| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Medicine (S.-A.W., J.A.B., J.M.H.), Section of Endocrinology, Diabetes, and Metabolism, Pennsylvania State University College of Medicine, Hershey, Pennsylvania 17033; Department of Anatomy (J.E.G.), Physiological Sciences and Radiology, College of Veterinary Medicine, North Carolina State University, Raleigh, North Carolina 27606; and Department of Dairy and Poultry Sciences and the Interdisciplinary Concentration in Animal Molecular and Cell Biology (F.A.S.), University of Florida, Gainesville Florida 32611
Address all correspondence and requests for reprints to: Dr. James M. Hammond, Head, Section of Endocrinology, Diabetes, and Metabolism, H044, Department of Medicine, Pennsylvania State University College of Medicine, Hershey, Pennsylvania 17033. E-mail: jhammond{at}psu.edu
| Abstract |
|---|
|
|
|---|
.
We studied IGFBP-3 and ALS messenger RNA (mRNA) by in
situ hybridization. These transcripts were colocalized with
aromatase mRNA, a marker of healthy granulosa cells. IGFBP-3 mRNA was
equally expressed in granulosa cells of all growing follicles. In
contrast, granulosa cell ALS mRNA levels were higher
(P < 0.05) in preantral and small antral follicles
than in large antral follicles. In thecal cells, expression of
mRNA for IGFBP-3, ALS and cyclin D1 (a marker of cell proliferation)
was restricted to healthy (aromatase-expressing) follicles. In those
follicles, thecal expression of IGFBP-3 mRNA was low or absent in
preantral follicles but increased (P < 0.05) in
antral follicles. Thecal cell ALS transcripts peaked in small antral
follicles (P < 0.05) and then declined. In
granulosa cells of atretic follicles, transcripts for aromatase were
greatly reduced, whereas IGFBP-3 mRNA levels remained high. In
contrast, ALS transcript levels were greatly reduced in both granulosa
(P < 0.05) and thecal cells (P
< 0.001) of atretic follicles. After ovulation, IGFBP-3 mRNA was
moderately expressed in granulosa luteins but strongly detected in a
few theca-derived cells and in vascular endothelial cells. This study
demonstrates that follicular fluid IGFBP-3 and ALS, like the IGFs,
originate (at least in part) from the ovary. The ability of follicular
cells to synthesize, assemble, and store all components of the ternary
complex may be critical in determining the bioavailability of
follicular IGF-I and -II. | Introduction |
|---|
|
|
|---|
IGFBP-3 is, by far, the most abundant IGFBP in porcine follicular fluid; in contrast to the low-molecular-weight IGFBPs, its concentration increases during the growth of healthy follicles (6). However, attempts to detect IGFBP-3 messenger RNA (mRNA) in porcine follicular cells in vivo indicated that the levels were minimal (7). These observations suggested that IGFBP-3, probably of extrafollicular origin, gained increasing access to the follicle with maturation. Most circulating IGF-I is associated with IGFBP-3 and the acid-labile subunit (ALS), presumably in a ternary complex, which was felt to be restricted to the intravascular space (8, 9). However, it has recently been demonstrated that human follicular fluid contains high levels of ALS (10, 11). These observations further supported the notion that most of the intrafollicular IGFBP-3 (and, by implication, IGF-I) could reach the follicle from the circulation. Inevitably, such a physiological construct would call into question the presumed importance of the ovarian IGF autocrine/paracrine system (2, 3, 12). Thus, circulating levels of IGF-I, if accessible to the ovary, would be sufficient to saturate the relevant biochemical processes.
Many of the in vivo data reviewed above, including those from our own laboratory, were in conflict with several of our publications (13, 14) that showed that cultured porcine granulosa cells expressed IGFBP-3 mRNA and protein; under these conditions, IGFBP-3 expression is suppressed by gonadotropins (13, 14). Because of these data and because of the extreme importance attached to an understanding of the source of follicular IGFBP-3 and its bound IGFs, we have reexamined these issues. Using in situ hybridization with homologous probes, we have studied synchronized follicular and luteal-phase pigs. These studies have detected ovarian sources of both IGFBP-3 and ALS. The expression of these mRNAs is highly regulated; thus, they could play an autocrine/paracrine role in the process of follicle selection.
| Materials and Methods |
|---|
|
|
|---|
(10 mg/animal,
Lutalyse; Pharmacia and Upjohn, Kalamazoo, MI) on
day 12 of the estrous cycle. Animals were killed and ovariectomized 3,
5, 6, 7, or 9 days after PGF2
. In this model, ovulation occurs on
day 6 or 7 after PG treatment. The experimental protocol for animal
care and use was performed in accordance with the NIH Guide and Care of
Laboratory Animals and with approval of the North Carolina State
University Institutional Animal Care and Use Committee.
Complementary DNA (cDNA) and cRNA probes
Granulosa cells were isolated from small- to medium-sized
follicles of immature pigs and cultured in the presence of 10 ng FSH.
Total RNA was prepared from the cell cultures and reverse transcribed
to cDNA. These granulosa cell cDNA preparations were used as templates
in the amplification of ALS and cyclin D1 cDNA fragments. ALS primers
(15) forward: 5' TTCTGCAGCTCCCGGAACCTCA 3'; reverse: 5'
TGCAGGTAGGTCAGCTTGTTG 3' were used to amplify a 465-bp fragment from
porcine granulosa cell cDNA preparation. The resulting ALS cDNA
fragment was cloned in TA vector, sequenced, and used to generate a
35S-labeled cRNA probe for in situ
hybridization. Cyclin D1 is an important cell cycle regulator; its
overexpression is associated with oncogenic transformation in
vitro (16) and in vivo (17). In preliminary studies,
its transcripts were localized to thecal cells of healthy growing
follicles. Therefore, it was used as a marker of thecal cell
proliferation. Primers for cyclin D1 were as previously published (18);
forward: 5' CTGGCCATGAACTACCTGGA 3'; reverse: 5'GTCACACTTGATCACTCTGG 3'
and were used to amplify a 230-bp fragment from porcine granulosa cell
cDNA preparations. The resulting fragment was cloned, sequenced, and
used to generate in situ hybridization probes.
35S-labeled cRNA probes were also synthesized
from porcine IGFBP-3 (19) and human aromatase cDNAs (20).
In situ hybridization
Ovarian pieces, approximately 1 cm x 1 cm x 1 cm in
size, were embedded in OCT and frozen on dry ice, and 10-µm-thick
frozen sections were prepared. Aromatase gene expression, along with
morphological criteria such as absence of pyknotic granulosa cell
nuclei and integrity of the basal lamina, were used to identify healthy
follicles. In situ hybridization was conducted as described
previously (21). After the in situ procedure, sections were
exposed to autoradiographic film (Biomax MR; Eastman Kodak Co., Rochester, NY), for 14 days, to evaluate the overall
intensity of hybridization signals. Slides were then dipped in NTB2
liquid emulsion (Eastman Kodak Co.) and exposed for 2
(aromatase) or 3 weeks (IGFBP-3 and ALS) at 4 C. For a given probe,
exposure time was the same for all animals. Sections were developed in
Dektol-19 (Eastman Kodak Co.) and counter-stained
with hematoxylin. In side-by-side comparison, the strength of the
signal with homologous IGFBP-3 cRNA probe was stronger than that
obtained with heterologous (rat) IGFBP-3 cRNA probe. Two types of
controls were used for in situ hybridization. First,
hybridization of ovarian sections with
35S-labeled IGFBP-3 sense probe gave a low,
diffuse, and uniform hybridization signal. Second, blank slides were
also included in which no radioactive probe was added to the
hybridization buffer. As a result, no silver grains were detected on
ovarian sections.
Quantification of in situ hybridization signal and statistical
analyses
Grain density was measured using NIH image analysis software in
random, but constant and nonoverlapping, areas of microscopic field at
a magnification of 20x. Four such areas were counted for each
follicular compartment (granulosa or theca compartment) within any
follicle considered, and only areas covered by cells were counted. The
background was determined by counting grain density in four areas of
slide devoid of tissue, providing an internal control for each slide.
For each follicular compartment, the background value was subtracted
from the grain density. To ensure accuracy of follicular
classification, for preantral stages, only those follicles that were at
largest or nearly largest cross-section were considered. For mRNA
expression in the theca compartment, only follicles at least 250 µm
in diameter (large preantral follicles and more advanced stages) were
considered; such follicles are typically surrounded by at least two
layers of theca cells. For mRNA expression in granulosa cells, smaller
preantral follicles (including primary follicles with a single layer of
cuboidal granulosa cells) were also considered. Antral follicles were
classified as large when they were more than 4 mm in diameter at the
nearly largest cross-section (approximated by the presence of the
oocyte or cumulus cells) and/or when their theca compartment was more
than 50 µm thick. Antral follicles were classified as small,
otherwise.
The number of animals considered was 35 for each follicular phase time point (day 3, 5, 6, or 7) and 4 for the luteal phase time point (day 9). A single ovarian section was used per animal and per probe to determine the intensity of hybridization signal. For each follicular compartment (granulosa or thecal cells), data from each variable (grain density of IGFBP-3 or ALS mRNA expression) were initially subjected to two-way ANOVA to assess temporal (time points) and spatial (stage of follicular development) regulation. No differences were seen among time points. Consequently, data from follicular and luteal phases were subsequently pooled and analyzed by one-way ANOVA. Differences between means were tested using the Newman-Keuls multiple-range test. For each probe (ALS or IGFBP-3) and for each follicular compartment (granulosa cell or theca cell compartment), 2250 healthy preantral follicles, 2735 healthy small antral follicles, 1628 atretic small antral follicles, and 818 healthy large antral follicles were examined.
The effects of follicular condition on IGFBP-3 or ALS mRNA expression were examined within a single follicular category (small antral follicular stage), and treatment comparisons (i.e. healthy vs. atretic follicles) were conducted using the t test.
Immunohistochemical identification of endothelial cells
Immunohistochemical localization of the endothelial cell marker,
factor VIII, was conducted on sections consecutive to those used
for IGFBP-3, ALS, and cyclin D1 in situ hybridization.
Frozen sections were air-dried at room temperature for at least 2
h, fixed in cold acetone (10 min), and rinsed in PBS (pH 7.4), and
the nonspecific binding was blocked by incubation with CAS-Block
(Zymed Laboratories, Inc. Laboratory, South San Francisco,
CA). Sections were then incubated for 2 h in the presence of
factor VIII antiserum (Zymed Laboratories, Inc.) diluted
1:20. The subsequent steps were conducted using a nonbiotin
amplification kit (NBA, Zymed Laboratories, Inc.) and
according to the manufacturers instructions.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
treatment; and, in three
luteal-phase animals, we were able to delineate a series of
time-dependent stages in the corpus luteum formation based on the
luteal morphology. In the freshly ovulated follicle (day 7 post
PGF2
), high levels of cyclin D1 (Fig. 8
), those cells expressing high levels of cyclin D1 (Fig. 8E
|
| Discussion |
|---|
|
|
|---|
Unlike other ovarian growth factors, IGF-I circulates at high concentrations as part of a ternary complex composed of IGF, IGFBP-3, and ALS (24, 25, 26). It was generally believed that the ternary complex required processing in the vascular space and that only the binary complex (IGF-I/IGFBP-3) gained access to tissues (27). However, recent studies have shown high ALS levels in follicular fluid (10, 11); apparently most of the IGFs within that compartment exist as part of the ternary complex (11). These results have necessitated a reexamination of the source and regulation of follicular IGFs and their binding proteins.
Previous data from our laboratory (6) have shown that follicular fluid IGFBP-3 protein increases with the growth of preovulatory follicles in pigs (IGFBP-3 vs. diameter, r = 0.55; P < 0.01). However, there was a poor correlation with atresia (r = -0.181; P, not significant). In a follow-up study (28) during early follicle development in the luteal phase (these follicles are all destined for atresia), there was a weaker correlation between IGFBP-3 levels and follicular size (r = 0.397; P < 0.05) and no significant correlation with atresia (r = -0.186). In another study (29), Howard et al. found no change in IGFBP-3 during follicle growth in pooled postweaning samples of porcine follicular fluid. However, these authors described a definite decline in IGFBP-3 after hCG in an eCG/hCG ovarian stimulation protocol. The follicles sampled in these earlier studies were likely different from those in the current one. Follicular dissection techniques are directed mainly at medium-to-large antral follicles, which are easier to harvest. In both the current studies and the previous ones (6, 28), we observed no correlation of IGFBP-3 levels or expression with atresia. We did not observe a convincing increase in follicular IGFBP-3 mRNA during transition from small to large antral follicles. During this period, we (6, 28) found a doubling of IGFBP-3 peptide. The discrepancy between mRNA and peptide could result from differences in the follicles sampled; however, it might also reflect some influx of serum IGFBP-3 during terminal follicular growth.
It is not terribly surprising that the current studies with homologous probes detected IGFBP-3 mRNA when previous studies with Northern, dot-blot, and heterologous in situ assays gave negative or equivocal results. Further, it is noteworthy that granulosa cells from 3- to 5-mm porcine follicles, previously shown to express IGFBP-3 in culture (14), were found to express the mRNA in vivo. These previous culture studies showed a diminution in IGFBP-3 expression during gonadotropin or cAMP-induced luteinization in culture (13, 30). Such data seemed inconsistent with the substantial increase in IGFBP-3 expression in the corpus luteum in vivo (7, 31). However, it seems, from current studies and others (31, 32), that the expression of this protein in the corpus luteum could be mainly localized to the endothelial cells.
In summary, the current study shows that thecal, but not granulosa, cell IGFBP-3 mRNA expression is regulated during porcine follicular development and atresia. IGFBP-3 transcript levels were low in thecal cells of preantral follicles but elevated in the theca interna of antral follicles. The observation that thecal cell, but not granulosa, cell IGFBP-3 mRNA may be the regulated species is further illustrated by the decrease in this mRNA in the thecal, but not the granulosa, cell compartment during atresia. These observations are consistent with a role for IGFBP-3 in the development of the theca compartment. Although these studies do not exclude an ovarian role for circulating IGFBP-3, they demonstrate a local source, which could account for most of the available physiological data.
It has been widely accepted that the ternary complex does not exit the vascular space. As a corollary, it has been generally believed that ALS acts solely as an IGF-transport protein in the circulation. Consequently, the regulation and role of ALS in peripheral tissue have not yet been actively considered. To the best of our knowledge, this study is the first to demonstrate that granulosa, thecal, and luteal cells are a site of ALS synthesis. In humans, follicular fluid levels of ALS protein were found to be almost 50% of those in the circulation and were considerably higher than those in other biological fluids (11). In the current study, ALS mRNA expression was high and was physiologically regulated in both granulosa and thecal cells during the course of follicular development. Interestingly, in thecal cells, the regulation of ALS transcripts mimicked that of IGFBP-3, i.e. they increased between the preantral and the early antral stage. In human ovaries, the majority of IGF (-I and -II) and IGFBP-3 found in follicular fluid exists in the ternary complex (11). It is possible, indeed likely, that follicular cells synthesize and secrete ALS and IGFBP-3 into the follicular fluid to form a ternary complex with the IGFs.
The data provided here fall well short of a comprehensive understanding of the role of the IGFBPs in the ovary. However, they can generate hypotheses and speculation. The current data, like our previous studies, indicate that IGFBP-3 is abundant in healthy preovulatory follicles. In fact, levels of the peptide and thecal mRNA seem to increase with follicle growth. These observations do not jibe easily with the well-demonstrated role of IGFBP-3 as a potent inhibitor of ovarian cell function in vivo (33) and in vitro (34). In vitro studies in our laboratory have shown that IGFBP-3 can attach to ovarian granulosa cells, presumably through sulfated glycoaminoglycans, and dramatically increase the binding capacity of these cells for IGF-I (35). Such a mechanism could facilitate IGF-I effects, but neither others nor we have shown such actions to date. Available studies, including our own, have failed to take into account the new observations that much ovarian IGFBP-3 (and IGF-I) exists as a ternary complex with ALS (11). Based on the known high affinity and stability of this complex, one would postulate that these components would be sequestered, not immediately available for cellular action. However, the components are likely to have their effects significantly extended in time. Such an action could result in a stable ovarian pool of IGF-I, which could be targeted to ovarian cells by, as yet, undefined processing steps.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received October 1, 1999.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. W Kim, R. P Rhoads, N. Segoale, N. B Kristensen, D. E Bauman, and Y. R Boisclair Isolation of the cDNA encoding the acid labile subunit (ALS) of the 150 kDa IGF-binding protein complex in cattle and ALS regulation during the transition from pregnancy to lactation. J. Endocrinol., June 1, 2006; 189(3): 583 - 593. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Ongeri, M. F. Verderame, and J. M. Hammond Follicle-Stimulating Hormone Induction of Ovarian Insulin-Like Growth Factor-Binding Protein-3 Transcription Requires a TATA Box-Binding Protein and the Protein Kinase A and Phosphatidylinositol-3 Kinase Pathways Mol. Endocrinol., July 1, 2005; 19(7): 1837 - 1848. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Ongeri, Q. Zhu, M. F. Verderame, and J. M. Hammond Insulin-Like Growth Factor-Binding Protein-3 in Porcine Ovarian Granulosa Cells: Gene Cloning, Promoter Mapping, and Follicle-Stimulating Hormone Regulation Endocrinology, April 1, 2004; 145(4): 1776 - 1785. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Arraztoa, P. Monget, C. Bondy, and J. Zhou Expression Patterns of Insulin-Like Growth Factor-Binding Proteins 1, 2, 3, 5, and 6 in the Mid-Cycle Monkey Ovary J. Clin. Endocrinol. Metab., November 1, 2002; 87(11): 5220 - 5228. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. V. Silha and L. J. Murphy Minireview: Insights from Insulin-Like Growth Factor Binding Protein Transgenic Mice Endocrinology, October 1, 2002; 143(10): 3711 - 3714. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. V. Silha, Y. Gui, T. Modric, A. Suwanichkul, S. K. Durham, D. R. Powell, and L. J. Murphy Overexpression of the Acid-Labile Subunit of the IGF Ternary Complex in Transgenic Mice Endocrinology, October 1, 2001; 142(10): 4305 - 4313. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-A. Wandji, J. E. Gadsby, J. A. Barber, and J. M. Hammond Messenger Ribonucleic Acids for MAC25 and Connective Tissue Growth Factor (CTGF) Are Inversely Regulated during Folliculogenesis and Early Luteogenesis Endocrinology, July 1, 2000; 141(7): 2648 - 2657. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |