This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Lane, P. H. Search for Related Content PubMed PubMed Citation Articles by Lane, P. H.

5-Thio-D-Glucose Elevates Renal Transforming Growth Factor ß-1 at a Dose that Does Not Prevent Streptozocin Diabetes in Rats¹

Department of Pediatrics, University of Nebraska Medical Center, Omaha, Nebraska 68198-2169

Address all correspondence and requests for reprints to: Pascale H. Lane, M.D., Pediatric Nephrology, University of Nebraska Medical Center, 982169 Nebraska Medical Center, Omaha, Nebraska 68198-2169. E-mail: phlane{at}unmc.edu

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Studies of early nephropathy in streptozocin (STZ)-treated rats are complicated by the nephrotoxicity of this agent. Inhibitors of the diabetogenic actions of STZ have been described, but their effects on the kidney have not been assessed. This study examined the effects of one agent, 5-thio-D-glucose (5TG) on renal hypertrophy and transforming growth factor ß 1 (TGF-ß1). Forty male Sprague Dawley rats were divided into four groups: saline controls (SC), 5TG alone, 5TG + STZ, and STZ. After 2 weeks of observation, urine, plasma, and kidneys were studied. Nine of 10 STZ rats were diabetic at the time of euthanasia, as were 5 of 10 5TG + STZ animals. Both tissue levels of messenger RNA and protein for active and total TGF-ß1 were elevated in STZ and 5TG-STZ animals compared with SC. 5TG also elevated mRNA and produced protein levels intermediate to the other groups. 5TG plus STZ is an unacceptable control for nephropathy studies in STZ diabetes, both because of lack of efficacy at the dose studied and the induction of TGF-ß1 by 5TG. 5TG may yet prove of value in studying control of renal TGF-ß1 expression and excretion.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
THE STREPTOZOCIN (STZ)-treated rat is a widely used model for the study of early diabetic nephropathy. Interpretation of studies using this model, especially those of short duration, is complicated by the nephrotoxicity of STZ. There is always some question whether diabetes or STZ caused any changes demonstrated in the kidney. One tactic to address this problem is specific inhibition of the diabetogenic effects of STZ. A number of agents have been shown to inhibit the ß cell toxicity of STZ, including 3–0-methylglucose, 2-deoxyglucose, and 5-thio-D-glucose (1, 2, 3, 4). In mice, the latter has been shown to be the most potent inhibitor of STZ (3, 4).

Using STZ plus an inhibitor would produce a control group that received an equal dosage of STZ but did not develop diabetes. An appropriate inhibitor would have no effects on the renal parameters of interest. In our lab, these include renal and glomerular hypertrophy and transforming growth factor ß. While attractive in theory, the potential effects of these STZ inhibitors on the kidney have not been addressed in the literature.

The present study was designed to test the efficacy of 5TG in the inhibition of STZ diabetes in rats and the direct effects of this substance on kidney function and structure. Production of transforming growth factor ß1 (TGF-ß1), an important mediator of diabetic kidney disease, was also measured to assess effects of 5TG and STZ on this growth factor (5).

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Animals
Forty male Sprague Dawley rats, all approximately 150 g BW, were divided into four groups. One group was injected ip on day 0 with STZ, 65 mg/kg BW (STZ). The second group received 5TG, 50 mg/kg (5TG). This dose was chosen because it completely blocked the diabetogenic effects of STZ 200 mg/kg in mice (3). The third group received 5TG followed by STZ at the same doses (5TG + STZ). The final group received a similar volume of normal saline and served as controls (SC). The animals had spontaneously voided urine collected 48 to 72 h after injection to determine the presence or absence of glycosuria as an indicator of DM. No insulin was administered to these animals. They had free access to standard rat chow and tap water throughout the study.

During the final 48 h of the experiment, animals were housed in metabolic cages for the collection of 24-h urine specimens. On the fourteenth day after injection, the rats were anesthetized with pentobarbital. Plasma was collected by cardiac puncture. The kidneys were then excised, weighed, and processed for further study. One kidney was immersion fixed for histologic examination. The other was snap-frozen in liquid nitrogen and stored at -70 C until needed for isolation of protein and RNA. The Institutional Animal Care and Use Committee of the University of Nebraska approved all studies.

Histology and immunohistochemistry
At the time of harvest, one kidney was immersed in HistoCHOICE MB (Amresco Inc., Solon, OH). Within 1 h, the kidney was halved lengthwise, then cut transversely into 5 mm slices. These slices were immersed in a 4:1 mixture of HistoCHOICE MB and ethanol to promote tissue firmness. After at least 24 h of fixation at 4 C, the tissues were sectioned at 30 µm thickness on a vibratome. Free-floating sections were stored in the fixative and ethanol mixture until immunostaining could be performed.

Immunohistochemical analysis of TGF-ß1 was performed on free-floating tissue sections in tissue culture inserts. Tissues were removed from fixative and rinsed with PBS. They were then incubated at room temperature in 10% hydrogen peroxide for 5 min, and then triple rinsed with PBS. All further incubations took place at 37 C. The tissues were blocked with 1% normal goat serum in PBS for 10 min, and the excess serum was blotted off. Rabbit antihuman TGF-ß1 antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was applied at a 1:1000 dilution for 2 h. The tissues were then triple rinsed with PBS and 1:500 goat antirabbit antibody conjugated to peroxidase (Chemicon Inc., Temecula, CA) was applied for 20 min. Following three more PBS rinses, 3-amino-9-ethylcarbazole peroxidase substrate was applied (Chemicon) for 10 min. The sections were then rinsed with distilled water, placed on slides, covered with Crystal/Mount (BioMedia, Fullerton, CA), and coverslipped.

Each tissue had five low-power (20x) fields captured using a digital microscopy system. Glomeruli were captured at a higher power (40x). Tissue sections were examined for qualitative differences in distribution of TGF-ß1 by a single investigator (PHL) who was masked to the identity of the samples. Quantitative differences in immunostaining were assessed using a method based on the mean saturation density (6, 7), a measurement inversely proportional to semiquantitative scoring systems. We have studied this method in sections from 40 rats in another study. Multiple digital images were captured from each AEC-stained tissue section. Standard RGB images were converted to the hue-saturation-lightness model (The Image Processing Tool Kit 2.5, Reindeer Games, Inc., Asheville, NC). The mean gray level of each saturation channel micrograph was determined using ScionImage (Scion Corp., Frederick, MD), a Windows program based on NIH Image Software. In a series of glomeruli from 25 animals, saturation score correlated inversely with traditional semiquantitative scores (r = -0.86; P = 0.03), and showed good reproducibility with 5 low-power fields of cortex (coefficient of variation 4.1%).

Mean glomerular volume was determined for each animal by capturing and measuring the maximal profile area of 10–15 glomeruli per animal. Sections of 30-µm thickness let us focus up and down on glomeruli to identify those in which a maximal profile was preceded and succeeded optically by smaller area profiles. This "equatorial" profile was then captured, and the area of the minimal convex polygon surrounding its capillary tuft was assessed using the polygon tool in ScionImage Software (Release ß 3, Scion Corp.). Final magnification was determined by stage micrometer. From the mean maximal profile area the mean glomerular radius was determined. Glomerular volume was then calculated as a sphere as previously reported (8).

Biochemical studies on plasma and urine
Plasma glucose was measured using a hexokinase end-point method (Sigma, St. Louis, MO). Urine albumin was assessed by competitive ELISA (Nephrat, Exocell, Inc., Philadelphia, PA). Plasma and urine creatinine was measured using a colorimetric end-point method based on the Jaffe reaction (also from Sigma).

TGF-ß1 protein quantitation
After thawing, protein was extracted from 100 mg of renal tissue using a nonacidic protein extraction reagent, T-PER (Pierce Chemical Co., Rockford, IL). Active TGF-ß1 was then measured by ELISA (E_max, Promega Corp., Madison, WI); total TGF-ß1 was measured using the same assay after acidification of the tissue extract. ELISA assays were run in duplicate. This assay has coefficient of variation of 8.2% in our laboratory. Total protein was assessed using the Coomassie method (also from Pierce Chemical Co.). Results are reported as pg of TGF-ß1 per mg of total protein.

RNA analysis
Tissue was stored at -70 until the time of analysis. Approximately 100 mg of tissue was homogenized and total RNA extracted using Trizol Reagent (Life Technologies, Inc., Grand Island, NY). Semiquantitative RT-PCR was performed. The primers were designed using the published sequences of rat TGF-ß1, TGF-ß inducible gene h3 (ßig-H3), and -tubulin in the GeneFisher Team program (http://bibiserv.techfak.uni-bielefeld.de). This produced 8 primer pairs for each substance. A primer set with the least difference in melting temperature between the forward and reverse sequences was selected, then cross-checked for specificity for the rat messenger RNA (mRNA) sequence using Blast Query Sequence Search (http://www.ncbi.nlm.nih.gov). Specificity of the PCR product was confirmed by Northern blot analysis on rat liver. Sequences used were TGF-ß1: 5'tgtccggcagtggctgaac and 5'ggcttcgcacccacgtagt; ßig-H3: 5'ctccatcacactcaggggaa and 5'ttggatccctccaaacacgg; and -tubulin: 5'aagaagtccaagctggagttc and 5'gttggtctggaattctgtcag. Complementary DNA was fractionated by electrophoresis through a 1% agarose gel. Optical densities of the bands were determined using GelDoc with MultiAnalyst software (Bio-Rad Laboratories, Inc. Hercules, CA). Results are expressed as the ratio of the optical density of the TGF-ß1 or ßig-H3 band to the -tubulin band.

Statistical analysis
Most values were not normally distributed and are expressed as median (25th, 75th percentiles); normally distributed parameters are shown as mean ± SD. Data were examined with ANOVA with posthoc Tukey tests if normally distributed or Kruskal-Wallis ANOVA on ranks with posthoc Dunn tests if the distribution failed the normality test. Similarly, hyperglycemic and normoglycemic animals were compared with unpaired t tests or the Mann-Whitney rank sum test. Normoglycemic and hyperglycemic members of the 5TG + STZ group were also compared with these tests. P < 0.05 was considered significant for all comparisons. All statistical analyses were performed with SigmaStat 2.0 (SPSS, Inc., Chicago, IL).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
All rats in the STZ group had moderate to large glycosuria by dipstick 48 to 72 h after receiving the injection; all other rats were negative at that time. After 2 weeks, when 24-h urine collections were obtained, 1 rat in the STZ group no longer had glucose in the urine, while 5 of the 10 animals that received 5TG + STZ had developed glycosuria. By the end of 2 weeks, rats in the STZ group had lower body weight than those in the other groups (Table 1). There was a trend toward increasing kidney weight in this group that did not reach statistical significance, even when examined as a percentage of body weight (Table 1). Kidney weight was significantly greater in rats with hyperglycemia (plasma glucose >250 mg/dl, the highest value in the saline controls) when compared with those with normal blood sugars at the time of euthanasia [1.20 (1.13, 1.30) vs. 1.00 (0.96, 1.10) g; P = 0.002]. No significant differences in mean glomerular volume were demonstrated for these groups (Table 1), although hyperglycemic animals showed a strong trend toward increased volume (0.80 ± 0.11 vs. 0.70 ± 0.16 x 10⁶ µm³; P = 0.06). Plasma creatinine and creatinine clearance were similar among the four groups (Table 1). Plasma glucose was significantly higher in the two groups with diabetic animals, STZ and 5TG + STZ, than in those without diabetes (Table 1). As expected, there were no significant differences in the renal excretion of albumin during this short course of diabetes (Table 1).

View larger version (21K): [in this window] [in a new window]   Figure 1. Levels of active (gray bars) and total (black bars) TGF-ß1 protein in renal tissue. Bars show median values while error bars show 75th percentile. Both active and total TGF-ß1 were significantly greater in 5TG and STZ animals than in controls.

View larger version (48K): [in this window] [in a new window]   Figure 2. Ratios of mRNA for TGF-ß1 to -tubulin, expressed as percentage of the control group mean. All three experimental groups were significantly greater than the saline controls; there were no significant differences among these three groups. Shaded area shows the 10th through 90th percentiles with the median line. Error bars designate the 5th and 95th percentiles. Outlier data points are filled circles. A gel with representative samples is shown.

View larger version (55K): [in this window] [in a new window]   Figure 3. Ratios of mRNA for ßIG-H3 to a-tubulin, expressed as a percentage of the control group mean. Both groups receiving STZ were significantly greater than the saline controls; STZ animals were significantly greater than the 5TG group as well. 5TG values were intermediate to and not significantly different from saline controls and the 5TG-STZ combination group.

View larger version (207K): [in this window] [in a new window]   Figure 4. Representative photomicrographs of immunohistochemistry for TGF-ß1 taken with a 40x objective. No quantitative or qualitative differences in immunohistochemical staining could be demonstrated, although animals in the 5TG + STZ and STZ groups had focal areas of increased immunostaining as shown.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

ßIG-H3 is a structural protein that in vitro is produced by a variety of cells when treated with isoforms 1 and 2 of TGF-ß (9). Renal ßIG-H3 is up-regulated in the diabetic state (10). Insulin-like growth factor I, a known stimulus to normal and diabetic renal growth, does not induce this mRNA (10). While it is possible that some other unidentified component of the diabetic state is increasing mRNA for ßIG-H3, it still provides support for increased activity of TGF-ß.

The diabetic state has been shown to increase renal cellular production of TGF-ß shortly after exposure to hyperglycemia or glycated protein (5). It was expected that this growth factor would be increased in animals in the 5TG + STZ and STZ groups that had developed DM. The increase in TGF-ß mRNA and protein seen with 5TG alone was unexpected. The magnitude of mRNA and protein elevation in animals receiving both STZ and 5TG was similar to those seen in animals receiving either agent alone, suggesting that these agents do not have direct additive effects on TGF-ß. Half of the 5TG + STZ group developed diabetes and had values comparable to the STZ group; however, half did not have hyperglycemia, but had a similar increase in TGF-ß1 production and activity to diabetic animals receiving this combination.

A variety of molecules can inhibit the pancreatic ß cell toxicity of STZ (1, 2, 3, 4). All of these are substituted glucose analogs. Their exact mechanism is unknown, but it is presumed that they block the action of STZ via its glucose moiety. 5TG demonstrates a series of metabolic effects, including inhibition of a number of enzymes involved in glycogen and glucose metabolism (11). Acutely, oral or parenteral administration results in hyperphagia, hyperglycemia, and increased insulin levels; glucose and insulin return toward baseline by 150 min (11, 12). Chronic oral administration for 3 weeks also increases serum glucose and insulin levels in a dose-dependent manner (12). Infusion into the fourth ventricle of the rat brain for 2 weeks has been examined (13). In this setting, 5TG decreases food intake, increases body fat, and has no effect on serum glucose or insulin concentrations. It is unclear what the mechanism of induction of TGF-ß1 mRNA and protein might be in the present study, why this effect is sustained 2 weeks after the single injection of 5TG, or how long this effect would last. It is possible that these findings were transient, due to the hyperglycemia associated with 5TG administration, and that normalization of TGF-ß1 would eventually occur.

It is also of interest that despite stimulation of renal TGF-ß1 production similar to the levels seen in STZ DM, no functional or structural consequences of 5TG administration were demonstrated. Our data also suggest that this lack of structural effect is not due to lack of activation of TGF-ß1 because levels of active growth factor and ßIG-H3, a gene specifically induced by TGFß, were both elevated in the 5TG group. Thus, the early structural changes of STZ DM are due to more than TGF-ß1.

Other investigators of STZ DM in the rat have demonstrated significant glomerular hypertrophy after 2 weeks of DM, whereas our study demonstrated only a strong trend in this direction. This may be because of the age of the rats in this experiment. We have previously demonstrated a lack of renal and glomerular hypertrophy in rats given STZ before puberty, as have other investigators (14, 15, 16). The animals in this study were 6–8 weeks old at the onset, and thus in early puberty. It is likely that this blunted the hypertrophic response to the diabetic state.

5TG is the most potent inhibitor of STZ studied in mice (3); it has not been used in this context in rats before. Single-dose STZ DM in mice requires 200 mg/kg BW. Fifty micrograms/per kilogram of 5TG completely prevents DM in this mouse model. The rats in the present study received only 65 mg/kg of STZ preceded by the full 50 mg/kg of 5TG, yet 50% still developed DM. 5TG thus appears to be a much less effective prophylactic agent in the STZ rat model. While higher doses of 5TG might prove protective in the rat, they could induce greater changes in the kidney, eliminating the usefulness of this combination as a control group.

We have also measured both active and total tissue levels of TGF-ß1. Protocols used before our study extracted the tissue protein with acidification, which activated latent TGF-ß1 (17). Thus, only total tissue levels could be measured. The new reagent T-PER allows nonacidic extraction of tissue proteins, so active and total tissue levels can be measured. Increased active levels were associated with increased expression of ßIG-H3, supporting increased TGF-ß activity in these kidneys.

We have shown that 5TG increases renal expression of TGF-ß1 mRNA and protein 2 weeks after injection to a level comparable to those seen in diabetic animals. This alone would make it a poor control agent in nephropathy studies in STZ diabetes; however, its lack of efficacy at the present dose in the rat model also makes it an unattractive alternative to saline controls. While higher doses may block the diabetogenic effects of STZ, they may also increase the effects on TGF-ß1. 5TG may ultimately prove of value to study the mechanism(s) through which TGF-ß mRNA, protein synthesis, and activation are controlled.

	Acknowledgments

 
Pascale H. Lane, M.D., is the recipient of a Career Development Award from the American Diabetes Association. The author would like to thank J. Smith Leser and Nataliy Babushkina-Patz for their technical expertise and Pierce Chemical Co. for providing T-PER for use in these experiments.

	Footnotes

 
¹ Portions of these studies were presented at the Pediatric Academic Societies Annual Meeting, San Francisco, California, May 2, 1999, and published in abstract in Pediatr Res 45:334A, 1999, and at the Annual Meeting of the American Diabetes Association, San Diego, California, June 19–21, 1999, and published in abstract in Diabetes [Suppl 1]48:A141.

Received April 3, 2000.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Dulin WE, Wyse BM 1969 Studies on the ability of compounds to block the diabetogenic activity of streptozotocin. Diabetes 18:459–466[Medline]
2. Ganda OP, Rossini AA, Like AA 1976 Studies on streptozotocin diabetes. Diabetes 25:595–603[Abstract]
3. Wang Z, Dohle C, Friemann J, Green BS, Gleichmann H 1993 Prevention of high- and low-dose STZ-induced diabetes with D-glucose and 5-thio-D-glucose. Diabetes 42:420–428[Abstract]
4. Wang Z, Fleichmann H 1998 GLUT2 in pancreatic islets: crucial target molecule in diabetes induced with multiple low doses of streptozotocin in mice. Diabetes 47:50–56[Abstract]
5. Sharma K, Ziyadeh FN 1995 Hyperglycemia and diabetic kidney disease. The case for transforming growth factor-ß as a key mediator. Diabetes 44:1139–1146[Abstract]
6. Russ JC 1998 Acquiring images. In: The Image Processing Handbook. CRC Press, Boca Raton, FL, pp 1–86
7. Russ JC 1998 Segmentation and thresholding. In: The Image Processing Handbook. CRC Press, Boca Raton, FL, pp 371–430
8. Lane PH, Steffes MW, Mauer SM 1992 Estimation of glomerular volume: a comparison of four methods. Kidney Int 41:1085–1089[Medline]
9. Skonier J, Neubauer M, Madisen L, Bennett K, Plowman GD, Purchio A 1992 cDNA cloning and sequence analysis of ßig-h3, a novel gene induced in a human adenocarcinoma cell line after treatment with transforming growth factor-ß. DNA Cell Biol 11:511–522[Medline]
10. Gilbert RE, Wilkinson-Berka JL, Johnson DW, Cox A, Soulis T, Wu LL, Kelly DJ, Jerums G, Pollock CA, Cooper ME 1998 Renal expression of transforming growth factor-ß inducible gene-h3 (ßig-h3) in normal and diabetic rats. Kidney Int 54:1052–1062[CrossRef][Medline]
11. Ritter RC, Slusser P 1980 5-thio-D-glucose causes increased feeding and hyperglycemia in the rat. Am J Physiol 238:E141–E144
12. Veeraragavan K, Ramakrishnan S 1983 Glucose concentration and insulin release in 5-thio-D-glucose treated mice. Metabolism 32:1115–1119[Medline]
13. He B, White BD, Edwards GL, Martin RJ 1998 Longer-term fourth ventricular 5-thioglucose infusion increases body fat in the rat. Proc Soc Exp Biol Med 217:168–172[Abstract]
14. Lane PH 1997 Age of onset of streptozocin diabetes determines the renal structural response in the rat. Pediatr Res 41:912–915[Medline]
15. Bach LA, Jerums G 1990 Effect of puberty on initial kidney growth and rise in kidney IGF-I in diabetic rats. Diabetes 39:557–562[Abstract]
16. Ellis EN, Wiegmann TB, Savin VJ 1992 Diminished glomerular capillary hydraulic conductivity precedes morphologic changes in experimental diabetes mellitus in the rat. Diabetes 41:1106–1112[Abstract]
17. Danielpour D 1993 Improved sandwich enzyme-linked immunosorbent assays for transforming growth factor ß1. J Immunol Methods 158:17–25[CrossRef][Medline]

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Lane, P. H. Search for Related Content PubMed PubMed Citation Articles by Lane, P. H.