| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Third Department of Internal Medicine, Yamanashi Medical University, Tamaho, Yamanashi 409-3898, Japan
Address all correspondence and requests for reprints to: Toshimasa Onaya, Professor and Chairman, Third Department of Internal Medicine, Yamanashi Medical University, 1110 Shimokato, Tamaho, Yamanashi 409-3898, Japan. E-mail: onayat{at}res.yamanashi-med.ac.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In thyroid, it has been reported that TGF-ß1 is a potent inhibitor of growth and DNA synthesis in rat (5), porcine (6), and human (7) thyroid follicular cells (TFCs) as well as in other epithelial cell systems (2, 3). Differentiation markers of TFCs, such as Na+/I- symporter (NIS) (8, 9), thyroglobulin (TG) (10), and the TSH receptor (TSHR) (11) are also suppressed by TGF-ß1. TGF-ß1 synthesis at the messenger RNA (mRNA) level has been documented in follicular cell cultures derived from the thyroid glands of numerous species (12, 13). At present, it is thought that the potent suppression of thyroid growth and differentiation afforded by TGF-ß1 serves to modulate the effects of both TSH and other growth factors to maintain homeostasis of the thyroid gland (13).
Disordered regulation of intrathyroidal expression of TGF-ß1 has been implicated in the pathogenesis of various thyroid diseases. As may be predicted from its potent antiproliferative action, decreased TGF-ß1 expression and loss of TGF-ß1- responsiveness in thyroid cells have been reported in nontoxic goiter (14) and differentiated thyroid cancer (15). Excess intrathyroidal TGF-ß1 expression was reported as the reason for intrathyroidal fibrosis in myxedematous cretinism caused by selenium deficiency (16). Furthermore, the immunomodulatory effect of TGF-ß1 was documented in an animal model of autoimmune thyroiditis (17), and the molecular mechanism of TGF-ß1 action on down-regulation of major histocompatibility complex class I expression in FRTL-5 cells was recently detailed (18).
Despite the apparent involvement of TGF-ß1 in normal and pathological processes of the thyroid gland, our knowledge about the molecular mechanism of TGF-ß1 action on TFCs is very limited. Herein, we attempt to clarify the mechanism of TGF-ß1 action on the gene expression of TG, a thyroid-specific molecule necessary for the formation and storage of thyroid hormones, which also has recently been shown to have an autoregulatory function in the thyroid (19). The thyroid-specific expression of TG involves at least three thyroid-specific transcription factors: thyroid transcription factor-1 (TTF-1), thyroid transcription factor-2 (TTF-2), and Pax-8 (20, 21, 22, 23). We show that TGF-ß1 decreases Pax-8 DNA-binding activity by reducing its mRNA levels, which, in part, appears to be involved in a TGF-ß1-induced decrease in TG gene expression.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-32P] dCTP (3000 Ci/mmol) and
[
-32P] ATP (3000 Ci/mmol) were purchased
from Amersham Pharmacia Biotech (Arlington Heights, IL).
The sources of other materials have been detailed previously (24, 25).
Cells
FRTL-5 rat thyroid cells (CRL 8305, American Type Culture Collection (Manassas, VA) (26) were grown in a 5%
CO2-95% air atmosphere in Coon’s modified
Ham’s F-12 medium supplemented with 5% calf serum (Life Technologies, Inc., Grand Island, NY). The medium includes a
six-hormone mixture containing bovine TSH (10 mU/ml), insulin (10
µg/ml), human transferrin (5 µg/ml),
glycyl-L-histidyl-L-lysine (10 ng/ml),
somatostatin (10 ng/ml), and hydrocortisone (0.36 ng/ml). Cells were
passaged every 7–8 days and fed a fresh medium every 2–3 days. When
the cells were grown to 80% confluency, they were shifted to the basal
medium containing no TSH, and then maintained for 7 days until use.
These quiescent FRTL-5 cells were treated with indicated concentrations
of TGF-ß1, in the presence or absence of 10 mU/ml TSH. All cultured
cells were used before passage 20.
Northern blot analysis
Total RNA was isolated with a PERPECT RNA Kit (5 prime 3 prime,
Inc., Boulder, CO). Total RNA (10 µg per lane) was denatured,
electrophoresed on a 1% agarose gel, and then blotted by capillary
transfer onto a nitrocellulose membrane (Schleicher & Schuell, Inc., Keene, NH). After fixation at 80 C in a vacuum oven for
2 h, the membranes were prehybridized for at least 2 h at 42
C in 50% formamide, 5x Denhardt’s solution (0.2% Ficoll, 0.2%
polyvinilpyrolidone, and 0.2% BSA), 5x SSPE (20x SSPE = 3
M NaCI, 0.2 M sodium phosphate, and 20
mM EDTA, pH 7.4), 0.1% SDS, and 0.2 mg/ml heat-denatured
salmon sperm DNA. Hybridization was performed at 42 C for 24 h
with the radiolabeled probe in 50% formamide, 2.5x Denhardt’s
solution, 5x SSPE, 0.1% SDS, 10% dextran sulfate, and 0.1 mg/ml
heat-denatured salmon sperm DNA. Membranes were washed for 15 min at
room temperature in wash buffer A (6x SSPE, 0.5% SDS), for 15 min at
37 C in wash buffer B (1x SSPE, 0.1% SDS), and for 15 min at 65 C in
wash buffer B. An imaging plate was exposed to the membranes overnight,
and the results were quantitated using a Bas 2000 Image Analyzer
(Fuji Photo Film Co., Ltd., Tokyo, Japan). The
complementary DNAs (cDNAs) used in this report were as follows: The TG
(27), Pax-8 (23) and rat ß-actin cDNAs were
kindly donated by Dr. L. D. Kohn (NIH, Bethesda, MD). All probes
were radiolabeled with [-32P] dCTP using a
random primer labeling kit (Takara Shuzo Co., Tokyo, Japan).
Plasmids
Chimeric reporter plasmids incorporating genomic sequences of
the TG gene from -688 to +75, and -168 to +36 bp, were constructed by
PCR (25). TG promoter segments were amplified using
appropriate forward and reverse primers including a KpnI
site (5'-end) and BglII site (3'-end), to facilitate
directional cloning. Amplified fragments were ligated into the
KpnI-BglII sites of plasmid pGL2-Basic
(Promega Corp., Madison, WI). These luciferase (Luc)
constructs are designated pTG Luc (-688) and pTG Luc (-168),
respectively. Cloned inserts were sequenced in their entirety to ensure
against PCR-generated misincorporations. For experiments showing the
functional relevance of Pax-8 on the TG promoter, four
residues (underlined, see Fig. 6A
) of the Pax-8-binding
element were mutated both in an oligonucleotide probe and in the
construct having a minimal TG promoter, Oligo C PMT and pTG Luc
(-168PMT), respectively. The sequence of Oligo C PMT is as the
following:
5'-CACTACCACGTCAAGTGCTCTTGA-3'. To
generate a mutant construct, pTG Luc (-168PMT), the promoter segment
with mutations in the Pax-8-binding sequence was generated by PCR using
a forward primer that contained the mutated sequence in the
Pax-8-binding site with a KpnI site on the 5'-end
(5'-CGCAGGTACCGTCACCCTACTGATTACTCAAGTATTCTTAGCGGGAGCAGACTCAAGTAGAGGGAGTTCCTGTGACTAGCAGAGAAAACAAAGTGAGCCACTACCACGTCAAGTGCTCTTGAACAGTAG-3')
and the reverse primer described above. Pax-8 (23)
expression vector, pRc/CMV-Pax-8, was kindly donated by Dr. L. D.
Kohn (NIH). All plasmids were prepared using a Plasmid Maxi Kit
(QIAGEN, Chatsworth, CA).
|
Nuclear extracts
FRTL-5 cells were grown to approximately 80% confluency in TSH
(+) medium and then maintained in TSH (-) medium for 7 days. After
cells were exposed to the noted concentration of TGF-ß1 for the
indicated hours, nuclear extracts were prepared as described previously
(24, 25). Cells were washed twice with PBS and resuspended
in a 5 pellet volume of 0.3 M sucrose and 2% Tween-40 in
buffer A [10 mM HEPES-KOH (pH 7.9) containing 10
mM KC1, 1.5 mM MgCl2, 0.1
mM EDTA, 0.5 mM dithiothreitol (DTT), 0.5
mM phenylmethylsulfonylfluoride, 2 µg/ml leupeptin, and 2
µg/ml pepstatin-A]. After the cells were frozen in liquid nitrogen,
thawed, and gently homogenized, the suspension was layered onto 1.5
M sucrose in buffer A and centrifuged at 25,000 x
g in a swinging bucket rotor. Nuclei were washed with buffer
A and lysed in 2.5 volume of buffer B [10 mM
HEPES-KOH (pH 7.9), containing 420 mM NaCl, 1.5
mM MgCl2, 0.1
mM EDTA, 10% glycerol, 0.5
mM DTT, 0.5 mM
phenylmethylsulfonylfluoride, 2 µg/ml leupeptin, and 2 µg/ml
pepstatin-A]. Lysed nuclei were centrifuged at 15,000 x
g for 1 h, and used in electrophoretic mobility shift
assays (EMSAs).
EMSA
EMSAs were performed as described previously (24, 25). Synthesized, double-stranded oligonucleotides, Oligo C and
Oligo K (20), were labeled with
[-32P] ATP and T4
polynucleotide kinase, and then purified using a Quick Spin Column
(Roche Molecular Biochemicals, Indianapolis, IN). Two
micrograms of nuclear extracts were incubated in a 30 µl reaction
volume for 20 min at room temperature in the following buffer: 10
mM Tris-HCI (pH 7.6), 17 mM KC1, 1.7
mM MgC12, 1 mM DTT, 1
mM EDTA, 7% glycerol, 0.1% Triton X-100, and 0.5 µg
poly (dI-dC). Labeled probe (50,000 cpm; 
0.5 ng DNA) was added, and
incubation was continued for an additional 20 min at room temperature.
DNA-protein complexes were separated on 4.5% native polyacrylamide
gels. In experiments using antiserum to TTF-1 or Pax-8, nuclear
extracts were incubated with the antiserum or its control counterpart
in the same buffer for 30 min at room temperature before adding the
labeled probe and processing as above.
Others
Western blot analyses were performed as described previously
(25). Fifteen micrograms of each nuclear extract prepared
as above were analyzed on 0.1% SDS-10% PAGE, electrotransferred to
nitrocellulose membrane (Schleicher & Schuell, Inc.), and
immunodetected (29) by anti-Pax-8 antiserum
(25). Protein concentration was determined by Bradford’s
method (Bio-Rad Laboratories, Inc.), and recrystallized
BSA was used as a standard. All experiments were performed a minimum of
three times with similar results. Results of experiments were analyzed
using ANOVA.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). FRTL-5 cells were treated with
various concentrations of TGF-ß1 for 12 h, in the absence (-)
or presence (+) of TSH to verify the effect of TGF-ß1 on both
quiescent and proliferating thyroid cells. TG mRNA was detected as a
single band of about 8.5-kb in size, which is consistent with previous
reports (10, 27). Incubation of FRTL-5 cells with TGF-ß1
for 12 h had a concentration-dependent inhibitory effect on TG
gene expression, both in the absence and in the presence of TSH. Thus,
a significant decrease in TG mRNA levels was measured at 0.1 ng/ml,
near 50% inhibition occurred with 0.5 ng/ml, and maximal inhibition
was achieved with 5 ng/ml TGF-ß1 (Fig. 1). These results are similar
to a previous report by Colletta et al. (10),
where TGF-ß1 time-dependently reduced TG mRNA levels in both
quiescent and proliferating FRTL-5 cells. The molecular mechanism by
which TGF-ß1 acts to decrease TG gene expression in FRTL-5 cells, is
characterized below.
|
). Both
constructs expressed significantly higher activity compared with the
promoterless control plasmid, pGL2-Basic, which expressed very weak
activity (Fig. 2B). When TGF-ß1 was added to the basal medium
(-TSH), the promoter activities of both pTG Luc (-688) and pTG Luc
(-168) were significantly suppressed in a concentration-dependent
manner (Fig. 2B). The suppression by TGF-ß1 was also observed in the
presence of TSH (+TSH). The addition of TSH significantly increased the
luciferase activities of these two plasmids. However, the simultaneous
addition of TGF-ß1 and TSH significantly decreased the luciferase
activity compared with the activity seen with the addition of TSH
without TGF-ß1 (Fig. 2B). Promoterless pGL2-Basic showed very weak
basal activity and no responsiveness to TSH. There seems to be no
significant differences in the basal promoter activity or
TSH-responsiveness between pTG Luc (-688) and pTG Luc (-168). These
results are in conformity with the report that the minimal TG promoter,
170 bp sequence upstream of the transcription initiation site, is
enough for full promoter activity of TG (30). Also, there
seems to be no significant difference in the TGF-ß1-responsiveness
between these two plasmids. This suggests little involvement of the
region upstream to the 168-bp 5'-flanking region in the response of the
TG gene to TGF-ß1. As transcriptional regulation of the TG gene
expression by TGF-ß1 was clearly shown, we examined the effect of
TGF-ß1 on thyroid-specific transcription factors that play a decisive
role in the regulation of TG promoter activity (20).
|
, and Ref. 21), which includes the TTF-1-
and Pax-8-binding sites. The radiolabeled synthetic oligonucleotide,
Oligo K, spanning -106 to -83 bp of the TG promoter (Fig. 2A, and Ref. 21), was used to study the DNA-binding activity of TTF-2. As
reported previously (23, 25), nuclear extracts from FRTL-5
cells formed two protein-DNA complexes with Oligo C (Fig. 3A, arrows). To clearly
separate these two complexes, we employed a longer time for
electrophoresis in comparison with the previous report
(25). The nature of these two complexes was clarified by
adding specific antibodies. Anti-TTF-1 antibodies supershifted the
upper complex (Fig. 3A, lane 2), and anti-Pax-8 antibodies inhibited
the formation of the lower complex (Fig. 3A, lane 4). Each preimmune
serum had no effect on TTF-1 or Pax-8 complex formation (Fig. 3A, lanes
1 and 3). Thus, the upper band is the TTF-1/DNA complex and the lower
one is the Pax-8/DNA complex.
|
). TSH had different effects on
the DNA-binding activities of TTF-1 and Pax-8 in that TSH decreased
TTF-1/DNA complex formation but increased Pax-8/DNA complex formation
(Fig. 3B, lane 1 vs. lane 3). The intensity of the Pax-8/DNA
complex was decreased by the addition of TGF-ß1 in both TSH (-) and
TSH (+) conditions. There was no TGF-ß1-induced change in TTF-1/DNA
complex formation (Fig. 3B, upper bands). Next, we studied
TTF-2 DNA-binding activity using the same nuclear extracts and Oligo K.
TSH decreased TTF-2/DNA complex formation (Fig. 3C, lane 1
vs. lane 3), and TGF-ß1 had no significant effect on the
formation of TTF-2/DNA complex (Fig. 3C, lanes 1 vs.
2, and lanes 3 vs. 4).
Based on the above data, we assumed that the altered DNA-binding
activity of Pax-8 is involved in the TGF-ß1-induced suppression of TG
promoter activity. To study the effect of TGF-ß1 on Pax-8 DNA-binding
activity in more detail, we examined the concentration-dependency of
TGF-ß1 action on Pax-8/DNA complex formation (Fig. 4A). FRTL-5 cells were treated with
various concentrations of TGF-ß1 (0.5, 1, and 5 ng/ml) for 12 h
in the absence or presence of TSH. Regardless of the presence of TSH,
the Pax-8/DNA complex was unequivocally decreased by TGF-ß1 in a
concentration-dependent manner (Fig. 4A, lower bands). In
contrast, TTF-1/DNA complex was not affected by TGF-ß1 in both TSH
(-) and TSH (+) conditions (Fig. 4A, upper bands). In
addition, Pax-8 protein levels in nuclear extracts were assessed by
Western blot analysis (Fig. 4B). A protein of approximately 60 kDa,
which corresponds to Pax-8 (25), was detected in both
TGF-ß1-treated and nontreated nuclear extracts from FRTL-5 cells. The
amount of the Pax-8 protein was decreased by TGF-ß1 with a
concentration-dependency in both TSH (-) and TSH (+) conditions.
TGF-ß1 comparably decreased Pax-8 DNA-binding activity and its
protein levels in nuclear extracts (Fig. 4, A vs. B).
|
). Total RNA was
prepared from FRTL-5 cells treated for 12 h with various
concentrations of TGF-ß1 (0.1 - 5 ng/ml) in the absence or presence
of TSH. When TGF-ß1 was added to the basal medium (-TSH), Pax-8 mRNA
levels were decreased in a concentration-dependent manner (Fig. 5A).
The reduction by TGF-ß1 was also observed with the presence of TSH in
the incubation medium. Thus, a significant and near 50% decrease in
Pax-8 mRNA levels was measured at 0.5 ng/ml, and maximal inhibition was
achieved at 5 ng/ml TGF-ß1 in both TSH (-) and TSH (+) conditions
(Fig. 5A). The TGF-ß1-induced decrease of Pax-8 mRNA levels occurred
to the same extent as those observed in the DNA-binding activity of
Pax-8 as well as the TG gene expression (Figs. 1, 2, and 4).
|
). The Pax-8
mRNA levels were decreased after 6 h of TGF-ß1 addition by
Northern blot analysis (Fig. 5C). Pax-8 protein levels in nuclear
extracts were also decreased after 6 h of TGF-ß1 treatment of
FRTL-5 cells by Western blot analysis (Fig. 5C). Thus, the time course
of the TGF-ß1-induced decrease in Pax-8 mRNA is similar to that of
Pax-8 protein.
Pax-8-binding site mutant loses the TGF-ß1-responsiveness
To investigate the functional relevance of Pax-8 and/or the
Pax-8-binding element on the TG promoter, the Pax-8-binding element was
mutated in the pTG Luc (-168) chimeric construct having a minimal TG
promoter (Fig. 6A). Both TTF-1 and Pax-8
bind to Oligo C site on the TG promoter, and their binding sequences
(20) are overlapping (Fig. 6A). To minimize the influence
of the mutations on the binding of TTF-1, we mutated four residues
(Fig. 6A, underlined) that surround the core sequence for
TTF-1 binding. According to our expectation, TTF-1 but not Pax-8 can
bind to the mutated sequence in EMSAs, using the wild-type Oligo C (WT)
and its mutated counterpart (PMT) as probes (Fig. 6B). When pTG Luc
(-168) was transfected into FRTL-5 cells, it exhibited both a
TGF-ß1-induced decrease in promoter activity and TSH-responsiveness
(Fig. 6C), as shown in Fig. 2B. In contrast, the basal promoter
activity expressed by pTG Luc (-168PMT), which does not bind Pax-8 but
does retain binding activity to TTF-1, was halved by comparison to the
activity of wild-type pTG Luc (-168) (Fig. 6C, fifth vs.
first bar). The activity was not, however, reduced to the level of
promoterless pGL2-Basic (Fig. 2B) or that of pTG Luc (-168MT)
(25), which binds neither TTF-1 nor Pax-8. pTG Luc
(-168PMT) lost the TGF-ß1-induced decrease in activity as well as
TSH-responsiveness (Fig. 6C). It retained the responsiveness to TTF-1
when TTF-1 expression vector was cotransfected with pTG Luc (-168PMT)
into FRTL-5 cells (data not shown).
Another result did support Pax-8 involvement in TGF-ß1-mediated
decrease in TG gene expression. When we cotransfected pTG Luc (-168)
construct with Pax-8-expressing vector pRc/CMV-Pax-8 or its control
vector pRc/CMV (Fig. 7), overexpression
of Pax-8 cDNA increased pTG Luc (-168) activity. Overexpression
of Pax-8 resulted in the near-complete loss of TGF-ß1-induced
suppression of TG promoter activity (Fig. 7). Overexpression of the
control vector had no effect on activity with or without TGF-ß1 (Fig. 7 vs. Figure 6C, -TSH). pTG Luc (-168PMT) lost not only
TGF-ß1-responsiveness but also Pax-8-induced increase in activity
(Fig. 7). These results indicate that Pax-8 is involved in
TGF-ß1-induced decrease, as well as TSH-responsiveness, of the TG
promoter.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this paper, we examined the molecular mechanisms of TGF-ß1 action on thyroid using the TG promoter and FRTL-5 cells. We showed that TGF-ß1 down-regulates TG mRNA levels and TG promoter activity in FRTL-5 cells. We also showed that TGF-ß1 decreases DNA-binding activity of Pax-8, but not that of TTF-1 or TTF-2. TGF-ß1 comparably reduces Pax-8 mRNA and protein levels, resulting in the decreased DNA-binding activity of Pax-8. Moreover, we confirmed the functional relevance of the Pax-8-binding element in the TGF-ß1-induced decrease as well as the TSH-induced increase in TG promoter activity.
TG is the major product of thyroid follicular cells, and its exclusive transcription in thyroid is dependent on a set of thyroid-specific transcription factors (20, 21, 22, 23). Colletta et al. (10) first reported that TGF-ß1 decreases TG mRNA levels in FRTL-5 cells. TG has been reported to have intrinsic TGF-ß-like activity (34) and autoregulatory functions that counterbalance the actions of TSH in thyroid (19). In this respect, the TGF-ß1 may dampen its own negative influence on the thyroid gland by down-regulating TG expression, and thus providing an autoregulatory feedback loop participating in the delicate control of thyroid homeostasis.
We previously reported that TGF-ß1 decreases NIS mRNA and protein levels in FRTL-5 cells (8). Other thyroid-specific gene products such as thyroperoxidase (TPO) (7) and TSHR (11) were also reported to be down regulated by TGF-ß1. Thus, all thyroid-specific gene products are negatively regulated by TGF-ß1. Our finding of the TGF-ß1-induced decrease in Pax-8 activity might account for the mechanism by which TGF-ß1 down-regulates both the TPO and NIS genes as there have been increasing reports that Pax-8 is essential for expression of these thyroid-specific genes. The arrangement of regulatory elements in the TPO proximal promoter is analogous to that of the TG promoter (20). Esposito et al. (35) reported that Pax-8 activates the enhancer of the human TPO gene, which is located approximately 5.5 kb upstream of the gene. Recently, Ohno et al. (36) reported that the NIS upstream enhancer (NUE) located between -2264 and -2495 bp in the 5'-flanking region of the rat NIS gene, interact with Pax-8, resulting in transcriptional activation. We may therefore speculate that a common mechanism, which is mediated by decreased activity of Pax-8, is involved in TGF-ß1-induced down-regulation of the TG, TPO, and NIS genes. This simple paradigm, however, cannot apply to TSHR, as there has been no report concerning Pax-8 involvement in the transcriptional regulation of TSHR. There seem to be different mechanisms mediating the TGF-ß1 effect on the TSHR gene, which must await further elucidation.
Pax-8 is a paired domain-containing thyroid-specific transcription
factor essential for thyroid development during embryogenesis and the
maintenance of differentiated thyrocytes in the adult. Furthermore,
Pax-8 knock-out mice have been shown to possess a complete absence of
thyroid follicular structure (37). Macchia et
al. (38) reported that the presence of Pax-8
mutations cause severe reductions in Pax-8 DNA-binding activity in a
patient with congenital hypothyroidism. In the mutant rat thyroid cell
line FRTL-5/TA that is devoid of the expression of TG and TPO, the
Pax-8 mRNA transcript signal is markedly reduced, whereas TTF-1 mRNA
and protein levels were comparable to wild-type FRTL-5 cells
(39). It has been demonstrated that Pax-8 mRNA levels
correlate well with the degree of TG expression, and that Pax-8 protein
levels control the expression of the TG gene in FRTL-5 cells
(40). Given all these reports, it may be speculated that
TGF-ß1-mediated suppression of Pax-8 activity down- regulates the
expression of TG gene. To date, there has been no report on the
cytokine regulation of Pax-8 except our recent report, in which TNF-
decreases Pax-8 DNA-binding activity by cytoplasmic trapping
(25). In the present report, we show that TSH increase
Pax-8 DNA-binding activity with no increase in Pax-8 mRNA levels. Kambe
et al. (41) report that the TSH-induced
increase in Pax-8 DNA-binding activity is higher than can be accounted
for by Pax-8 mRNA levels, and may possibly act through redox
regulation. Our mRNA data using FRTL-5 cells are not compatible with
previous reports showing that the Pax-8 mRNA transcript is increased by
TSH in primary cultured dog thyrocytes (42) and in FRTL-5
cells (43). Medina et al. (43)
compared the Pax-8 mRNA levels in FRTL-5 cells at 6 or 24 h after
TSH treatment with those cells before exposure to TSH (0 h). We
examined the mRNA levels of Pax-8 in TSH-treated and nontreated FRTL-5
cells at 12 h after addition of fresh medium. Further
investigation is required for resolution of this discrepancy. There are
several reports examining which mechanisms regulate Pax-8 binding
activity at a posttranscriptional level. The conformational change of
the paired domain, -helical gain, induced upon DNA binding, the
so-called "induced fit," enables Pax-8 to bind to specific DNA
sequences. It has been shown that this process is under the control of
redox potential (44). TSH increases the expression of the
reducing molecules thyroredoxin and ubiquitous nuclear redox factor-1
(Ref-1), resulting in both increased amounts of, and the increased
DNA-binding activity of, Pax-8 (41, 45). In this context,
it is of interest that TGF-ß1 induces the production of hydrogen
peroxide in several cell types such as osteoblastic cells, hepatocytes,
and lung fibroblasts (46). Therefore, a TGF-ß1-induced
change in the intracellular redox state could be a candidate for the
mechanism by which TGF-ß1 induces a decrease in the DNA-binding
activity of Pax-8. However, as our data suggest that TGF-ß1 decreases
Pax-8 mRNA levels and Pax-8 DNA-binding activity to the same extent,
there may be little involvement of TGF-ß1 in the redox regulation in
thyroid cells. In addition to the redox mechanism, Pax-8 DNA-binding
activity can be modified by protein kinase A (PKA)-mediated
phosphorylation at the posttranscriptional level (47).
Napolitano et al. (18) recently reported that the TGF-ß1 down-regulation of both TTF-1 mRNA levels and DNA-binding activity is, at least in part, involved in the TGF-ß1-induced decrease in major histocompatibility complex class I gene expression. At present, the reason for the discrepancy between our data using Oligo C and their using Oligo TSHR TTF-1 remains to be determined.
For the preceding several years, there has been much progress in understanding the molecular mechanisms of TGF-ß1 action. The functional diversity of TGF-ß1 is explained by a relatively simple TGF-ß1-signaling system, which involves the specific type I and type II TGF-ß1 receptors harboring intrinsic serine/threonine kinase activity, and their substrate molecules, the Smads proteins (4, 48). The cell-type-specific responses of TGF-ß1 is determined by the nuclear partner proteins of the given cell type with which the Smad complex binds. In the nucleus, Smads can either positively or negatively regulate activation of target genes, and function as either a transcriptional factor or a comodulator, recruiting either coactivators or corepressors (4). Recently, the presence of the TGF-ß1 superfamily members including TGF-ß1, activin, and bone morphogenic protein-7 (BMP-7), and the translocation of Smad2, Smad3, and Smad4 in response to ligand binding, has been reported in porcine thyroid follicular cells in primary culture (11). To date, there has been no report documenting the direct role of Smads in the regulation of thyroid-specific genes. Whether Smad binding elements exists in the Pax-8 promoter region requires further investigation.
In conclusion, we provide evidence that TGF-ß1 down-regulates TG gene expression by suppressing the Pax-8 binding to the TG promoter. TGF-ß1 through Pax-8 may regulate other thyroid-specific and nonthyroid-specific genes in addition to TG, playing an important role in the physiological and pathological conditions of the thyroid.
Received July 12, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, TSH, and aging regulate TGF-ß synthesis and
secretion in FRTL-5 rat thyroid cells. Am J Physiol
268:R808–R815
regulation of thyroid transcription factor-1 and
Pax-8 in rat thyroid FRTL-5 cells. Endocrinology 140:4651–4658This article has been cited by other articles:
 |
|
 |
|
  C Crescioli, L Cosmi, E Borgogni, V Santarlasci, S Gelmini, M Sottili, E Sarchielli, B Mazzinghi, M Francalanci, A Pezzatini, et al. Methimazole inhibits CXC chemokine ligand 10 secretion in human thyrocytes J. Endocrinol., October 1, 2007; 195(1): 145 - 155. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Fozzatti, M. L Velez, A. M Lucero, J. P Nicola, I. D Mascanfroni, D. R Maccio, C. G Pellizas, G. A Roth, and A. M Masini-Repiso Endogenous thyrocyte-produced nitric oxide inhibits iodide uptake and thyroid-specific gene expression in FRTL-5 thyroid cells J. Endocrinol., March 1, 2007; 192(3): 627 - 637. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. Velez, E. Costamagna, E. T. Kimura, L. Fozzatti, C. G. Pellizas, M. M. Montesinos, A. M. Lucero, A. H. Coleoni, P. Santisteban, and A. M. Masini-Repiso Bacterial Lipopolysaccharide Stimulates the Thyrotropin-Dependent Thyroglobulin Gene Expression at the Transcriptional Level by Involving the Transcription Factors Thyroid Transcription Factor-1 and Paired Box Domain Transcription Factor 8 Endocrinology, July 1, 2006; 147(7): 3260 - 3275. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Kesmodel, I. Prabakaran, R. Canter, C. Menon, K. Molnar-Kimber, and D. Fraker Virus-Mediated Oncolysis of Thyroid Cancer by a Replication-Selective Adenovirus Driven by a Thyroglobulin Promoter-Enhancer Region J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3440 - 3448. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Costamagna, B. Garcia, and P. Santisteban The Functional Interaction between the Paired Domain Transcription Factor Pax8 and Smad3 Is Involved in Transforming Growth Factor-{beta} Repression of the Sodium/Iodide Symporter Gene J. Biol. Chem., January 30, 2004; 279(5): 3439 - 3446. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
