help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, M. S.
Right arrow Articles by Dannies, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, M. S.
Right arrow Articles by Dannies, P. S.
Endocrinology Vol. 141, No. 9 3485-3492
Copyright © 2000 by The Endocrine Society

ARTICLES

Accumulation of Synaptosomal-Associated Protein of 25 kDa (SNAP-25) and Other Proteins Associated with the Secretory Pathway in GH4C1 Cells Upon Treatment with Estradiol, Insulin, and Epidermal Growth Factor1

Min S. Lee, Yong Lian Zhu, Zhenyu Sun, Harrison Rhee, Andreas Jeromin, John Roder and Priscilla S. Dannies

Department of Pharmacology, Yale University School of Medicine (M.S.L., Y.L.Z., Z.S., H.R.), New Haven, Connecticut 06510; and Samuel Lunenfeld Research Institute, Mount Sinai Hospital (A.J., J.R.), Toronto, Ontario, Canada J5G 1X5

Address all correspondence and requests for reprints to: Dr. Priscilla Dannies, Department of Pharmacology, Yale University School of Medicine, New Haven, Connecticut 06511.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Treatment of rat pituitary GH4C1 cells with estradiol, insulin, and epidermal growth factor induces secretory granule accumulation, PRL storage, and stabilization of ICA512, a membrane protein associated with secretory granules. In these investigations we found that the same treatment induced accumulation over 2-fold of other proteins in the secretory pathway, including synaptosomal-associated protein of 25 kDa (SNAP-25), synaptotagmin III, synaptobrevin, synaptophysin, and cyclophilin B, and did not affect accumulation of others, including synaptotagmin I, calnexin, and glucose-regulated protein 94. The induction of proteins was not a coordinate event, because epidermal growth factor alone maximally stimulated SNAP-25 accumulation, but not that of synaptotagmin III. Induction of SNAP-25 accumulation occurred without an increase in its synthesis, and induction of cyclophilin B occurred without an increase in its messenger RNA accumulation, suggesting that accumulation may be caused by stabilization of the proteins. SNAP-25 immunofluorescence was located in the cytoplasm and on the plasma membrane and sometimes was heavily concentrated in protrusions from the cell surface, especially in hormone-treated cells. Frequenin immunofluorescence was also sometimes concentrated in intense patches, but did not colocalize with SNAP-25. Growth hormone and prolactin immunofluorescence was not found in the protrusions and sometimes did not colocalize with each other when they were present in the same cell. Hormone treatment of GH4C1 cells therefore induces accumulation of specific proteins in all parts of the secretory pathway and causes morphological changes in addition to accumulating secretory granules.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
ALL CELLS HAVE secretory pathways to transport secretory and plasma membrane proteins to the cell surface. Neuroendocrine cells also have specialized pathways. These cells concentrate proteins hormones in large membrane-enclosed vesicles, known as secretory granules, that provide hormone stores ready for rapid release by fusion to the plasma membrane when cells are stimulated. Neuroendocrine cells also have a second specialized branch of the secretory pathway called synaptic-like microvesicles (1). These microvesicles undergo exocytosis at the plasma membrane, but do not carry protein cargo.

Both secretory granules and microvesicles have some of the same protein family members in their membranes, including synaptotagmin and synaptobrevin (2, 3). These families were initially found in neurons because of their abundance, and function in fusing synaptic vesicles to the plasma membrane. There is evidence to indicate that the same families of proteins have similar roles in fusion of secretory granules to the plasma membrane to release hormones from neuroendocrine cells (4, 5, 6, 7, 8, 9, 10).

How secretory granules form, how cells concentrate hormones there, and how cells include only appropriate proteins in the membranes of the granules are subjects of intense investigation (11, 12). GH4C1 cells are rat pituitary tumor cells that serve as a model to investigate these processes. In the absence of estradiol, these cells contain few secretory granules, but in its presence, especially with insulin and epidermal growth factor, accumulation of secretory granules increases 50-fold (13). This combined hormone treatment increases the accumulation of a protein, ICA512 (also called IA-2{alpha}), that is a transmembrane protein found primarily in secretory granule membranes and not in microvesicle membranes (14, 15, 16). The function of ICA512 is unknown. The combined hormone treatment that induces secretory granule accumulation in GH4C1 cells increases ICA512 accumulation primarily by stabilizing the protein, and the time course and pattern of induction of ICA512 by combinations of estradiol and growth factors are similar to those for the induction of PRL storage (17). Such findings raised the possibility that accumulating secretory granules may affect the fate of ICA512 and vice versa. It is not known, however, whether the induction by hormone treatment is restricted to proteins in the secretory granule branch of the secretory pathway or whether hormone induction has a more widespread effect. To determine whether the effects of hormone treatment of GH4C1 cells were restricted to proteins associated preferentially with secretory granules, or whether there were more general effects on the secretory pathway, we assessed the effects of hormone treatment on other proteins in neuroendocrine cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture
GH4C1 cells were grown in stock cultures in a 1:1 mixture of DMEM and Ham’s F-10 nutrient mixture supplemented with 15% horse serum. For induction with hormones, cells were plated in the same medium supplemented with 15% gelding serum alone or in combination with 1 nM estradiol, 300 nM insulin, and 5 nM epidermal growth factor, at a density of 2.5 x 105 cells/100-mm plate; the low density enhances the storage effect (18). The medium was replaced on the third day, and the cells were used on the fourth day unless otherwise indicated.

Immunoblots
After counting, cells were dissolved in loading buffer [50 mM Tris (pH 6.8), 2% SDS, 0.01% bromophenol blue, 10% glycerol, 10% ß-mercaptoethanol, and 200 mM dithiothreitol] and heated at 100 C for 5 min, followed by 60 C for 15 min. Aliquots equal to 50,000 cells, except for synaptobrevin, were subjected to electrophoresis on 12.5% acrylamide. For synaptobrevin, membranes prepared from equal numbers of cells were used. Proteins were transferred to Immobilon membranes (Millipore Corp., Bedford, MA) at 300 mA for 1.5 h, and membranes were incubated with the primary antibody overnight, followed by incubation with rabbit antimouse Ig for blots using monoclonal antibodies or rabbit antichicken Ig for blots using chicken antibodies, and then incubation with 10 µCi [125I]protein A (NEN Life Science Products, Boston, MA) for all blots for 1 h. The Molecular Imager system (Bio-Rad Laboratories, Inc., Hercules, CA) was used to detect and quantitate the bound radioactivity.

The following antibodies were used: mouse monoclonal antibodies specific for Rab3a/b/c and Rab3a (19), synaptotagmin I (20), rat syntaxin I (Cl78.1), synaptobrevin II (21), and synaptosomal-associated protein of 25 kDa (SNAP-25) (Cl71.1 and Cl71.2; gifts from R. Jahn) and chicken antisera 21 and 22 for rat frequenin (Sage, C., et al., submitted for publication). Rabbit antiserum for synaptotagmin III was a gift from S. Seino, antiserum for cyclophilin B was a gift from R. Handschumacher, antiserum for calnexin was a gift from A. Helenius, antiserum for ERP60 was a gift from Dr. T. Wileman (22), and the other antisera were obtained from Affinity BioReagents, Inc. (Neshanic Station, NJ).

Membranes were prepared from control and treated cells by resuspending cells after centrifuging in PBS plus 100 µg/ml aprotinin, 1 mM benzamide, 1 µg/ml pepstatin A, and 15 µg/ml leupeptin and rupturing them with a ball homogenizer. Nuclei were spun down, and membranes were collected by centrifuging at 100,000 x g for 1 h.

Pulse-chase analysis
After 4 days of culture with or without hormone treatment, cultures were labeled in DMEM with no methionine or cysteine with 0.1% horse serum, 1 mM NaHCO3, and 20 mM HEPES, pH 7.0. After rinsing, cells were incubated with 400 µCi Express 35S Protein Labeling Mix (NEN Life Science Products) for 20 min and then in Ham’s F-10 nutrient mixture with 5% horse serum, 1 mM NaHCO3, and 20 mM HEPES (pH 7.5), 1.5 mM methionine, and cysteine for further times. Cells were lysed in 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 0.02% sodium azide, 0.1% SDS, 100 µg/ml phenylmethylsulfonylfluoride, 1 µg/ml aprotinin, 2% Triton X-100, 0.5% sodium deoxycholate, 2.5 µg/ml leupeptin, and 2.5 µg/ml pepstatin. Lysates were incubated with rabbit serum and protein A-Sepharose beads (5 mg/sample; Pharmacia Biotech, Piscataway, NJ) overnight, and then with monoclonal antiserum to SNAP-25 followed by rabbit antimouse Ig and then protein A-Sepharose beads for 18 h. The beads were washed once with 50 mM Tris HCl (pH 7.5), 150 mM NaCl, 0.2% Triton X-100, 1 mM EDTA (pH 8.0), 0.02% sodium azide, 0.25% BSA, 2.5 µg/ml leupeptin, and 2.5 µg/ml pepstatin for 30 min and then twice with 10 mM Tris-HCl (pH 7.0), 0.2% Triton X-100, 2.5 µg/ml leupeptin, and 2.5 µg/ml pepstatin for 30 min/wash. Proteins were eluted from the beads by heating at 100 C for 5 min, followed by 60 C for 15 min in 125 mM Tris (pH 6.8), 4% SDS, 0.02% bromophenol blue, 10% glycerol, 10% ß-mercaptoethanol, and 200 mM dithiothreitol. After SDS-PAGE was performed, gels were dried at 75 C for 2 h under a vacuum. Results were corrected for cell number using values obtained from replicate plates. Variation in cell numbers on replicate plates was less than 10%.

Northern analysis
The cyclophilin B sequences were cloned by RT-PCR using the primers 5'-cacggatccgctgcgcctctcgga-3' and 5'gtgctcgagtagagggatgaggtccc3'. An aliquot of cells was removed for counting, and the rest was used for RNA extraction with RNeasy (QIAGEN, Chatsworth, CA). Aliquots equivalent to equal numbers of cells (usually about 5 x 105) were used for electrophoresis and hybridization, carried out as previously described (23). 32P-labeled probes were generated by random priming. The probe for cyclophilin A was p1B15 (24).

Immunomicroscopy
GH4C1 cells were plated on glass coverslips and cultured with or without hormone treatment for 4 days, then fixed with 4% paraformaldehyde and 120 mM sodium phosphate buffer, pH 7.4, and staining and microscopy were carried out as previously described (17). Mouse monoclonal antibody for PRL was a gift from Jonathan Scammell; rabbit polyclonal antibody for PRL was previously described (17), and the rabbit polyclonal antiserum to SNAP-25 was obtained from Affinity BioReagents, Inc. A baboon polyclonal to rat GH was used. Other primary antiserum were described above. Secondary antisera were rabbit antimonkey IgG-fluorescein isothiocyanate (IgG-FITC), mouse antichicken IgG-FITC, and goat antimouse IgG-FITC conjugate from Sigma-Aldrich Corp. (St. Louis, MO) and Texas Red-X goat antirabbit and goat antimouse IgG from Molecular Probes, Inc. (Eugene, OR). The changes in SNAP-25 and frequenin were assessed by counting 3 or more fields of over 100 cells each in cultures treated with hormones and untreated in 2 separate experiments performed at the Cell Biology Core of the Diabetes Endocrinology Research Center. Confocal microscopy was performed with the help of Philippe Male on a Carl Zeiss LSM 510 (New York, NY) at the Yale University Center for Cell Imaging.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
We investigated whether hormone treatment changed the level of three proteins present in or associated with the membranes of secretory granules and synaptic-like microvesicles: Rab3, a membrane-associated guanosine triphosphatase that undergoes membrane association and dissociation during vesicle transport and fusion (25, 26); synaptotagmin, an integral membrane protein that is the major Ca2+ sensor responsible for neurotransmitter release (2); and synaptobrevin (also referred to as VAMP), a membrane protein that is a constituent of the fusion complex essential for exocytosis (3). Each of these three proteins is a member of a family with several isoforms that are differentially expressed in neurosecretory cells. Both Rab3A and Rab3B and both synaptotagmin I and III are expressed in the anterior pituitary gland (4, 27, 28, 29, 30). Synaptotagmin I is the major form in the gland, but synaptotagmin III is the major form in GH4C1 cells (31). Synaptobrevin II is the form of synaptobrevin expressed in the anterior pituitary gland (4, 30). These proteins in untreated and hormone-treated GH4C cells were analyzed by quantitative immunoblots after gel electrophoresis. Treatment with estradiol, insulin, and epidermal growth factor increased synaptotagmin III and synaptobrevin over 2-fold (Fig. 1Go and Table 1Go). All proteins associated with secretory vesicles did not increase, however, as Rab3a levels remained constant, as did total levels of Rab3A plus Rab3B, assayed by an antibody that recognizes both forms. Accumulation of synaptotagmin I also did not change.



View larger version (45K):
[in this window]
[in a new window]
  		Figure 1. Immunoblots after electrophoresis of neurosecretory proteins in cells treated with insulin, estradiol, and epidermal growth factor (T) and in untreated cells (C). Amounts of lysate, or in the case of synaptobrevin, of membranes, equivalent to equal numbers of cells were added to each lane.

 

View this table:
[in this window]
[in a new window]
  		Table 1. Summary of experiments of induction of neurosecretory proteins with estradiol, insulin, and epidermal growth factor

 
The changes were not limited to proteins with the ability to associate with secretory granules, because levels of synaptophysin, a protein found in membranes of synaptic-like microvesicles (32), but not in secretory granules, were also increased over 2-fold with hormone treatment (Fig. 1Go and Table 1Go). Frequenin, or neuronal Ca2+ sensor 1, is a Ca2+-binding protein found associated strongly with synaptophysin and to a lesser extent with dense core secretory granules in PC12 cells (33). Overexpression of frequenin enhanced exocytosis, probably through a regulatory mechanism (33). Although the expression of frequenin was first described at the neuromuscular junction (34), it is also heavily expressed in chromaffin cells and other secretory cell types (33) (Jeromin, A., and J. Roder, unpublished results). Hormone treatment caused less accumulation of frequenin than synaptophysin (Fig. 1Go and Table 1Go).

Synaptobrevin on secretory vesicles forms complexes with two proteins found primarily on the plasma membrane, syntaxin and SNAP-25 (3); complex formation is necessary for and precedes the step of membrane fusion that causes exocytosis. Syntaxin is also a member of a family with several isoforms; the anterior pituitary gland expresses primarily syntaxin IA (30). Hormone treatment of GH4C1 cells increased SNAP-25 levels over 4-fold in this series of experiments, with little or no effect on syntaxin I (Fig. 1Go and Table 1Go). There was variation in the amount of induction of SNAP-25 from experiment to experiment, but in all the experiments performed, SNAP-25 accumulation increased in hormone-treated cells compared with that in untreated cells.

Microvesicles and secretory granules are structures that occur relatively late in the secretory pathway and are found in specialized cells. The beginning of the secretory pathway, the endoplasmic reticulum, into which secretory proteins are transported as they are synthesized is a structure all cells have in common. The lumen of the endoplasmic reticulum contains many proteins that assist in protein folding. We examined the effect of hormone treatment on proteins that are localized primarily in the lumen of the endoplasmic reticulum (35). There was little or no effect on calnexin, GRP94 (glucose-regulated protein 94), or ERP72 (endoplasmic reticulum protein 72); there were only slight effects on GRP78 (also called BiP), ERP60, and protein disulfide isomerase (Fig. 2Go, Table 2Go). Cyclophilin B, a cis-trans peptide prolyl isomerase found in the secretory pathway (36, 37), was induced over 2-fold. As with SNAP-25, the amount of induction of cyclophilin B showed variation among experiments, but the accumulation of the protein was induced in each experiment. Therefore, treating GH4C1 cells with estrogen, insulin, and epidermal growth factor had a selective effect on the induction of proteins early in the secretory pathway as well as in later, more specialized stages.



View larger version (49K):
[in this window]
[in a new window]
  		Figure 2. Immunoblots of proteins located in the endoplasmic reticulum in GH4C1 cells treated with insulin, estrogen, and epidermal growth factor (T) and in untreated cells (C). Amounts of lysates equivalent to equal number of cells were added to each lane.

 

View this table:
[in this window]
[in a new window]
  		Table 2. Summary of experiments of induction of proteins located in the endoplasmic reticulum by treatment that induces PRL storage

 
We previously found that the induction of ICA512 had characteristics resembling the induction of secretory granule accumulation in GH4C1 cells (17). Therefore, we examined induction of the protein, SNAP-25, whose accumulation was stimulated the most, to determine whether that were the case for induced proteins other than ICA512. The induction of SNAP-25 was a slow process, taking days to reach a maximum effect (Fig. 3Go), a characteristic also true of secretory granule accumulation and ICA512 accumulation (38). Unlike secretory granule accumulation, however, the induction of SNAP-25 was as great with epidermal growth factor alone as it was with all three factors combined (Fig. 4BGo). In contrast, epidermal growth factor alone did not induce accumulation of synaptotagmin III (Fig. 4AGo).



View larger version (15K):
[in this window]
[in a new window]
  		Figure 3. Time course of induction of SNAP-25 by estradiol, epidermal growth factor, and insulin. Data are the mean ± SE of three experiments.

 


View larger version (21K):
[in this window]
[in a new window]
  		Figure 4. Induction of SNAP-25 and synaptotagmin III by estrogen, epidermal growth factor, or insulin alone and in combination. Data are expressed as the ratio of that found in treated cells to untreated cells in the same experiment. Each value is the mean ± SE of three or more experiments. A, Synaptotagmin III; B, SNAP-25. E, Estradiol; EGF, epidermal growth factor; IN, insulin.

 
Increased accumulation of SNAP-25 may be caused by increased synthesis or increased stability of the protein. We measured the rate of synthesis of SNAP-25 in control and treated cells by [35S]amino acid incorporation followed by immunoprecipitation and then gel electrophoresis (Fig. 5Go) to determine whether its synthesis was increased by hormone treatment. In three experiments, the synthesis of SNAP-25 in cells treated with the hormone combination was 0.94 ± 0.1-fold that in control cells. Because there was no increase in SNAP-25 synthesis, accumulation may have been caused by increased stability. About 50% of the SNAP-25 that was synthesized in a 20-min pulse was degraded by 4 h, and there was a more slowly turning over component of this newly synthesized SNAP-25, as some was still present 16 h later (not shown), although at these longer times the weakness of the signal relative to background made quantification of the signal inaccurate. We were unable to detect a difference in turnover rate at short time periods when [35S]SNAP-25 could be accurately detected. An interpretation consistent with the lack of change in synthesis is that the difference in accumulation of SNAP-25 is caused by increased stability of one or more slowly turning over components.



View larger version (29K):
[in this window]
[in a new window]
  		Figure 5. Synthesis of SNAP-25 in hormone-treated and untreated GH4C1 cells. Untreated (C) or estradiol-, insulin-, and epidermal growth factor-treated (T) GH4C1 cells were incubated with [35S]amino acids for 20 min and then subjected to lysis, followed by immunoprecipitation of SNAP-25.

 
Proteins in the early part of the secretory pathway were not induced coordinately with SNAP-25, as we found no stimulation of GRP78, ERP60, or cyclophilin B by estradiol, insulin, or epidermal growth factor alone (not shown). We were unable to distinguish [35S]amino acid incorporation into cyclophilin B from incorporation into background proteins, and therefore could not measure the effects of hormone treatment on cyclophilin B synthesis. The induction of cyclophilin B protein accumulation, however, was not reflected by an increase in cyclophilin B messenger RNA (mRNA; Fig. 6Go), so induction of accumulation must occur by increased translation of the message or increased stabilization of the protein.



View larger version (50K):
[in this window]
[in a new window]
  		Figure 6. Northern analysis of cyclophilin B in hormone-treated and untreated GH4C1 cells. RNA was extracted from untreated (C) or estradiol-, insulin-, and epidermal growth factor-treated (T) cells, and equal amounts of RNA were loaded on the lanes. A, Cyclophilin B sequences; B, cyclophilin A sequences. The membrane was stripped and reprobed for cyclophilin A, a protein in the cytoplasm whose mRNA does not change in GH4C1 cells with hormone treatment (23 ), to serve as a control for sample loading.

 
GH4C1 cells are heterogeneous in hormone production, and the amount of PRL in individual cells varies widely in hormone-treated cultures (13). We found heterogeneity similar to what has been described previously, assessing PRL location by immunofluorescence and confocal microscopy (Fig. 7Go). Immunostaining for cyclophilin B was relatively homogeneous regardless of whether the cells stained for PRL (Fig. 7AGo), and the pattern of cyclophilin B localization was the same in cells treated with hormone or not treated (not shown). In cells that made PRL, there was little overlap of PRL with cyclophilin B, which resides in the endoplasmic reticulum, so that most of the PRL immunofluorescence is likely to be either in the Golgi complex, the large structure near the nuclei, or in secretory granules, with PRL staining near the cell membranes.



View larger version (51K):
[in this window]
[in a new window]
  		Figure 7. Confocal microscopy of immunostained GH4C1 cells that were treated with hormones. The immunofluorescent stains in the panels are as follows: A, PRL (green) and cyclophilin B (red); B, PRL (green) and SNAP-25 (red); C, PRL (red) and frequenin (green); D, PRL (green) and GH (red); and E, PRL (green) and GH (red). Where the two stains colocalize, the color is yellow. In each case, there was no staining with the secondary antibody when nonspecific serum was used as the primary antibody.

 
The localization of neuroendocrine proteins was more heterogeneous. In other neuronal and neuroendocrine cells, SNAP-25 is primarily located on the plasma membrane, but Matsumoto et al. (5) found in GH4C1 cells that SNAP-25 was primarily in the cytoplasm in a punctate pattern, with some staining at the plasma membrane. We found a similar staining pattern in most GH4C1 cells (Fig. 7BGo). In GH4C1 cells treated with hormones, however, we saw an additional feature in some cells. SNAP-25 was heavily concentrated in protrusions that occurred from the surface of the cells (Fig. 7BGo). Not all cells had these protrusions, and there appeared to be no relation to PRL content, as the SNAP-25-enriched areas occurred in cells that stained for PRL as well as in cells that did not (Fig. 7BGo). In cells that made both PRL and SNAP-25, there was no evidence for colocalization, either in the cell or along the plasma membrane. These SNAP-25-enriched protrusions were seen much less frequently in GH4C1 cells that had not been treated with hormones. In two independent experiments, the mean values for cells with SNAP-25-enriched protrusions per 100 cells were 10.7 and 10.8 for hormone-treated GH4C1 cells, and 0.8 and 1.7 for cells not treated with hormones.

In PC-12 cells, frequenin was localized in the cytoplasm in a pattern suggesting that it was associated with secretory granules as well as with microvesicles (33). In hormone-treated GH4C1 cells, the localization of frequenin was usually dispersed in the cytoplasm, with occasional very small bright spots whose location varied from near the nucleus to near the membrane (Fig. 7CGo). There was no obvious colocalization with PRL in most cells. Occasionally in hormone-treated GH4C1 cells, we also detected heavy staining of frequenin in the plasma membrane or in protrusions from cells. The section in Fig. 7CGo shows a heavily stained area in the plasma membrane. SNAP-25 and frequenin rarely colocalized, either in the protrusions or in the cytoplasm (not shown). Cells with heavy patches of frequenin were less common than SNAP-25 in hormone-treated cells, averaging 0.75/100 cells in 1 experiment, with less than 0.1/100 cells in untreated cells in the same experiment.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Estradiol increases PRL storage and secretory granule accumulation in GH4C1 cells, a process that occurs over days and is enhanced by insulin and epidermal growth factor (13, 18). Induction of the accumulation of ICA512, a protein preferentially located in secretory granules, shows similar characteristics (17), suggesting the possibility that induction of ICA512 and accumulation of secretory granules might be related events. In this study, however, we found that treatment with the hormone combination has effects that are not limited to proteins associated with secretory granules or necessary for their function, but that proteins are affected in separate parts of the secretory pathway, including synaptophysin in synaptic-like microvesicles and cyclophilin B in the endoplasmic reticulum. The effects of hormone treatment, therefore, appear to be complex and to serve other functions in addition to increasing PRL storage, making it less compelling that the induction of ICA512 needs be directly related to PRL storage, although the connection remains possible. Although at this time the function of the hormonally induced effects is not known, there are several unusual specific aspects of the results of these investigations.

Treatment with the hormone combination caused a selective increase in the accumulation of proteins in the first part of the secretory pathway, the endoplasmic reticulum. Induction of accumulation was most pronounced for cyclophilin B, one of the proteins in the endoplasmic reticulum that facilitates folding (36). Accumulation of chaperones in the endoplasmic reticulum has been previously shown to be regulated through a process called the unfolded protein response, in which accumulation of unfolded proteins in the secretory pathway elicits a dramatic rapid increase in transcription of mRNAs coding for secretory pathway chaperone proteins (39). The increased accumulation of cyclophilin B protein in GH4C1 cells induced by hormone treatment differs from the unfolded protein response in that it is not accompanied by an increase in mRNA for cyclophilin B. More PRL is synthesized after hormone treatment, resulting in more PRL to fold in the endoplasmic reticulum, but increased PRL synthesis does not appear to cause more cyclophilin B to accumulate, because cyclophilin B appears relatively evenly distributed in GH4C1 cells regardless of whether they stained for PRL. In addition, treatment with epidermal growth factor alone did not increase cyclophilin B accumulation, although it increased PRL synthesis (23, 40). Therefore, the mechanism for inducing cyclophilin B must differ from previously described effects, but at this time the mechanism leading to its accumulation is obscure.

Hormone treatment also caused selective accumulation of some proteins in later parts of the secretory pathway. One of the most prominently affected is SNAP-25. SNAP-25 is present primarily on the plasma membrane in small punctate patches in anterior pituitary cells (4, 30). In GH4C1 cells, SNAP-25 is present in intracellular pools as well as on the plasma membrane (Ref. 5 and this study). SNAP-25 in the plasma membrane is not homogeneous, as about 10% of cells treated with hormones have large patches of SNAP-25 concentrated in protrusions from the cell surface. The 4-fold accumulation of SNAP-25 was not reflected by an increase in its synthesis, similar to our findings with ICA512 (17). Changes in synthesis of less than 4-fold that correspond with accumulation have been detected in GH4C1 cells (38), so we expect to detect changes if they occur. It is possible that hormone treatment increases the stability of SNAP-25, even though we failed to detect differences in the half-life of SNAP-25 at early times if a slowly turning over component that we cannot measure reliably is accumulating. The time course of SNAP-25 accumulation is consistent with stabilizing a component with a half-life of a day or more rather than hours (41). The accumulation of SNAP-25 in protrusions on GH4C1 cells may be such a slowly turning over pool.

SNAP-25 regulation is not the same in GH4C1 cells as it is in the normal rat pituitary gland. Estradiol decreases SNAP-25 mRNA levels in the normal gland (42), and there is less SNAP-25 protein in estrogen-induced tumors of the pituitary gland in Fisher 344 rats than in normal glands (43). Human prolactinomas have more SNAP-25, but not more Rab3A protein, than normal glands (44), so in this respect induction in GH4C1 cells resembles changes in human prolactinomas more than it does the induced tumors in Fisher 344 rats.

The presence of large concentrated patches of SNAP-25 on the plasma membrane of pituitary cells has not been previously reported. Childs and co-workers have shown that some cells in primary cultures of rat anterior pituitary glands have prominent bulges or protrusions that contain most of the hormones in those cells, gonadotropins and GH, as well as concentrated patches of the GnRH receptor (45, 46). The presence of both receptors and hormones indicates that these bulges are functional places of hormone release in the normal cells, and it is possible that SNAP-25 may be concentrated there as well. Whether formation of protrusions in GH4C1 cells is an incomplete differentiation to a structure similar to bulges in normal cells in culture or whether there are other functions associated with this structure is not known at this time.

Heterogeneity in GH4C1 cells and their parent cell line, GH3, has been known for some time. GH4C1 cells contain a range of PRL accumulation patterns and secretory granules (13). Cells may secrete predominantly PRL or GH or both hormones and may convert from secreting one to secreting the other without dividing (47, 48, 49, 50). We have shown here that cells are also heterogeneous in the amount and localization of SNAP-25. The investigations of the locations of PRL and GH also revealed that there is another kind of heterogeneity; there is intracellular heterogeneity in the secretory pathway of single cells in addition to the differences that exist among cells. PRL and GH did not always colocalize; in some cells that contained both PRL and GH, we found the two hormones in distinct regions of the cells. Alternate production of either GH or PRL at distinct times followed by conversion to production of the other by a single cell is one possibility to account for the different locations of PRL and GH. GH4C1 cells regulate PRL storage differently from GH storage (11, 13); further investigations of the reasons for the separate locations of GH and PRL may also increase the understanding of the mechanisms involved in storing protein hormones.


   Footnotes
 
1 This work was supported by a grant from the American Diabetes Association, NIH Grant DK-46097, and the Cell Biology Core of the Diabetes Endocrinology Research Grant. Back

Received March 9, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Thomas-Reetz AC, De Camilli P 1994 A role for synaptic vesicles in non-neuronal cells: clues from pancreatic ß cells and from chromaffin cells. FASEB J 8:209–216[Abstract]
  2. Bennett MR 1999 The concept of a calcium sensor in transmitter release. Prog Neurobiol 59:243–277[CrossRef][Medline]
  3. Ferro-Novick S, Jahn R 1994 Vesicle fusion from yeast to man. Nature 370:191–193[CrossRef][Medline]
  4. Majo G, Aguado F, Blasi J, Marsal J 1998 Synaptobrevin isoforms in secretory granules and synaptic-like microvesicles in anterior pituitary cells. Life Sci 62:607–616[CrossRef][Medline]
  5. Masumoto N, Ikebuchi Y, Matsuoka T, Tasaka K, Miyake A, Murata Y 1997 Involvement of SNAP-25 in TRH-induced exocytosis in pituitary GH4C1 cells. J Endocrinol 153:R5–R10
  6. Baldini G, Wang G, Weber M, Zweyer M, Bareggi R, Witkin JW, Martelli AM 1998 Expression of Rab3D N135I inhibits regulated secretion of ACTH in AtT-20 cells. J Cell Biol 140:305–313[Abstract/Free Full Text]
  7. Iezzi M, Escher G, Meda P, Charollais A, Baldini G, Darchen F, Wollheim CB, Regazzi R 1999 Subcellular distribution and function of Rab3A, B, C, and D isoforms in insulin-secreting cells. Mol Endocrinol 13:202–212[Abstract/Free Full Text]
  8. Aguado F, Majo G, Ruiz-Montasell B, Canals JM, Casanova A, Marsal J, Blasi J 1996 Expression of synaptosomal-associated protein SNAP-25 in endocrine anterior pituitary cells. Eur J Cell Biol 69:351–359[Medline]
  9. Coppola T, Perret-Menoud V, Luthi S, Farnsworth CC, Glomset JA, Regazzi R 1999 Disruption of Rab3-calmodulin interaction, but not other effector interactions, prevents rab3 inhibition of exocytosis. EMBO J 18:5885–5891[CrossRef][Medline]
  10. Tasaka K, Masumoto N, Mizuki J, Ikebuchi Y, Ohmichi M, Kurachi H, Miyake A, Murata Y 1998 Rab3B is essential for GnRH-induced gonadotrophin release from anterior pituitary cells. J Endocrinol 157:267–274[Abstract]
  11. Dannies PS 1999 Protein hormone storage in secretory granules: mechanisms for concentration and sorting. Endocr Rev 20:3–21[Abstract/Free Full Text]
  12. Orci L, Ravazzola M, Amherdt M, Madsen O, Perrelet A, Vassalli JD, Anderson RG 1986 Conversion of proinsulin to insulin occurs coordinately with acidification of maturing secretory vesicles. J Cell Biol 103:2273–2281[Abstract/Free Full Text]
  13. Scammell JG, Burrage TG, Dannies PS 1986 Hormonal induction of secretory granules in a pituitary tumor cell line. Endocrinology 119:1543–1548[Abstract/Free Full Text]
  14. Rabin DU, Pleasic SM, Shapiro JA, Yoo-Warren H, Oles J, Hicks JM, Goldstein DE, Rae PM 1994 Islet cell antigen 512 is a diabetes-specific islet autoantigen related to protein tyrosine phosphatases. J Immunol 152:3183–3188[Abstract]
  15. Solimena M, Dirkx R, Jr, Hermel JM, Pleasic-Williams S, Shapiro JA, Caron L, Rabin DU 1996 ICA 512, an autoantigen of type I diabetes, is an intrinsic membrane protein of neurosecretory granules. EMBO J 15:2102–2114[Medline]
  16. Lan MS, Lu J, Goto Y, Notkins AL 1994 Molecular cloning and identification of a receptor-type protein tyrosine phosphatase, IA-2, from human insulinoma. DNA Cell Biol 13:505–514[Medline]
  17. Lee MS, Dirkx Jr R, Solimena M, Dannies PS 1998 Stabilization of the receptor protein tyrosine phosphatase-like protein ICA512 in GH4C1 cells upon treatment with estradiol, insulin, and epidermal growth factor. Endocrinology 139:2727–2733[Abstract/Free Full Text]
  18. Kiino DR, Dannies PS 1982 Hormonal regulation of prolactin storage in a clonal strain of rat pituitary tumor cells. Yale J Biol Med 55:409–420[Medline]
  19. Matteoli M, Takei K, Cameron R, Hurlbut P, Johnston PA, Sudhof TC, Jahn R, De Camilli P 1991 Association of Rab3A with synaptic vesicles at late stages of the secretory pathway. J Cell Biol 115:625–633[Abstract/Free Full Text]
  20. Brose N, Petrenko AG, Sudhof TC, Jahn R 1992 Synaptotagmin: a calcium sensor on the synaptic vesicle surface. Science 256:1021–1025[Abstract/Free Full Text]
  21. Chilcote TJ, Galli T, Mundigl O, Edelmann L, McPherson PS, Takei K, De Camilli P 1995 Cellubrevin and synaptobrevins: similar subcellular localization and biochemical properties in PC12 cells. J Cell Biol 129:219–231[Abstract/Free Full Text]
  22. Rouiller I, Brookes SM, Hyatt AD, Windsor M, Wileman T 1998 African swine fever virus is wrapped by the endoplasmic reticulum. J Virol 72:2373–2387[Abstract/Free Full Text]
  23. Reaves BJ, Van Itallie CM, Moore HH, Dannies PS 1990 Prolactin and insulin are targeted to the regulated pathway in GH4C1 cells, but their storage is differentially regulated. Mol Endocrinol 4:1017–1026[Abstract/Free Full Text]
  24. Danielson PE, Forss-Petter S, Brow MA, Calavetta L, Douglass J, Milner RJ, Sutcliffe JG 1988 p1B15: a cDNA clone of the rat mRNA encoding cyclophilin. DNA 7:261–267[Medline]
  25. Martinez O, Goud B 1998 Rab proteins. Biochim Biophys Acta 1404:101–112[Medline]
  26. Novick P, Zerial M 1997 The diversity of Rab proteins in vesicle transport. Curr Opin Cell Biol 9:496–504[CrossRef][Medline]
  27. Redecker P, Cetin Y, Grube D 1995 Differential distribution of synaptotagmin I and rab3 in the anterior pituitary of four mammalian species. Neuroendocrinology 62:101–110[CrossRef][Medline]
  28. Lledo PM, Vernier P, Vincent JD, Mason WT, Zorec R 1993 Inhibition of Rab3B expression attenuates Ca(2+)-dependent exocytosis in rat anterior pituitary cells. Nature 364:540–544[CrossRef][Medline]
  29. Marqueze B, Boudier JA, Mizuta M, Inagaki N, Seino S, Seagar M 1995 Cellular localization of synaptotagmin I, II, and III mRNAs in the central nervous system and pituitary and adrenal glands of the rat. J Neurosci 15:4906–4917[Abstract]
  30. Jacobsson G, Meister B 1996 Molecular components of the exocytotic machinery in the rat pituitary gland. Endocrinology 137:5344–5356[Abstract]
  31. Mizuta M, Inagaki N, Nemoto Y, Matsukura S, Takahashi M, Seino S 1994 Synaptotagmin III is a novel isoform of rat synaptotagmin expressed in endocrine and neuronal cells. J Biol Chem 269:11675–11678[Abstract/Free Full Text]
  32. Becher A, Drenckhahn A, Pahner I, Margittai M, Jahn R, Ahnert-Hilger G 1999 The synaptophysin-synaptobrevin complex: a hallmark of synaptic vesicle maturation. J Neurosci 19:1922–1931[Abstract/Free Full Text]
  33. McFerran BW, Graham ME, Burgoyne RD 1998 Neuronal Ca2+ sensor 1, the mammalian homologue of frequenin, is expressed in chromaffin and PC12 cells and regulates neurosecretion from dense-core granules. J Biol Chem 273:22768–22772[Abstract/Free Full Text]
  34. Pongs O, Lindemeier J, Zhu XR, Theil T, Engelkamp D, Krah-Jentgens I, Lambrecht HG, Koch KW, Schwemer J, Rivosecchi R 1993 Frequenin–a novel calcium-binding protein that modulates synaptic efficacy in the Drosophila nervous system. Neuron 11:15–28[CrossRef][Medline]
  35. Kuznetsov G, Nigam SK 1998 Folding of secretory and membrane proteins. N Engl J Med 339:1688–1695[Free Full Text]
  36. Bose S, Mucke M, Freedman RB 1994 The characterization of a cyclophilin-type peptidyl prolyl cis-trans-isomerase from the endoplasmic-reticulum lumen. Biochem J 300:871–875
  37. Price ER, Zydowsky LD, Jin MJ, Baker CH, McKeon FD, Walsh CT 1991 Human cyclophilin B: a second cyclophilin gene encodes a peptidyl-prolyl isomerase with a signal sequence. Proc Natl Acad Sci USA 88:1903–1907[Abstract/Free Full Text]
  38. Kiino DR, Dannies PS 1981 Insulin and 17ß-estradiol increase the intracellular prolactin content of GH4C1 cells. Endocrinology 109:1264–1269[Abstract/Free Full Text]
  39. Sidrauski C, Chapman R, Walter P 1998 The unfolded protein response: an intracellular signalling pathway with many surprising features. Trends Cell Biol 8:245–249[CrossRef][Medline]
  40. Schonbrunn A, Krasnoff M, Westendorf JM, Tashjian Jr AH 1980 Epidermal growth factor and thyrotropin-releasing hormone act similarly on a clonal pituitary cell strain. Modulation of hormone production and inhbition of cell proliferation. J Cell Biol 85:786–797[Abstract/Free Full Text]
  41. Schimke RT, Doyle D 1970 Control of enzyme levels in animal tissues. Annu Rev Biochem 39:929–976[CrossRef][Medline]
  42. Jacobsson G, Razani H, Ogren SO, Meister B 1998 Estrogen down-regulates mRNA encoding the exocytotic protein SNAP-25 in the rat pituitary gland. J Neuroendocrinol 10:157–163[CrossRef][Medline]
  43. Majo G, Lorenzo MJ, Blasi J, Aguado F 1999 Exocytotic protein components in rat pituitary gland after long-term estrogen administration. J Endocrinol 161:323–331[Abstract]
  44. Majo G, Ferrer I, Marsal J, Blasi J, Aguado F 1997 Immunocytochemical analysis of the synaptic proteins SNAP-25 and Rab3A in human pituitary adenomas. Overexpression of SNAP-25 in the mammmosomatotroph lineages. J Pathol 183:440–446[CrossRef][Medline]
  45. Childs GV, Unabia G, Miller BT 1994 Cytochemical detection of gonadotropin-releasing hormone-binding sites on rat pituitary cells with luteinizing hormone, follicle-stimulating hormone, and growth hormone antigens during diestrous up-regulation. Endocrinology 134:1943–1951[Abstract/Free Full Text]
  46. Kaiser UB, Lee BL, Carroll RS, Unabia G, Chin WW, Childs GV 1992 Follistatin gene expression in the pituitary: localization in gonadotropes and folliculostellate cells in diestrous rats. Endocrinology 130:3048–3056[Abstract/Free Full Text]
  47. Boockfor FR, Hoeffler JP, Frawley LS 1985 Cultures of GH3 cells are functionally heterogeneous: thyrotropin-releasing hormone, estradiol and cortisol cause reciprocal shifts in the proportions of growth hormone and prolactin secretors. Endocrinology 117:418–420[Abstract/Free Full Text]
  48. Mogg RJ, Boockfor FR 1992 Single and dual hormone secretors in GH3 cultures respond differently to hypothalamic factors. Mol Cell Endocrinol 87:1–8[CrossRef][Medline]
  49. Kineman RD, Frawley LS 1994 Secretory characteristics and phenotypic plasticity of growth hormone- and prolactin-producing cell lines. J Endocrinol 140:455–463[Abstract/Free Full Text]
  50. Kakeya T, Takeuchi S, Takahashi S 2000 Epidermal growth factor, insulin, and estrogen stimulate development of prolactin-secreting cells in cultures of GH3 cells. Cell Tissue Res 299:237–243[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J Mol EndocrinolHome page
J. M Weiss, H. Huller, S. Polack, M. Friedrich, K. Diedrich, O. Treeck, G. Pfeiler, and O. Ortmann
Estradiol differentially modulates the exocytotic proteins SNAP-25 and munc-18 in pituitary gonadotrophs
J. Mol. Endocrinol., February 1, 2007; 38(2): 305 - 314.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. S. Lee, Y. L. Zhu, J. E. Chang, and P. S. Dannies
Acquisition of Lubrol Insolubility, a Common Step for Growth Hormone and Prolactin in the Secretory Pathway of Neuroendocrine Cells
J. Biol. Chem., January 5, 2001; 276(1): 715 - 721.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, M. S.
Right arrow Articles by Dannies, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, M. S.
Right arrow Articles by Dannies, P. S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals