich in IGF-IR in young adult animals. We used the brains of four wild-type, four heterozygous, and four homozygous males (the same mice used to check that growth was proportional) and those of two WT and two homozygous females. [125I]IGF-I binding was specific and saturable, and receptor affinity did not depend on genotype (Kd range, 0.47–0.60 nM). The number of IGF-I-binding sites per cell, however, was lower in hetero- and homozygous animals than in WT (Fig. 4Go and Table 1Go). The mean number of specific binding sites in IGF-IRneo homozygotes was only 59% of that in the WT (P < 0.01), whereas in heterozygotes it was 88% (not significant). The number of receptors did not depend on gender, and the decrease in number was similar for male and female homozygotes. From our data, we estimate the mean number of receptor binding sites to be 8 x 105/cell in WT and 5 x 105/cell in homozygous IGF-IRneo brains, all cell types included.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 4. Inhibition of specific binding of 15 pM [125I]IGF-I by unlabeled IGF-I from WT, heterozygous, and homozygous mouse brain cell membranes. The data are from one of four experiments, with reactions at each concentration carried out in triplicate. Nonspecific binding was evaluated using 200 nM unlabeled IGF-I. Inset, Comparison of total specific binding of [125I]IGF-I to cell membranes of the three different genotypes (four animals each). a, P < 0.05 vs. wild-type; b, P < 0.05 vs. the heterozygous group (by Mann-Whitney test). Hm, Homozygous IGF-IRneo; Ht, heterozygous IGF-IRneo.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Comparison of Bmax from Scatchard analysis of competition experiments performed with 15 pM [125I]IGF-I

 
Determination of plasma IGF-I and IGFBPs. Circulating IGF-I levels in adult (12-week-old) female IGF-IRneo mice (heterozygous or homozygous) did not differ significantly from WT levels (Table 2Go). However, in adult males homozygous for IGF-IRneo, the mean plasma IGF-I concentration was 26% higher than that in WT (P < 0.05). Plasma IGFBP-1, -2, -3, and -4 concentrations, estimated by Western ligand blotting (Fig. 5Go), did not differ significantly in hetero- and homozygous IGF-IRneo females from those in the WT animals (Table 2Go). Adult homozygous IGF-IRneo males had significantly lower plasma IGFBP-4 concentrations than WT animals (P < 0.01), but plasma IGFBP-1, -2, and -3 concentrations were similar to those in the WT.


View this table:
[in this window]
[in a new window]
 
Table 2. Circulating IGF-I and IGFBP concentrations in IGF-IRneo mice

 


View larger version (81K):
[in this window]
[in a new window]
 
Figure 5. Representative examples of Western ligand blot (WLB) profiles used to estimate the plasma concentrations of IGFBP-1 to -4 from males and females of different genotypes. A pool of human plasma served as the quantitative standard. Male and female samples were processed under slightly different conditions, so that direct comparison of experimental results between sexes is not possible. WLBs were analyzed using phosphorimager technology, and quantitative results are summarized in Table 2Go. Hom, Homozygous IGF-IRneo; Het, heterozygous IGF-IRneo.

 
Evidence for altered splicing of the IGF-IR primary transcript
Interference of the inserted bacterial neomycin sequences with the normal splicing of the primary receptor transcript may be responsible for the decrease in the number of IGF-binding sites. To show that aberrant splicing does indeed occur, we searched for neo/receptor splice junctions by RT-PCR. Using PCR primer pairs, with the upstream primer corresponding to exon 2 of the receptor complementary DNA, and the downstream primer corresponding to neo sequences, we obtained RT-PCR products of the expected size, with one major band. We checked that this band corresponded to sequences from the receptor-coding region fused to neo sequences by subcloning the band and studying its restriction enzyme profile. Seven clones had integrated fragments of the correct size. Comparison of their restriction enzyme digestion profiles showed that there were two different exon 2/neo fusions. The corresponding plasmid inserts were sequenced, and both were found to contain distinct junctions between the 3'-end of exon 2 and sequences from the neo cassette (Fig. 6Go). Once RNA splicing has begun in the reverse neo sequence, there are two possibilities. 1) RNA splicing of the neo sequence continues until the 3'-end of exon 3 is reached and then splices into exon 4, and so forth. The resulting messenger RNA (mRNA) contains normal 5'- and 3'-untranslated regions (UTR) and additional sequences from neo. Whatever the splice site (827, 842, or other positions in the neo open reading frame), the stop codons in the reverse neo will invariably produce invalidating truncations of the translation products (see Fig. 6Go for details). 2) RNA splicing may leave the neo sequence before exon 3 is reached, then continue normally by accepting the 5'-end of exon 3, and so on. Again, mRNAs will contain normal 5'- and 3'-receptor UTR and additional neo sequences of various lengths. Most of these mRNAs will produce receptor proteins truncated in the region corresponding to neo, exon 3, or exon 4, and the rest will have random insertions between exons 2 and 3; thus, none of them is likely to contribute to IGF signaling.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 6. Identification of two aberrant RNA splice events for the IGF-IRneo allele. A, Constitutive splicing of exon 3 is disturbed by the neo cassette. Due to imperfect splice sites in the DNA of bacterial origin, a certain proportion of primary transcripts transmit fragments from the neo cassette into the mature receptor RNA. Note that the neo gene was inserted in the receptor gene in the opposite orientation. B, Two splice variants between exon 2 and neo (splice sites at nucleotides 827 and 842 of the neo open reading frame) were isolated by RT-PCR cloning and characterized by sequencing. The positions of the RT-PCR primers are indicated by arrowheads (A). Data were obtained from the negative strand for 842 and the positive strand for 827. The predicted consequences at the protein level are indicated. We found no products involving the splice site at position 800, described by Jacks et al. (33 ). neo, Neomycin resistance cassette; nt, nucleotides; ORF, open reading frame; PGK, phosphoglycerol kinase promoter; amino acids in IUPAC (International Union of Pure and Applied Chemistry) code.

 
Selective excision of the neomycin resistance cassette by the transgene EIIa-Cre. If the attenuated IGF-IRneo allele was responsible for the postnatal growth deficit (a so-called hypomorphic allele), then the selective elimination of neo by Cre recombination should restore WT growth. We crossed IGF-IRneo with the mosaic balancer mouse EIIa-Cre (26). To maintain the genetic background of our line, we used EIIa-Cre in a 129/Sv background. We used Southern blotting to select animals that had undergone recombination of the loxP sites flanking the neo cassette, but that had conserved the floxed exon 3 of IGF-IR. Mice from this new line, called IGF-IRlox, were devoid of the neo cassette and simply carried two functional loxP sites, one on either side of exon 3. Homo- and heterozygous IGF-IRlox mice were weighed at 6 weeks and did not differ from WT littermates in terms of body weight (females, 23.9 ± 0.6, 23.4 ± 0.4, 23.2 ± 0.4; males, 26.8 ± 0.6, 26.9 ± 0.5, 27.8 ± 0.2; order: homozygous, heterozygous, WT; ±SEM; total n = 53). This experiment also generated individuals that had lost exon 3 together with the neo cassette, a deletion that completely disrupts the IGF-IR. IGF-IRex3-/- mice, homozygous for this deletion, had features of the classical IGF-IR KO phenotype (13) (Fig. 7Go). Their birth weight was 50.3% that of heterozygous and WT littermates. All homozygous animals were born alive but unable to breath. They invariably died within the first few minutes of extrauterine life. They had generalized hypotrophia, with particularly underdeveloped intercostal muscles. We performed receptor binding assays with end-gestational embryos; IGF-IR binding was undetectable in homozygous IGF-IRex3-/- embryos (n = 2), whereas in heterozygous IGF-IRex3- (n = 5) and WT (n = 3) embryos it was 113 ± 53 (±SEM) and 221 ± 66 fmol/mg protein, respectively.



View larger version (81K):
[in this window]
[in a new window]
 
Figure 7. Excision of exon 3 (by EIIa-Cre) produces the phenotype of the classical IGF-IR knockout. A, Schematic representation of the Cre recombination events. The excision of exon 3, which codes for the IGF ligand domain, causes a frame shift, which, in turn, creates a stop codon in exon 4. B, Animals that had lost both the neo cassette and exon 3 (heterozygous IGF-IRex3-) were crossed. One quarter of the offspring (27%; n = 30) died at birth and had the classical IGF-IR KO phenotype. C, IGF-IRex3-/- animals identified by Southern hybridization. The upper band corresponds to the WT, and the lower band corresponds to the complete excision of the floxed regions (IGF-IRex3-). D and E, Sagittal sections from IGF-IRex3-/- mice at birth (E) showing a smaller brain, shorter snout, and smaller body than WT (D). F and G, Sagittal sections from the thoracic wall show severely underdeveloped intercostal muscles (IM) in newborn IGF-IRex3-/- (G) relative to WT (F) animals. H and I, Lung tissue from a WT newborn (H) that had breathed for several hours after birth compared with an IGF-IRex3-/- lung. F–I, x50 magnification. B, Bronchiole; C3/C4, ribs 3 and 4; E3, exon 3; Hm KO, homozygous IGF-IRex3-/-; Ht KO, heterozygous IGF-IRex3-; IM, intercostal muscle; M, DNA molecular size marker; V, blood vessel.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The IGF system has been studied using transgenic gain or loss of function models, in which circulating and tissue levels of IGFs and IGFBPs were modified (for review see Ref. 27). The disruption of the IGF-II gene (28) showed that this ligand is an important regulator of embryonic, but not of postnatal, growth. Studies with the conventional KO mutant for the IGF-I gene (29, 30, 31) have shown that ante- and postnatal growth strongly depend on the availability of IGF-I. Recently, Yakar et al. (32) abolished postnatal IGF-I production in the liver using conditional gene-targeting. The resulting animals had low plasma IGF-I concentrations, with the IGF-I present presumably generated from nonhepatic tissues. Surprisingly, the postnatal growth of these liver-specific IGF-I KO mice did not differ significantly from that of control mice, suggesting that IGFs from nonhepatic sources may be sufficient to sustain normal growth. Studies with the classical KO mutant for IGF-IR have shown that a complete disruption of the receptor is not viable ex utero (12, 13). We studied the postnatal role of the IGF-I receptor by altering its functional levels, using a conditional gene-targeting strategy. This has advantages over dominant negative approaches, because overproduced inactive forms of IGF-IR heterodimers may interact with the structurally similar insulin receptor. It is also preferable to the use of ligand analogs and blocking antibodies, which may have concomitant nonspecific effects. The IGF-IRneo mouse described here is the first transgenic model in which the IGF-I receptor is ubiquitously down-regulated, facilitating studies of the consequences for postnatal growth. Although this insertional mutation is genetically fixed, its effects on somatic growth were exclusively postnatal. These results provide direct evidence that postnatal and, in particular, pubertal growth in mice involves mediation by the IGF-IR.

In homozygous IGF-IRneo mice, we observed 41% fewer than normal receptors (in brain tissue) and a growth deficit of 13% in young adult males (6% in females). We investigated whether aberrant RNA splicing due to cryptic RNA splice sites in neo occurred with the IGF-IRneo allele and found evidence that this was indeed the case. Other studies have shown that aberrant neo splicing occurs in the adult and embryo, and that it is not specific for a particular gene, developmental stage, or tissue (33, 34, 35). The insertion of bacterial DNA into mammalian genes interferes with normal expression in a stochastic fashion, and the gene product appears to be invalidated at the translational level due to aberrant RNA splicing. We found that neo insertion reduced receptor density and growth in heterozygous and homozygous animals. The effect on growth retardation and receptor density in heterozygotes was about half that in homozygotes. This is important, as it may shed light on certain aspects of IGF-IR gene regulation.

As the IGF-IR is expressed in a biallelic fashion (unlike IGF-II and the mannose-6-phosphate/IGF type 2 receptor, which are reciprocally imprinted genes in the mouse) (28, 36), we conclude that in IGF-IRneo, there is little or no compensation of receptor expression at the transcriptional and/or posttranscriptional levels. The same seems also to apply to our heterozygous IGF-IRex3- mice. This differs from the observations of Liu and colleagues using classical IGF-IR KO animals (12, 13). In heterozygous classical KO animals, they found normal levels of receptor mRNA and normal growth, suggesting effective up-regulation of the second (intact, WT) allele, probably involving feedback control via the receptor mRNA or protein. This implies that a single functional WT allele of the IGF receptor is sufficient to assure normal expression and growth. Classical IGF-IR KO was achieved by partial ablation of IGF-IR exon 3 and neo insertion into exon 3. As neo and the receptor gene were in the same orientation, all IGF-IR transcripts were truncated by polyadenylation upstream from exon 3. In this study, the neo insertion that created the IGF-IRneo mutation was intronic. Thus, all of the mature receptor mRNAs would have their 3'-UTRs and some simply contain additional neo sequences in the coding region. Thus, decreasing intact receptor mRNA levels seems to increase the production of the second, WT receptor allele. The 5'- and 3'-UTRs of the IGF-IR are unusually large (>1 and >5 kb, respectively) and are well conserved even between distant species (37, 38, 39). It is therefore possible that the UTRs of IGF-IR contain elements that efficiently regulate receptor gene expression and/or mRNA stability.

The relatively modest effects on postnatal growth of this partial receptor invalidation were sufficient to increase the plasma IGF-I concentration (and decrease the plasma IGFBP-4 concentration) in males, but not in females. This suggests that a decrease in the number of receptors has a more pronounced effect on growth regulation in males than in females. A significant growth deficit also seems to be necessary to provoke an IGF system response. It also shows that the relationship between the number of IGF-IR and postnatal growth is not simply proportional.

In IGF-IRneo mice, various tissues are attained to a very similar degree, whether they produce the receptor in large numbers under normal conditions (kidney, brain) or in small numbers (e.g. liver). Thus, it may be misleading to assess the functional importance of this growth factor system for the development of a given tissue from the local physiological expression levels of its receptor. IGF-IRneo mice developed normally until 3 weeks after birth. Similarly, as the number of receptors in most tissues is higher during embryogenesis and early postnatal life than during later postnatal life, one would expect a relative lack of receptors to affect growth primarily early in life. This is clearly not the case, but the number of receptors does become limiting for growth later in postnatal life, when circulating IGF-I levels peak, and physiological receptor expression has already been down-regulated (40). Thus, high levels of IGF-IR do not seem to be a prerequisite for the development of a loss of function phenotype. We conclude that the functional deficit due to the partial invalidation of the receptor is minimal during embryogenesis but becomes relevant during postnatal growth.

High plasma IGF-I concentrations in homozygous IGF-IRneo males indicate that a lack of receptors on the target cells effectively triggers IGF ligand regulation and may reflect the activation of GH-IGF feedback. Both hypothalamic and pituitary sites are targets for IGF-I, which reduces GH synthesis and secretion (41). In IGF-I-/- mice, the pituitary gland exhibits ultrastructural signs of somatotropic stimulation (42). Selective IGF-I gene deletion in the liver, which results in a substantial reduction in the circulating IGF-I concentration, markedly increases the serum GH concentration (32). The high plasma IGF-I concentration in our homozygous IGF-IRneo males can therefore be interpreted as resulting from an increase in GH production due to hypothalamic and/or pituitary IGF-IR deficiency. Higher plasma IGF-I concentrations may also result from peripheral responses in paracrine regulation.

In Western ligand blots, there was no difference in the IGFBP profiles of IGF-IRneo and WT females. In males, it was not possible to detect any increase in IGFBP-3 by Western ligand blotting. The IGFBP-3 concentration normally changes after the IGF-I concentration. Studies in transgenic mice have shown that IGFBP-4 is a functional antagonist of IGF-I in vivo (43). The observed down-regulation of IGFBP-4 may therefore be an additional compensatory mechanism by which receptor-deficient males try to promote growth. The overproduction of IGF-I in transgenic animals increases tissue-specific IGFBP-5 production, but does not affect IGFBP-4 levels (44). This suggests that IGFBP-4 regulation is not secondary to an increase in IGF-I levels, but may be more directly related to the lack of physiological IGF-IR concentrations. In light of the lack of available data (for review, see Ref. 45), more experiments are clearly needed to investigate this further.

These and other findings suggest that the IGF system of the mouse is particularly required during later postnatal growth, but can no longer compensate at this point for the defect caused by the IGF-IRneo allele in males. We conclude that unimpaired, WT expression of the IGF-IR is necessary if male mice are to attain their normal body weight, and that a partial reduction in IGF signaling effectively reduces the probability that males will achieve their full growth potential. Females, in contrast, seem more able to tolerate the relative lack of IGF receptors during postnatal growth.

The somatotropic axis is sexually dimorphic in mammals. It is therefore tempting to interpret the observed growth retardation as a consequence of sex-related differences in GH secretion patterns and changes in other growth mediators (for reviews, see Refs. 46, 47). However, although gender-related differences in growth correlate with circulating IGF-I levels in some species, in many others they do not (46). Similarly, GH-mediated growth effects of androgens, at least on an endocrine level, are also unlikely to account for males being more sensitive to a decrease in IGF-IR levels than females. There is, however, increasing evidence that the growth-promoting effects of androgens result from direct effects on peripheral target cells, involving cooperation with IGF signaling or stimulation of the synthesis of IGF system components. Zung et al. (48) found that testosterone-induced weight gain is not mediated by hepatic IGF-I expression or high plasma IGF-I concentrations. Testosterone did, however, significantly increase GH receptor mRNA levels in the epiphyseal growth plate. This mechanism may, in turn, increase peripheral GH sensitivity and subsequently increase local IGF production and signaling. The importance of the IGF-I produced by peripheral tissues has been demonstrated by the conditional KO of IGF-I in hepatocytes (32). Similarly, androgens increase IGF-I expression and selectively decrease IGFBP-4 in a human osteoblastic cell line (49), a mechanism that may also explain on a paracrine/autocrine level why males are more affected by a decrease in the number of IGF-IR than females. Future experiments using conditional genetic approaches may further clarify some of these aspects.

Both mouse models presented here, IGF-IRneo and IGF-IRlox, are useful for conditional gene invalidation (32, 50). The advantage of IGF-IRlox is that postnatal growth of the mutants is indistinguishable from that of the WT, even in males, so subtle phenotypes may be studied. The advantage of IGF-IRneo is that during Cre recombination of the floxed regions, two intermediate recombination products (selective loss of neo and selective loss of exon 3) may form, thereby creating partial gene excision patterns that provide information about the recombination kinetics of the particular Cre transgene used. The presence of intermediate products indicates low level Cre expression, marks the initial phase of Cre recombination, and is characteristic for progressive cumulative genomic Cre recombination. A lack of intermediate products, in contrast, is associated with Cre transgenes that produce rapid invalidation through high level recombinase expression.

We have shown herein that a functional deficit of the IGF-IR affects the postnatal growth of males more than that of females. Floxed IGF-IR mice offer new perspectives for the in vivo study of IGF signaling. Combinations of floxed IGF-IR mice with other Cre transgenic lines (Holzenberger, M., M. Leneuve, R. Zaoui, and Y. Le Bouc, manuscript in preparation) show that this receptor can be specifically invalidated at various developmental stages, in many tissues, and also in terminally differentiated cells in the adult organism.


    Acknowledgments
 
We thank Argiris Efstratiadis for providing mouse IGF receptor genomic clones, Richard Mortensen for the pNTK vector, Anne Voss for the gift of ES cell line MPI-II, and Pascale Briant for providing access to the microinjection facilities at the Institut Cochin de Génétique Moléculaire (Paris, France). Heiner Westphal kindly provided the EIIa-Cre transgenic mouse.


    Footnotes
 
1 This work was supported by INSERM and the University of Paris VI. Back

2 Supported by a European Community Research Grant and a Novo Nordisk Fellowship. Back

Received November 2, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. White MF, Kahn CR 1994 The insulin signalling system. J Biol Chem 269:1–4[Free Full Text]
  2. Blakesley VA, Butler AA, Koval AP, Okubo Y, LeRoith D 1999 IGF-I receptor function: transducing the IGF-1 signal into intracellular events. In: Rosenfeld R, Roberts Jr C (eds) The IGF System. Humana Press, Totowa, pp 143–164
  3. Jones JI, Clemmons DR 1995 Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev 16:3–34[Abstract/Free Full Text]
  4. Martin JL, Baxter RC 1999 IGF binding proteins and extracellular matrix. In: Rosenfeld R, Roberts Jr C (eds) The IGF System. Humana Press, Totowa, pp 227–256
  5. Mathews LS, Hammer RE, Behringer RR, D’Ercole AJ, Bell GI, Brinster RL, Palmiter RD 1988 Growth enhancement of transgenic mice expressing human insulin-like growth factor I. Endocrinology 123:2827–2833[Abstract/Free Full Text]
  6. Reiss K, Cheng W, Ferber A, Kajstura J, Li P, Li B, Olivetti G, Homcy CJ, Baserga R, Anversa P 1996 Overexpression of IGF-I in the heart is coupled with myocyte proliferation in transgenic mice. Proc Natl Acad Sci USA 93:8630–8635[Abstract/Free Full Text]
  7. Wolf E, Kramer R, Blum WF, Foll J, Brem G 1994 Consequences of postnatally elevated insulin-like growth factor-II in transgenic mice: endocrine changes and effects on body and organ growth. Endocrinology 135:1877–1994[Abstract]
  8. Leventhal PS, Russell JW, Feldman EL 1999 IGFs and the nervous system. In: Rosenfeld R, Roberts Jr C (eds) The IGF System. Humana Press, Totowa, pp 425–456
  9. Carson MJ, Behringer RR, Brinster RL, McMorris FA 1993 Insulin-like growth factor I increases brain growth and central nervous system myelination in transgenic mice. Neuron 10:729–740[CrossRef][Medline]
  10. Ye P, Carson J, D’Ercole AJ 1995 Insulin-like growth factor-I influences the initiation of myelination: studies of anterior commissure of transgenic mice. Neurosci Lett 201:235–238[CrossRef][Medline]
  11. Coleman ME, DeMayo F, Yin KC, Lee HM, Geske R, Montgomery C, Schwartz RJ 1995 Myogenic vector expression of insulin-like growth factor I stimulates muscle cell differentiation and myofiber hypertrophy in transgenic mice. J Biol Chem 270:12109–12116[Abstract/Free Full Text]
  12. Baker J, Liu J-P, Robertson EJ, Efstratiadis A 1993 Role of insulin-like growth factors in embryonic and postnatal growth. Cell 75:73–82[CrossRef][Medline]
  13. Liu J-P, Baker J, Perkins AS, Robertson EJ, Efstratiadis A 1993 Mice carrying null mutations of the genes encoding insulin-like growth factor I (IGF-1) and type 1 IGF receptor (Igf1r). Cell 75:59–72[Medline]
  14. Marth JD 1996 Recent advances in gene mutagenesis by site-directed recombination. J Clin Invest 97:1999–2002[Medline]
  15. Kühn R, Schwenk F, Aguet M, Rajewsky K 1995 Inducible gene targeting in mice. Science 269:1427–1429[Abstract/Free Full Text]
  16. Voss AK, Thomas T, Gruss P 1997 Germ line chimeras from female ES cells. Exp Cell Res 230:45–49[CrossRef][Medline]
  17. McMahon AP, Bradley A 1990 The Wnt-1 (int-1 proto-oncogene) is required for development of a large region of the mouse brain. Cell 62:1073–1085[CrossRef][Medline]
  18. Wurst W, Joyner AL 1993 Production of targeted embryonic stem cells clones. In: Joyner A (ed) Gene Targeting. A Practical Approach. IRL Press at Oxford University Press, Oxford, pp 33–61
  19. Ramirez-Solis R, Rivera-Perez J, Wallace JD, Wims M, Zheng H, Bradley A 1992 Genomic DNA microextraction: a method to screen numerous samples. Anal Biochem 201:331–335[CrossRef][Medline]
  20. Durieux C, Ruiz-Gayo M, Corringer PJ, Bergeron F, Ducos B, Roques BP 1992 [3H]pBC 264, a suitable probe for studying cholecystokinin-B receptors: binding characteristics in rodent brains and comparison with [3H]SNF 8702. Mol Pharmacol 41:1089–1095[Abstract]
  21. Gay E, Seurin D, Babajko S, Doublier S, Cazillis M, Binoux M 1997 Liver-specific expression of human insulin-like growth factor binding protein-1 in transgenic mice: repercussions in reproduction, ante- and perinatal mortality and postnatal growth. Endocrinology 138:2937–2947[Abstract/Free Full Text]
  22. Bessone S, Vidal F, Le Bouc Y, Epelbaum J, Bluet-Pajot MT, Darmon M 1999 EMK protein kinase-null mice: dwarfism and hypofertility associated with alterations in the somatotrope and prolactin pathways. Dev Biol 214:87–101[CrossRef][Medline]
  23. Binoux M, Seurin D, Lassarre C, Gourmelen M 1984 Preferential measurement of insulin-like growth factor (IGF) I-related peptides in serum with the aid of IGF binding proteins (IGFBPs) produced by rat liver in culture. Estimation of serum IGFBP levels. J Clin Endocrinol Metab 59:453–462[Abstract/Free Full Text]
  24. Hossenlopp P, Seurin D, Segovia-Quinson B, Hardouin S, Binoux M 1986 Analysis of serum insulin-like growth factor binding proteins using Western blotting: use of the method for titration of the binding protein and competitive binding studies. Anal Biochem 154:138–143[CrossRef][Medline]
  25. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  26. Lakso M, Pichel JG, Gorman JR, Sauer B, Okamoto Y, Lee E, Alt FW, Westphal H 1996 Efficient in vivo manipulation of mouse genomic sequences at the zygote stage. Proc Natl Acad Sci USA 93:5860–5865[Abstract/Free Full Text]
  27. D’Ercole AJ 1999 Actions of IGF system proteins from studies of transgenic and gene knockout models. In: Rosenfeld R, Roberts Jr C (eds) The IGF System. Humana Press, Totowa, pp 545–577
  28. De Chiara TM, Efstratiadis A, Robertson EJ 1990 A growth-deficiency phenotype in heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting. Nature 345:78–80[CrossRef][Medline]
  29. Powell-Braxton L, Hollingshead P, Giltinan D, Pitts-Meek S, Stewart T 1993b Inactivation of the IGF-I gene in mice results in perinatal lethality. Ann NY Acad Sci 692:300–301
  30. Powell-Braxton L, Hollingshead P, Warburton C, Dowd M, Pitts-Meek S, Dalton D, Gillett N, Stewart TA 1993a IGF-I is required for normal embryonic growth in mice. Genes Dev 12B:2609–2617
  31. Wang J, Zhou J, Powell-Braxton L, Bondy C 1999 Effects of Igf1 gene deletion on postnatal growth patterns. Endocrinology 140:3391–3394[Abstract/Free Full Text]
  32. Yakar S, Liu JL, Stannard B, Butler A, Accili D, Sauer B, LeRoith D 1999 Normal growth and development in the absence of hepatic insulin-like growth factor I. Proc Natl Acad Sci USA 96:7327–7329
  33. Jacks T, Shih TS, Schmitt EM, Bronson RT, Bernards A, Weinberg RA 1994 Tumour predisposition in mice heterozygous for a targeted mutation in Nf1. Nat Genet 7:353–361[CrossRef][Medline]
  34. Meyers EN, Lewandoski M, Martin GR 1998 An Fgf8 mutant allelic series generated by Cre- and Flp-mediated recombination. Nat Genet 18:136–141[CrossRef][Medline]
  35. Nagy A, Moens C, Ivanyi E, Pawling J, Gertsenstein M, Hadjantonakis AK, Pirity M, Rossant J 1998 Dissecting the role of N-myc in development using a single targeting vector to generate a series of alleles. Curr Biol 8:661–664[CrossRef][Medline]
  36. Lau MM, Stewart HCE, Liu Z, Bhatt H, Rotwein P 1994 Loss of the imprinted IGF-2/cation-independent mannose 6-phosphate receptor results in fetal overgrowth and perinatal lethality. Genes Dev 8:2953–2963[Abstract/Free Full Text]
  37. Ullrich A, Gray A, Tam AW, Yang-Feng T, Tsubokawa M, Collins C, Henzel W, Le Bon T, Kathuria S, Chen E, Jacobs S, Francke U, Ramachandran J, Fujitu-Yamaguchi Y 1986 Insulin-like growth factor I receptor primary structure: comparison with insulin receptor suggests structural determinants that define functional specificity. EMBO J 10:2503–2512
  38. Lowe Jr WL, Adamo M, Werner H, Roberts Jr CT, LeRoith D 1989 Regulation by fasting of rat insulin-like growth factor I and its receptor. Effects on gene expression and binding. J Clin Invest 2:619–626
  39. Holzenberger M, Lapointe F, Leibovici M, Ayer-Le Lièvre C 1996 The avian IGF type 1 receptor: cDNA analysis and in situ hybridization reveal conserved sequence elements and expression patterns relevant for the development of the nervous system. Dev Brain Res 97:76–87[CrossRef][Medline]
  40. Werner H, Woloschak M, Adamo M, Shen-Orr Z, Roberts Jr CT, LeRoith D 1989 Developmental regulation of the rat insulin-like growth factor I receptor gene. Proc Natl Acad Sci USA:7451–7545
  41. Giustina A, Veldhuis JD 1998 Pathophysiology of the neuroregulation of growth hormone secretion in experimental animals and the human. Endocr Rev 19:717–797[Abstract/Free Full Text]
  42. Stefaneanu L, Powell-Braxton L, Won W, Chandrashekar V, Bartke A 1999 Somatotroph and lactotroph changes in the adenohypophyses of mice with disrupted insulin-like growth factor I gene. Endocrinology 140:3881–3889[Abstract/Free Full Text]
  43. Wang J, Niu W, Witte DP, Chernausek SD, Nikiforov YE, Clemens TL, Sharifi B, Strauch AR, Fagin JA 1998 Overexpression of insulin-like growth factor-binding protein-4 (IGFBP-4) in smooth muscle cells of transgenic mice through a smooth muscle alpha-actin-IGFBP-4 fusion gene induces smooth muscle hypoplasia. Endocrinology 139:2605–2614[Abstract/Free Full Text]
  44. Ye P, D’Ercole J 1998 Insulin-like growth factor I (IGF-I) regulates IGF binding protein-5 gene expression in the brain. Endocrinology 139:65–71[Abstract/Free Full Text]
  45. Rajaram S, Baylink DJ, Mohan S 1997 Insulin-like growth factor-binding proteins in serum and other biological fluids:regulation and functions. Endocr Rev 18:801–831[Abstract/Free Full Text]
  46. Gatford KL, Egan AR, Clarke IJ, Owens PC 1998 Sexual dimorphism of the somatotrophic axis. J Endocrinol 157:373–389[CrossRef][Medline]
  47. Mauras N, Rogol AD, Haymond MW, Veldhuis JD 1996 Sex steroids, growth hormone, insulin-like growth factor-1: neuroendocrine and metabolic regulation in puberty. Horm Res 45:74–80[Medline]
  48. Zung A, Phillip M, Chalew SA, Palese T, Kowarski AA, Zadik Z 1999 Testosterone effect on growth and growth mediators of the GH-IGF-I axis in the liver and epiphyseal growth plate of juvenile rats. J Mol Endocrinol 23:209–221[Abstract]
  49. Gori F, Hofbauer LC, Conover CA, Khosla S 1999 Effects of androgens on the insulin-like growth factor system in an androgen-responsive human osteoblastic cell line. Endocrinology 140:5579–5586[Abstract/Free Full Text]
  50. Brüning JC, Michael MD, Winnay JN, Hayashi T, Horsch D, Accili D, Goodyear LJ, Kahn CR 1998 A muscle-specific insulin receptor knockout exhibits features of the metabolic syndrome of NIDDM without altering glucose tolerance. Mol Cell 2:559–569[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
A. Cadoret, C. Rey, D. Wendum, K. Elriz, F. Tronche, M. Holzenberger, and C. Housset
IGF-1R Contributes to Stress-Induced Hepatocellular Damage in Experimental Cholestasis
Am. J. Pathol., August 1, 2009; 175(2): 627 - 635.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Fang, I. D. Schwartz, B. D. Johnson, M. A. Derr, C. T. Roberts Jr., V. Hwa, and R. G. Rosenfeld
Familial Short Stature Caused by Haploinsufficiency of the Insulin-Like Growth Factor I Receptor due to Nonsense-Mediated Messenger Ribonucleic Acid Decay
J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1740 - 1747.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Kappeler, C. De Magalhaes Filho, P. Leneuve, J. Xu, N. Brunel, C. Chatziantoniou, Y. Le Bouc, and M. Holzenberger
Early Postnatal Nutrition Determines Somatotropic Function in Mice
Endocrinology, January 1, 2009; 150(1): 314 - 323.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
N. Kloting, L. Koch, T. Wunderlich, M. Kern, K. Ruschke, W. Krone, J. C. Bruning, and M. Bluher
Autocrine IGF-1 Action in Adipocytes Controls Systemic IGF-1 Concentrations and Growth
Diabetes, August 1, 2008; 57(8): 2074 - 2082.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
P Froment, M Vigier, D Negre, I Fontaine, J Beghelli, F L Cosset, M Holzenberger, and P Durand
Inactivation of the IGF-I receptor gene in primary Sertoli cells highlights the autocrine effects of IGF-I
J. Endocrinol., September 1, 2007; 194(3): 557 - 568.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
M J E Walenkamp and J M Wit
Genetic disorders in the GH IGF-I axis in mouse and man
Eur. J. Endocrinol., August 1, 2007; 157(suppl_1): S15 - S26.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. Cheng and J. Du
Mechanical Stretch Simulates Proliferation of Venous Smooth Muscle Cells Through Activation of the Insulin-Like Growth Factor-1 Receptor
Arterioscler Thromb Vasc Biol, August 1, 2007; 27(8): 1744 - 1751.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. G. Laustsen, S. J. Russell, L. Cui, A. Entingh-Pearsall, M. Holzenberger, R. Liao, and C. R. Kahn
Essential Role of Insulin and Insulin-Like Growth Factor 1 Receptor Signaling in Cardiac Development and Function
Mol. Cell. Biol., March 1, 2007; 27(5): 1649 - 1664.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. J. E. Walenkamp, H. J. van der Kamp, A. M. Pereira, S. G. Kant, H. A. van Duyvenvoorde, M. F. Kruithof, M. H. Breuning, J. A. Romijn, M. Karperien, and J. M. Wit
A Variable Degree of Intrauterine and Postnatal Growth Retardation in a Family with a Missense Mutation in the Insulin-Like Growth Factor I Receptor
J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3062 - 3070.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. Raile, J. Klammt, A. Schneider, A. Keller, S. Laue, R. Smith, R. Pfaffle, J. Kratzsch, E. Keller, and W. Kiess
Clinical and Functional Characteristics of the Human Arg59Ter Insulin-Like Growth Factor I Receptor (IGF1R) Mutation: Implications for a Gene Dosage Effect of the Human IGF1R
J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2264 - 2271.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. D. Gagliardi, E. Y. W. Kuo, S. Raulic, G. F. Wagner, and G. E. DiMattia
Human stanniocalcin-2 exhibits potent growth-suppressive properties in transgenic mice independently of growth hormone and IGFs
Am J Physiol Endocrinol Metab, January 1, 2005; 288(1): E92 - E105.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Entingh-Pearsall and C. R. Kahn
Differential Roles of the Insulin and Insulin-like Growth Factor-I (IGF-I) Receptors in Response to Insulin and IGF-I
J. Biol. Chem., September 3, 2004; 279(36): 38016 - 38024.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. Okubo, K. Siddle, H. Firth, S. O'Rahilly, L. C. Wilson, L. Willatt, T. Fukushima, S.-I. Takahashi, C. J. Petry, T. Saukkonen, et al.
Cell Proliferation Activities on Skin Fibroblasts from a Short Child with Absence of One Copy of the Type 1 Insulin-Like Growth Factor Receptor (IGF1R) Gene and a Tall Child with Three Copies of the IGF1R Gene
J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 5981 - 5988.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. Leneuve, S. Colnot, G. Hamard, F. Francis, M. Niwa-Kawakita, M. Giovannini, and M. Holzenberger
Cre-mediated germline mosaicism: a new transgenic mouse for the selective removal of residual markers from tri-lox conditional alleles
Nucleic Acids Res., March 1, 2003; 31(5): e21 - e21.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z.-J. Lan, A. C.-K. Chung, X. Xu, F. J. DeMayo, and A. J. Cooney
The Embryonic Function of Germ Cell Nuclear Factor Is Dependent on the DNA Binding Domain
J. Biol. Chem., December 20, 2002; 277(52): 50660 - 50667.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. A. Steinbrecher, S. A. Wowk, J. A. Rudolph, D. P. Witte, and M. B. Cohen
Targeted Inactivation of the Mouse Guanylin Gene Results in Altered Dynamics of Colonic Epithelial Proliferation
Am. J. Pathol., December 1, 2002; 161(6): 2169 - 2178.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
I. Lagutina, S. J. Conway, J. Sublett, and G. C. Grosveld
Pax3-FKHR Knock-In Mice Show Developmental Aberrations but Do Not Develop Tumors
Mol. Cell. Biol., October 15, 2002; 22(20): 7204 - 7216.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
P. Valet, G. Tavernier, I. Castan-Laurell, J. S. Saulnier-Blache, and D. Langin
Understanding adipose tissue development from transgenic animal models
J. Lipid Res., June 1, 2002; 43(6): 835 - 860.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Ducos, S. Cabrol, M. Houang, L. Perin, M. Holzenberger, and Y. Le Bouc
IGF Type 1 Receptor Ligand Binding Characteristics Are Altered in a Subgroup of Children with Intrauterine Growth Retardation
J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5516 - 5524.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Holzenberger, G. Hamard, R. Zaoui, P. Leneuve, B. Ducos, C. Beccavin, L. Perin, and Y. Le Bouc
Experimental IGF-I Receptor Deficiency Generates a Sexually Dimorphic Pattern of Organ-Specific Growth Deficits in Mice, Affecting Fat Tissue in Particular
Endocrinology, October 1, 2001; 142(10): 4469 - 4478.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
Z Laron
Insulin-like growth factor 1 (IGF-1): a growth hormone
Mol. Pathol., October 1, 2001; 54(5): 311 - 316.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. A. Butler and D. LeRoith
Minireview: Tissue-Specific Versus Generalized Gene Targeting of the igf1 and igf1r Genes and Their Roles in Insulin-Like Growth Factor Physiology
Endocrinology, May 1, 2001; 142(5): 1685 - 1688.
[Abstract] [Full Text]


Home page
Nucleic Acids ResHome page
M. Holzenberger, C. Lenzner, P. Leneuve, R. Zaoui, G. Hamard, S. Vaulont, and Y. L. Bouc
Cre-mediated germline mosaicism: a method allowing rapid generation of several alleles of a target gene
Nucleic Acids Res., November 1, 2000; 28(21): e92 - e92.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Holzenberger, M.
Right arrow Articles by Le Bouc, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holzenberger, M.
Right arrow Articles by Le Bouc, Y.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Growth Disorders
Hazardous Substances DB
*NEOMYCIN


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals