help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gu, W.-X.
Right arrow Articles by Du, G.-G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gu, W.-X.
Right arrow Articles by Du, G.-G.
Endocrinology Vol. 142, No. 1 157-164
Copyright © 2001 by The Endocrine Society

ARTICLES

Mutual Up-Regulation of Thyroid Hormone and Parathyroid Hormone Receptors in Rat Osteoblastic Osteosarcoma 17/2.8 Cells1

Wen-Xia Gu, Paula H. Stern, Laird D. Madison and Guo-Guang Du

Department of Molecular Pharmacology and Biological Chemistry (P.H.S., G.-G.D.) and Center for Endocrinology, Metabolism and Molecular Medicine (W.-X.G., L.D.M.), Northwestern University Medical School, Chicago, Illinois 60611-3008

Address all correspondence and requests for reprints to: Guo-Guang Du, M.D., Department of Molecular Pharmacology and Biological Chemistry, Northwestern University Medical School, 303 East Chicago Avenue, Chicago, Illinois 60611-3008. E-mail: g-du{at}nwu.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PTH and thyroid hormone (T3) stimulate anabolic and catabolic processes in bone predominantly by acting on osteoblasts. Both inadequate and excessive secretion of either hormone can result in clinical bone disorders. In addition, T3 and PTH related peptide (PTHrP) have multiple effects on a wide number of other tissues modulating both cell differentiation and proliferation. To address the question of whether there might be functional mutual regulation of T3 receptors (TR) and PTH/PTHrP receptors (PTHR), we studied their expression and receptor-mediated intracellular effects in rat osteoblastic osteosarcoma (ROS) 17/2.8 cells. PTHR were up-regulated by T3 pretreatment (10-10–10-6 M) in ROS 17/2.8 cells in a dose-dependent manner. T3 pretreatment increased both PTH-induced cyclic AMP response element binding protein (CREB) phosphorylation and PTH-induced intracellular calcium transients, and further decreased PTH-induced down-regulation of alkaline phosphatase activity, suggesting that there are functional consequences of the PTHR up- regulation. Pretreatment with PTH (10-10–10-6 M) or PTHrP (10-9 M) for 3–4 days resulted in a dose-dependent up-regulation of TR in ROS 17/2.8 cells. cAMP analogues or a calcium ionophore were able to mimic the effect of PTH on TR binding, suggesting that either the cAMP-signaling pathway or Ca2+ could be involved in PTH-induced up-regulation of the TR. These observations provide a novel example of mutual interactions between nuclear receptors and membrane receptors and may have significant implications for the regulation of bone remodeling in health and disease.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
BOTH THYROID HORMONE (T3) and PTH have multiple critical roles in bone. Mice lacking thyroid hormone receptors (TR{alpha}1-/-, ß-/-) display retarded growth and bone maturation, especially a decrease in longitudinal bone growth (1). In children, hyperthyroidism can cause acceleration of growth and skeletal development (2), whereas hyperthyroidism may accelerate bone loss in adults (3). Conversely, hypothyroidism can be associated with retarded bone maturation and stunted growth. PTH is one of the most important regulators of bone physiology. Hyperparathyroidism can result in bone loss, whereas low-dose and intermittent pulses of PTH stimulate bone formation in animals and humans (4, 5). The fact that both T3 and PTH stimulate both anabolic and catabolic processes in bone raises interesting questions about their possible interactions and the potential physiologic roles of such coordinate actions. In human subjects, the renal response, as well as the bone response, to administration of PTH is much greater in hyperthyroidism, compared with the responses in hypothyroid or euthyroid subjects (6). These clinical observations suggest that PTH and T3 have synergistic actions and result in increased bone resorption. It is noteworthy that more than 50 cases of patients with coexistent hyperthyroidism and primary hyperparathyroidism have been reported (7, 8).

Osteoblasts seem to be the major direct cellular target of PTH and T3 action in bone, because these cells possess both PTH receptors (PTHR) and T3 receptors (TR). TR{alpha}, TRß, and PTHR have been characterized in cells of the osteoblast lineage (9, 10).

Other studies documented that T3 stimulates proliferation of rodent and human osteoblastic cells (11, 12), increases alkaline phosphatase activity (13), and increases production of osteocalcin (14), as well as bone collagen and noncollagen proteins (15). PTH increases DNA synthesis and induces the expression of early-response genes in rat osteoblastic osteosarcoma (ROS) 17/2.8 cells (16, 17). In contrast to these stimulatory effects, PTH decreases alkaline phosphatase activity and collagen synthesis (16, 17). These findings suggest that functional interactions between PTH and T3 could exist in osteoblasts.

Many hormones and growth factors likely influence the expression and function of PTH and PTH-related peptide (PTHrP) receptors, and certainly of T3 receptors. In the case of the PTHR, glucocorticoids and transforming growth factor-ß up-regulate PTHR in ROS cells (18, 19, 20). 1,25-dihydroxyvitamin D, tumor necrosis factor-{alpha}, and retinoic acid down-regulate PTHR and receptor mRNA expression (21, 22). Insulin and hydrocortisone increase TR{alpha} transcripts (23, 24), whereas interleukin 1ß, interleukin 6, and tumor necrosis factor-{alpha} down-regulate TR{alpha}- and TRß binding capacity in a liver cell line (25).

In addition, both PTH and T3 have been shown to affect the production of a number of growth factors and cytokines in osteoblasts (16, 25, 26). These factors also affect bone remodeling, adding to the potential and complexity of the system. Although it is reasonable to infer that there may be interactions between T3 and PTH in the regulation of these factors, there is only limited information regarding this possibility. The purpose of the current study was to determine whether there are mutual interactions between T3 and PTH at the receptor level in osteoblastic cells and, if so, to examine the mechanisms and consequences of these interactions.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents
L-3,5,3'-[125I]- triiodothyronine ([125I]-T3) was purchased from DuPont, NEN Life Science Products (Boston, MA), [125I]–[Nle8,Nle18,Tyr34] PTH(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34) ([125I]-PTH) and [{alpha}32P] deoxycytidine triphosphate were from Amersham Pharmacia Biotech (Arlington Heights, IL). Bovine PTH(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34) amide (PTH) was purchased from Bachem Bioscience Inc. (Torrance, CA), Anti-CREB (cyclic AMP response element bindng protein) and Anti-Ser133-phosphorylated CREB were from Upstate Biotechnology, Inc. (Lake Placid, NY), and AMV reverse transcriptase and Taq polymerase were from Promega Corp. (Madison, WI). All chemicals were obtained commercially and were of the highest purity available.

Cell culture
ROS 17/2.8 cells were a generous gift from the Endocrine Unit, Massachusetts General Hospital (Boston, MA), initially provided by Dr. Gideon Rodan (Merck Sharp & Dohme Laboratories, West Point, PA). Cells were maintained in Ham’s F12 Medium supplemented with 5% FBS (Life Technologies, Inc., Grand Island, NY), with or without resin-stripping, in a humidified atmosphere of 95% O2-5% CO2 at 37 C. Cells were plated at a density of 5 x 104 cells/cm2, and experiments were performed with confluent cells in 24-well plates. The medium was changed every other day until the cells reached confluence, and daily thereafter.

PTH receptor binding in ROS cells
Confluent ROS cells were maintained in 5% resin-stripped FBS F12 medium. It is necessary to deplete T3 from the supplemented serum for observing the action of T3, because bovine serum contains a significant level of T3 (27). The cells were rinsed initially with buffer containing 50 mM Tris (pH 7.7), 100 mM NaCl, 2 mM CaCl2, 2.5 mM KCl, 0.5% heat-inactivated FBS, and 5% heat-inactivated horse serum, and then incubated in this buffer with 2 x 105 cpm/ml of [125I]-PTH, in the presence or absence of unlabeled PTH (10-6 M) at 16 C for 4 h, as previously described (10). For Scatchard analysis, cells were incubated with [125I]-PTH in the presence of increasing concentrations of unlabeled PTH. Incubations were terminated by aspirating the supernatant and washing the cells with ice-cold binding buffer. Cell membrane-bound radioactivity was recovered by lysing the cells with 1 N NaOH, and radioactivity was determined in a {gamma} counter. Specific binding was determined by subtracting binding in the presence of unlabeled PTH (1 µM) from total binding.

Thyroid hormone receptor binding in ROS cells and calvaria
ROS 17/2.8 cells were lysed in 0.5% Triton X-100, 50 mM Tris.HCl (pH 7.5), and nuclear proteins subsequently extracted in 0.4 M KCl, 50 mM Tris.HCl, pH 7.5 (extract buffer). For calvaria experiments, calvaria were dissected and cultured with the treatments. The culture medium was changed daily. After 72 h, the calvarium was removed and homogenized with a Polytron. The pellet was resuspended and incubated at 4 C for 60 min in extract buffer. It was then centrifuged for 30 min at 13,000 rpm, and the nuclear protein extract was collected. Equal amounts of nuclear protein extracts were incubated with [125I]-T3, in the presence or absence of unlabeled T3 (4 x 10-6 M), at 4 C overnight, as previously described (28). Free and bound [125I]-T3 were separated by vacuum filtration through nitrocellulose membranes (Millipore Corporation, Bedford, MA). Radioactivity on membranes was counted with a {gamma} counter. Specific binding was determined by subtracting binding in the presence of unlabeled T3 (4 x 10-6 M) from total binding.

Western blot analysis
Cytosolic proteins were extracted in a solution (0.9 M NaCl, 50 mM Na2HPO4, 2.5 mM EDTA, 20 mM NaF, 1 mM phenylmethylsulfonyl fluoride, and 50 mM HEPES-Tris, pH 7.4) containing a protease inhibitor cocktail (Roche Molecular Biochemicals, Indianapolis, IN). Equal amounts of cellular protein extracts were resolved by 10% SDS-PAGE and transferred onto nitrocellulose filters. In each experiment, duplicate membranes were prepared. The membranes were incubated with 3% nonfat milk in PBS for 1.5 h and then incubated overnight at 4 C with rabbit polyclonal antibodies against either total CREB or Ser133-phosphorylated CREB. Immunoreactive proteins were detected using an antirabbit horseradish peroxidase-conjugated antibody and the enhanced chemiluminescence system (Amersham Pharmacia Biotech), as previously described (29). Antibody-antigen complexes were detected with X-Omat film (Eastman Kodak Co., Rochester, NY) and quantified with a densitometer.

RNA isolation, RT-PCR analysis
Cells were extracted in 4 M guanidine isothiocyanate. Total RNA was separated by ultracentrifugation. The pellet was solubilized in 0.1% SDS, precipitated with ethanol, and reconstituted in DEPC-H2O, characterized by agarose gel electrophoresis, and quantitated by spectrophotometer at A260. The RT-PCR assay methodology has been previously described in detail (30). In brief, 1 µg of RNA product was reverse transcribed using random hexamer priming. The complementary DNAs (cDNAs) were then amplified by PCR in the presence of [{alpha}32P]deoxycytidine triphosphate using primers for the PTH receptor (5'GTTGC-GCGTGCAGTGCAGCCGCCTAAAGTA3' and 5'GTGGATGCAGATGACGTCATGACTAAAGAG3'), as well as cyclophilin as an internal control. PCR reactions were separated on acrylamide gels and quantitated by a BAS 1000 phosphoImager (Fuji Photo Film Co., Ltd., Tokyo, Japan). The results are expressed as a ratio of integrated optical density of PTHR to cyclophilin.

Assay for alkaline phosphatase activity and protein concentration
For measurement of intracellular alkaline phosphatase activity, cells were first washed with PBS and then ruptured by repeated freeze-thaw cycles and sonication. Alkaline phosphatase activity was measured by the p-nitrophenyl phosphate method (31). Protein concentration was measured by the Bio-Rad Laboratories, Inc. protein assay (Hercules, CA)

Intracellular calcium measurements
Cells were harvested, washed, and suspended in a loading buffer consisting of 145 mM NaCl, 5 mM KCl, 1 mM MgCl2, 10 mM HEPES, 10 mM glucose, 1 mM CaCl2, and 1% BSA, pH 7.4. Cells were incubated with 2 µM fluo-3 AM (acetoxymethylester) (Molecular Probes, Inc., Eugene, OR), by gentle shaking for 30 min, in loading buffer at room temperature. The cells were centrifuged, washed, and resuspended in loading buffer at a concentration of approximately 106 cells/ml. An LS-5 luminescence spectrophotometer (Perkin-Elmer Corp., Foster City, CA) was used for fluorometric determinations (excitation/emission: 505/530 nm). After a 1-min baseline recording, test solutions were added, and the maximal fluorescence was measured. The intracellular calcium concentrations, in nM quantities, were calculated by the following formula: [Ca2+]i = Kd x (F - Fmin)/(Fmax - F), where Kd is the dissociation constant for fluo-3 (400 nM), Fmax is the maximal fluorescence measured by addition of digitonin (40 µM), Fmin is the fluorescence of cell suspension without fluo-3 loading, and F is the measured fluorescence of sample in the cuvette.

Statistical analysis, binding parameters
Data are means ± SEM. Statistical significance was determined by ANOVA and post test. Differences were considered significant at P <= 0.05 (1); P < 0.01 (**); and P < 0.001(***). Parameters of binding were determined from the Scatchard plots using the Prism software (GraphPad, San Diego, CA).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Effect of T3 on [125I]-PTH binding
Pretreatment of ROS 17/2.8 cells with T3 (10-10–10-6 M) in F12 medium supplemented with 5% resin-stripped serum, for 3 days, resulted in a biphasic dose-dependent increase in [125I]-PTH(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34) binding, compared with binding in the vehicle-treated control cells (Fig. 1AGo). Maximal specific binding (144% of control) was seen with 10-7 M T3. The time point for measurement was selected from a time-course experiment (Fig. 1BGo), which demonstrated that the effect on binding started from day 1 and reached a plateau (134% of control) after 3 days of incubation with T3 (10-8 M).



View larger version (35K):
[in this window]
[in a new window]
  		Figure 1. Effect of T3 on [125I]-PTH-specific binding in ROS 17/2.8 cells. Confluent cells were incubated in F12 medium supplemented with resin-stripped FBS for 2 days, then treated with different doses of T3 or vehicle (C) for 3 days, respectively. Media were renewed daily. PTH receptor binding was then assayed as described in Materials and Methods. Statistical significance was determined by ANOVA and post test. *, P < 0.05; **, P < 0.01; ***, P < 0.001. A, Dose-response curve of effect of T3 (10-10–10-6 M) and vehicle (C) on [125I]-PTH-specific binding. Data are means and SEM of 3 determinations and are representative of two experiments, both of which gave similar results. B, Time course of effect of T3 (10-8 M) and vehicle (C) on [125I]-PTH-specific binding. Data are means and SEM of 4 determinations. Panel C, Scatchard plot of effect of T3 (10-8 M) and vehicle (C) on [125I]-PTH-specific binding. Cells were incubated with [125I]-PTH in the presence of increasing concentrations of unlabeled PTH for 16 h at 4 C. PTH receptor binding was then determined. B/F, Bound-to-free ratio. Data are from two experiments. D, Dose-response curve of effect of T3 (10-10–10-6 M) and vehicle (C) on cell growth. Cells were trypsinized and counted at the end of a 3-day treatment. Data are means and SEM of 4 determinations.

 
Scatchard analysis showed that T3 increased [125I]-PTH binding sites by approximately 38%, from 42,963 binding sites/cell (control) to 59,441 binding sites/cell (T3-treated). The binding affinity was changed minimally (Fig. 1CGo). There was no significant difference in cell numbers after pretreatment of ROS 17/2.8 cells with T3 (10-10–10-6 M) for 3 days (Fig. 1DGo). Therefore, the enhanced binding was attributable principally, if not totally, to an increase in available PTH receptors, rather than to altered receptor binding affinity or cell proliferation.

Effect of T3 on PTH receptor mRNA expression
RNA was extracted from control ROS 17/2.8 cells and cells treated with T3 (10-7 M) for 3 days, respectively. RT- PCR analysis revealed that the level of the PTH receptor transcripts was increased 44% by T3, as compared with the control (Fig. 2Go).



View larger version (17K):
[in this window]
[in a new window]
  		Figure 2. RT-PCR of PTH receptor mRNA expression in ROS 17/2.8 cells. Confluent cells were treated with T3 (10-7 M) or vehicle (C) in F12 medium supplemented with resin-stripped FBS for 3 days. Cell lysate RNA was extracted. RT-PCR was performed as described in Materials and Methods. PTHR primers were used to amplify the PTH receptor cDNA. Primers for cyclophilin were used as internal standards. A, Representative autoradiograph [the lanes labeled 3 and 7 denote the cDNA sample volume (µl) used for PCR]; B, quantitative results expressed as arbitrary units of integrated OD (IOD), calculated as a ratio of the expression of PTHR to cyclophilin.

 
Effect of T3 on PTH receptor function
PTH induces intracellular calcium transients in osteoblastic cells (32). The increase reaches a peak within 15 sec. Pretreatment of ROS 17/2.8 cells with T3 (10-8 M) for 3 days potentiated the calcium signal elicited by PTH (4 x 10-9 M) (Fig. 3AGo). The difference in the [Ca2+]i response was 34 nM (48 nM in T3-treated; 14 nM in control). The increase in PTH-induced intracellular calcium signals is consistent with the up-regulation of the PTH receptor by T3.



View larger version (28K):
[in this window]
[in a new window]
  		Figure 3. T3 pretreatment enhances PTH-induced functional response in ROS 17/2.8 cells. Confluent cells were incubated with F12 medium supplemented with resin-stripped FBS for 2 days, then treated with T3 (10-8 M), PTH (10-8 M), or vehicle (C) for 3 days, respectively. Media were renewed daily. A, Effect of T3 on PTH-induced intracellular calcium transients. Cells were trypsinized, centrifuged, and resuspended in loading buffer with 2 µM fluo-3 AM (acetoxymethylester). Calcium transients were elicited by PTH (4 x 10-9 M) as described in Materials and Methods. B, Effect of T3 on PTH-induced CREB phosphorylation. Cytosolic proteins were extracted, and Western blot analysis was performed with antibodies against pCREB or total CREB, respectively, as described in Materials and Methods. The ratio of pCREB to total CREB was determined using densitometry and expressed as arbitrary units of IOD. The data are representative of two experiments. Panel C, Effect of PTH and/or T3 on alkaline phosphatase activity. Confluent cells were either treated with PTH (10-8 M), T3 (10-8 M), PTH (10-8 M) plus T3 (10-8 M), or vehicle for 3 days, respectively. Alkaline phosphatase activity was then assayed as described in Materials and Methods. Data are means and SEM of 4 determinations and are representative of two experiments.

 
PTH induces phosphorylation of CREB through cAMP-dependent protein kinase A (33). Pretreatment of ROS 17/2.8 cells with T3 (10-8 M) for 3 days, followed by a 10-min pulse of PTH (10-8 M), potentiated PTH-induced CREB phosphorylation, increasing by 2.4-fold, compared with controls that were not treated with T3 (Fig. 3BGo). It is likely that the enhanced CREB phosphorylation is a consequence of the T3 stimulated up-regulation of the PTHR.

T3 increases alkaline phosphatase activity, and PTH down-regulates alkaline phosphatase activity in ROS 17/2.8 cells (13, 17). After pretreatment of ROS 17/2.8 cells with T3 (10-8 M) and/or PTH (10-8 M) for 3 days, the alkaline phosphatase activity of PTH-treated cells decreased (34.9 ± 0.8% of control). Cotreatment with PTH and T3 resulted in a further decrease to 15.5 ± 3.6%, compared with the control cells (Fig. 3C).

Effect of PTH/PTHrP on [125I]-T3 binding
Pretreatment of ROS 17/2.8 cells with PTH (10-10–10-6 M) for 4 days resulted in a dose-dependent increase in [125I]-T3 binding, compared with the controls (Fig. 4AGo).



View larger version (18K):
[in this window]
[in a new window]
  		Figure 4. Effect of PTH on [125I]-T3-specific binding in ROS 17/2.8 cells. Confluent cells were incubated in F12 medium and treated with a different dose of PTH or vehicle (C) for 4 days, respectively. Media were renewed daily. T3 receptor binding was then assayed as described in Materials and Methods. Statistical significance was determined by ANOVA and post test. *, P < 0.05; **, P < 0.01; ***, P < 0.001. A, Dose-response curve of effect of PTH (10-10–10-6 M) and vehicle (C) on [125I]-T3-specific binding. Data are means and SEM of 3 determinations. B, Time course of effect of PTH (10-8 M), PTHrP (10-8 M), and vehicle (C) on [125I]-T3-specific binding. Data are means and SEM of 2–4 determinations. Panel C, Scatchard plot of effect of PTH (10-8 M) on [125I]-T3-specific binding. Cells were incubated with [125I]-T3 in the presence of increasing concentrations of unlabeled T3, overnight at 4 C. T3 receptor binding was then assayed as described in Materials and Methods. B/F, Bound-to-free ratio.

 
Maximal specific binding in cells treated with PTH (10-6 M) was 314% of that seen in controls. The time course of the effect of PTH (10-8 M) on [125I]-T3 binding showed a maximal effect (245%) on day 3 (Fig. 4BGo). Scatchard analysis of the binding data indicated that the apparent binding affinity for T3 was similar in PTH-treated and control cells. Calculation of the number of binding sites per cell revealed that there was an approximately 48% increase in the number of T3 binding sites in PTH-treated cells, compared with the control cells (7,845 binding sites/cell in the controls; 11,629 binding sites/cell after PTH treatment) (Fig. 4CGo). Pretreatment of ROS 17/2.8 cells with PTHrP (10-9 M) for 4 days also increased [125I]-T3 binding to 155%, compared with the controls (Fig. 4BGo). Because the PTH receptor studied could be activated by both ligands (PTH and PTHrP), it is likely that the relevant receptor is the PTH/PTHrP receptor (see 35).

Effect of PTH/PTHrP on [125I]-T3 binding in calvaria
PTH treatment not only increased [125I]-T3 binding in the osteoblastic cell line but also in mouse calvaria (Fig. 5Go). This is logical in that the osteoblast is probably the major cell type in the calvaria. For these studies, mouse calvaria were pretreated with PTH (10-8–10-6 M) or PTHrP (10-8 M) for 3 days. [125I]-T3 binding was increased to 353% and 174%, respectively, compared with the controls.



View larger version (35K):
[in this window]
[in a new window]
  		Figure 5. Effect of PTH/PTHrP on [125I]-T3-specific binding in mouse calvaria. Eight-day-old mice calvaria were incubated in DMEM containing 10% heat-inactivated horse serum and treated with different doses of PTH (10-8–10-6 M), PTHrP (10-8 M), or vehicle (C) for 3 days, respectively. Media were renewed daily. Bone was homogenized, and cytosolic proteins were extracted. T3 receptor binding was then assayed as described in Materials and Methods. Data are means and SEM of 3 determinations and are representative of two experiments. Statistical significance was determined by ANOVA and post test. **, P < 0.01; ***, P < 0.001.

 
cAMP analogues or calcium ionophore can mimic PTH effects on TR binding
Several signal transduction pathways are activated by ligand binding to the PTH/PTHrP receptors. The predominant responses in these cells are the activation of adenylate cyclase and increased intracellular calcium. As shown in Fig. 6AGo, both forskolin (a potent activator of adenylate cyclase) and 8-Br-cAMP (a cAMP analog) were able to increase [125I]-T3 binding in ROS 17/2.8 cells. Also, (Fig. 6BGo) ionomycin (a calcium ionophore) increased [125I]-T3 binding in ROS 17/2.8 cells, whereas phorbol-12,13-dibutyrate (10-7 M) (a protein kinase C stimulator) had no effect. In other studies, concentrations of 10-9–10-6 M phorbol-12,13-dibutyrate were also ineffective (data not shown). This suggests that either the cAMP pathway or Ca2+ signaling may be involved in the PTH-induced up-regulation of TRs.



View larger version (21K):
[in this window]
[in a new window]
  		Figure 6. Effect of activation of signaling pathways on [125I]-T3-specific binding in ROS 17/2.8 cells. A, Effect of forskolin (FSK) or Br-cAMP on [125I]-T3-specific binding in ROS 17/2.8 cells. Confluent cells were incubated in F12 medium containing either 10 µM FSK, 100 µM Br-cAMP, or 10-8 M PTH for 3 days. Media were renewed daily. T3 receptor binding was then assayed as described in Materials and Methods. Data are means and SEM of 3 determinations and are representative of two experiments. Statistical significance was determined by ANOVA and post test. **, P < 0.01; ***, P < 0.001. B, Effect of phorbol-12,13-dibutyrate and ionomycin on [125I]-T3-specific binding in ROS 17/2.8 cells. Confluent cells were incubated in F12 medium containing either 10-7 M phorbol-12,13-dibutyrate (PDBu) or 10-6 M ionomycin (Iono) for 4 days. Media were renewed daily. T3 receptor binding was then assayed as described in Materials and Methods. Data are means and SEM of 3 determinations and are representative of two experiments. Statistical significance was determined by ANOVA and post test. *, P < 0.05; **, P < 0.01.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The intricate balance of concomitant bone resorption and formation is critical for the maintenance of bone metabolism and structure. Both processes are dependent on the action of osteoblasts and regulated by signals from systemic hormones and locally generated growth factors and cytokines. Among them, PTH and T3 play a particularly important role. The endocrine system offers a number of examples of mutual regulation of peptide and steroid hormone receptors. For example, thyroid hormone treatment has been shown to increase mRNA for cardiac membrane ß-adrenergic receptors, thereby potentially augmenting the cardiac responses to catecholamines (34). Glucocorticoids up-regulate, and 1,25-dihydroxyvitamin D down-regulates, PTH receptors in osteoblastic cells (19, 21). Because of the influence of both the T3 and PTH/PTHrP receptor pathway on bone biology, we addressed the question of whether these hormone systems modulate each other in bone cells. This study provides evidence for a positive regulation of the PTH/PTHrP membrane receptors by T3, and of T3 nuclear receptors by PTH. This illustrates that these hormones can act indeed in a synergistic fashion.

Our results indicate that PTHRs were up-regulated by T3 pretreatment (10-10–10-6 M) in osteoblastic ROS 17/2.8 cells (Fig. 1AGo, 2Go). The minimal effective dose of T3 was 10-10 M. Because 99.5% of T3 is normally bound to serum protein, after equilibrium the free T3 concentration in resin-stripped serum medium would be less than 10-11 M, which is in the human physiological range. Moreover, T3 pretreatment increased both PTH-induced intracellular calcium transients and PTH-induced CREB phosphorylation (Fig. 3Go, A and B), possibly through up-regulation of PTHR by T3 treatment. In ROS 17/2.8 cells, T3 enhances (and PTH decreases) alkaline phosphatase activity, and cotreatment of PTH/T3 results in augmented decrease of enzyme activity (Fig. 3CGo). This suggested that the effect of PTH on alkaline phosphatase activity is predominantly receptor-mediated, and that T3-induced up-regulation of PTHRs results in potentiation of the suppressive effect of PTH on alkaline phosphatase. Because T3 can stimulate cell proliferation in certain circumstances, the number of cell membrane receptors could be increased by this mechanism. Although [3H]-thymidine incorporation was slightly increased in T3-treated cells (data not shown), there were no significant changes in cell number when cells were cultured in medium containing resin-stripped serum (Fig. 1DGo). Therefore, the enhanced [125I]-PTH binding was attributable principally, if not totally, to an increase in available PTH receptors, rather than to altered receptor binding affinity or cell proliferation.

T3 receptors were up-regulated in ROS 17/2.8 cells, after pretreatment with PTH (10-10–10-6 M) for 3–4 days, in a dose-dependent manner (Fig 4Go). This up-regulation of TR binding was also seen after PTHrP (10-9 M) treatment. This suggests that the effects are mediated through a PTH/PTHrP receptor, i.e. a type 1 receptor. As of now, three subtypes of PTHRs have been characterized: type 1 is activated by both PTH and PTHrP; type 2 is activated by PTH only; and type 3 is activated by PTHrP only (35).

Pretreatment with either PTH or PTHrP likewise increases [125I]-T3-specific binding in mouse calvaria (Fig 5Go) and osteoblastic UMR106 cells (data not shown). This demonstrates that PTH/T3 interactions were not restricted to ROS 17/2.8 cells but also occur in other cells of the osteoblast lineage. Both cAMP analogues and the calcium ionophore, ionomycin, were able to mimic PTH effect on TR binding (Fig. 6Go, A and B), suggesting that either the cAMP-signaling pathway or increases in intracellular calcium could mediate PTH-induced up-regulation of TR.

Scatchard analysis showed that T3 (10-8 M) and PTH (10-8 M) increased the binding sites for the other hormone by approximately 38% and 48% per cell, respectively. This increase could be at the level of transcriptional regulation of the receptors. Regulation of PTH/PTHrP and TR receptor binding and mRNA expression by other hormones have been reported. PTH/PTHrP receptor availability was up-regulated (87%) by hydrocortisone (2 x 10-7 M); and simultaneously, the level of receptor transcripts was also increased in ROS 17/2.8 cells (18, 19). In the case of the TR, insulin up-regulated nuclear thyroid hormone binding (60%) and increased TR{alpha} mRNA expression in bovine aortic endothelial cells (23).

The mechanism of T3/PTH interactions is still unclear. The TR{alpha}1 promoter contains three putative CRE and one putative TPA site (36), and TRß1 promoter contains one putative TRE (37). All of these elements could be potentially regulated by PTH through phosphorylation of CREB, TR, AP1, or other thyroid receptor auxiliary proteins and coregulators, including calmodulin. TR not only can bind to TRE but also can interact with Jun and Fos (38), as well as with RXR, which are potential targets for TR activation of PTHR expression, because the PTHR promoter contains putative AP-1 and RXRß sites (39).

In conclusion, the present experiments demonstrate that PTH treatment increases the number of thyroid hormone receptors in osteoblastic ROS 17/2.8 cells in a time- and dose-dependent manner. Conversely, T3 treatment increases the number of PTH receptors and receptor transcripts in ROS 17/2.8 cells as well. This is a novel example of mutual regulation between nuclear receptors and membrane receptors, an observation that has significant implications for the regulation of bone remodeling. Further characterization of the involved TR isoforms, the signaling pathways, and the regulation of the promoter regions of both the PTH/PTHrP receptors and TRs may shed further light on these interactions.


   Acknowledgments
 
The authors thank Dr. Peter Kopp for his useful comments and advice.


   Footnotes
 
1 This work was supported by Buehler Research Grant 1999 from the Buehler Center on Aging, McGaw Medical Center, Northwestern University (to G.-G.D.) and a research grant from the Department of the Army, DAMD 17-96-1-6304 (to P.H.S. and L.D.M.). A portion of these studies was presented at the Second Joint Meeting of The American Society for Bone and Mineral Research, 1998, San Francisco, CA, and the 10th International Congress of Endocrinology, 1996, San Francisco, CA. Back

Received June 14, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gothe S, Wang Z, Ng L, Kindblom JM, Barros AC, Ohlsson C, Vennstrom B, Forrest D 1999 Mice devoid of all known thyroid hormone receptors are viable but exhibit disorders of the pituitary-thyroid axis, growth, and bone maturation. Genes Dev 13:1329–1341[Abstract/Free Full Text]
  2. Saggese G, Bertelloni S, Baroncelli GI 1990 Bone mineralization and calcitropic hormones in children with hyperthyroidism: effect of methimazole therapy. J Endocrinol Invest 13:587–592[Medline]
  3. Fraser SA, Anderson JB, Smith DA, Wilson GM 1971 Osteoporosis and fractures following thyrotoxicosis. Lancet 1:981–983[Medline]
  4. Oxlund H, Ejersted C, Andreassen TT, Torring O, Nilsson MH 1993 PTH (1–34) and (1–84) stimulate cortical bone formation both from periosteum and endosteum. Calcif Tissue Int 53:394–399[Medline]
  5. Ejersted C, Andreassen TT, Oxlund H, Jorgensen PH, Bak B, Haggblad J, Torring O, Nilsson MH 1993 Human PTH (1–34) and (1–84) increase the mechanical strength and thickness of cortical bone in rats. J Bone Miner Res 8:1097–1101[Medline]
  6. Castro JH, Genuth SM, Klein L 1975 Comparative response to parathyroid hormone in hyperthyroidism and hypothyroidism. Metabolism 24:839–848[CrossRef][Medline]
  7. Arem R, Lim-Abrahan MA, Mallette LE 1986 Concomitant Graves’ disease and primary hyperparathyroidism influence of hyperthyroidism on serum calcium and parathyroid hormone. Am J Med 80:693–698[CrossRef][Medline]
  8. Regal M, Paramo C, Luna-Cano R, Perez-Mendez LF, Sierra JM, Rodriguez I, Garcia-Mayor RV 1999 Coexistence of primary hyperparathyroidism and thyroid disease. J Endocrinol Invest 22:191–197[Medline]
  9. Williams GR, Bland R, Sheppard MC 1994 Characterization of thyroid hormone (T3) receptors in three osteosarcoma cell lines of distinct osteoblast phenotype: interactions among T3, vitamin D3, and retinoid signaling. Endocrinology 135:2375–2385[Abstract]
  10. Xie LY, Leung A, Segre GV, Yamamoto I, Abou-Samra AB 1996 Down-regulation of the PTH/PTHrP receptor by vitamin D3 in the osteoblast-like ROS 17/2.8 cells. Am J Physiol 270:E654–E660
  11. Ernst M, Froesch ER 1987 Triiodothyronine stimulates proliferation of osteoblast-like cells in serum-free culture. FEBS Lett 220:163–166[CrossRef][Medline]
  12. Kassem M, Mosekilde L, Eriksen EF 1993 Effects of triiodothyronine on DNA synthesis and differentiation markers of normal human osteoblast-like cells in vitro. Biochem Mol Biol Int 30:779–788[Medline]
  13. Sato K, Han DC, Fujii Y, Tsushima T, Shizume K 1987 Thyroid hormone stimulates alkaline phosphatase activity in cultured rat osteoblastic cells (ROS 17/2.8) through 3,5,3'-triiodo-L-thyronine nuclear receptors. Endocrinology 120:1873–1881[Abstract/Free Full Text]
  14. Rizzoli R, Poser J, Bürgi U 1986 Nuclear thyroid hormone receptors in cultured bone cells. Metabolism 35:71–74
  15. Kawaguchi H, Pilbeam CC, Raisz LG 1994 Anabolic effects of 3,3',5-triiodothyronine and triiodothyroacetic acid in cultured neonatal mouse parietal bones. Endocrinology 135:971–976[Abstract]
  16. Canalis E, Centrella M, Burch W, Mccarthy TL 1989 Insulin-like growth factor-I mediates selective anabolic effects of parathyroid hormone in bone cultures. J Clin Invest 83:60–65
  17. Bai XY, Yu WH, Li PF, Gu WX, Zhou AR, Stern PH, Du GG The proliferative effect of parathyroid hormone on osteoblast-like ROS 17/2.8 cells. Program of the 80th Annual Meeting of The Endocrine Society, New Orleans, LA, 1998, p 244 (Abstract)
  18. Yamamoto I, Potts Jr JT, Segre GV 1988 Glucocorticoids increase parathyroid hormone receptors in rat osteoblastic osteosarcoma cells (ROS 17/2). J Bone Miner Res 3:707–712[Medline]
  19. Urena P, Iida-Klein A, Kong XF, Jüppner H, Kronenberg HM, Abou-Samra AB, Segre GV 1994 Regulation of parathyroid hormone (PTH/PTH-related peptide) receptor messenger ribonucleic acid by glucocorticoids and PTH in ROS 17/2.8 and OK cells. Endocrinology 134:451–456[Abstract/Free Full Text]
  20. Mc Cauley LK, Beecher CA, Melton ME, Werkmeister JR, Jüppner H, Abou-Samra AB, Segre GV, Rosol TJ 1994 Transforming growth factor-ß1 regulates steady-state PTH/PTHrP receptor mRNA levels and PTHrP binding in ROS 17/2.8 osteosarcoma cells. Mol Cell Endocrinol 101:331–336[CrossRef][Medline]
  21. Titus L, Jackson E, Nanes MS, Rubin JE, Catherwood BD 1991 1,25-dihydroxyvitamin D reduces parathyroid hormone receptor number in ROS 17/2.8 cells and prevents the glucocorticoid-induced increase in these receptors: relationship to adenylate cyclase activation. J Bone Miner Res 6:631–637[Medline]
  22. Schneider HG, Allan EH, Moseley JM, Martin TJ, Findlay DM 1991 Specific down-regulation of parathyroid hormone (PTH) receptors and responses to PTH by tumor necrosis factor {alpha} and retinoic acid in UMR 106–06 osteoblast-like osteosarcoma cells. Biochem J 280:451–457
  23. Hu RM, WU LM, Frank HJ, Pedram A, Levin ER 1994 Insulin stimulates thyroid hormone receptor alpha gene expression in cultured bovine aortic endothelia cells. Mol Cell Endocrinol 103:65–71[CrossRef][Medline]
  24. Satyanarayana M, Sarvesh A, Khadeer MA, Ved HS, Soprano DR, Rajeswari MR, Pieringer RA 1994 Regulation of neuronal thyroid hormone receptor alpha 1 mRNA by hydrocortisone, thyroid hormone and retinoic acid. Dev Neurosci 16:255–259[Medline]
  25. Wolf M, Hansen N, Greten H 1994 Interleukin 1 beta, tumor necrosis factor-alpha and interleukin 6 decrease nuclear thyroid hormone receptor capacity in a liver cell line. Eur J Endocrinol 131:307–312[Abstract/Free Full Text]
  26. Huang BK, Golden LA, Tarjan G, Madison LD, Stern PH 2000 Insulin-like growth factor 1 production is essential for anabolic effects of thyroid hormone in osteoblasts. J Bone Miner Res 15:188–197[CrossRef][Medline]
  27. Samuels HH, Stanley F, Casanova J 1979 Depletion of L-3,5,3'-triiodothyronine and L-thyroxine in euthyroid calf serum for use in cell culture studies of the action of thyroid hormone. Endocrinology 105:80–85[Abstract/Free Full Text]
  28. Tagami T, Gu WX, Peairs PT, West BL, Jameson JL 1998 A novel natural mutation in the thyroid hormone receptor defines a dual functional domain that exchanges nuclear receptor corepressors and coactivators. Mol Endocrinol 12:1888–1902[Abstract/Free Full Text]
  29. Duan WR, Shin JL, Jameson JL 1999 Estrodiol suppresses phosphorylation of cyclic adenosine 3',5'-monophosphate response element binding protein (CREB) in the pituitary: evidence for indirect action via gonadotrophin-releasing hormone. Mol Endocrinol 13:1338–1352[Abstract/Free Full Text]
  30. Besecke LM, Guendner MJ, Schneyer AS, Bauer-Dantoin AC, Jameson JL, Weiss J 1996 Gonadotropin-releasing hormone regulates follicle-stimulating hormone-ß gene expression through the activin/follistatin autocrine or paracrine loop. Endocrinology 137:3667–3673[Abstract]
  31. Grigoriadis AE, Petkovich PM, Rosenthal AE, Heersche JNM 1986 Modulation by retinoic acid of 1,25-dihydroxyvitamin D3 effects on alkaline phosphatase activity and parathyroid hormone responsiveness in an osteosarcoma cell line. Endocrinology 119:932–939[Abstract/Free Full Text]
  32. Lee SK, Stern PH 1995 Endothelin B receptor activation enhances parathyroid hormone-induce calcium signals in UMR 106 cells. J Bone Miner Res 10:1343–1351[Medline]
  33. Pearman AT, Chou WY, Bergman KD, Pulumati MR, Partridge NC 1996 Parathyroid hormone induces c-fos promoter activity in osteoblast cells through phosphorylated cAMP response element (CRE)-binding protein binding to the major CRE. J Biol Chem 271:25715–25721[Abstract/Free Full Text]
  34. Moalic JM, Bourgeois F, Mansier P, Machida CA, Carre F, Chevalier B, Pitarque P, Swynghedauw B 1993 Beta 1 adrenergic receptor and G alpha S mRNA in rat heart as a function of mechanical load and thyroxine intoxication. Cardiovasc Res 27:231–237[Abstract/Free Full Text]
  35. Jüppner H 1999 Receptors for parathyroid hormone and parathyroid hormone related peptide: exploration of their biological importance. Bone 25:87–90[Medline]
  36. Ishida T, Yamanchi K, Ishikawa K, Yamamoto T 1993 Molecular cloning and characterization of the promoter region of the human c-erb A alpha gene. Biochem Biophys Res Commun 191:831–839[CrossRef][Medline]
  37. Sakurai A, Miyamoto T, DeGroot LJ 1992 Cloning and characterization of the human thyroid hormone receptor ß1 gene promoter. Biochem Biophys Res Commun 185:78–84[CrossRef][Medline]
  38. Zhang XR, Wills KN, Husmann M, Hermann T, Pfahl M 1991 Novel pathway for thyroid hormone receptor action through interaction with jun and fos oncogene activities. Mol Cell Biol 11:6016–6025[Abstract/Free Full Text]
  39. Manen D, Palmer G, Bonjour JP, Rizzoli R 1998 Sequence and activity of parathyroid hormone/parathyroid hormone-related protein receptor promoter region in human osteoblast-like cells. Gene 218:49–56[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J Mol EndocrinolHome page
J H D. Bassett and G. R Williams
The skeletal phenotypes of TR{alpha} and TR{beta} mutant mice
J. Mol. Endocrinol., April 1, 2009; 42(4): 269 - 282.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gu, W.-X.
Right arrow Articles by Du, G.-G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gu, W.-X.
Right arrow Articles by Du, G.-G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals