help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morishita, M.
Right arrow Articles by Saito, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morishita, M.
Right arrow Articles by Saito, H.
Endocrinology Vol. 141, No. 9 3313-3318
Copyright © 2000 by The Endocrine Society


ARTICLES

Antidiabetic Sulfonylurea Enhances Secretagogue-Induced Adrenocorticotropin Secretion and Proopiomelanocortin Gene Expression in Vitro

Minako Morishita, Yasumasa Iwasaki, Etsuko Yamamori, Atsushi Nomura, Noriko Mutsuga, Masanori Yoshida, Masato Asai, Yutaka Oiso and Hidehiko Saito

First Department of Internal Medicine (M.M., E.Y., A.N., N.M., M.Y., M.A., Y.O., H.S), Department of Clinical Laboratory Medicine (Y.I.), Nagoya University School of Medicine, Nagoya 466-8550, Japan

Address all correspondence and requests for reprints to: Yasumasa Iwasaki, M.D., Ph.D., Department of Clinical Laboratory Medicine, Nagoya University School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550, Japan. E-mail: iwasakiy{at}med.nagoya-u.ac.jp


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The presence of high-affinity binding sites for antidiabetic sulfonylureas (SUs) and the expression of SU receptor (SUR) messenger RNA in the adenohypophyseal cells have recently been reported. In this study, we examined the effects of SU on POMC gene expression and ACTH secretion using the AtT20PL cell line, a subclone of AtT20 in which the rat POMC 5'-promoter-luciferase fusion gene was stably incorporated. A representative SU glibenclamide inhibited the basal POMC 5'-promoter activity. In contrast, glibenclamide enhanced forskolin- or CRH-induced POMC expression in a dose-dependent manner. Interestingly, the latter effect was not observed under treatment with 3-isobutyl-1-methylxanthine, a nonselective phosphodiesterase inhibitor. Furthermore, diazoxide, an opener of the ATP-sensitive K+ channel, only antagonized the suppressive effect of glibenclamide. Lastly, RT-PCR analysis showed that mouse SUR (but not SUR2) messenger RNA was expressed in this cell line. These results suggest that, in AtT20PL cells, SU has dual effects, i.e. a suppressive effect on basal POMC expression through diazoxide-sensitive (ATP-sensitive) K+-channel-mediated mechanism, and an enhancing effect on cAMP/protein kinase A-stimulated POMC expression through a different mechanism (probably mediated by phosphodiesterase). To our knowledge, this is the first report showing the effect of SU on the expression of the anterior pituitary hormone gene.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE SULFONYLUREAS (SUs) are well-known insulin secretagogues widely used as oral hypoglycemic agents in the treatment of type 2 diabetes mellitus (1). Recent studies have revealed that SU closes ATP-sensitive K+ channels (KATP channels) through SU receptors (SURs) present in the pancreatic islet and provokes ß-cell depolarization, leading to the activation of the voltage-dependent calcium channel, of Ca2+ entry, and of insulin secretion (2). More recently, the structures of SURs and potassium inward rectifiers (KIRs) have been disclosed through cloning of their genes (3, 4), and the precise molecular mechanisms of their functions are now under intensive investigation.

The extrapancreatic effects of SU have also long been recognized (5). In fact, studies using molecular biological techniques show that SURs are expressed in a wide variety of tissues, including other endocrine organs (6). Regarding the anterior pituitary, in 1993, Bernardi et al. (7) reported that the adenohypophyseal cells contain high-affinity binding sites for SU, raising the possibility that the agent may have some effect on pituitary hormone secretion. More recently, Zhu et al. (8, 9) showed that SUR messenger RNA (mRNA) is present in human pituitary adenoma, suggesting that SUR is actually expressed in adenohypophyseal cells. However, there is no report, so far, regarding the effects of SU on the synthesis, especially in regard to gene expression, of the anterior pituitary hormones.

We have been studying the regulation of ACTH secretion and POMC gene expression using the AtT20PL cell line, a clone of AtT20 in which the rat POMC gene 5'-promoter-luciferase fusion gene was stably incorporated (10, 11). In this report, we examined whether glibenclamide, a representative antidiabetic SU, influences the synthesis and secretion of ACTH, using the above-mentioned in vitro system. Our results showed that SUR is actually expressed in AtT20PL cells and that glibenclamide has a direct effect on POMC gene expression as well as on ACTH release.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Rat CRH was obtained from the Peptide Institute (Osaka, Japan) and glibenclamide from Research Biochemicals International (Natick, MA). 3-isobutyl-1-methylxanthine (IBMX) and diazoxide were obtained from Sigma (St. Louis, MO).

Plasmid construction and stable transfection
Construction of the plasmid containing the POMC-luciferase-fusion gene and establishment of a clonal cell line were described in detail elsewhere (10). Briefly, approximately 7 kb of the rat POMC gene 5'-promoter (-708 to +64; +1 indicates the transcription start site) was isolated from a rat POMC gene and was inserted into the pA3Luc plasmid. AtT20 cells were transfected stably with the plasmid using the polybrene method, and a representative clonal cell line, designated as AtT20PL (POMC-Luciferase), was used for subsequent experiments.

Cell culture
The AtT20PL cells were maintained in a T75 culture flask with DMEM (Life Technologies, Inc., Grand Island, NY) supplemented with 10% FBS (Life Technologies) and antibiotics (50 U/ml penicillin and 50 U/ml streptomycin; Life Technologies), under 5% CO2-95% air atmosphere, at 37 C. Culture medium was changed twice a week, and the cells were subcultured once a week.

Experiments
For all the experiments, AtT20PL cells were plated in 3.5-cm diameter culture dishes with approximately 60% confluency and were cultured with low-serum medium (DMEM supplemented with 1% FBS) for 4 days, as described (10). On the day of the experiment, a 0.1% vol of the solutions for each test reagent, in 1000x concentration, or solvent alone was added directly into the culture medium of each dish, and the cells were incubated for the defined time interval. CRH was dissolved in sterile 0.1% acetic acid solution, whereas glibenclamide was in DMSO. At the end of incubation, the culture medium were removed, and the cells were harvested for the luciferase assay. In experiments in which ACTH secretion was studied, culture medium was changed to the serum-free medium immediately before the addition of the test reagent(s). After the cells were incubated for the defined time interval, culture medium was collected for ACTH assay.

RT-PCR procedure
RNA was isolated from the AtT20PL cells using TRIzol reagent (Life Technologies), and 1 µg of the total RNA was used for the RT reaction with avian myeloblastosis virus reverse transcriptase (Takara Shuzo, Ohtsu, Japan). The complementary DNA obtained was then amplified by PCR with Taq DNA polymerase (Takara Shuzo). The sequences of primer sets for amplifying mouse SUR were as follows: sense, CATCCTACAGGACCCTGTCC; antisense, CCTTCTGGCTCAGAAGCTTC. The sequences of primer sets for amplifying mouse SUR2 were the same as previously reported (12, 13).

Measurements
Luciferase assay was performed as described (10). ACTH in culture medium was measured by radioimmunometric assay (ACTH IRMA-kit, Mitsubishi Chemical, Tokyo, Japan).

Data analyses
Samples in each group of the experiments were in triplicate or quadruplicate. All data were expressed as mean ± SE. When statistical analyses were performed, data were compared by one-way ANOVA with Duncan’s multiple range test, and P values below 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RT-PCR analysis of the SURs in AtT20PL cells
To see whether the SURs are expressed in AtT20 cells, we carried out RT-PCR analysis using sets of specific primers for both mouse SUR and SUR2. As shown in Fig. 1Go, a band (440 bp) corresponding to the mouse SUR, but not SUR2, was amplified. No band was amplified from a sample in which reverse transcriptase was not added (data not shown). Restriction enzyme analysis showed that the DNA fragment was appropriately digested as expected (data not shown). This indicates that SUR (but not SUR2) mRNA is expressed in AtT20PL cells.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 1. Expression of the SUR subtypes, analyzed by RT-PCR, in AtT20PL cells. This figure shows photographs of the ethidium bromide-stained products using agarose gel electrophoresis. Complementary DNA, produced from an RT reaction using total RNA from AtT20PL cells, was amplified using PCR with pairs of oligonucleotide primers specific for mouse SUR or SUR2 (12 13 ). A DNA fragment with the predicted length (440 bp) corresponding to SUR was amplified. *, SUR2 amplified with a primer set reported by Isomoto S et al. (12 ); #, SUR2 amplified with a primer set reported by Chutkow, W. A., et al. (13 ).

 
The effect of glibenclamide on basal POMC 5'-promoter activity
We examined the effect of SU on basal POMC gene expression. As shown in Fig. 2Go, glibenclamide significantly suppressed POMC 5'-promoter activity in a time- and dose-related manner. Time-course study showed that the significant effect began as early as 3 h, and the maximal effect was observed at 18 h (Fig. 2AGo). The dose-response study showed that the significant suppressive effects were observed at and above 5 µM glibenclamide. These results suggest that SU indeed has a direct effect on corticotroph cells and that the effect on basal POMC gene expression is suppressive.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 2. The time-course (A) and dose-response (B) effects of glibenclamide on the POMC 5'-promoter activity in AtT20PL cells. A, Cells were treated with glibenclamide (50 µM) for 0–24 h; B, cells were treated with glibenclamide (0.1–100 µM) for 6 h; *, P < 0.05 vs. basal value. Luc, Luciferase.

 
The effects of glibenclamide on forskolin- or CRH-stimulated POMC gene expression
We then examined the effect of SU on secretagogue-stimulated POMC gene expression. Forskolin and CRH alone stimulated the POMC 5'-promoter activity by 106 and 78%, respectively. As shown in Fig. 3AGo, addition of glibenclamide enhanced the forskolin-induced promoter activity in a dose-dependent manner, in contrast with the suppressive effect on basal activity (see Fig. 2Go). The significant effect began at 5 µM glibenclamide, and the maximal effect was observed at 50 µM, with enhancement of the forskolin-induced increment by 70%. A similar effect of glibenclamide was observed on CRH-stimulated POMC expression (Fig. 3BGo). These results show that SU rather potentiates POMC gene expression induced by forskolin/CRH-stimulated cAMP/protein kinase A-signaling pathway.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 3. The dose-response effects of glibenclamide on forskolin (F)- or CRH-stimulated POMC 5'-promoter activity in AtT20PL cells. A, Cells were treated with F alone (10 µM) or F plus various doses of glibenclamide (0.1–50 µM) for 6 h; B, cells were treated with CRH (100 nM) alone for 3 h, or CRH (100 nM, 3 h) plus various doses of glibenclamide (0.1–50 µM, 6 h). Data were analyzed by subtracting the basal value from the stimulated values. Dark areas indicate the increments by glibenclamide. *, P < 0.05 vs. F or CRH alone.

 
The dose-response effect of glibenclamide on forskolin-induced ACTH secretion
We also examined the effect of SU on ACTH secretion. Forskolin alone stimulated ACTH secretion by 131%. As shown in Fig. 4Go, glibenclamide enhanced the forskolin- induced ACTH secretion in a dose-dependent manner; the significant effect began at 10 µM, and the maximal effect was observed at 50 µM, with enhancement of the forskolin- induced increment by 70%. The same concentration of glibenclamide stimulated basal ACTH secretion as well, although the effect was relatively mild (13% increase). These results suggest that SU has a stimulatory effect on ACTH secretion, as it does on secretagogue-induced POMC gene expression.



View larger version (67K):
[in this window]
[in a new window]
 
Figure 4. The dose-response effects of glibenclamide on F-induced ACTH secretion in AtT20PL cells. Cells were washed once, and then treated with F alone or F plus various doses of glibenclamide (5–50 µM) for 6 h. ACTH, secreted into culture medium for 6 h, was measured by radioimmunometric assay. Data were analyzed by subtracting the basal value from the stimulated values. *, P < 0.05 vs. F.

 
The effects of glibenclamide on 8Br-cAMP-stimulated POMC gene expression, or on forskolin-stimulated POMC expression under IBMX treatment
To further clarify the mechanism of the enhancing action of SU, we examined the effect of the drug on 8Br-cAMP-stimulated POMC gene expression. Forskolin (alone or under IBMX treatment) and 8Br-cAMP stimulated the POMC 5'-promoter activity by 112, 460, and 407%, respectively. As shown in Fig. 5Go, glibenclamide (50 µM) again potentiated the forskolin-induced POMC 5'-promoter activity (left). In contrast, the same concentration of glibenclamide showed a rather inhibitory effect on 8Br-cAMP-induced activity (middle). We also examined the effect of SU on forskolin-stimulated POMC expression under treatment with IBMX (200 µM), a nonselective phosphodiesterase inhibitor, to clarify the possible involvement of the enzyme. Unexpectedly, the enhancement of glibenclamide on forskolin-stimulated POMC expression was completely abolished, and instead, a suppressive effect, like the effect on basal activity, was dominant under IBMX treatment (right). IBMX did not influence the suppressive effect of SU on basal POMC promoter activity (data not shown). These observations raise the possibility that the potentiating effect of SU on POMC gene expression occurs at the level of cAMP regulation, probably through the change in phosphodiesterase activity.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. The effects of glibenclamide on F/8Br-cAMP-induced POMC 5'- promoter activity, or on the F-induced one under IBMX treatment, in AtT20PL cells. Left, Cells were treated with F alone (10 µM), or F plus glibenclamide (50 µM) for 6 h; middle, cells were treated with 8Br-cAMP (5 mM) alone for 3 h, or 8Br-cAMP (5 mM, 3 h) plus glibenclamide (50 µM, 6 h); right, the same experiment as left was carried out under treatment with IBMX (200 µM). IBMX was applied 30 min before the addition of F/glibenclamide; G, glibenclamide; 8Br, 8Br-cAMP; *, P < 0.05 vs. F or 8Br alone.

 
The impact of diazoxide pretreatment on the effect of glibenclamide on basal or forskolin-stimulated POMC gene expression
To ascertain whether the above effects of SU on POMC gene expression occur through the KATP channel, we examined the combined effects of SU and diazoxide, an opener of the channel. Forskolin (alone or under diazoxide treatment) stimulated the POMC 5'-promoter activity by 112 and 412%, respectively. As shown in Fig. 6AGo, 200 µM (10 times higher concentration of SU) of diazoxide abolished completely the suppressive effect of glibenclamide (20 µM) on basal POMC 5'-promoter activity, with a mild stimulatory effect remaining. On the other hand, as shown in Fig. 6BGo, the same concentration of diazoxide had no influence on the enhancing effect of glibenclamide on forskolin-stimulated POMC expression or, if any, enhanced the effect. It was thus assumed that the suppressive effect of SU on basal POMC gene expression is mediated by the diazoxide-sensitive KATP channel, whereas the enhancing effect on the secretagogue- induced one occurs through a diazoxide-insensitive mechanism.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 6. The influence of diazoxide pretreatment on the effects of gli-benclamide on basal or F-induced POMC 5'-promoter activity in AtT20PL cells. A, Cells were treated with vehicle or glibenclamide (20 µM) for 6 h with or without diazoxide pretreatment (200 µM). B, Cells were treated with F (10 µM, 6 h) or F (10 µM, 6 h) plus glibenclamide (20 µM, 6 h) with or without diazoxide pretreatment (200 µM). Diazoxide was applied 30 min before the addition of F/glibenclamide. C, Vehicle; *, P < 0.05 vs. vehicle or F alone.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we demonstrate that SUR mRNA is expressed in corticotroph cells, and SU indeed influences POMC expression as well as ACTH secretion. Furthermore, our data suggest that SU acts through two different mechanisms: a suppressive effect on basal POMC expression through a diazoxide-sensitive mechanism, and a potentiating effect on secretagogue-induced POMC expression through a diazoxide-insensitive mechanism. To our knowledge, this is the first report showing the effect of SU on gene expression of the anterior pituitary hormone.

SU has been used for the treatment of type 2 diabetes mellitus (1). This agent binds to its specific receptor, called SUR, present in the pancreatic islet, and acts as a secretagogue for insulin. SURs have also been shown to be expressed in a variety of organs, including the anterior pituitary (6, 12, 13). In fact, the existence of a binding site for SU, the expression of SUR in pituitary cells, and the effect of SU on pituitary hormone release have recently been reported (7, 14, 15, 16, 17, 18). In this study, we analyzed the expression of SURs, by the RT-PCR technique, and revealed that SUR (but not SUR2) mRNA is expressed in the AtT20PL cell line, in accordance with the previous report that pituitary cells express the KATP channel which has the same characteristics as those in ß-cells (18). The expression of SUR and the direct action of SU on POMC gene expression raise the possibility that the corticotroph is one of the target sites of SU, through its so-called extrapancreatic effect.

Our results show that glibenclamide has a unique dual effect on POMC expression: it inhibits basal activity, but it enhances secretagogue-stimulated 5'-promoter activity. Because the former effect was abolished by diazoxide treatment, the KATP channel is likely to be involved in the suppressive effect. SU is known to depolarize cells by closing the KATP channel (19), and the effect is in accordance with our result that glibenclamide had a mild stimulatory effect on basal ACTH secretion. In this sense, the suppressive effect of the reagent on basal POMC promoter activity was somewhat unexpected and requires further studies for clarifying the underlying mechanism.

In contrast, SU enhanced POMC gene expression stimulated by the activation of the cAMP/protein kinase A pathway. Interestingly, the effect, unlike that on basal expression, was not antagonized by diazoxide. Furthermore, when cells were pretreated with IBMX, a nonselective phosphodiesterase inhibitor, only a potentiating effect was completely eliminated. These data, taken together, raise the possibility that the dual effects of SU on POMC expression are mediated by different molecular mechanisms. One possible hypothesis is that, as reported in neuronal cells (20, 21), SU inhibits phosphodiesterase activity and thereby augments the cAMP- induced POMC expression. This explains why the enhancing effect did not occur with stimulation by 8Br-cAMP, phosphodiesterase-resistant cAMP analog. The hypothesis is also in accordance with the fact that, when the potentiating effect of SU was eliminated by IBMX, the suppressive effect (on basal expression occurring probably at the post cAMP level) became dominant. Recent studies show a functional link of SUR, not only with diazoxide-sensitive KIR but also with diazoxide-insensitive KIRs or other ion channels such as cystic fibrosis transmembrane conductance regulator (CFTR) (22, 23, 24); and, in fact, CFTR is suggested to be involved in hormone secretion (25), raising the possibility that some of these channels may mediate the enhancing effect. Alternatively, SU may act through completely different signaling pathway(s), such as the activation of protein kinase C or glycosylphosfatidylinositol-phospholipase-C (26, 27). In any event, accumulating evidence and observations, including our data, suggest that SU seems to have a more versatile mode of action than previously recognized, which may explain some of the extrapancreatic effects of the drug.

Although SURs are expressed in various extrapancreatic tissues, as mentioned above, the nature of the intrinsic ligands for the receptors (endosulfines) is still elusive (28, 29). Furthermore, the function of the KATP channel/SUR complex in the extrapancreatic organs, under normal physiological conditions, is not fully characterized. The role of SURs in regulating pituitary hormone synthesis and secretion also is not known. Nevertheless, our results shown here may be of physiological significance, from a clinical point of view, because of the widespread use of the agent for diabetic patients. The maximal serum level of glibenclamide in diabetic patients is approximately 1.5 µM (30), which is somewhat lower than the minimum dose of the agent eliciting a significant effect on corticotroph POMC expression. However, because glibenclamide is shown to accumulate within and act through the lipid layer of the plasma membrane because of its lipophilic nature (31, 32), it is possible that the agent affects synthesis and secretion of the pituitary hormones in vivo. In particular, in patients with pituitary adenoma, the administration of glibenclamide for accompanying diabetes mellitus may concomitantly stimulate pituitary hormone secretion from the adenoma cells, which could exacerbate the symptoms attributable to hormone excess. Further basic and clinical studies concerning the effect of SU on pituitary hormone synthesis and secretion will clarify the physiological role of SU in extrapancreatic tissues, including the anterior pituitary gland.


    Acknowledgments
 
We thank Prof. Yoshitomo Oka (Yamaguchi University, Japan) for providing the sequence of the mouse SUR mRNA.

Received February 4, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Groop LC 1992 Sulfonylureas in NIDDM. Diabetes Care 15:737–754[Abstract]
  2. Ashcroft FM 1996 Mechanisms of the glycaemic effects of sulfonylureas. Horm Metab Res 28:456–463[Medline]
  3. Aguilar-Bryan L, Nichols CG, Wechsler SW, Clement JP, Boyd IV AE, Gonzalez III G, Herrera-Sosa H, Nguy K, Bryan J, Nelson DA 1995 Cloning of the b-cell high affinity sulfonylurea receptor: a regulator of insulin secretion. Science 268:423–426[Abstract/Free Full Text]
  4. Inagaki N, Gonoi T, Clement IV JP, Namba N, Inazawa J, Gonzalez G, Aguilar-Bryan L, Seino S, Bryan J 1995 Reconstitution of IATP: an inward rectifier subunit plus the sulfonylurea receptor. Science 270:1166–1170[Abstract/Free Full Text]
  5. Kaku K, Inoue Y, KanekoT 1995 Extrapancreatic effects of sulfonylurea drugs. Diabetes Res Clin Pract [Suppl] 28:S105–S108
  6. Hernandez-Sanchez C, Wood TL, LeRoith D 1997 Developmental and tissue-specific sulfonylurea receptor gene expression. Endocrinology 138:705–711[Abstract/Free Full Text]
  7. Bernardi H, De Weille JR, Epelbaum J, Mourre C, Amoroso S, Slama A, Fosset M, Lazdunski M 1993 ATP-modulated K+ channels sensitive to antidiabetic sulfonylureas are present in adenohypophysis and are involved in growth hormone release. Proc Natl Acad Sci USA 90:1340–1344[Abstract/Free Full Text]
  8. Zhu Z, McCutcheon IE, Lopes MB, Laws Jr ER, Wagner VL, Bruner JM, Fuller GN, Langford LA, Ang LW, Friend KE 1998 Sulfonylurea receptor mRNA expression in pituitary macroadenomas. Endocrine 8:7–12[CrossRef][Medline]
  9. Friend K, McCutcheon I, Lopes MB, Laws Jr E, Ang L Sulfonylurea receptor mRNA expression in pituitary macroadenomas. 4th International Pituitary Congress, San Diego, CA, 1996 (Abstract G8)
  10. Aoki Y, Iwasaki Y, Katahira M, Oiso Y, Saito H 1997 Regulation of the rat proopiomelanocortin gene expression in AtT-20 cells. I. Effects of the common secretagogues. Endocrinology 138:1923–1929[Abstract/Free Full Text]
  11. Aoki Y, Iwasaki Y, Katahira M, Oiso Y, Saito H 1997 Regulation of the rat proopiomelanocortin gene expression in AtT-20 cells. II. Effects of pituitary adenylate cyclase-activating polypeptide and vasoactive intestinal polypeptide. Endocrinology 138:1930–1934[Abstract/Free Full Text]
  12. Isomoto S, Kondo C, Yamada M, Matsumoto S, Higashiguchi O, Horio Y, Matsuzawa Y, Kurachi Y 1996 A novel sulfonylurea receptor forms with BIR (Kir6.2), a smooth muscle type ATP-sensitive K+ channel. J Biol Chem 271:24321–24324[Abstract/Free Full Text]
  13. Chutkow WA, Simon MC, Le Beau MM, Burant CF 1996 Cloning, tissue expression, and chromosomal localization of SUR2, the putative drug-binding subunit of cardiac, skeletal muscle, and vascular KATP channels. Diabetes 45:1439–1445[Abstract]
  14. Fosset M, Epelbaum J, Lazdunski M 1992 Antidiabetic sulfonylureas antagonize somatostatin inhibition of prolactin secretion in vitro. Eur J Pharmacol 220:273–274[CrossRef][Medline]
  15. Meucci O, Landolfi E, Scorziellon A, Grimaldi M, Ventra C, Avallone A, Schettini G 1992 Dopamine and somatostatin inhibition of prolactin secretion from MMQ pituitary cells: role of adenosine triphosphate-sensitive potassium channels. Endocrinology 131:1942–1947[Abstract/Free Full Text]
  16. De Weille JR, Fosset M, Epelbaum J, Lazdunski M 1992 Effectors of ATP-sensitive K+ channels inhibit the regulatory effects of somatostatin and GH-releasing factor on growth hormone secretion. Biochem Biophys Res Commun 187:1007–1014[CrossRef][Medline]
  17. Wang X, Sato N, Greer MA, Greer SE 1994 Evidence that tolbutamide induces prolactin secretion by a mechanism which does not involve blocking ATP-sensitive potassium channels. Life Sci 55:847–853[CrossRef][Medline]
  18. Nelson DA, Bryan J, Wechsler S, Clement 4th JP, Aguilar-Bryan L 1996 The high-affinity sulfonylurea receptor: distribution, glycosylation, purification, and immunoprecipitation of two forms from endocrine and neuroendocrine cell lines. Biochemistry 35:14793–14799[CrossRef][Medline]
  19. Ashcroft FM 1996 Mechanisms of the glycaemic effects of sulfonylureas. Horm Metab Res 28:453–463
  20. Garcia-Rafanell J, Morell-Mastre J 1974 Inhibition of cyclic 3', 5',-nucleotide phosphodiesterase by glypentide and other oral antidiabetic agents. Rev Esp Fisiol 30:277–281[Medline]
  21. Lupo B, Bataille D 1987 A binding site for [3H]glipizide in the rat cerebral cortex. Eur J Pharmacol 140:157–169[CrossRef][Medline]
  22. Sheppard DN, Welsh MJ 1992 Effect of ATP-sensitive K+ channel regulators on cystic fibrosis transmembrane conductance regulator chloride currents. J Gen Physiol 100:573–591[Abstract/Free Full Text]
  23. Schultz BD, DeRoos AD, Venglarik CJ, Singh AK, Frizzell RA, Bridges RJ 1996 Glibenclamide blockade of CFTR chloride channels. Am J Physiol 271:L192–L200
  24. Ammala C, Moorhouse A, Gribble F, Ashfield R, Prokes P, Smith PA, Sakura H, Coles B, Ashcroft SJH, Ashcroft FM 1996 Promiscuous coupling between the sulfonylurea receptor and inward rectifying potassium channels. Nature 379:545–548[CrossRef][Medline]
  25. Weyler RT, Yurko-Mauro KA, Rubenstein R, Kollen WJ, Reenstra W, Alt- schuler SM, Egan M, Mulberg AE 1999 CFTR is functionally active in GnRH-expressing GT1–7 hypothalamic neurons. Am J Physiol 277:C563–C571
  26. Muller G, Dearey EA, Punter J 1993 The sulfonylurea drug, glimepiride, stimulates release of glycosylphosphatidylinositol-anchored plasma- membrane proteins from 3T3 adipocytes. Biochem J 289:509–521
  27. Muller G, Geisen K 1996 Characterization of the molecular mode of action of the sulfonylurea, glimepiride, at adipocytes. Horm Metab Res 28:469–487[Medline]
  28. Virsolvy-Vergine A, Leary H, Kuroki S, Lupo B, Dufour M, Bataille D 1992 Endosulfine, an endogenous peptidic ligand for the sulfonylurea receptor: purification and partial characterization from ovine brain. Proc Natl Acad Sci USA 89:6629–6633[Abstract/Free Full Text]
  29. Virsolvy-Vergine A, Salazar G, Sillard R, Denoloy L, Mutt V, Bataille D 1996 Endosulfine, endogenous ligand for the sulfonylurea receptor: isolation from porcine brain and partial structural determination of the alpha form. Diabetologia 39:135–141[CrossRef][Medline]
  30. Sartor G, Melander A, Schersten B, Wahlin-Boll E 1980 Serum glibenclamide in diabetic patients, and influence of food on the kinetics and effects of gli- benclamide. Diabetologia 18:17–22[CrossRef][Medline]
  31. Zunkler BJ, Trube G, Panten U 1989 How do sulfonylureas approach their receptor in the B-cell plasma membrane? Naunyn Schmiedebergs Arch Pharmacol 340:328–332[Medline]
  32. Gylfe E, Hellman B, Sehlin J, Taljedal I-B 1984 Interaction of sulfonylurea with the pancreatic B-cell. Experientia 40:1126–1134[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
L. P. Chapman, M. J. Epton, J. C. Buckingham, J. F. Morris, and H. C. Christian
Evidence for a Role of the Adenosine 5'-Triphosphate-Binding Cassette Transporter A1 in the Externalization of Annexin I from Pituitary Folliculo-Stellate Cells
Endocrinology, March 1, 2003; 144(3): 1062 - 1073.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Ozata, D. Gungor, M. Turan, G. Ozisik, N. Bingol, T. Ozgurtas, and I. C. Ozdemir
Improved Glycemic Control Increases Fasting Plasma Acylation-Stimulating Protein and Decreases Leptin Concentrations in Type II Diabetic Subjects
J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3659 - 3664.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morishita, M.
Right arrow Articles by Saito, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morishita, M.
Right arrow Articles by Saito, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals