| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Gene Mediates Rapid Messenger Ribonucleic Acid Turnover1
Department of Microbiology, National University of Ireland (M.R.K.), Galway, Ireland; and European Molecular Biology Laboratory (G.F., V.S.B., T.D., H.B., F.G.), 69012 Heidelberg, Germany
Address all correspondence and requests for reprints to: Dr. Frank Gannon, EMBL, Postfach 10.2209, Meyerhofstrasse 1, D-69012, Heidelberg, Germany. E-mail: Gannon{at}EMBL-Heidelberg.de
| Abstract |
|---|
|
|
|---|
messenger RNA (hER
mRNA) has a
relatively short half-life, which was determined to be approximately
5 h in MCF-7 cell line after actinomycin D treatment. The
3'-untranslated region (3'UTR) of hER
mRNA was previously shown
to completely down-regulate chloramphenicol acetyltransferase activity
when present at the 3'-end of chloramphenicol acetyltransferase
transcripts, suggesting a destabilizing function of the hER
3'UTR
sequence. Chimeric genes composed of a serum-inducible Fos promoter,
GH-coding sequences, and different segments of the hER
complementary
DNA 3'UTR sequence were used to confirm this hypothesis and to localize
the RNA region responsible for the destabilizing effect. The presence
of the complete hER
3'UTR reduced the half-life of the reporter mRNA
from more than 24 to 3 h. When the hER
3'UTR was subdivided
into four fragments (UTR14), one fragment, UTR2, retained the most
ability to down-regulate the reporter mRNA (t1/2 =
4 h). A stretch of four AUUUA motifs within UTR2 was shown not to
mediate mRNA destabilization. In contrast, further subdivision of the
UTR2 into three parts (UTR2ac) resulted in the loss of the
destabilizing activity. Finally, recombination of two UTR2 subfragments
(UTR2a and -b) partially restored this function, indicating a
cooperative role among the three UTR2ac subfragments in the process
that leads to destabilization of the hER
transcript. | Introduction |
|---|
|
|
|---|
(ER
) plays a key
role in many normal physiological processes, ranging from female sexual
development and reproduction to liver, fat, and bone cell metabolism
(1, 2, 3). The ER
has been shown to be also involved in the biology of
breast cancer and is used clinically as an important prognostic factor
(4). Therefore, elucidation of the molecular mechanisms that control
the expression of the ER
gene should provide crucial information
concerning not only the differential tissue and temporal ER
expressions in estrogen target cells, but also its involvement in
pathological processes. We recently extended earlier observations to
show that the human ER
gene was a complex genomic unit exhibiting
alternative splicing and promoter usage in a tissue-specific manner
(5). This demonstrated the importance of transcriptional control in the
regulation of ER
expression. Nevertheless, several other reports
indicate that ER
mRNA stability is subject to hormonal control
(6, 7, 8, 9), suggesting that the regulation of ER
expression may occur
also at a posttranscriptional level.
ER
is a member of the multigene nuclear receptor family, and an
unusual feature of this family is the conservation of a very long
3'-untranslated region (3'UTR), which is usually 2 times as long as the
coding region (10, 11). The human ER
3'UTR is 4.3 kb in length (10).
When the availability of the 3'UTR sequences of the different nuclear
receptor genes allows comparisons to be made, there seems to be higher
than expected sequence identity between species. Unfortunately, in
addition to the human ER
3'UTR, only 80 bp of rodent ER
3'UTR
(12, 13) are known, and thus there are no closely related species to
search for conserved sequences within the mammalian ER
3'UTRs.
However, when the ER 3'UTR sequences of two avian species, chicken (P.
Nestor, C. Murphy, and F. Gannon, unpublished data) and zebra finch
(14), are compared with each other, there is 75% identity over 900 bp,
and more complete comparisons between human and chicken ER 3'UTR
sequences also show some regions of extensive identity. These
observations prompted an investigation into the possible functional
role for the ER
3'UTR in posttranscriptional control of ER
expression.
Sequence analysis of the hER
3'UTR indicated that this region is
more AU rich than the coding region, as it contains long tracts of
AU-rich sequence as well as 13 copies of AUUUA (10, 11). AU-rich
elements (AREs) and AUUUA motifs have been shown in many cases to
mediate mRNA destabilization. They were first identified as having
functional roles in the very unstable mRNAs, e.g.
protooncogenes c-fos (15) and c-myc (16), the
cytokine granulocyte-macrophage colony-stimulating factor (17), and a
number of genes that encode interleukins and interferons (18, 19),
where rapid mRNA turnover is required for appropriate responses to
control signals. Therefore, the possibility that ARE could have a role
in directing hER
mRNA destabilization was suggested (11).
The destabilizing function of the hER
3'UTR sequence is demonstrated
in this report. The decay kinetics of chimeric transcripts, containing
the hER
3'UTR or shorter fragments of it, were studied in a
stably transformed cell culture in an attempt to delineate
destabilizing regions. A 1-kb subfragment of the hER
3'UTR still
retained destabilizing activity. Surprisingly, a stretch of four AUUUA
motifs within this fragment was not responsible for that
destabilization. In contrast, a cooperative role between different
regions of this 1-kb subfragment was shown to be required for a
significant destabilizing effect.
| Materials and Methods |
|---|
|
|
|---|
3'UTR [from nucleotides (nt) 23696264] was
digested from p3'hER2 (21) and subcloned first into PCR II cloning
vector (Invitrogen, Leek, The Netherlands) previously
digested with EcoRI and XhoI. A
KpnI/XhoI fragment, including the 3.895-kb ER
3'UTR sequence, was digested from that and ligated into the unique
KpnI/SacI site in the bovine GH 3'UTR of the pfGH
vector along with a 100-bp XhoI/SacI fragment
from Bluescript (Stratagene, La Jolla, CA) that acted as a
bridging fragment. PCR was performed using the p3'hER plasmid or human
genomic DNA as a template to generate four fragments spanning the
entire hER 3'UTR (UTR14). The primers were designed to introduce a
KpnI or SacI site to the 5'- and 3'-ends of the
PCR products to facilitate subcloning into the
KpnI/SacI site of the pfGH plasmid. The following
5'- and 3'-primers were used for the four constructs: 3'1k and 3'1s
(20343397) for UTR1, 3'2k and 3'2s (33844464) for UTR2, 3'3k and
3'3s (44505497) for UTR3, and 3'4k and 3'4kk (55036305) for UTR4
(the numbers in parentheses refer to the hER
sequence as
published in Ref. 10). UTR2 was further subdivided into three PCR-generated fragments (UTR2ac) using the following primer pairs: 3'2k and 2a3' (33844030) for UTR2a, 2b5' and 2b3' (40314173) for UTR2b, and 2c5' and 3'2s (41744464) for UTR2c. UTR2(AU)mut and UTR2b(AU)mut cover the same sequence as UTR2 and UTR2b, respectively, except that the four ATTTA motifs within them were mutated to ACCCA. This mutation in UTR2b(AU)mut was performed by changing the sequence in the long PCR primers used, 2d5' and 2d3', to generate the mutated PCR product. UTR2(AU)mut was amplified by PCR in 2 rounds of 30 cycles using the long primers UTR2b(AU)mut sense and antisense [sequences identical to UTR2b(AU)mut] with the primers 3'2k and 3'2s. The mutated sequences were confirmed by sequencing. Constructs containing the longer recombined PCR-generated subfragments were prepared using primer pairs 3'2k and 2b3' for UTR2(a+b) (33844173) and 2b5' and 3'2s for UTR2(b+c) (40314064). Again, a KpnI or SacI site was incorporated into all primers to enable subcloning directly into pfGH.
Templates used to prepare the double stranded probes labeled by
random priming were obtained as follows. To detect hER mRNA from MCF-7
cells, a PCR product (exons 18) was amplified from hER
complementary DNA. For the control probe 36B4, a 220-bp PstI
fragment from a pBR322 plasmid containing the sequence for the
constitutively expressed gene 36B4 (provided by P. Chambon, Institut de
Génétique et de Biologie Moléculaire et
Cellulaire, Centre National de la Recherche
Scientifique/Institut National de la Santé et de la Recherche
Médicale/Université Louis Pasteur, Illkirch, France)
(22) was subcloned into Bluescript. PCR products were amplified with
flanking vector primers and then used as a template for labeling. For
the GH probe, a fragment from the GH-coding region of pfGH (6811060)
was amplified from that plasmid using the primers 5'GHcod and
3'GHcod.
Primers
The following primers were used: 3'1k,
GGTACCCCCACACGGTTCAGATAATC; 3'1s, GAGCTCGGACCAGTCTAATGCATACG; 3'2k,
GGTACCCAGATTACGTATGCCCC; 3'2s, GAGCTCGTATTACATCGTCTAGTC; 3'3k,
GGTACCGACGATGTAATACCAG; 3'3s, GAGCTCTGCCTTTCACATAACTA; 3'4k,
GGTACCGTTCATACAGTAGCTCAA; 3'4kk, GGTACCGAACATCAAATAGGTTGA; 2a3',
GTAGCACGAGCTCCAGAATTACTACATTCAATTG; 2b5',
TGATCGGGGTACCGGATTTAATTTGACTGGGTT; 2b3',
GTAGCACGAGCTCATTTAAATGAATAATCACC; 2c5',
TGATCGGGGTACCGAAGATCACATTTCATATCAAC; 2d5', TGATCGGGGTACCGGACCCAATTTGACTGGGTTAACATGCAAAAACCAAGGAAAAATACCCAGTTTTTT;
2d3', GTAGCACGAGCTCATTTGGGTGAATAATCACCAGGCTTTAGGCATGGGTGACTGTA;
5'GHcod, TGGCTTTTGGCCTGCTCT; and 3'GHcod, CATAGACGTTGCTGTCAG.
Cell culture and transfections
MCF-7 cell lines were maintained in DMEM with
L-glutamine (BioWhittaker, Inc., Verviers,
Belgium) supplemented with 10% FCS (BioWhittaker, Inc.),
penicillin (50 IU/ml), and streptomycin (50 µg/ml; Life Technologies, Inc., Paisley, Scotland) at 37 C under 5%
CO2. To analyze the endogenous hER
mRNA decay
rate in MCF-7 cells, actinomycin D (Sigma, Poole, UK) was
added to the medium at a final concentration of 0.5 µg/ml, and cells
were harvested for RNA isolation at various points from 024 h after
actinomycin D treatment.
HeLa cells were maintained under the same conditions as described above. Stably transfected cell lines were prepared by transfecting 10 µg pfGH construct plasmids according to the calcium phosphate method (23). Forty-eight hours later cells were grown in 600 µg/ml G418 sulfate (Geneticin, Life Technologies, Inc.) to select for the neo marker that was included on the pfGH plasmid. Resistant colonies were pooled, and cell lines were maintained in 300 µg/ml G418 sulfate thereafter.
For the time-course experiments, cells grown to 50% confluence in 10% FCS in DMEM were washed twice with PBS and then cultivated for 48 h in 0.5% FCS-DMEM as a serum deprivation step. Then cells were stimulated by adding 20% FCS-DMEM to induce the c-fos promoter. Harvesting for RNA isolation was carried out at 0, 2, 4, 6, 9, 12, and 24 h after serum stimulation.
RNA preparation and analysis
Total RNA was isolated from harvested cells using the LiCl-urea
method (24). Thirty-microgram aliquots of RNA were electrophoresed
through 1.2% agarose gels in the presence of formaldehyde and
transferred overnight to Hybond N membranes (Amersham International, Aylesbury, UK). After fixing the membranes by UV
cross-linking, they were prehybridized at 42 C for 36 h in 50%
formamide, 5 x SSC (standard saline citrate), 5 x
Denhardts solution, 0.5% SDS, and 100 µg/ml denatured salmon
testis DNA. Hybridization was carried out at 42 C overnight in the same
solution but also including 50 µg/ml salmon testis DNA and a final
concentration of 1 x 106 cpm/ml
32P-labeled probe. Double stranded probes
(GH-coding region) were labeled using the random prime labeling kit,
High Prime (Roche Molecular Biochemicals, Mannheim,
Germany). After hybridization, blots were washed twice in 2 x
SSC-0.1% SDS at room temperature for 10 min and then twice in 0.2
x SSC-0.1% SDS at 55 C for 45 min. Membranes were exposed to x-ray
film (Eastman Kodak Co., Rochester, NY) at -70 C. To
rehybridize with the 36B4 control probe the first probes were stripped
from the membrane by immersing in freshly boiled 0.5% SDS solution and
were allowed to cool to room temperature before hybridizing again, as
described above.
Autoradiographs were scanned using a ScanMaker III (Microtek Electroniks GmBH, Dusseldorf, Germany) and ScanWizard (Polaroid, Cambridge, MA) and Adobe PhotoShop (Macintosh, San José, CA) software. Signals were quantified using the NIH Image 1.54 program. All signals were also quantified using the Vilber Lourmat detection system and Bioprint/Bio1d V.96 software (Vilber Lourmat, Torcy, France) to verify the densitometry results. Densitometric values for GH signals were normalized using the values obtained for the internal reference, 36B4.
| Results |
|---|
|
|
|---|
mRNA half-life in MCF-7 cells after
actinomycin D treatment is 5 h
mRNA at a
relatively high level and is the most widely used in ER
expression
studies. This cell line was chosen to study the endogenous ER
mRNA
decay rate. Cells were grown in DMEM with normal FCS, as were all cell
lines when analyzing decay rates of any transcript described in this
paper. MCF-7 cells were harvested at various time points after addition
of the transcription inhibitor actinomycin D at 0.5 µg/ml to the
medium. Northern blot analysis of the cellular RNA, performed using a
probe spanning the coding region of ER
mRNA, is shown in Fig. 1A
mRNA signal was normalized by measuring the 18S ribosomal mRNA band
after methylene blue staining. The half-life of ER
mRNA was deduced
to be approximately 5 h in the presence of actinomycin D (Fig. 1B
|
3'UTR reduces the half-life of an otherwise stable reporter
mRNA
3'UTR (the 3.9-kb
EcoRI/XhoI fragment) is cloned downstream of the
chloramphenicol acetyltransferase (CAT)-coding region of the KSSV2
expression vector as part of the mRNA transcript, it caused a reduction
to basal levels of CAT activity (11). The down-regulating activity was
specific to the hER
3'UTR, as the insertion of the ER
-coding
region or other fragments used as fragment size controls did not have
such an effect (11). This reduction might result from an effect of the
ER
mRNA 3'UTR on either the stability of CAT mRNA or the
translation, as in the case of interferon-ß, where the 3'UTR inhibits
translation (25, 26).
To determine whether the 3'UTR of the hER
mRNA mediates rapid mRNA
turnover, the decay rate of a reporter transcript containing hER
3'UTR was measured directly in stably transfected cells using an
accurate method involving a serum-inducible expression system (20, 27, 28). This method takes advantage of the transient nature of induction
of the c-fos promoter upon serum stimulation (29) and avoids
the use of artificial transcription inhibitors that can modify mRNA
half-lives (18, 28). In the following experiments, the c-fos
promoter controlled the expression of a GH chimeric gene (fGH) (20)
that contained unique restriction sites in its 3'UTR region allowing
the insertion of various hER
3'UTR sequences (Fig. 2
). The fGH mRNA, which contains no
insert, was previously shown to have a half-life of more than 24 h
(20). The vectors expressing fGH chimeric genes (pfGH) with or without
hER
3'UTR sequences were then stably transfected into HeLa cells.
The half-lives of the chimeric fGH mRNAs were measured by densitometric
scanning of hybridizing bands in Northern blotting experiments at
various time points after serum stimulation. The probe used for this
analysis was specific for the GH-coding region.
|
3'UTR. In Fig. 3C
3'UTR was 34 h (Fig. 3C
3'UTR.
Hybridization analysis with probes spanning the 3'UTR of the hER
mRNA (UTR14 probes, see below) indicated that sequences beyond
approximately the first 2 kb of the 3'UTR were not present in the
shorter transcript (Fig. 3B
3'UTR sequences. These data confirmed the presence of a
mRNA-destabilizing element in the 3'UTR of hER
mRNA.
|
3'UTR (UTR2) retains significant
ability to destabilize the fGH transcript
3'UTR responsible
for this destabilizing activity, further fGH chimeric gene constructs
were made. Thus, the entire hER
3'UTR was subdivided into four
PCR-generated fragments of approximately equivalent sizes: UTR1 (1.4
kb), UTR2 (1 kb), UTR3 (1 kb), and UTR4 (0.8 kb; Fig. 2A
3'UTR begins at +2034, and because the EcoRI/XhoI
3.8-kb fragment, which was used in the fGH+hER
3'UTR construct,
started at +2369, the first 335 nucleotides of the 3'UTR that were not
yet tested were included in UTR1. The time course for measuring decay
rates of the new chimeric fGH mRNAs was carried out as described above.
The approximate half-lives were as follows: 1) fGH+UTR1, 20 h; 2)
fGH+UTR2, 45 h; 3) fGH+UTR3, 18 h; and 4) fGH+UTR4, 13 h
(Fig. 4
3'UTR, a second
shorter fGH transcript was also detected in the cells stably
transfected with the chimeric gene fGH+UTR2 (Fig. 4A
3'UTR (data not
shown).
|
3 h) was comparable to
that of fGH+UTR2. Furthermore, neither the fGH transcript containing
the four AUUUA motifs of UTR2, the UTR2b fragment (fGH+UTR2b
t1/2 >20 h), nor the same fragment in which the
AUUUA motifs were mutated [fGH+UTR2b(AU)mut t1/2
>20 h] caused any destabilization. These data suggested that a
process other than AUUUA-mediated mRNA destabilization was responsible
for the rapid mRNA turnover conferred by UTR2 sequences.
|
|
UTR2-destabilizing effect. Therefore, new
chimeric genes were constructed by recombining two of the three UTR2
subfragments (UTR2ac), fGH+UTR2(a+b) and fGH+UTR2(b+c) (Fig. 2A
mRNA. | Discussion |
|---|
|
|
|---|
is an
inducible transcription factor whose level has been shown to be
controlled in a tissue- and development-specific manner (1, 5).
Generally, estrogen target genes have different sensitivities to the
loaded ER, and their transcriptional response is often rate limited by
the receptor concentration in the cell (34, 35). Therefore, it is vital
that the ER
level is rigidly controlled to ensure appropriate target
gene expression. A relatively high mRNA turnover rate could be one
mechanism, in conjunction with transcription controls, for maintaining
the ER
at suitable levels.
Using the transcriptional inhibitor actinomycin D, and in agreement
with a previous study (7), we showed that the endogenous hER
mRNA in
MCF-7 cells could be considered unstable, with a half-life of
approximately 5 h. Actinomycin D is known to cause widespread
transcription inhibition in the cell and to have a severe impact on
cellular physiology, which has been shown in a number of situations to
prolong the life of unstable mRNAs (18, 28, 36). This may imply that
hER
mRNA is subject to even higher turnover in vivo.
A role for 3'UTR in hER
mRNA turnover was previously suggested by
preliminary results showing that the hER
3'UTR specifically
down-regulated the protein levels of a CAT reporter when present at the
3'-end of the transcript (11). This effect was observed in ER-positive
cell lines (ZR-751) as well as ER-negative cell lines (HeLa),
suggesting a ubiquitous underlying mechanism (11). To locate the
region(s) of the hER
3'UTR that was functionally involved in the
destabilizing effect, the decay kinetics of a new set of chimeric
transcripts (fGHs), controlled by the c-fos promoter and
containing insertions of hER
3'UTR and subfragments, were measured.
The transiently inducible c-fos promoter allowed measurement
of the rate of decay of newly synthesized transcripts after serum
stimulation without the addition of inhibitors. The presence of the
3.8-kb fragment of hER
3'UTR caused a reduction of the fGH reporter
transcript half-life from more than 24 to 34 h. It should be noted
that this half-life is shorter than the hER
half-life in MCF-7 cells
treated with actinomycin D (t1/2 = 5 h), a
discrepancy that could be either cell type related or a result of
actinomycin D prolonging the half-life (18, 28). When four hER
3'UTR
subfragments (UTR14) with an approximate size of 1 kb were analyzed,
only UTR2 displayed significant destabilizing ability, with the
half-life reduced to 45 h. As all fragments were of similar length,
the possibility that the effect was merely size related is
excluded.
The hER
3'UTR has many AU-rich regions, and notably the UTR2
subfragment contains four AUUUA motifs and a 17-nucleotide uridylate
stretch in close proximity (within 120 nucleotides) in addition to a
21-nucleotide adenylate stretch upstream. AREs serve as specific
destabilizing sequences in the short-lived cytokine, protooncogene, and
interferon mRNAs (19). Mutation of the AUUUA motif can disrupt
these degradation pathways (33), presumably by interfering with the
binding to the motif by specific proteins (29, 37). AREs have been
classified into AUUUA-bearing AREs (class I and II) and those that do
not contain AUUUA, but are U rich (class III). Classes I and II are
further distinguished by the former having a few scattered AUUUA motifs
coupled with a nearby U-rich stretch, whereas the class II AREs contain
multiple reiterations of AUUU that can give rise to overlapping
nonamers of UUAUUUAUU (36, 38). This nonamer has been proposed to be
the essential minimal element in destabilization (20, 39), whereas
others have proposed that the AUUUA motif is the minimal essential
element (38). hER
3'UTR does not contain the nonamer, but the
AU-rich region in UTR2 is more similar to class I AREs, which are also
present in other transcription factors, c-fos and
c-myc. Transcripts containing class I and class II AREs are
distinguished by the mechanism of degradation during polyadenylase
[poly(A)] tail removal; class II AREs direct asynchronous and
processive poly(A) tail digestion, and class I AREs direct synchronous
and distributive deadenylation (36, 38).
The importance of the four AUUUA motifs of the hER
UTR2
fragment in the destabilizing process was tested by mutating them to
ACCCA motifs [UTR2(AU)mut]. However, no obvious difference in
fGH+UTR2 mRNA decay was observed regardless of whether the motifs were
mutated. This result indicates that the presence of these four AUUUA
motifs was not the main source of destabilization. This finding is not
unprecedented, because others have found that AUUUAs were dispensable
for rapid degradation of the mouse c-myc RNA (40, 41). In
fact, a study showed that an AUUUA mutation in c-myc does
not affect mRNA stability, but, rather, influences the subcellular
localization of the transcript (42). In addition, non-AUUUA, but
U-rich, elements can confer degradation, as exemplified by class III
AREs.
The destabilizing activity of UTR2 was disrupted by subdividing it further into three smaller fragments, UTR2ac. In view of this result, it was speculated that a sequence element had been inadvertently disrupted by fragmentation of UTR2. Further investigation showed that recombining UTR2a and -b fragments (UTR2a+b) partially restored the destabilizing effect, whereas recombining UTR2b and -c was ineffective. That implies that sequences from both UTR2a and -b are required for the destabilizing effect. Nevertheless, the fact that the UTR2a+b subfragment did not destabilize as strongly as UTR2 suggests the presence of other element(s) elsewhere in the UTR2, which is required for optimal degradation. Several mRNAs subject to rapid turnover contain more than one sequence element required for destabilization (30, 31), with different domains in the transcript being responsible for separate steps in the degradation pathways (32, 33).
Another mechanism to direct destabilization is through particular
secondary structures adopted by the RNA. An example of this is the 3'
stem-loop structure of histone mRNA that serves as a signal for
degradation (43). Also, the insulin-like growth factor II gene contains
a 4-kb long 3'UTR where two domains that are critical for mRNA
degradation are separated by 2 kb, but are capable of interacting via
secondary structure. The stem structure and the primary sequence of
this complex element are responsible for directing a site-specific
endonucleolytic cleavage, which leads to rapid degradation of the
insulin-like growth factor II mRNA (44). Such processes could be also
involved in the hER
3'UTR-destabilizing effect. Indeed, preliminary
S1 nuclease and primer extension experiments on in vivo or
in vitro transcribed mRNA containing hER
UTR2 sequences
suggested the existence of a relatively stable secondary structure(s)
within the UTR2 region (data not shown). The loss of such a secondary
structure(s) when UTR2 was fragmented could therefore account for the
disappearance of destabilizing ability. Further investigations are
obviously required to test this hypothesis.
Finally, it should be noted that a second shorter transcript was
also detected by the GH probe in the HeLa cells expressing both the
chimeric genes fGH+hER 3'UTR and fGH+UTR2, but not fGH+UTR1, -3, or -4
or UTR2 subfragments (a, b, c, a+b, and b+c). Two mechanisms may
explain this result. A potential internal poly(A) signal located in the
hER
UTR2 at position +4442 may be functional in addition to that of
the fGH 3'UTR that is normally used by the fGH chimeric genes. However,
in this case, a second shorter transcript should have been observed for
the chimeric genes fGH+UTR2c and fGH+UTR2(b+c). The alternative
explanation is that an endonucleolytic cleavage occurs in the UTR2
region, thereby accounting for the shorter transcript detected by
Northern blot. Indeed, the second shorter transcript is only detected
with fGH mRNAs presenting a short half-life (fGH+hER 3'UTR and
fGH+UTR2), which may suggest a correlation between the presence of this
second transcript and the mechanism that directs mRNA destabilization
conferred by UTR2 sequences. The fact that fGH+UTR2(a+b) retains a
partial destabilizing activity, whereas no second shorter transcript is
detected may also indicate that the hER
3'UTR degradation pathway
requires separate steps with more than one sequence element involved in
the process. As the origin of the second transcripts could be linked to
the degradation pathway of hER
transcript, future studies are
obviously needed to further characterize the origin of the shorter
transcripts and, in turn, the mechanism leading to hER
mRNA
instability and to identify the factors involved in this process.
In summary, this present study refines the characterization of the role
of the 3'UTR of hER
mRNA. It shows the existence of another level in
the control of expression of the ligand-activated transcription factor
hER in addition to transcriptional regulation. Given the general
similarities in the structure and function of members of the steroid
hormone receptor gene family, it is predicted that elements that
influence the stability of mRNAs of other steroid hormone receptors
should also be found in their 3'UTR.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received May 4, 2000.
| References |
|---|
|
|
|---|
strogen receptor.
Baillieres Clin Endocrinol Metab 8:433449[CrossRef][Medline]
gene are generated by alternative splicing and
promoter usage. Mol Endocrinol 12:19391954This article has been cited by other articles:
![]() |
D. P. Pandey and D. Picard miR-22 Inhibits Estrogen Signaling by Directly Targeting the Estrogen Receptor {alpha} mRNA Mol. Cell. Biol., July 1, 2009; 29(13): 3783 - 3790. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. H. Ing, D. A. Massuto, and L. A. Jaeger Estradiol Up-regulates AUF1p45 Binding to Stabilizing Regions within the 3'-Untranslated Region of Estrogen Receptor {alpha} mRNA J. Biol. Chem., January 18, 2008; 283(3): 1764 - 1772. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Adams, H. Furneaux, and B. A. White The Micro-Ribonucleic Acid (miRNA) miR-206 Targets the Human Estrogen Receptor-{alpha} (ER{alpha}) and Represses ER{alpha} Messenger RNA and Protein Expression in Breast Cancer Cell Lines Mol. Endocrinol., May 1, 2007; 21(5): 1132 - 1147. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Keen, Q. Zhou, B. H. Park, C. Pettit, K. M. Mack, B. Blair, K. Brenner, and N. E. Davidson Protein Phosphatase 2A Regulates Estrogen Receptor {alpha} (ER) Expression through Modulation of ER mRNA Stability J. Biol. Chem., August 19, 2005; 280(33): 29519 - 29524. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. H. Ing Steroid Hormones Regulate Gene Expression Posttranscriptionally by Altering the Stabilities of Messenger RNAs Biol Reprod, June 1, 2005; 72(6): 1290 - 1296. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lu, A. Pierron, and K. Ravid An Adenosine Analogue, IB-MECA, Down-Regulates Estrogen Receptor {alpha} and Suppresses Human Breast Cancer Cell Proliferation Cancer Res., October 1, 2003; 63(19): 6413 - 6423. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Mitchell and N. H. Ing Estradiol Stabilizes Estrogen Receptor Messenger Ribonucleic Acid in Sheep Endometrium via Discrete Sequence Elements in Its 3'-Untranslated Region Mol. Endocrinol., April 1, 2003; 17(4): 562 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Baran, P. A. Kelly, and N. Binart Characterization of a Prolactin-Regulated Gene in Reproductive Tissues Usingthe Prolactin Receptor Knockout Mouse Model Biol Reprod, April 1, 2002; 66(4): 1210 - 1218. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zierold, J. A. Mings, and H. F. DeLuca Parathyroid hormone regulates 25-hydroxyvitamin D3-24-hydroxylase mRNA by altering its stability PNAS, October 31, 2001; (2001) 241516798. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Guo, L. Savage, K. D. Sarge, and O.-K. Park-Sarge Gonadotropins Decrease Estrogen Receptor-{beta} Messenger Ribonucleic Acid Stability in Rat Granulosa Cells Endocrinology, June 1, 2001; 142(6): 2230 - 2237. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Bakheet, M. Frevel, B. R. G. Williams, W. Greer, and K. S. A. Khabar ARED: human AU-rich element-containing mRNA database reveals an unexpectedly diverse functional repertoire of encoded proteins Nucleic Acids Res., January 1, 2001; 29(1): 246 - 254. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zierold, J. A. Mings, and H. F. DeLuca Parathyroid hormone regulates 25-hydroxyvitamin D3-24-hydroxylase mRNA by altering its stability PNAS, November 20, 2001; 98(24): 13572 - 13576. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |