| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
From The Diabetes Laboratories (S.M., S.H., L.H., E.E., V.S., J.S.B., P.O.T.), Pacific Northwest Research Institute, Seattle, Washington 98122; and the Division of Endocrinology (M.R.), the University of Wisconsin, Madison, Wisconsin 53792
Address all correspondence and requests for reprints to: Dr. Stewart Metz, Pacific Northwest Research Institute, 720 Broadway, Seattle, Washington 98122. E-mail: smetz{at}pnri.org
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We have presented evidence (10, 11) that a deficiency of intracellular content of guanine nucleotides (GNs; especially GTP) acutely modulates ß cell function by impairing insulin release. In preliminary studies, DNA synthesis was also markedly reduced (12, 13, 14), and eventually, apoptotic cell death ensued (12). Therefore, we proposed (15) that GTP starvation first inhibits the secretory ability and mitogenesis of ß cells, rendering them both quiescent (probably in the G0/G1 phase of the cell cycle) and also functionally incompetent. In the continued presence of stimulation (e.g. by high glucose), the effete ß cell, unable to respond to growth signals, is removed from the cell pool by programmed cell death.
The rate-limiting enzyme in the synthesis of new GNs is inosine-5'-monophosphate dehydrogenase (IMPDH), a soluble enzyme which converts IMP (derived via either the salvage or de novo synthetic pathways) to xanthosine monophosphate and from there to GNs. Studies in nonendocrine cells suggest that alterations in IMPDH and/or GTP content modify proliferation or differentiation and that there is an increase in IMPDH activity in rapidly growing and/or malignant cells. Mitogenic stimulation may even require the induction of a specific isoform of IMPDH [summarized in (15, 16)] That isoform (IMPDH 2) seems to be growth-related, whereas IMPDH 1 is constitutively active. IMPDH can be inhibited by mycophenolic acid (MPA) or other structurally—and mechanistically—dissimilar agents such as mizoribine [MZ; Ref. (17)]. These agents also block DNA synthesis and cell proliferation and conversely, may induce cell quiescence and differentiation (18, 19, 20, 21, 22, 23, 24). Such pharmacologic studies appear to have physiologic relevance because MPA not only has exceptional selectivity against IMPDH, in contrast to other enzymes of purine metabolism, but it also seems remarkably free of nonspecific effects on signal transduction in ß cells (12, 15, 18, 25, 26).
Similar studies of the effects of GTP synthesis on cell proliferation
have not been carried out in endocrine cells. Studies of the role of
IMPDH in proliferation of the endocrine pancreas require the use of
intact ß cells, since glucose (which acts via generation of
intracellular messengers) is not only a major mitogen per
se, but is also required for the expression of the mitogenic
effects of other receptor-mediated factors such as insulin-like growth
factor (IGF)-1 (27). Herein, we use an approach with which
to assay inosine monophosphate dehydrogenase (IMPDH) activity in intact
ß cells provided with tritiated inosine or hypoxanthine. It takes
advantage of the observation (28) that if the purine ring
of inosine (or its degradation product hypoxanthine) is labeled with
tritium in the 2- and 8-positions, the action of IMPDH detritiates the
label at the 2- position (which is released into the medium and
quantified as an index of IMPDH); the second tritium remains on the
purine ring and can be used to follow the intracellular products of the
reaction:
 |
The expression of IMPDH is also assessed using RT-PCR and immunoblotting. Using these techniques, we compare the effects of MPA and MZ, and physiologic agonists, on IMPDH activity and expression, to their effects on DNA synthesis, chiefly measured as bromodeoxyuridine (BrdU) incorporation. We provide strong evidence that IMPDH is, indeed, a competency factor for ß-cell proliferation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
b. Cells
ß-TC6 (29), ß-HC-13 (30), and
HIT-T15 (31, 32) cells were obtained from Dr. Paul
Robertson (Seattle, WA) from stocks originally provided by Drs. A.
E. Boyd III and D. Hanahan, respectively. They were used at passage
numbers 42–56, 15–26, and 76–82, respectively (numbered following
their receipt in Seattle). INS-1 cells (33) were a gift of
Dr. Claes Wollheim (Geneva, Switzerland), and were used mostly at
passages 50–53. ß-TC-tet cells (34, 35) were a generous
gift of Dr. Shimon Efrat (Tel Aviv, Israel). These cells are a
conditionally transformed cell line under the control of the bacterial
tet resistance operon which modulates the expression of SV40 large T
antigen (Tag) expression; addition of tetracycline (tet) to the growth
medium blocks Tag expression and cell growth. In the studies below,
tetracycline, when present, was provided at 1 µg/ml for 7–10 days of
culture. Cell growth was markedly inhibited by the presence of tet, as
indicated by a marked reduction in DNA content/well [2.28 ± 0.34
vs. 6.44 ± 1.34 µg DNA/well, tet vs.
control; n = 5–6 each] as well as in doubling times (0.5 ±
0.7 doublings over 6–8 days vs. 2.7 ± 0.6 in the
presence and absence of tetracycline, respectively;
± SD; n = 11 each
(also cf. Table 1
, below).
|
c. Assessment of IMPDH activity
Following culture, cells (1–2 x
104, in 24-well plates) were washed and studied
during a 21 h experimental incubation period (except where
indicated otherwise) in 1 ml of RPMI 1640 medium; where present,
unlabeled inosine and MPA or MZ, or their diluents, were added for the
final 4 h of this incubation period. Labeled substrate
(3H-inosine; 8 µCi/well in 250 µl of RPMI
1640 medium) was added for the final 3 h, except where indicated.
For studies of intact islets, incubation times were extended to 16
h, with MPA and 3H-inosine present throughout, to
reproduce the conditions of our previous studies (e.g. Refs.
10, 11) and to assure adequate permeation of label to
the ß-cell enriched inner core of cells. Intact, Sprague Dawley rat
islets were isolated from the pancreas and purified by hand picking as
described, with the recent modifications in (36). They
were cultured overnight in 60 x 15 mm Petri dishes in 2.5 ml of
RMPI 1640 medium), with the addition of 0.4 µM
radiolabeled inosine plus unlabeled inosine to bring the final
concentration to 6–16 µM. These studies were
approved by the Animal Care Committee of the University of
Wisconsin-Madison.
Following incubation, the cellular medium was removed; 250 µl was mixed with 625 µl of activated charcoal (100 mg/ml) to precipitate any residual unconverted extracellular 3H-inosine. This effect was virtually quantitative (data not shown). Islets, on the other hand, were transferred to 12 x 75 mm plastic tubes and were allowed to settle by gravity; 250 µl of media was then mixed with 625 µl of charcoal, vortexed, and centrifuged (1100 g x 10 min). Radioactivity remaining in the medium was then counted by scintillation spectroscopy. Values for IMPDH activity (i.e. cpm in charcoal-treated media) were always corrected for cell-free blanks (i.e. charcoal-nonprecipitable counts present in wells incubated exactly as described above except for the absence of cells). These values ranged from 1.3 to 2.8% of total cpm added. In some studies, 3H-inosine was replaced by 3H-hypoxanthine to eliminate potential variations in the rate of phosphorolysis of inosine to hypoxanthine, as well as to study a shorter period of stimulation (4 h of incubation, as vs. 21 h with inosine). For these studies, experimental perturbations were only present during the last four hours of the study. Each value in all studies represents the means of triplicate determinations.
Maximized conditions for the IMPDH assay were first determined. Residual intracellular inosine and hypoxanthine was found (6% of cell totals by barium acetate fractionation and 7% by TLC), indicating that substrate was not depleted during the incubation period. The detritiation of [2,8-3H] inosine was readily demonstrated in all cell preparations. The only other enzyme inducing similar detritiation as IMPDH is xanthine oxidase; however, addition of 50 µM allopurinol (a potent inhibitor of xanthine oxidase) had no effect on tritium release (not shown). Therefore, release of 3H can be specifically related to IMPDH activity. The dependence of IMPDH activity on substrate concentration was then assessed in ß cell lines by adding 0–50 µM unlabeled inosine to tracer amounts of labeled inosine. Relative IMPDH activities at various extracellular substrate (inosine) concentrations were obtained by multiplying radioactivity by the dilution factor (i.e. corrected for added unlabeled inosine). Studies to assess the intracellular generation of purine metabolites were carried out similarly to those described above, except that the total extracellular inosine concentration was 1.6 µM, and incubations were extended to 18–21 h to label relatively minor purines (i.e. GTP, GDP, IMP) sufficiently for quantitation by TLC, as well as to reproduce the period assessed during studies of mitogenesis.
To examine the effects of variations in GN availability on IMPDH activity, protein, and gene expression, cells were treated for 12–45 h with MPA (0.3 or 1.0 µg/ml), MZ (50 µg/ml), or guanosine (0 through 300 µM). Cells were then washed five times to remove as much as possible of the residual MPA, MZ, or guanosine, before the level of IMPDH activity and expression was assessed.
d. Expression of IMPDH: mRNA and protein
For assessments of gene expression, real-time,
semiquantitative RT-PCR using TaqMan technology was employed, as
described in (37). Total RNA was extracted from INS-1 or
ß-TC-tet cells using RNeasy mini-kit (QIAGEN,
Valencia, CA). One-step RT-PCR was carried out essentially as
described (37) using the Gold RT-PCR kit from
Perkin-Elmer Corp. Biosystems and an ABI Prism 770
sequence detector equipped with a thermocycler (TaqMan technology) and
a cooled CCD camera to detect fluorescence emission over a range of
wavelengths (500–650 nm). Amplification was for 40 cycles with
denaturation at 95 C for 15 sec, annealing and extension at 60 C for 1
min. Because a complete curve of amplification is developed over the
course of 40 cycles, analyses could be carried out solely within the
exponential range of amplification. Comparative analysis was then based
upon the cycle number at which a significant increase in the
amplification signal above threshold is detected.
Immunoblots for total cellular content of IMPDH were carried out as follows. Whole cell extracts of ß-TC-tet cells were prepared by washing cells with PBS, and lysing them in buffer containing 50 mM Tris-HCl (pH 7.5), 250 mM NaCl, 5 mM EDTA, 1% Ipegal (Sigma), 1% glycerol, and 1x complete protease inhibitors (Roche Molecular Biochemicals, Indianapolis, IN), using five freeze/thaw cycles in liquid N2/37 degree water bath. Lysates were spun down in a refrigerated microfuge at 15,500 rpm and supernatants were transferred to a fresh tube. Protein concentrations were determined using BCA protein assay kit (Pierce Chemical Co., Pittsburgh, PA). Ten or 20 µg of total protein was loaded on 12% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories, Inc., Chicago, IL). Western blot analyses were performed with mouse monoclonal anti-IMPDH at 1 µg/ml (a gift from Dr. F. Collart) and goat antimouse IgG-horseradish peroxidase (Santa Cruz Biotechnology, Inc. #SC-2005) at 1:2,000 dilution. Detection was by chemiluminescence (NEN Life Science Products, Pittsburgh, PA) and exposure to Kodak X-OMAT Blue XB-1 film. Relative levels of IMPDH protein were determined by densitometry using a Packard ScanJet IIcx/T with image analysis using DeskScan II version 2.6.
The oligonucleotide probe and primers used were:
IMPDH 1 probe: 6FAM-CCCTCCATAACTGAGTGGTCCACAGA-TAMRA
Forward primer: CTCTTACGAAAAGCGGCTGTACT
Reverse primer: GAAAGGAGCTGGAGAACCCGTAGT
IMPDH 2 probe: 6FAM-CCTCCATTCGTATGAGAAGCGGCTTTTC-TAMRA
Forward primer: GGAGCTTAAGTTTGAGAAGAGAACGT
Reverse primer: AGGTGTGCTGGATCCCTTTTC
The reporter dye was FAM and the quencher dye, TAMRA.
Data are expressed as the ratio between the IMPDH signal and that of a housekeeping gene (actin, or glyceraldehyde-3-phosphate dehydrogenase).
e. Assays for BrdU incorporation and proliferating cell nuclear
antigen (PCNA) content
Cells (5–15 x 104 per well)
were subcultured in 24-well plates and allowed to grow at least 2 days.
They were then synchronized in a quiescent state by a 21–24 h period
in low glucose (1.7 or 3.3 mM, except 0.4 mM
for HIT-T15 cells) in RPMI 1640 medium containing a reduced
concentration of FCS (0.2% or 0.5%). For the experimental period,
high serum (10%) and/or high glucose (11.1–16.7 mM,
except 5.6 mM for HIT-T15 cells) with or without other test
agents were added to the RPMI 1640 medium, for a final incubation
period of 21 h (except where indicated). The cells were loaded
with BrdU (final concentration = 10 µM) concurrent
with the addition of agonist(s) during this final 21 h. For
studies of the reversibility of MPA effects, synchronized cells were
treated for an initial 24 h with MPA or with its diluent. Cells
were then gently washed three times (5 min each) to allow residual drug
to exit the cells, and then were reincubated for 21 h with BrdU,
in the presence of MPA or its diluent.
BrdU incorporation was quantified using an enzyme-linked immunoassay method from Oncogene Science Products, Inc. (Cambridge, MA), mostly using modifications of the manufacturer’s directions. After washing, denaturation, and fixation, anti-BrdU serum (1:100) was added and incubated for 60 min, followed by three washes of the cells. Second antibody (peroxidase goat antimouse IgG HRP conjugate, 1:1000) was then added and incubated for another 30 min. Following washing, peroxidase substrate (tetramethylbenzidine; 100 µl/well) was added and cells were reincubated in the dark for 15 min. Color production was quantified within 5 min of adding stop solution using a spectrophotometric plate reader at a wavelength of 450 nm, with 490 nm as the reference wavelength. Two controls were assessed: cell-free wells, treated as described above, and one containing cells but no BrdU. These were barely detectable and were essentially identical to values from cells incubated in low glucose and low serum, indicating that the cells had indeed been rendered quiescent. Blank values were subtracted from experimental values. Each condition was assessed by at least quadruplicate determinations within each study. Since true basal values of DNA synthesis in quiescent cells were essentially undetectable, expression of stimulated values as a percentage of basal was considered meaningless.
For measurement of PCNA content, 2–4 x 104 INS-1 cells were plated and synchronized as described above. At the end of a 21-h final incubation in 0.2% serum/1.7 mM glucose, or 10% serum/16.7 mM glucose ± MPA 0.3 µg/ml, PCNA was extracted and measured by ELISA, as described by instructions in the kit (Oncogene, catalog no. QIA 59).
f. Assessments of purine nucleotide content
Following the removal of media used to measure IMPDH
activity, the cells were extracted twice using 10% ice-cold
trichloroacetic acid (TCA) followed by back-extraction using 500 µl
of cell extract; 1.26 ml diethylether was added, vortexed, and, after
phase separation, the top phase was drawn off and discarded. This
procedure was repeated three more times. The small amount of
TCA-insoluble material was not assessed further. The TCA extracts were
then either applied to PEI-cellulose TLC plates directly, or treated
with ethanolic barium acetate (which precipitates all phosphorylated
purines while leaving bases or nucleosides in solution. Extracts
(containing 2.5 µg each of unlabeled exogenous standards) were
applied to PEI-cellulose plates that had been developed first in 100%
MeOH and allowed to dry. The plates were then developed in a gradient
of LiCl2 (pH 
4.0), using 0.5 M
LiCl for 6 min, followed by 1.0 M for 10 min, then 1.5
M until approximately 1 cm from top of plate. Any tailing
of compounds using this system was eliminated by adding 40 mg/ml EDTA
to the solvent system. The Rf for the major
compounds of interest were: GTP, 0.12; ATP, 0.24; GDP, 0.32;
hypoxanthine, 0.37 (some overlap with ADP); ADP, 0.44; IMP, 0.50; and
inosine, 0.62. The identity of compounds was confirmed in initial
studies using a second TLC system (0.5 M sodium formate, pH
3.4, followed by development in 50% MeOH). Radioactivity in each spot
was quantified using a PhosphorImager (Cyclone Storage Phosphor System;
Packard Instrument Co., Meridien, CT) and a 12.5 x 25.2 cm
tritium-sensitive screen (Pt. no. 7001489). It was verified that, under
the conditions studied, the output from the PhosphorImager was in the
linear range and yielded similar results to those using scintillation
spectroscopy. For some studies used to quantify residual inosine or
hypoxanthine in the cells, barium precipitation was used with minimal
modifications from (38): 25.2 µl of 2 M
K2CO3 and 37.8 µl of 25%
barium acetate were added to 110 µl of cell extract. After vortexing,
657 µl of 95% ethanol was added. An aliquot of the supernatant was
used to assay the total intracellular content of unmetabolized inosine
plus hypoxanthine.
g. Soluble tetrazolium salt test for cell number and
viability
The details of the performance and interpretation of this test
in ß cells has been described by us in detail (39).
Cells were synchronized, then treated for 21 h with diluent
(DMSO), half-maximal concentrations of MPA (0.3 µg/ml) or MZ (20
µg/ml).
h. DNA content
Cells were extracted and assayed by the method of Rymaszewski
(40).
i. Data presentation and statistical analyses
Net flux through IMPDH was considered to be the absolute
accumulation in the medium of 3H (following
quantitative precipitation of unmetabolized inosine) over a 3-h
incubation period (16 h for intact islets), expressed as cpm per
well/DNA, after correction for blank values. However, the content of
radioactivity released into the medium could be influenced by total
cell uptake of label. Therefore, true enzymatic activity of IMPDH is
expressed as the ratio between total efflux of tritium and total cell
labeling (IMPDH activity, as percent of uptake), where total cell
labeling (Uptake) is calculated as the sum of tritium in medium (after
charcoal treatment) plus tritium remaining in cells (following TCA
extraction). The expression of IMPDH enzymatic activity in this fashion
was validated using specific inhibitors of IMPDH enzymatic activity
(see Results). TLC data are expressed as a percentage of the
sum of all labeled spots. Note that for these calculations, cpm
measured in the GN spots were multiplied by two, since they had lost
half of their radioactivity consequent to the action of IMPDH. BrdU
incorporation is expressed as absolute optical density readings (OD),
corrected for blanks. PCNA consists of two pools, only one of which
responds to mitogenic stimulation (41). Therefore, values
for cells kept under quiescent conditions were subtracted from
stimulated cells, to calculate the incremental response to stimulation.
The amount of PCNA is expressed as units/ml.
Data are presented as mean ± SEM for the number of replicates or experiments, as indicated. All major findings were confirmed on a minimum of three independent occasions. Single comparisons were analyzed by Student’s t test, paired t test, or (where two or more comparisons were required) by post hoc testing, following initial assessment by one- or two-way ANOVA. The concentration-dependent effects of glucose were assessed by one-sample ANOVA.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) ). Net flux through IMPDH
increased with inosine concentration (not shown) in all but one cell
line (HIT-T15 cells; see below); it approached or reached saturation at
the highest concentrations of inosine tested (25–50
µM). Assessment of IMPDH activity was unaltered
by such changes in extracellular concentrations of inosine
(e.g. 18.6 ± 2% of cellular uptake of label was
metabolized via IMPDH by INS-1 cells at 0.8 µM
inosine vs. 18.6 ± 1% at 25
µM inosine; n = 9 determinations each). In
contrast to substrate uptake, true IMPDH activity was not affected
by the proliferative rate (Table 1). These findings were observed in
each of a variety of ß-cell lines (ß-HC, ßTC, ß-TC-tet, and
INS-1). In addition, in preliminary studies, IMPDH activity was readily
detected in each of these six independent preparations of intact
islets, averaging 4772 ± 946 cpm/islet. However, in contrast to
other cell lines, the uptake of radiolabel into HIT-T15 cells was very
low (e.g. 23% of that observed using ßHC cells), and a
very high percentage (49–50%) of this incorporated inosine was
metabolized by IMPDH in HIT-T15 cells, whereas the comparable figure in
ßHC cells was only 19–20%. Furthermore, in comparison to other cell
lines, IMPDH activity reached apparent saturation at very low inosine
concentrations (<5 µM) in HIT-T15 cells. These
findings are in accord with previous data suggesting impairments of
several aspects of purine metabolism in HIT-T15 cells (see
Discussion). Therefore, these cells were not studied
further. Major conclusion. Both uptake of label, and activity of IMPDH, can be accurately quantified over a wide range of extracellular inosine (and presumably, intracellular IMP) concentrations, and both variables may be independently modulated.
b. Inhibition of IMPDH by MPA or MZ in intact islets or in
hyperplastic or transformed ß cells (Fig. 1; Tables 1 and 2)
MPA induced a potent and concentration-dependent inhibition of
IMPDH activity in all cell types. The inhibition by MPA was similar
when expressed as absolute flux through IMPDH into the medium, or as a
percentage of total label incorporated into cells. The
IC50 for MPA was in the range of 0.1–0.6 µg/ml
(1 µM MPA = 0.32 µg/ml) in all hyperplastic or
transformed cell lines, including ß-TC13 and ß-HC-9 cells (data not
shown). However, this figure was 
0.07 µg/ml for HIT-T15 cells. The
slower proliferative rates in quiescent ß-TC-tet cells (Table 1) was
accompanied by a shift to the right in the concentration dependence
curves for inhibition by MPA, either at a low or at a high inosine
concentration (Fig. 1). Additionally, in these studies a decrease in
sensitivity to MPA at 0.8 µM inosine, compared with that
at 25 µM inosine, was seen. These latter observations
support the unique uncompetitive nature of inhibition by MPA (see
Discussion). MZ also inhibited IMPDH in a
concentration-dependent fashion with an approximate
IC50 of 3 µg/ml in INS-1 or proliferating
ß-TC-tet cells, whether studied in synchronized or unsynchronized
cells (not shown). In intact islets, overnight (16 h) exposure to MPA
(25 µg/ml) inhibited IMPDH by 54 ± 4% at 25 µg/ml (n =
5), without changes in insulin or total protein content of the islets.
In these preliminary studies, this inhibition seemed to become
progressively greater as glucose concentration in the culture medium
rose (P < 0.05 by ANOVA; df 6; data not shown),
supporting our earlier findings (11) using inhibition of
GTP content, rather than IMPDH, as the end point. The fact that MPA or
MZ inhibited the ratio of label released into the medium, corrected for
total cell labeling, validates the use of this formula (% of total
uptake) to express true enzymatic activity.
|
|
) at 1
µg/ml (a concentration at which IMPDH was inhibited 80–86%). GTP
fell by 55%, whereas ATP fill only minimally (-6%). Most
dramatically, IMP rose to 206% of control (see Discussion).
In contrast, using the barium precipitation technique, intracellular
inosine plus hypoxanthine rose by only 33% from 5.9 ± 0.20 to
7.86 ± 0.57% (P < 0.05; one-tailed paired
t test; n = 5 experiments), a finding confirmed by TLC
assessments of cell content of inosine (Table 2). Thus, MPA increased
IMP formation out of proportion to any increase in inosine uptake (see
Discussion). Major conclusions. MPA or MZ potently inhibits IMPDH activity and GN content in all sources of ß cells, independently of substrate uptake.
c. Effects of mitogens on DNA synthesis
INS-1 cells were used for most studies of BrdU incorporation,
since they are relatively well differentiated, are responsive to
several mitogens, and have frequently been used in previous studies of
DNA synthesis in ß cells (27). The findings were,
however, confirmed using ß-TC-tet cells. Both cell lines demonstrated
substantial glucose-induced insulin release at normal or near-normal
EC50 for glucose (data not shown).
After 21 h of stimulation, high serum (10%) alone at low (1.7 or
3.3 mM) glucose, increased BrdU incorporation only
inconsistently. High glucose alone (16.7 mM at 0.2% serum)
modestly but consistently increased BrdU incorporation. However, the
response to both serum and high glucose combined was dramatically
synergistic (data not shown); therefore, this combination was chosen
for most studies. The effect of glucose (in the presence of 10% serum)
required its metabolism and was not merely an osmotic effect, since
3–0-methylglucose, mannitol, fructose, and L-glucose all
failed to reproduce the glucose effect (data not shown). The effects of
glucose on mitogenesis increased progressively from 1.7 through 16.7
mM glucose, at which point apparent saturation was reached.
Overall, the slopes of these glucose concentration-dependence curves
were similar at 0.5% FCS compared with that at 10% FCS. The effects
of mitogens seemed evident by 4 h after exposure to stimuli,
although these observations were at the limits of assay sensitivity.
Provision of guanosine (up to 300 µM), hypoxanthine, or
xanthosine (a precursor of GMP), failed to directly alter BrdU
incorporation by 21 h (data not shown), in the presence or absence
of either low or high concentrations of glucose or serum.
Major conclusions. Glucose or serum (especially in combination) rapidly increases DNA synthesis, although an increase in GNs alone probably does not.
d. Effects of the inhibition of IMPDH on DNA synthesis in ß cells
(Figs. 2, 3, and 4;
and Tables 3 and 4)
MPA led to a concentration-dependent inhibition of BrdU
uptake (Table 3). The concentration-dependence curves for inhibition of
IMPDH in INS-1 or ß-TC-tet cells were almost identical to those for
inhibition of BrdU incorporation. The concentrations inhibiting IMPDH
by 50% were mostly 0.1–0.6 µg/ml, whereas the
IC50 for BrdU incorporation was 0.3 µg/ml
(n = 5 complete concentration-response curves) (Fig. 2). The
inhibitory effect of MPA (generally studied at its
IC50) was abrogated by inclusion of guanine (100
µM; Fig. 2) or 200 µM guanosine (not
shown), but not by adenine (Fig. 2). Neither guanine nor adenine had
any stimulatory effects on mitogenesis by themselves (see below). MZ
(1–100 µg/ml) mimicked the inhibitory responses of MPA, with
IC50 of about 7 µg/ml (Fig. 3). The effects of
MZ were also prevented by guanine but not by adenine (Fig. 3). BrdU
incorporation was also assessed over 45 h, with MPA and BrdU
provided only in the final 21 h (Table 4). Under these conditions,
the induction of DNA synthesis in response to high glucose alone, or
serum alone (in the presence or absence of ketoisocaproic acid), was
clearly measurable. Stimulatory effects of either glucose or serum over
45 h were inhibited by MPA (Table 4) or MZ (data not shown),
changes that were prevented by guanosine. The effects on IMPDH
activity did not seem to be secondary to growth inhibition
because provision of interleukin-1ß (2.5–10.0 ng/ml for 21
h) markedly inhibited BrdU incorporation (by 48 ± 6%; n =
6) while inducing only a minor effect on IMPDH activity (-15%; n
= 6) and interleukin had no effect on uptake (data not shown). In each
of three experiments, MPA at its IC50 (0.3
µg/ml) also inhibited (by 46 ± 0.3%) the increment in total
cell content of a second marker of DNA synthesis (proliferating cell
nuclear antigen) upon induction by high glucose plus 10% serum
(5.32 ± 0.65 to 2.96 ± 0.58 U/ml, df 19; P
< 0.02).
|
|
|
|
|
e. Effects of ketoisocaproic acid (Fig. 4; Tables 3 and 4)
Ketoisocaproic acid (KIC) also induced a strong mitogenic response
in INS-1 cells or ß-TC cells, either in the presence or absence of
high serum concentration, and after either 21 or 45 h of
stimulation (Tables 3 and 4; Fig. 4). In the presence of 10% serum,
near-saturation was reached by as low as 500 µM KIC.
Another mitochondrial fuel, leucine (10–15 mM), provided
in the presence of 10 mM glutamine and 10% serum,
reproduced the effects of KIC (data not shown), which were likewise
inhibited by MPA or MZ. These effects were prevented by guanine or
guanosine but not adenine (Table 4). In these same studies, MPA also
markedly reduced, in parallel, the BrdU response to 10% serum plus
high glucose (not shown) in a guanine- or guanosine-sensitive fashion.
Likewise, MZ inhibited (df 14; P < 0.001) the effect
of serum plus glucose in ß-TC-tet(-) cells. In ß-HC cells, MPA
inhibited the effects of glucose plus serum by up to 85%
(P < 0.001; ANOVA), and of 10 mM
KIC plus serum by up to 73% (P < 0.001). Similar
results were seen in HIT-T15 cells as well.
Major conclusion. DNA synthesis induced by KIC also is dependent on adequate flux through IMPDH.
f. Relationship to insulin secretion or cell toxicity (Figs. 5 and 6;
Table 5)
Because both MPA and MZ markedly reduce insulin secretion
(10, 11), we considered the possibility that the blockade
of the high levels of insulin accumulating in the medium, with its
known proliferative effect, might explain the inhibitory effects of MPA
on mitogenesis. When bovine insulin (5 µM) was provided
during the experimental period, it did augment DNA synthesis somewhat,
especially in the presence of high glucose alone. However, under no
circumstance was insulin able to circumvent the inhibitory effects of
MPA (which were, in contrast, vitiated by guanosine in the same
studies; data not shown). Likewise, IGF-1 (10 nM)
progressively augmented glucose-, serum-, or glucose plus serum-induced
BrdU accumulation (Fig. 5); nevertheless, MPA was still able to inhibit
DNA synthesis under every condition (P < 0.001 by
one-way ANOVA). Thus, like insulin, IGF-1 was unable to prevent the
inhibitory effect of MPA. Assessments of IMPDH activity had been
carried out in the presence of added inosine; however, when 25
µM inosine was added, it did not alter BrdU
responses to MPA (data not shown).
|
|
|
), only minor and inconsistent changes were
seen, and these were considerably less than the decrements in BrdU
incorporation (Table 5). The number of unattached INS-1 cells in the
medium, and their viability, were also unaltered (not shown). In a
second well-differentiated cell line (ß-HC6), similar results were
seen. Additionally, the effects of MPA on BrdU uptake were totally
reversible using serum alone as stimulus (to 119 ± 10% of
control), and were largely reversible (to 82 ± 6% of control) in
the presence of serum plus glucose (Fig. 6). Major conclusions. Effects of IMPDH inhibitors cannot be ascribed to reductions in insulin accumulating in the medium, or to nonspecific cell toxicity.
g. Effects of mitogens on IMPDH activity (Table 6)
Glucose augmented IMPDH activity, whether the length of
stimulation was 4 or 21 h, and whether the label was
3H-inosine or
3H-hypoxanthine (Table 6). In contrast,
3–0-methyl glucose, L-glucose, or fructose failed to
reproduce the effects of glucose. The effect of glucose on IMPDH was
mimicked by 10 mM ketoisocaproic acid (139% of control;
n = 4 experiments; P = 0.035), whereas serum
(Table 6) had only a delayed and less consistent effect, compatible
with its inability to consistently augment mitogenesis by 21 h.
Glucose also increased the uptake of precursor; however, this effect
was not reproduced by KIC or serum after 21 h. After 45 h of
stimulation, however, serum or KIC did augment total uptake in
preliminary studies (n = 4 experiments; not shown). The effects of
glucose on both uptake of label (inosine or hypoxanthine) and on IMPDH
activity, whether measured after 4 or 21 h of stimulation, all
increased continuously in a concentration-dependent manner between 3.3
and 16.7 mM (P < 0.0001 for all
effects), and approached saturation by 16.7
mM glucose. The presence of effects of glucose on
IMPDH activity at 4 h mimicked the time point at which
glucose-stimulated mitogenesis was first detected (see above).
|
h. Effects of mitogens on IMPDH expression or protein (Fig. 7)
Using semiquantitative RT-PCR, it was first established that
INS-1 cells (Fig. 7), ß-TC-tet cells, or rat islets (not shown)
expressed IMPDH 2 and, with lower abundance, IMPDH
1. In addition, expression of IMPDH 1 and IMPDH
2 was readily observed by Northern blot analysis in INS-1, ß-HC,
or ß-TC cells with transcripts at 2.6 kb (type 1 IMPDH)
or 1.7 kb (type 2 IMPDH) (data not shown). IMPDH protein
was also detected in ßTC-tet cells; INS-1 cells could not be studied
because rat proteins are not recognized by the antibody used. To assure
that we could detect changes in gene expression or cellular content of
IMPDH protein, we first determined the responses to GTP depletion and
excess, as have others (23, 42). When MPA (1 µg/ml) was
applied to INS-1 cells for 21 h and then washed out, gene
expression of IMPDH 2 increased to 204% of diluent control
(1.87 ± 0.44 to 3.44 ± 0.50; ratios of IMPDH 2
to housekeeping gene; n = 6 pairs; P = 0.0003). A
lower concentration of MPA (0.3 µg/ml) had a similar, though smaller,
effect, whereas MZ also increased IMPDH 2 mRNA to 153% at
12 h and 296% of control by 24 h. MPA treatment also
increased IMPDH mass to 133 ± 14% of diluent control (n =
6; P < 0.004). In contrast, expression (mRNA) of the
constitutive isoform (IMPDH 1) did not change (not shown).
IMPDH activity also had increased from initial values from 26.3 ±
8 (diluent) to 32.6 ± 8% (df 6; P < 0.02) after
wash-out of MPA.2
|
Once it had been demonstrated that we were able to detect changes in IMPDH activity, expression, and protein, the responses to physiologic mitogens were assessed. Neither glucose nor serum (alone or in combination) detectably increased IMPDH 2 mRNA at 21 h. IMPDH protein was not increased by glucose or serum, alone or in combination (high glucose alone = 115 ± 9% of control; n = 5; P = ns; high glucose plus high serum = 92 ± 6% of control; n = 8; P = ns); serum alone = 74 ± 8% of control; n = 8; P = 0.014).
Major conclusions (Table 7).
IMPDH expression and activity are detectably modulated by classical
product feedback; that is, they are decreased by elevations in GN and
increased by GN depletion. However, the effects of glucose on IMPDH
activity cannot be explained by changes in gene expression, at least at
early time points. These data suggest that IMPDH 2 is regulated by at
least one more, unidentified mechanism other than changes in gene
expression, probably at the enzyme level (see Table 7 and
Discussion).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Intact cells were required because glucose, a major mitogen of
ß cells, must be metabolized intracellularly to exert its effects.
Cultured cells were used in most of the current studies because primary
ß cells from adult islets replicate extremely slowly, and detection
of decrements from basal level of 0.2–0.4% of dividing cells
(2, 46) would not be logistically possible. However,
the cell lines studied retained mitogenic responsiveness to all
physiologic agonists (as well as robust glucose-induced insulin
release). It was critical to include studies of several dissimilar cell
lines so that any findings could not be readily ascribed to any
peculiarity of a single cell line. Although the cell lines were derived
via very different approaches, they responded similarly. For example,
ß-TC13 cells, the ß-TC-tet line, and ß-HC cells, are all derived
from transgenic mice expressing the SV40 Tag under the control of the
insulin promoter. The former two are insulinoma cells, whereas ß-HC
cells (and quiescent ß-TC-tet cells) are hyperplastic ß cells and
are more differentiated. In further contrast, INS-1 cells are derived
from radiation-induced rat ß-cell tumors, whereas HIT-T15 cells are
clonal, being derived from Syrian hamster islets transformed by SV40.
Growth rates also differ between cell types. Thus, the observations
reported herein are not restricted in terms of clonality,
transformation, degree of differentiation, growth rate, species of
derivation, or expression of SV40 Tag, and therefore the conclusions
are likely to be physiologically relevant. Nonetheless, additional
studies involving proliferation of normal ß cells are desirable.
However, we did observe, in these and earlier studies
(25), that the HIT-T15 cells, although demonstrating
similar qualitative findings, displayed some quantitative abnormalities
in nucleobase uptake and/or incorporation of purine bases into cellular
pools. Therefore, HIT-T15 cells should be used only with extreme
caution in future studies as a model of purine physiology in ß
cells.
The assay was also validated, in part, by measurements of intracellular
purines. In addition to the expected decline of GNs induced by MPA, a
large percentage rise in IMP levels was seen, as observed in other
cells (47, 48, 49, 50). IMP can accumulate via four mechanisms: 1)
accumulation proximal to the block in IMPDH; 2) increases in
availability of the phosphoribosylpyrophosphate (PRPP) required for IMP
synthesis, due in turn to the loss of feedback by GNs
(51, 52, 53), which inhibits PRPP synthetase; 3) the GTP
dependence of conversion of IMP to AMP at the adenylosuccinate
synthetase step; and 4) inhibition by GNs of the retroconversion of AMP
back to IMP by adenosine deaminase (54). Thus,
measurements of the concomitant rise in intracellular IMP and its
derivatives may be a particularly useful index of IMPDH inhibition in
addition to decrements in GNs. In our studies, GTP fell by only 55% at
an MPA concentration that inhibited IMPDH activity by 80–86%.
Similarly, in the studies of Balzarini and De Clercq (28),
little or no decline in GTP was detected after a 5-h exposure to MPA,
by which time IMPDH had been inhibited by >30–50%.
b. Effects of mitogens and inhibitory effects of MPA or MZ
Marked inhibition of IMPDH in intact islets and in all ß-cell
lines tested was achieved by MPA or MZ, which are highly selective
inhibitors of IMPDH in ß cells and elsewhere (12, 15, 18, 26, 53). The unique nature of the uncompetitive inhibition by MPA of
IMPDH (55) was confirmed in the current studies, again
validating the assay. Uncompetitive inhibitors become increasingly
potent as substrate concentrations rise toward the
Vmax. Indeed, the inhibitory effect of MPA was
greater at the higher inosine concentration (see Fig. 1)
(55). Even when the effects of MPA were expressed in
relationship to the total cellular uptake of label, potent inhibition
was seen. Although the mass of intracellular IMP derived via the uptake
of inosine precursor cannot be rigorously assessed by these studies, it
is interesting to note that approximations of half-maximal IMPDH
activity for most of the cell lines occurred at 4–12
µM inosine. Taking into account the small amounts of
preformed IMP in cells, this figure is reasonably close to the
published Km of IMP for IMPDH in mammalian cells
(mean 20 µM; Refs. 55, 56, 57). Taken
together, these data suggest that this assay should be useful to
study IMPDH activity in many ß cell lines over a wide range of
endogenously formed intracellular IMP concentrations.
It is of interest that the inhibition induced by MPA seemed to be greater in faster-growing cells. Because precursor uptake was greater in these cells, they would indeed be predicted to be more sensitive to MPA, as indicated above. However, in addition, the inducible (type 2) isoform of IMPDH is the one implicated in previous studies of the role of IMPDH in cell cycle progression, mitogenesis, and cell survival (15, 20, 21, 58, 59). Isoform 2 of IMPDH is more sensitive to inhibition by MPA than is the constitutive isoform (60); this fact might also contribute to the greater sensitivity to MPA in rapidly proliferating cells. In all cell lines, however, either MPA or MZ induced a potent inhibition of BrdU incorporation at concentrations virtually identical to those inhibiting IMPDH. PCNA content [a measure of cell proliferation maximum in the late G1 and S phases (Refs. 41, 61)] was also inhibited by MPA. In addition, rigorous and extensive testing excluded nonspecific toxic effects as the cause of these effects. Thus, there can be little doubt that restriction of IMPDH activity severely hampers mitogenesis of ß cells.
Mitogens can rapidly increase the apparent uptake and phosphoribosylation of some nucleosides (62, 63, 64), an event that correlates with the onset of S phase (62). This increase in uptake is, in fact, largely due to intracellular retention of precursor when the availability of PRPP is increased (63, 64). This finding is particularly relevant to ß cells because glucose augments cellular content of PRPP (48, 65). This formulation is supported by the fact that another mitogenic fuel that is not a hexose (KIC) augmented IMPDH but not substrate uptake. Whatever the mechanism, an increase in net inosine or hypoxanthine uptake might mimic an increase in true IMPDH enzyme activity by providing increased substrate (IMP) availability. While glucose did increase label uptake, it also increased true IMPDH enzymatic activity. Thus, in ß cells, mitogens increase net flux through IMPDH by two mechanisms: 1) substrate uptake; and 2) direct modulation of enzyme activity. The mechanism(s) by which glucose or KIC increase true IMPDH activity with little or no change in gene expression, are unclear. At the least, glucose’s effect clearly requires its metabolism since four other unmetabolized, or poorly metabolized, sugars failed to mimic it. The regulation of both IMPDH activity and expression in general is very poorly understood. However, the possible mechanisms might include carboxyl methylation (or possibly other posttranslational modifications) at critical cysteine residues in the nucleotide binding site (66); end-product feedback mechanisms (56); and modifications of the Km for IMP or NAD (55). Additional studies will be required to address this question. It is of interest that, in contrast, spontaneous rates of proliferation of the cell lines seemed correlated in general with substrate uptake but not IMPDH activity. Thus, it seems likely that the mechanisms of growth stimulation differ between acute activation of mitogenesis and chronically elevated rates of cell division. This distinction has been largely overlooked in the extant literature.
c. Possible mechanisms, and Summary
The effects of MPA could not be attributed to secondary
decrements in ATP or ATP/ADP ratio, which declined little or not at all
(this study and Ref. 10); furthermore, adenine or
adenosine (which maintain normal ATP levels; Ref. 10) did
not restore cell proliferation. Parenthetically, the content of
cellular adenine nucleotides is probably maintained, at least in part,
by the large rise in IMP, which can be directly converted to AMP.
In contrast, the inhibition of proliferation by MPA or MZ was closely
related to inhibition of GNs. There is substantial evidence that the
effects of GNs on mitogenesis may be exerted at several levels. Some
are direct, including conversion to their deoxy derivatives, direct
incorporation into nucleotides, or support for GTP-dependent,
RNA-primed DNA synthesis (67). However, other, indirect
effects are likely present; these involve modulation of several key
regulators of the cell cycle. We reported that MPA reduced activity of
the cyclin D1/cyclin-dependent kinase 4(Cdk4)
cascade in neonatal rat islet cells (14); this observation
is of particular relevance in view of recent reports that targeted
disruption of Cdk4 in mice induces postnatal ß-cell hypoplasia and
diabetes (68, 69). We have also observed (Li, G., and S.
Metz; unpublished data) that GTP depletion induces
p21CIP1/WAF1, a potent cell cycle inhibitor
acting on several cyclin-dependent kinases, as well as on DNA
polymerase 
. Sherley et al. have suggested that the
effects of p53, another potent cell cycle inhibitor, may act via
changes in the expression and activity of IMPDH, since transfection
into cells of IMPDH reversed the inhibition of mitogenesis induced by
p53 (24, 70, 71). Finally, glucose does rapidly increase
GTP/GDP ratio in rat islets (36) and simultaneously
activates several MPA-inhibitable small GTP-binding proteins involved
in cell cycle progression (14, 15, 72). Evaluation of each
of these possible mechanisms will require additional studies.
In summary, adequate activity of IMPDH, acting via the production of GNs, appears to be required for cell cycle progression and DNA synthesis in ß cells—that is, it is a competence factor, as defined by Thompson (73). This modulation of IMPDH during mitogenesis does not appear to be a secondary epiphenomenon, since commensurate changes in IMPDH did not appear under several conditions (such as provision of serum or interleukin-1ß), wherein rates of mitogenesis were altered. However, it also seems unlikely that an increase in IMPDH activity can, per se, initiate DNA synthesis, as indicated by the lack of induction of DNA synthesis by providing precursors of GTP. Thus, increases in IMPDH activity might potentiate mitogenesis induced by physiologic fuels, or sustain it over time as a secondary effect. Such regulation of IMPDH may be germane to the differentiation, growth, and survival of ß cells (including those used for purposes of transplantation) as well as, possibly, other endocrine cells. Given that the concentrations of MPA that inhibit ß-cell proliferation and induce apoptosis (12) are well within the range of concentrations of MPA when used clinically as an immunosuppressive agent during transplantation (74), these observations may also have clinical relevance.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Note that this is a substantial underestimation,
since MPA is not easily washed from cells (Ref. 22 );
furthermore, such estimates include both the inducible and constitutive
isoforms of IMPDH, of which only the former can be physiologically
modulated.
Received July 17, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
