help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wandji, S.-A.
Right arrow Articles by Hammond, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wandji, S.-A.
Right arrow Articles by Hammond, J. M.
Endocrinology Vol. 141, No. 7 2638-2647
Copyright © 2000 by The Endocrine Society


ARTICLES

Porcine Ovarian Cells Express Messenger Ribonucleic Acids for the Acid-Labile Subunit and Insulin-Like Growth Factor Binding Protein-3 during Follicular and Luteal Phases of the Estrous Cycle1

S.-A. Wandji, J. E. Gadsby, F. A. Simmen, J. A. Barber and J. M. Hammond

Department of Medicine (S.-A.W., J.A.B., J.M.H.), Section of Endocrinology, Diabetes, and Metabolism, Pennsylvania State University College of Medicine, Hershey, Pennsylvania 17033; Department of Anatomy (J.E.G.), Physiological Sciences and Radiology, College of Veterinary Medicine, North Carolina State University, Raleigh, North Carolina 27606; and Department of Dairy and Poultry Sciences and the Interdisciplinary Concentration in Animal Molecular and Cell Biology (F.A.S.), University of Florida, Gainesville Florida 32611

Address all correspondence and requests for reprints to: Dr. James M. Hammond, Head, Section of Endocrinology, Diabetes, and Metabolism, H044, Department of Medicine, Pennsylvania State University College of Medicine, Hershey, Pennsylvania 17033. E-mail: jhammond{at}psu.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It has recently been shown that, in follicular fluid, as in the circulation, insulin-like growth factors (IGFs)-I and -II exist in a ternary complex with IGF binding protein-3 (IGFBP-3) and the acid-labile subunit (ALS). The current study was designed to determine whether ovarian follicular and luteal cells could synthesize IGFBP-3 and ALS. Ovaries were collected, during the follicular and early luteal phases, from mature pigs whose cycles were synchronized with PGF2{alpha}. We studied IGFBP-3 and ALS messenger RNA (mRNA) by in situ hybridization. These transcripts were colocalized with aromatase mRNA, a marker of healthy granulosa cells. IGFBP-3 mRNA was equally expressed in granulosa cells of all growing follicles. In contrast, granulosa cell ALS mRNA levels were higher (P < 0.05) in preantral and small antral follicles than in large antral follicles. In thecal cells, expression of mRNA for IGFBP-3, ALS and cyclin D1 (a marker of cell proliferation) was restricted to healthy (aromatase-expressing) follicles. In those follicles, thecal expression of IGFBP-3 mRNA was low or absent in preantral follicles but increased (P < 0.05) in antral follicles. Thecal cell ALS transcripts peaked in small antral follicles (P < 0.05) and then declined. In granulosa cells of atretic follicles, transcripts for aromatase were greatly reduced, whereas IGFBP-3 mRNA levels remained high. In contrast, ALS transcript levels were greatly reduced in both granulosa (P < 0.05) and thecal cells (P < 0.001) of atretic follicles. After ovulation, IGFBP-3 mRNA was moderately expressed in granulosa luteins but strongly detected in a few theca-derived cells and in vascular endothelial cells. This study demonstrates that follicular fluid IGFBP-3 and ALS, like the IGFs, originate (at least in part) from the ovary. The ability of follicular cells to synthesize, assemble, and store all components of the ternary complex may be critical in determining the bioavailability of follicular IGF-I and -II.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE EXISTENCE of an autocrine/paracrine insulin-like growth factor (IGF) system in the ovary has been well documented in many species (1, 2, 3, 4, 5), including the pig. Functionally, this system comprises the ligands, IGF-I and -II, their receptors, and a series of IGF-binding proteins (IGFBPs)-1 through -6. During gonadotropin-dependent development of ovarian follicles, these components interact in a coordinated manner that results in enhanced local actions and interaction of IGFs and gonadotropins in selected follicles. The several processes leading to this net effect include enhanced local secretion and/or levels of IGF-I and reduction of secretion or levels of low-molecular-weight IGFBPs (IGFBP-2, -4, and -5). The discordant regulation between these IGFBPs and IGF-I in porcine ovaries has led to the suggestion that the IGFs and their binding proteins act as antagonistic principles.

IGFBP-3 is, by far, the most abundant IGFBP in porcine follicular fluid; in contrast to the low-molecular-weight IGFBPs, its concentration increases during the growth of healthy follicles (6). However, attempts to detect IGFBP-3 messenger RNA (mRNA) in porcine follicular cells in vivo indicated that the levels were minimal (7). These observations suggested that IGFBP-3, probably of extrafollicular origin, gained increasing access to the follicle with maturation. Most circulating IGF-I is associated with IGFBP-3 and the acid-labile subunit (ALS), presumably in a ternary complex, which was felt to be restricted to the intravascular space (8, 9). However, it has recently been demonstrated that human follicular fluid contains high levels of ALS (10, 11). These observations further supported the notion that most of the intrafollicular IGFBP-3 (and, by implication, IGF-I) could reach the follicle from the circulation. Inevitably, such a physiological construct would call into question the presumed importance of the ovarian IGF autocrine/paracrine system (2, 3, 12). Thus, circulating levels of IGF-I, if accessible to the ovary, would be sufficient to saturate the relevant biochemical processes.

Many of the in vivo data reviewed above, including those from our own laboratory, were in conflict with several of our publications (13, 14) that showed that cultured porcine granulosa cells expressed IGFBP-3 mRNA and protein; under these conditions, IGFBP-3 expression is suppressed by gonadotropins (13, 14). Because of these data and because of the extreme importance attached to an understanding of the source of follicular IGFBP-3 and its bound IGFs, we have reexamined these issues. Using in situ hybridization with homologous probes, we have studied synchronized follicular and luteal-phase pigs. These studies have detected ovarian sources of both IGFBP-3 and ALS. The expression of these mRNAs is highly regulated; thus, they could play an autocrine/paracrine role in the process of follicle selection.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Ovaries were obtained from mature cycling pigs in which luteolysis was induced by administration of PGF2{alpha} (10 mg/animal, Lutalyse; Pharmacia and Upjohn, Kalamazoo, MI) on day 12 of the estrous cycle. Animals were killed and ovariectomized 3, 5, 6, 7, or 9 days after PGF2{alpha}. In this model, ovulation occurs on day 6 or 7 after PG treatment. The experimental protocol for animal care and use was performed in accordance with the NIH Guide and Care of Laboratory Animals and with approval of the North Carolina State University Institutional Animal Care and Use Committee.

Complementary DNA (cDNA) and cRNA probes
Granulosa cells were isolated from small- to medium-sized follicles of immature pigs and cultured in the presence of 10 ng FSH. Total RNA was prepared from the cell cultures and reverse transcribed to cDNA. These granulosa cell cDNA preparations were used as templates in the amplification of ALS and cyclin D1 cDNA fragments. ALS primers (15) forward: 5' TTCTGCAGCTCCCGGAACCTCA 3'; reverse: 5' TGCAGGTAGGTCAGCTTGTTG 3' were used to amplify a 465-bp fragment from porcine granulosa cell cDNA preparation. The resulting ALS cDNA fragment was cloned in TA vector, sequenced, and used to generate a 35S-labeled cRNA probe for in situ hybridization. Cyclin D1 is an important cell cycle regulator; its overexpression is associated with oncogenic transformation in vitro (16) and in vivo (17). In preliminary studies, its transcripts were localized to thecal cells of healthy growing follicles. Therefore, it was used as a marker of thecal cell proliferation. Primers for cyclin D1 were as previously published (18); forward: 5' CTGGCCATGAACTACCTGGA 3'; reverse: 5'GTCACACTTGATCACTCTGG 3' and were used to amplify a 230-bp fragment from porcine granulosa cell cDNA preparations. The resulting fragment was cloned, sequenced, and used to generate in situ hybridization probes. 35S-labeled cRNA probes were also synthesized from porcine IGFBP-3 (19) and human aromatase cDNAs (20).

In situ hybridization
Ovarian pieces, approximately 1 cm x 1 cm x 1 cm in size, were embedded in OCT and frozen on dry ice, and 10-µm-thick frozen sections were prepared. Aromatase gene expression, along with morphological criteria such as absence of pyknotic granulosa cell nuclei and integrity of the basal lamina, were used to identify healthy follicles. In situ hybridization was conducted as described previously (21). After the in situ procedure, sections were exposed to autoradiographic film (Biomax MR; Eastman Kodak Co., Rochester, NY), for 1–4 days, to evaluate the overall intensity of hybridization signals. Slides were then dipped in NTB2 liquid emulsion (Eastman Kodak Co.) and exposed for 2 (aromatase) or 3 weeks (IGFBP-3 and ALS) at 4 C. For a given probe, exposure time was the same for all animals. Sections were developed in Dektol-19 (Eastman Kodak Co.) and counter-stained with hematoxylin. In side-by-side comparison, the strength of the signal with homologous IGFBP-3 cRNA probe was stronger than that obtained with heterologous (rat) IGFBP-3 cRNA probe. Two types of controls were used for in situ hybridization. First, hybridization of ovarian sections with 35S-labeled IGFBP-3 sense probe gave a low, diffuse, and uniform hybridization signal. Second, blank slides were also included in which no radioactive probe was added to the hybridization buffer. As a result, no silver grains were detected on ovarian sections.

Quantification of in situ hybridization signal and statistical analyses
Grain density was measured using NIH image analysis software in random, but constant and nonoverlapping, areas of microscopic field at a magnification of 20x. Four such areas were counted for each follicular compartment (granulosa or theca compartment) within any follicle considered, and only areas covered by cells were counted. The background was determined by counting grain density in four areas of slide devoid of tissue, providing an internal control for each slide. For each follicular compartment, the background value was subtracted from the grain density. To ensure accuracy of follicular classification, for preantral stages, only those follicles that were at largest or nearly largest cross-section were considered. For mRNA expression in the theca compartment, only follicles at least 250 µm in diameter (large preantral follicles and more advanced stages) were considered; such follicles are typically surrounded by at least two layers of theca cells. For mRNA expression in granulosa cells, smaller preantral follicles (including primary follicles with a single layer of cuboidal granulosa cells) were also considered. Antral follicles were classified as large when they were more than 4 mm in diameter at the nearly largest cross-section (approximated by the presence of the oocyte or cumulus cells) and/or when their theca compartment was more than 50 µm thick. Antral follicles were classified as small, otherwise.

The number of animals considered was 3–5 for each follicular phase time point (day 3, 5, 6, or 7) and 4 for the luteal phase time point (day 9). A single ovarian section was used per animal and per probe to determine the intensity of hybridization signal. For each follicular compartment (granulosa or thecal cells), data from each variable (grain density of IGFBP-3 or ALS mRNA expression) were initially subjected to two-way ANOVA to assess temporal (time points) and spatial (stage of follicular development) regulation. No differences were seen among time points. Consequently, data from follicular and luteal phases were subsequently pooled and analyzed by one-way ANOVA. Differences between means were tested using the Newman-Keuls multiple-range test. For each probe (ALS or IGFBP-3) and for each follicular compartment (granulosa cell or theca cell compartment), 22–50 healthy preantral follicles, 27–35 healthy small antral follicles, 16–28 atretic small antral follicles, and 8–18 healthy large antral follicles were examined.

The effects of follicular condition on IGFBP-3 or ALS mRNA expression were examined within a single follicular category (small antral follicular stage), and treatment comparisons (i.e. healthy vs. atretic follicles) were conducted using the t test.

Immunohistochemical identification of endothelial cells
Immunohistochemical localization of the endothelial cell marker, factor VIII, was conducted on sections consecutive to those used for IGFBP-3, ALS, and cyclin D1 in situ hybridization. Frozen sections were air-dried at room temperature for at least 2 h, fixed in cold acetone (10 min), and rinsed in PBS (pH 7.4), and the nonspecific binding was blocked by incubation with CAS-Block (Zymed Laboratories, Inc. Laboratory, South San Francisco, CA). Sections were then incubated for 2 h in the presence of factor VIII antiserum (Zymed Laboratories, Inc.) diluted 1:20. The subsequent steps were conducted using a nonbiotin amplification kit (NBA, Zymed Laboratories, Inc.) and according to the manufacturer’s instructions.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ovarian in situ expression of IGFBP-3 and ALS mRNAs during porcine follicular and luteal phases
IGFBP-3 and ALS transcripts were present in granulosa and theca cells of virtually all growing follicles (Figs. 1Go and 2Go). However, in granulosa or theca cells, neither IGFBP-3 nor ALS mRNA expression was regulated as a function of the stage of estrous cycle (early follicular, preovulatory, or luteal stage). Consequently, data from follicular and luteal time points were pooled for quantitative analyses of IGFBP-3 and ALS mRNA expression. In granulosa cells, IGFBP-3 mRNA was constitutively expressed throughout follicular development (Fig. 3Go). In contrast, theca cell IGFBP-3 mRNA levels were lower in preantral follicles than in small antral (P < 0.01) or large antral follicles (P < 0.05; Fig. 3Go). Granulosa cell ALS transcript levels showed the opposite trend to that seen with IGFBP-3. Granulosa cell ALS transcript levels were higher (P < 0.05) in preantral or small antral follicles than in large antral follicles (Figs. 1Go, 2Go, and 4Go). In thecal cells, ALS mRNA levels were lower in preantral (P < 0.01) or in large antral follicles (P < 0.05) than in small antral follicles (Fig. 4Go). ALS transcripts were also detected in the oocyte of preantral follicles (Fig. 1Go).



View larger version (82K):
[in this window]
[in a new window]
 
Figure 1. Darkfield view of in situ hybridization of IGFBP-3, ALS, cyclin D1, and aromatase mRNAs in porcine preantral and small antral follicles. Consecutive frozen sections of porcine ovaries were hybridized sequentially with 35S-labeled IGFBP-3, ALS, cyclin D1, or aromatase antisense cRNA probes, as described in Materials and Methods. IGFBP-3 (A) and ALS transcripts (C) were colocalized to granulosa cells (GCs) of preantral follicles (PFs) and aromatase (B) expressing small antral follicles. IGFBP-3 and ALS mRNAs were also expressed in thecal cells (TCs) of small antral follicles. ALS transcripts were also detected in the oocyte (OO) of preantral follicles. Cyclin D1 mRNA (D) was mainly localized to a few discrete cells in the thecal interna, along the follicular basal lamina; a moderate expression was also found in GCs. The bar represents 60 µm.

 


View larger version (82K):
[in this window]
[in a new window]
 
Figure 2. Darkfield view of IGFBP-3, ALS, cyclin D1, and aromatase mRNA expression in porcine preovulatory follicle wall. Consecutive frozen sections of porcine ovaries were sequentially hybridized with 35S-labeled IGFBP-3, ALS, cyclin D1, or aromatase antisense cRNA probes, as described in Materials and Methods. Transcripts of IGFBP-3 (A) and ALS (C) were colocalized with aromatase mRNA (B) to GC of preovulatory follicles. IGFBP-3 and ALS mRNAs were also colocalized to the TC compartment in preovulatory follicles. Cyclin D1 transcripts (D) were only weakly expressed in some thecal cells along the follicular basal lamina. The bar represents 60 µm.

 


View larger version (24K):
[in this window]
[in a new window]
 
Figure 3. Quantitative distribution of GC and TC IGFBP-3 mRNA expression during porcine follicular development. Porcine ovarian sections were hybridized with 35S-labeled IGFBP-3 antisense cRNA probe, as described in Materials and Methods. The hybridization signal (grain density) was quantified in constant areas of the GC or TC compartment using NIH image analysis software. Each bar represents the mean grain density of IGFBP-3 mRNA ± SEM. Within a given follicular compartment (GC or TC), bars denoted by different letters represent significantly different means. TC, but not GC, IGFBP-3 mRNA was regulated as a function of the stage of follicular development (preantral vs. small antral follicles, P < 0.01; preantral vs. large antral follicles, P < 0.05). ns, Nonsignificant.

 


View larger version (46K):
[in this window]
[in a new window]
 
Figure 4. Quantitative distribution of GC and TC ALS mRNA expression during porcine follicular development. Frozen sections from porcine ovaries were hybridized with 35S-labeled ALS antisense cRNA, as described in Materials and Methods. The hybridization signal (grain density) was quantified in constant areas of the GC or TC compartment using NIH image analysis software. Bars represent mean grain density of ALS mRNA ± SEM. Within a follicular compartment (GC or TC), bars denoted by different letters represent significantly different means. Theca cells (a and b), preantral vs. small antral follicles, P < 0.01; small antral vs. large antral follicles, P < 0.05; GCs (c and d), P < 0.05.

 
Aromatase expression has been shown to be restricted to granulosa cells of healthy antral follicles; and therefore, its mRNA distribution was used, along with morphological criteria, to differentiate between healthy and atretic follicles. Cyclin D1 mRNA expression, which was restricted to theca cells of healthy (aromatase-expressing) follicles was used as a marker for cell proliferation in the theca. Sequential in situ hybridization of probes to consecutive sections show that aromatase transcripts were colocalized with IGFBP-3 and ALS mRNAs to granulosa cells of healthy antral follicles (Figs. 1Go and 2Go). In granulosa cells of atretic antral follicles, aromatase mRNA expression was reduced or absent (Fig. 5Go, A and B), as expected, whereas IGFBP-3 transcript levels were as high as in healthy antral follicles (Figs. 5Go, C and D; and 6). IGFBP-3, ALS, and cyclin D1 mRNAs were colocalized to thecal cells of healthy follicles (Figs. 1Go and 2Go); thecal IGFBP-3 mRNA levels were higher (P < 0.01) in healthy than in atretic antral follicles (Fig. 6Go). ALS mRNA levels were greatly reduced in both granulosa (P < 0.05) and thecal cells (P < 0.001) of atretic antral follicles, compared with healthy antral follicles (Fig. 7Go).



View larger version (112K):
[in this window]
[in a new window]
 
Figure 5. In situ hybridization of IGFBP-3 and aromatase mRNAs to an atretic ovarian follicle. Consecutive frozen sections of porcine ovaries were sequentially hybridized with either 35S-labeled aromatase (A and B) or IGFBP-3 (C and D) antisense cRNA probes, as described in Materials and Methods. IGFBP-3 mRNA signal was strongly expressed in the GC, but not in the TC, compartment of atretic follicles. In contrast, aromatase transcripts were totally absent in atretic follicles. The bar represents 180 µm.

 


View larger version (20K):
[in this window]
[in a new window]
 
Figure 6. Quantitative expression of IGFBP-3 mRNAs in GCs and TCs of healthy and atretic small antral follicles. Frozen sections from porcine ovaries were hybridized with 35S-labeled IGFBP-3 antisense cRNAs, as described in Materials and Methods, and the hybridization signal was quantified in the GC and TC compartments of healthy or atretic follicles, using NIH image analysis software. Each bar represents the mean (± SEM) grain density of IGFBP-3 mRNA. Within a follicular compartment (GC or TC), bars denoted by different letters represent significantly different means. In TCs (but not in GCs), IGFBP-3 mRNA levels were lower in atretic than in healthy follicles (P < 0.01).

 


View larger version (41K):
[in this window]
[in a new window]
 
Figure 7. Quantitative expression of ALS mRNAs in GCs and TCs of healthy and atretic small antral follicles. Frozen sections from porcine ovaries were hybridized with 35S-labeled ALS cRNA probes, as described in Materials and Methods, and the hybridization signal was quantified in the GC and TC compartments of healthy or atretic follicles, using NIH image analysis software. Each bar represents the mean (± SEM) grain density of ALS mRNA. Within a follicular compartment (GC or TC), bars denoted by different letters represent significantly different means. In GCs or in TCs, ALS mRNA levels were higher in healthy than in atretic follicles (GCs, P < 0.05; TCs, P < 0.001).

 
Ovulation occurred on day 6 or 7 after PGF2{alpha} treatment; and, in three luteal-phase animals, we were able to delineate a series of time-dependent stages in the corpus luteum formation based on the luteal morphology. In the freshly ovulated follicle (day 7 post PGF2{alpha}), high levels of cyclin D1 (Fig. 8Go, A and B) and IGFBP-3 (Fig. 8CGo) mRNA expression were associated with a layer of cells concentrated along the border between the granulosa and the theca lutein compartments, an area particularly rich in endothelial cells (22). Granulosa luteins expressed moderate levels of IGFBP-3 mRNA (Fig. 8CGo) but very little cyclin D1 transcripts (Fig. 8Go A and B). Two days after ovulation (day 9 post PGF2{alpha}), those cells expressing high levels of cyclin D1 (Fig. 8EGo) or IGFBP-3 (Fig. 8FGo) mRNA were no longer restricted to the theca/granulosa lutein border but were dispersed, like endothelial cells (Fig. 8DGo), across the granulosa lutein compartment. Interestingly, in the mature corpus luteum, IGFBP-3 mRNA was abundantly expressed in endothelial cells from well-developed blood vessels and other vascular profiles (Fig. 8JGo). These studies strongly suggest endothelial cell localization of luteal IGFBP-3 mRNA. However, a definite cell-by-cell localization would provide irrefutable evidence for this hypothesis. In contrast to IGFBP-3, a moderate ALS mRNA expression was present in virtually every luteal cell type (Fig. 8HGo). An IGFBP-3 sense control probe gave a low and uniform signal (Fig. 8IGo).



View larger version (128K):
[in this window]
[in a new window]
 
Figure 8. In situ hybridization of IGFBP-3, ALS, and cyclin D1 mRNAs and immunolocalization of endothelial cells during porcine luteogenesis. Frozen sections of porcine ovaries were hybridized with 35S-labeled IGFBP-3, ALS, or cyclin D1 antisense cRNA probes, or a sense IGFBP-3 control probe, as described in Materials and Methods. Selected consecutive sections were also stained for factor VIII-related antigen, which identifies blood vessels. The ovary depicted in A–C was collected on ovulation day (day 7 post PGF2{alpha}). Note the high expression level of cyclin D1 (A, brightfield; B, darkfield) and IGFBP-3 (C) mRNA in cells concentrated along the border between the GC (GLL, large arrows) and TC (TLL, arrowheads) lutein compartments. Two days after ovulation, i.e. day 9 post PGF2 {alpha} (D–I), endothelial cells (D) and cells expressing cyclin D1 (E) and high levels of IGFBP-3 mRNA (F) were dispersed throughout the GC lutein compartment. A sense IGFBP-3 mRNA probe gave a low and uniform hybridization signal (I) on a consecutive section. In the same ovary, ALS mRNA (H) was expressed in virtually every luteal cell type (H). In an ovary from the midluteal phase (J), IGFBP-3 mRNA (dark grains) was selectively expressed in endothelial cells associated with well-organized vascular profiles (VP). The bars represent 120 µm (A–I) or 60 µm (J).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Knockout experiments in mice have led to general agreement that IGF-I is crucial for ovarian follicular development (23). These data, along with widespread evidence of amplified IGF expression in growing follicles, have led others and us to postulate a complex, highly organized IGF-based autocrine/paracrine system regulating these events. In general, these formulations have ignored or deemphasized the importance of the endocrine (circulating) components of the IGF system.

Unlike other ovarian growth factors, IGF-I circulates at high concentrations as part of a ternary complex composed of IGF, IGFBP-3, and ALS (24, 25, 26). It was generally believed that the ternary complex required processing in the vascular space and that only the binary complex (IGF-I/IGFBP-3) gained access to tissues (27). However, recent studies have shown high ALS levels in follicular fluid (10, 11); apparently most of the IGFs within that compartment exist as part of the ternary complex (11). These results have necessitated a reexamination of the source and regulation of follicular IGFs and their binding proteins.

Previous data from our laboratory (6) have shown that follicular fluid IGFBP-3 protein increases with the growth of preovulatory follicles in pigs (IGFBP-3 vs. diameter, r = 0.55; P < 0.01). However, there was a poor correlation with atresia (r = -0.181; P, not significant). In a follow-up study (28) during early follicle development in the luteal phase (these follicles are all destined for atresia), there was a weaker correlation between IGFBP-3 levels and follicular size (r = 0.397; P < 0.05) and no significant correlation with atresia (r = -0.186). In another study (29), Howard et al. found no change in IGFBP-3 during follicle growth in pooled postweaning samples of porcine follicular fluid. However, these authors described a definite decline in IGFBP-3 after hCG in an eCG/hCG ovarian stimulation protocol. The follicles sampled in these earlier studies were likely different from those in the current one. Follicular dissection techniques are directed mainly at medium-to-large antral follicles, which are easier to harvest. In both the current studies and the previous ones (6, 28), we observed no correlation of IGFBP-3 levels or expression with atresia. We did not observe a convincing increase in follicular IGFBP-3 mRNA during transition from small to large antral follicles. During this period, we (6, 28) found a doubling of IGFBP-3 peptide. The discrepancy between mRNA and peptide could result from differences in the follicles sampled; however, it might also reflect some influx of serum IGFBP-3 during terminal follicular growth.

It is not terribly surprising that the current studies with homologous probes detected IGFBP-3 mRNA when previous studies with Northern, dot-blot, and heterologous in situ assays gave negative or equivocal results. Further, it is noteworthy that granulosa cells from 3- to 5-mm porcine follicles, previously shown to express IGFBP-3 in culture (14), were found to express the mRNA in vivo. These previous culture studies showed a diminution in IGFBP-3 expression during gonadotropin or cAMP-induced luteinization in culture (13, 30). Such data seemed inconsistent with the substantial increase in IGFBP-3 expression in the corpus luteum in vivo (7, 31). However, it seems, from current studies and others (31, 32), that the expression of this protein in the corpus luteum could be mainly localized to the endothelial cells.

In summary, the current study shows that thecal, but not granulosa, cell IGFBP-3 mRNA expression is regulated during porcine follicular development and atresia. IGFBP-3 transcript levels were low in thecal cells of preantral follicles but elevated in the theca interna of antral follicles. The observation that thecal cell, but not granulosa, cell IGFBP-3 mRNA may be the regulated species is further illustrated by the decrease in this mRNA in the thecal, but not the granulosa, cell compartment during atresia. These observations are consistent with a role for IGFBP-3 in the development of the theca compartment. Although these studies do not exclude an ovarian role for circulating IGFBP-3, they demonstrate a local source, which could account for most of the available physiological data.

It has been widely accepted that the ternary complex does not exit the vascular space. As a corollary, it has been generally believed that ALS acts solely as an IGF-transport protein in the circulation. Consequently, the regulation and role of ALS in peripheral tissue have not yet been actively considered. To the best of our knowledge, this study is the first to demonstrate that granulosa, thecal, and luteal cells are a site of ALS synthesis. In humans, follicular fluid levels of ALS protein were found to be almost 50% of those in the circulation and were considerably higher than those in other biological fluids (11). In the current study, ALS mRNA expression was high and was physiologically regulated in both granulosa and thecal cells during the course of follicular development. Interestingly, in thecal cells, the regulation of ALS transcripts mimicked that of IGFBP-3, i.e. they increased between the preantral and the early antral stage. In human ovaries, the majority of IGF (-I and -II) and IGFBP-3 found in follicular fluid exists in the ternary complex (11). It is possible, indeed likely, that follicular cells synthesize and secrete ALS and IGFBP-3 into the follicular fluid to form a ternary complex with the IGFs.

The data provided here fall well short of a comprehensive understanding of the role of the IGFBPs in the ovary. However, they can generate hypotheses and speculation. The current data, like our previous studies, indicate that IGFBP-3 is abundant in healthy preovulatory follicles. In fact, levels of the peptide and thecal mRNA seem to increase with follicle growth. These observations do not jibe easily with the well-demonstrated role of IGFBP-3 as a potent inhibitor of ovarian cell function in vivo (33) and in vitro (34). In vitro studies in our laboratory have shown that IGFBP-3 can attach to ovarian granulosa cells, presumably through sulfated glycoaminoglycans, and dramatically increase the binding capacity of these cells for IGF-I (35). Such a mechanism could facilitate IGF-I effects, but neither others nor we have shown such actions to date. Available studies, including our own, have failed to take into account the new observations that much ovarian IGFBP-3 (and IGF-I) exists as a ternary complex with ALS (11). Based on the known high affinity and stability of this complex, one would postulate that these components would be sequestered, not immediately available for cellular action. However, the components are likely to have their effects significantly extended in time. Such an action could result in a stable ovarian pool of IGF-I, which could be targeted to ovarian cells by, as yet, undefined processing steps.


    Acknowledgments
 
The authors thank Dr. Teresa L. Wood for making available to us her video imaging system. The authors are also grateful to Drs. Billy Flowers and Zhaoping Ge and to Ms. Vickie Hedgpeth for animal treatment and ovary collection.


    Footnotes
 
1 Supported by NIH Grants HD-24565 and HD-32483 (to J.M.H.) and HD-24565–11S1 (to S.A.W.). Back

Received October 1, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hammond JM 1999 IGF (insulin-like growth factor). Encyclopedia of Reproduction 2:781–790
  2. Hammond JM, Mondschein JS, Samaras SE, Smith SA, Hagen DR 1991 Autocrine and paracrine actions of ovarian growth factor regulators: the ovarian insulin-like growth factor system. J Reprod Fertil Suppl 43:199–208[Medline]
  3. Hammond JM, Samaras SE, Grimes R, Leighton J, Barber J, Canning SF, Guthrie HD 1993 The role of insulin-like growth factor and epidermal growth factor-related peptides in intraovarian regulation of the pig ovary. In: Foxcroft, Hunter, Doberski (eds) Control of Pig Reproduction IV. J Reprod Fertil Suppl 48:117–125[Medline]
  4. Adashi EY, Resnick CE, Hurwitz A, Ricciarelli E, Hernandez ER, Roberts CT, LeRoith D, Rosenfeld RG 1992 The inter-ovarian IGF system. Growth Regul 2:10–15[Medline]
  5. Giudice LC 1992 Insulin-like growth factors and ovarian follicular development. Endocr Rev 13:641–669[CrossRef][Medline]
  6. Grimes RW, Guthrie DH, Hammond JM 1994 Insulin-like growth factor-binding protein-2 and -3 are correlated with atresia and preovulatory maturation in the porcine ovary. Endocrinology 135:1996–2000[Abstract]
  7. Samaras SE, Hagen DR, Shimasaki S, Ling N, Hammond, Hammond JM 1992 Expression of insulin-like growth factor binding protein-2 and -3 messenger ribonucleic acid in the porcine ovary: localization and physiological changes. Endocrinology 130:2739–2744[Abstract]
  8. Binoux M, Hossenlopp P 1988 Insulin-like growth factor (IGF) and IGF-binding proteins: comparison of human serum and lymph. J Clin Endocrinol Metab 67:509–514[Abstract]
  9. Baxter RC 1990 Circulating levels and molecular distribution of the acid-labile (alpha) subunit of the high molecular weight insulin-like growth factor-binding protein complex. J Clin Endocrinol Metab 70:11347–11353
  10. Labarta JI, Gargoski SE, Simpson DM, Lee PDK, Argente J, GuevaraAguirres, Rosenfeld RG 1997 Immunoblot studies of the acid-labile subunit (ALS) in biological fluids, normal human serum and in children with GH deficiency and GH receptor deficiency before and after long-term therapy with GH or IGF-I respectively. Clin Endocrinol (Oxf) 47:657–666[CrossRef][Medline]
  11. Cwyfan Hughes SC, Mason HD, Franks S, Holly JMP 1997 The insulin-like growth factors (IGFs) in follicular fluid are predominantly bound in the ternary complex. J Endocrinol 155:R1–R4
  12. Hammond JM, Hsu CJ, Mondschein JS, Canning SF 1988 Paracrine and autocrine functions of growth factors in the ovarian follicle. J Anim Sci [Suppl 2] 66:21–28
  13. Mondschein JS, Smith SA, Hammond JM 1990 Production of insulin-like growth factor binding proteins (IGFBPs) by porcine granulosa cells: identification of IGFBP-2 and -3 and regulation by hormones and growth factors. Endocrinology 127:2298–2306[Abstract]
  14. Grimes RW, Samaras SE, Barber JA, Shimasaki S, Ling N, Hammond JM 1992 Gonadotropin and cAMP-modulation of insulin-like growth factor-binding protein production in ovarian granulosa cells. Am J Physiol 262:E497–E503
  15. Lee CY, Kwak I, Simmen RCM, Simmen FA Molecular cloning of the porcine acid-labile subunit (ALS) of the 150-kilodalton IGF-binding protein complex. Program of the 81st Annual Meeting of The Endocrine Society, San Diego, CA, 1999, p 411 (Abstract)
  16. Zhou P, Jiang W, Weghorst CM, Weinstein IB 1996 Overexpression of cyclin D1 enhances gene amplification. Cancer Res 87:459–465
  17. Wang TC, Cardiff RD, Zukerberg L, Lees E, Arnold A, Schmidt EV 1994 Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice. Nature 369:669–674[CrossRef][Medline]
  18. Uchimaru K, Tanaguchi T, Yoshikawa M, Asano S, Arnold A, Fujita T, Motokura T 1997 Detection of cyclin D1 (bcl-1, PRAD1) overexpression by a simple competitive reverse transcription-polymerase chain reaction assay in t(11;14)(q13;q32)-bearing B-cell malignancies and/or mantle cell lymphoma. Blood 89:965–974[Abstract/Free Full Text]
  19. Shimasaki S, Shimonaka M, Ui M, Inouye S, Shibata F, Ling N 1990 Structural characterization of a follicle stimulating hormone inhibitor in porcine ovarian follicular fluid: its identification as insulin-like growth factor binding protein (IGF-BP3). J Biol Chem 265:2198–2202[Abstract/Free Full Text]
  20. Guthrie HD, Barber JA, Leighton JK, Hammond JM 1994 Steroidogenic cytochrome P450 enzyme messenger ribonucleic acids and follicular fluid steroids in individual follicles during preovulatory maturation in the pig. Biol Reprod 51:465–471[Abstract]
  21. Wandji SA, Wood TL, Crawford J, Levison SW, Hammond JM 1998 Expression of mouse ovarian insulin growth factor system components during follicular development and atresia. Endocrinology 139:5205–5214[Abstract/Free Full Text]
  22. Wandji SA, Gadsby JE, Barber JA, Hammond JM Messenger RNA for mac25 and connective tissue growth factor (CTGF) are inversely regulated during folliculogenesis and early luteogenesis. Endocrinology, in press
  23. Baker J, Hardy MP, Zhou J, Bondy C, Lupu F, Bellve AR, Efstratiadis A 1996 Effects of an igf1 gene null mutation on mouse reproduction. Mol Endocrinol 10:903–918[Abstract]
  24. Lewitt MS, Saunders H, Phuyal JL, Baxter RC 1994 Complex formation by insulin-like growth factor binding-protein-3 and human acid-labile subunit in growth hormone-deficient rats. Endocrinology 134:2404–2409[Abstract]
  25. Arany E, Zabel P, Freeman D, Hill J 1993 Elimination of radio-labelled recombinant human insulin-like growth factor binding protein-3 from the circulation, and its distribution amongst organs and tissues in adult male rats. Regul Pept 48:133–143[CrossRef][Medline]
  26. Baxter RC 1991 Insulin-like growth factor (IGF) binding proteins: the role of IGFBPs in regulating IGF availability. Acta Paediatr Scand [Suppl] 372:107–114[Medline]
  27. Lewitt MS, Saunders H, Baxter RC 1993 Bioavailability of insulin-like growth factor (IGFs) in rats determined by the molecular distribution of human IGF-binding protein-3. Endocrinology 133:1797–1802[Abstract]
  28. Guthrie HD, Grimes RW, Hammond JM 1995 Changes in insulin-like growth factor-binding protein-2 and -3 in follicular fluid during atresia of follicles grown after ovulation in pigs. J Reprod Fertil 104:225–230[Abstract]
  29. Howard HJ, Ford JJ 1992 Relationships among concentrations of steroids, inhibin, insulin-like growth actor-1 (IGF-1), and IGF-binding proteins during follicular development in weaned sows. Biol Reprod 47:193–201[Abstract]
  30. Grimes RW, Barber JA, Shimasaki S, Nicholas L, Hammond JM 1994 Porcine ovarian granulosa cells secrete insulin-like growth factor binding protein-4 and -5 and express their mRNA ribonucleic acids: regulation by follicle-stimulating hormone and insulin-like growth factor-I. Biol Reprod 50:695–701[Abstract]
  31. Gadsby JE, Lovdal JA, Samaras S, Barber JS, Hammond JM 1996 Expression of the messenger ribonucleic acids for insulin-like growth factor-I and insulin-like growth factor binding proteins in porcine corpora lutea. Biol Reprod 54:339–346[Abstract]
  32. Zhou J, Adesanya OO, Vatzias G, Hammond JM, Bondy C 1996 Selective expression of insulin-like growth factor system components during porcine ovary follicular selection. Endocrinology 137:4893–4901[Abstract]
  33. Bicsak TA, Ling N, Depaolo LV 1991 Ovarian intrabursal administration of insulin-like growth factor binding protein inhibits follicle rupture in gonadotropin-treated immature female rats. Biol Reprod 44:599–603[Abstract]
  34. Samaras SE, Hammond JM 1995 Insulin-like growth factor binding protein-3 inhibits porcine granulosa cell function in vitro. Am J Physiol 268:E1057–E1064
  35. Clarkson AM, Hammond JM Interaction of insulin-like growth factors, and their binding proteins in porcine granulosa cells. Program of the 32nd Annual Meeting of The Society of Study of Reproduction, Pullman, WA, 1999, p 171 (Abstract)



This article has been cited by other articles:


Home page
J EndocrinolHome page
J. W Kim, R. P Rhoads, N. Segoale, N. B Kristensen, D. E Bauman, and Y. R Boisclair
Isolation of the cDNA encoding the acid labile subunit (ALS) of the 150 kDa IGF-binding protein complex in cattle and ALS regulation during the transition from pregnancy to lactation.
J. Endocrinol., June 1, 2006; 189(3): 583 - 593.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. M. Ongeri, M. F. Verderame, and J. M. Hammond
Follicle-Stimulating Hormone Induction of Ovarian Insulin-Like Growth Factor-Binding Protein-3 Transcription Requires a TATA Box-Binding Protein and the Protein Kinase A and Phosphatidylinositol-3 Kinase Pathways
Mol. Endocrinol., July 1, 2005; 19(7): 1837 - 1848.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. M. Ongeri, Q. Zhu, M. F. Verderame, and J. M. Hammond
Insulin-Like Growth Factor-Binding Protein-3 in Porcine Ovarian Granulosa Cells: Gene Cloning, Promoter Mapping, and Follicle-Stimulating Hormone Regulation
Endocrinology, April 1, 2004; 145(4): 1776 - 1785.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. A. Arraztoa, P. Monget, C. Bondy, and J. Zhou
Expression Patterns of Insulin-Like Growth Factor-Binding Proteins 1, 2, 3, 5, and 6 in the Mid-Cycle Monkey Ovary
J. Clin. Endocrinol. Metab., November 1, 2002; 87(11): 5220 - 5228.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. V. Silha and L. J. Murphy
Minireview: Insights from Insulin-Like Growth Factor Binding Protein Transgenic Mice
Endocrinology, October 1, 2002; 143(10): 3711 - 3714.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. V. Silha, Y. Gui, T. Modric, A. Suwanichkul, S. K. Durham, D. R. Powell, and L. J. Murphy
Overexpression of the Acid-Labile Subunit of the IGF Ternary Complex in Transgenic Mice
Endocrinology, October 1, 2001; 142(10): 4305 - 4313.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S.-A. Wandji, J. E. Gadsby, J. A. Barber, and J. M. Hammond
Messenger Ribonucleic Acids for MAC25 and Connective Tissue Growth Factor (CTGF) Are Inversely Regulated during Folliculogenesis and Early Luteogenesis
Endocrinology, July 1, 2000; 141(7): 2648 - 2657.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wandji, S.-A.
Right arrow Articles by Hammond, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wandji, S.-A.
Right arrow Articles by Hammond, J. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals