help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kang, H.-C.
Right arrow Articles by Onaya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, H.-C.
Right arrow Articles by Onaya, T.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
*Genetics Home Reference
Hazardous Substances DB
*THYROGLOBULIN
Endocrinology Vol. 142, No. 1 267-275
Copyright © 2001 by The Endocrine Society


ARTICLES

Pax-8 Is Essential for Regulation of the Thyroglobulin Gene by Transforming Growth Factor-ß1

Ho-Cheol Kang, Masayuki Ohmori, Norikazu Harii, Toyoshi Endo and Toshimasa Onaya

Third Department of Internal Medicine, Yamanashi Medical University, Tamaho, Yamanashi 409-3898, Japan

Address all correspondence and requests for reprints to: Toshimasa Onaya, Professor and Chairman, Third Department of Internal Medicine, Yamanashi Medical University, 1110 Shimokato, Tamaho, Yamanashi 409-3898, Japan. E-mail: onayat{at}res.yamanashi-med.ac.jp


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Transforming growth factor-ß1 (TGF-ß1) is a multifunctional cytokine that is thought to play a major role in the regulation of growth and differentiation of thyroid cells. However, little is known of its detailed mechanisms of action in thyrocytes. We have therefore studied the molecular mechanisms of TGF-ß1 action on thyroglobulin (TG) gene expression by focusing our attention on TGF-ß1 regulation of thyroid-specific transcription factors. TGF-ß1 decreased TG messenger RNA (mRNA) expression both in the presence and in the absence of TSH in rat thyroid FRTL-5 cells. Transfected into FRTL-5 cells, the activity of reporter plasmids containing the rat TG promoter ligated to a luciferase gene was significantly suppressed by the addition of TGF-ß1. When the nuclear extracts prepared from TGF-ß1-treated FRTL-5 cells were used in gel mobility shift assays, the amount of protein-DNA complex formed by Pax-8 was reduced, both in the presence and in the absence of TSH, but protein-DNA complexes formed by thyroid transcription factor-1 (TTF-1) and TTF-2 were not. The suppressive effect of TGF-ß1 on Pax-8/DNA complex formation is in part due to the suppression of Pax-8 mRNA and protein levels by TGF-ß1. Expressions of Pax-8 mRNA and protein, which were assessed by Northern blot and Western blot analyses, respectively, were decreased by TGF-ß1 treatment of FRTL-5 cells in a concentration-dependent manner. In a transfection experiment, mutation of the Pax-8-binding site caused a loss of both TGF-ß1- and TSH-responsiveness in TG promoter activity. Overexpression of Pax-8 abolished the TGF-ß1 suppression of TG promoter activity. These results indicate that TGF-ß1 decreases Pax-8 mRNA levels as well as Pax-8 DNA-binding activity, which, at least in part, seems to be involved in the TGF-ß1-induced suppression of TG gene expression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TRANSFORMING GROWTH FACTOR-ß1 (TGF-ß1) is a 2.5-kDa dimeric polypeptide (1) known as a fundamental regulatory molecule in many cell types, acting by both autocrine and paracrine mechanisms (2, 3). The unique feature of TGF-ß1 is its functional versatility, as the final biological outcome of the signal elicited by TGF-ß1 binding to its receptor depends on the cell type and the hormone/growth factor milieu, which is referred to as "the cellular context" (4).

In thyroid, it has been reported that TGF-ß1 is a potent inhibitor of growth and DNA synthesis in rat (5), porcine (6), and human (7) thyroid follicular cells (TFCs) as well as in other epithelial cell systems (2, 3). Differentiation markers of TFCs, such as Na+/I- symporter (NIS) (8, 9), thyroglobulin (TG) (10), and the TSH receptor (TSHR) (11) are also suppressed by TGF-ß1. TGF-ß1 synthesis at the messenger RNA (mRNA) level has been documented in follicular cell cultures derived from the thyroid glands of numerous species (12, 13). At present, it is thought that the potent suppression of thyroid growth and differentiation afforded by TGF-ß1 serves to modulate the effects of both TSH and other growth factors to maintain homeostasis of the thyroid gland (13).

Disordered regulation of intrathyroidal expression of TGF-ß1 has been implicated in the pathogenesis of various thyroid diseases. As may be predicted from its potent antiproliferative action, decreased TGF-ß1 expression and loss of TGF-ß1- responsiveness in thyroid cells have been reported in nontoxic goiter (14) and differentiated thyroid cancer (15). Excess intrathyroidal TGF-ß1 expression was reported as the reason for intrathyroidal fibrosis in myxedematous cretinism caused by selenium deficiency (16). Furthermore, the immunomodulatory effect of TGF-ß1 was documented in an animal model of autoimmune thyroiditis (17), and the molecular mechanism of TGF-ß1 action on down-regulation of major histocompatibility complex class I expression in FRTL-5 cells was recently detailed (18).

Despite the apparent involvement of TGF-ß1 in normal and pathological processes of the thyroid gland, our knowledge about the molecular mechanism of TGF-ß1 action on TFCs is very limited. Herein, we attempt to clarify the mechanism of TGF-ß1 action on the gene expression of TG, a thyroid-specific molecule necessary for the formation and storage of thyroid hormones, which also has recently been shown to have an autoregulatory function in the thyroid (19). The thyroid-specific expression of TG involves at least three thyroid-specific transcription factors: thyroid transcription factor-1 (TTF-1), thyroid transcription factor-2 (TTF-2), and Pax-8 (20, 21, 22, 23). We show that TGF-ß1 decreases Pax-8 DNA-binding activity by reducing its mRNA levels, which, in part, appears to be involved in a TGF-ß1-induced decrease in TG gene expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Recombinant human TGF-ß1 was purchased from Genzyme/Techne Corp. (Cambridge, MA). A highly purified preparation of bovine TSH was obtained from Sigma (St. Louis, MO). [{alpha}-32P] dCTP (3000 Ci/mmol) and [{gamma}-32P] ATP (3000 Ci/mmol) were purchased from Amersham Pharmacia Biotech (Arlington Heights, IL). The sources of other materials have been detailed previously (24, 25).

Cells
FRTL-5 rat thyroid cells (CRL 8305, American Type Culture Collection (Manassas, VA) (26) were grown in a 5% CO2-95% air atmosphere in Coon’s modified Ham’s F-12 medium supplemented with 5% calf serum (Life Technologies, Inc., Grand Island, NY). The medium includes a six-hormone mixture containing bovine TSH (10 mU/ml), insulin (10 µg/ml), human transferrin (5 µg/ml), glycyl-L-histidyl-L-lysine (10 ng/ml), somatostatin (10 ng/ml), and hydrocortisone (0.36 ng/ml). Cells were passaged every 7–8 days and fed a fresh medium every 2–3 days. When the cells were grown to 80% confluency, they were shifted to the basal medium containing no TSH, and then maintained for 7 days until use. These quiescent FRTL-5 cells were treated with indicated concentrations of TGF-ß1, in the presence or absence of 10 mU/ml TSH. All cultured cells were used before passage 20.

Northern blot analysis
Total RNA was isolated with a PERPECT RNA Kit (5 prime 3 prime, Inc., Boulder, CO). Total RNA (10 µg per lane) was denatured, electrophoresed on a 1% agarose gel, and then blotted by capillary transfer onto a nitrocellulose membrane (Schleicher & Schuell, Inc., Keene, NH). After fixation at 80 C in a vacuum oven for 2 h, the membranes were prehybridized for at least 2 h at 42 C in 50% formamide, 5x Denhardt’s solution (0.2% Ficoll, 0.2% polyvinilpyrolidone, and 0.2% BSA), 5x SSPE (20x SSPE = 3 M NaCI, 0.2 M sodium phosphate, and 20 mM EDTA, pH 7.4), 0.1% SDS, and 0.2 mg/ml heat-denatured salmon sperm DNA. Hybridization was performed at 42 C for 24 h with the radiolabeled probe in 50% formamide, 2.5x Denhardt’s solution, 5x SSPE, 0.1% SDS, 10% dextran sulfate, and 0.1 mg/ml heat-denatured salmon sperm DNA. Membranes were washed for 15 min at room temperature in wash buffer A (6x SSPE, 0.5% SDS), for 15 min at 37 C in wash buffer B (1x SSPE, 0.1% SDS), and for 15 min at 65 C in wash buffer B. An imaging plate was exposed to the membranes overnight, and the results were quantitated using a Bas 2000 Image Analyzer (Fuji Photo Film Co., Ltd., Tokyo, Japan). The complementary DNAs (cDNAs) used in this report were as follows: The TG (27), Pax-8 (23) and rat ß-actin cDNAs were kindly donated by Dr. L. D. Kohn (NIH, Bethesda, MD). All probes were radiolabeled with [{alpha}-32P] dCTP using a random primer labeling kit (Takara Shuzo Co., Tokyo, Japan).

Plasmids
Chimeric reporter plasmids incorporating genomic sequences of the TG gene from -688 to +75, and -168 to +36 bp, were constructed by PCR (25). TG promoter segments were amplified using appropriate forward and reverse primers including a KpnI site (5'-end) and BglII site (3'-end), to facilitate directional cloning. Amplified fragments were ligated into the KpnI-BglII sites of plasmid pGL2-Basic (Promega Corp., Madison, WI). These luciferase (Luc) constructs are designated pTG Luc (-688) and pTG Luc (-168), respectively. Cloned inserts were sequenced in their entirety to ensure against PCR-generated misincorporations. For experiments showing the functional relevance of Pax-8 on the TG promoter, four residues (underlined, see Fig. 6AGo) of the Pax-8-binding element were mutated both in an oligonucleotide probe and in the construct having a minimal TG promoter, Oligo C PMT and pTG Luc (-168PMT), respectively. The sequence of Oligo C PMT is as the following: 5'-CACTACCACGTCAAGTGCTCTTGA-3'. To generate a mutant construct, pTG Luc (-168PMT), the promoter segment with mutations in the Pax-8-binding sequence was generated by PCR using a forward primer that contained the mutated sequence in the Pax-8-binding site with a KpnI site on the 5'-end (5'-CGCAGGTACCGTCACCCTACTGATTACTCAAGTATTCTTAGCGGGAGCAGACTCAAGTAGAGGGAGTTCCTGTGACTAGCAGAGAAAACAAAGTGAGCCACTACCACGTCAAGTGCTCTTGAACAGTAG-3') and the reverse primer described above. Pax-8 (23) expression vector, pRc/CMV-Pax-8, was kindly donated by Dr. L. D. Kohn (NIH). All plasmids were prepared using a Plasmid Maxi Kit (QIAGEN, Chatsworth, CA).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 6. Effect of mutations in the Pax-8-binding site on the TG promoter activity. A, Mutations (underlined) are denoted by comparison with the sequence of the wild-type promoter. Black and white dots indicate the bases matching those of the TTF-1 and Pax-8 consensus sequences (20 ), respectively. B, The oligonucleotide C (WT) or its mutated counterpart (PMT) was used as the radiolabeled probe. Each was incubated with nuclear extracts from FRTL-5 cells maintained for 7 days without TSH. C, The pTG Luc (-168) and its mutant pTG Luc (-168PMT) were transfected into FRTL-5 cells. After transfection, the cells were cultured with or without 0.5 ng/ml TGF-ß1 in the absence or presence of 10 mU/ml TSH, and then harvested for luciferase assay. *, Statistically significant decrease induced by TGF-ß1. **, Statistically significant increase induced by TSH.

 
Transient expression analysis
Transient transfection used FRTL-5 cells. Before transfection, FRTL-5 cells were grown to 80% confluency in TSH (+) medium and then shifted to TSH (-) medium for 5 days. One day before transfection, they were returned to TSH (+) medium. Transfection used an electroporation technique (Gene Pulser, Bio-Rad Laboratories, Inc., Richmond, CA), as described previously (24, 25). FRTL-5 cells were harvested, washed, and suspended, 1.5 x 107 cells/ml, in 0.8 ml PBS. Ten micrograms of the TG promoter-luciferase chimeric plasmid and 3 µg pCH110-ß-gal were added. Overexpression experiments involving cotransfection with pRc/CMV-Pax-8 or its control vector pRc/CMV included 5 µg of the appropriate plasmid DNA. The cells were pulsed (300 V; 960 microfarads), plated, and cultured in TSH (+) medium. One day after transfection, the cells were washed with PBS, and cultures were continued in TSH (-) medium plus 5% calf serum, with the noted concentration of TGF-ß1, in the presence or absence of 10 mU/ml TSH, for the last 24 h of culture. The cells were then harvested for both the luciferase and the ß-galactosidase assay. These assays were performed as described previously (28, 29). Luciferase activity was normalized by ß-galactosidase activity.

Nuclear extracts
FRTL-5 cells were grown to approximately 80% confluency in TSH (+) medium and then maintained in TSH (-) medium for 7 days. After cells were exposed to the noted concentration of TGF-ß1 for the indicated hours, nuclear extracts were prepared as described previously (24, 25). Cells were washed twice with PBS and resuspended in a 5 pellet volume of 0.3 M sucrose and 2% Tween-40 in buffer A [10 mM HEPES-KOH (pH 7.9) containing 10 mM KC1, 1.5 mM MgCl2, 0.1 mM EDTA, 0.5 mM dithiothreitol (DTT), 0.5 mM phenylmethylsulfonylfluoride, 2 µg/ml leupeptin, and 2 µg/ml pepstatin-A]. After the cells were frozen in liquid nitrogen, thawed, and gently homogenized, the suspension was layered onto 1.5 M sucrose in buffer A and centrifuged at 25,000 x g in a swinging bucket rotor. Nuclei were washed with buffer A and lysed in 2.5 volume of buffer B [10 mM HEPES-KOH (pH 7.9), containing 420 mM NaCl, 1.5 mM MgCl2, 0.1 mM EDTA, 10% glycerol, 0.5 mM DTT, 0.5 mM phenylmethylsulfonylfluoride, 2 µg/ml leupeptin, and 2 µg/ml pepstatin-A]. Lysed nuclei were centrifuged at 15,000 x g for 1 h, and used in electrophoretic mobility shift assays (EMSAs).

EMSA
EMSAs were performed as described previously (24, 25). Synthesized, double-stranded oligonucleotides, Oligo C and Oligo K (20), were labeled with [{gamma}-32P] ATP and T4 polynucleotide kinase, and then purified using a Quick Spin Column (Roche Molecular Biochemicals, Indianapolis, IN). Two micrograms of nuclear extracts were incubated in a 30 µl reaction volume for 20 min at room temperature in the following buffer: 10 mM Tris-HCI (pH 7.6), 17 mM KC1, 1.7 mM MgC12, 1 mM DTT, 1 mM EDTA, 7% glycerol, 0.1% Triton X-100, and 0.5 µg poly (dI-dC). Labeled probe (50,000 cpm; ~ 0.5 ng DNA) was added, and incubation was continued for an additional 20 min at room temperature. DNA-protein complexes were separated on 4.5% native polyacrylamide gels. In experiments using antiserum to TTF-1 or Pax-8, nuclear extracts were incubated with the antiserum or its control counterpart in the same buffer for 30 min at room temperature before adding the labeled probe and processing as above.

Others
Western blot analyses were performed as described previously (25). Fifteen micrograms of each nuclear extract prepared as above were analyzed on 0.1% SDS-10% PAGE, electrotransferred to nitrocellulose membrane (Schleicher & Schuell, Inc.), and immunodetected (29) by anti-Pax-8 antiserum (25). Protein concentration was determined by Bradford’s method (Bio-Rad Laboratories, Inc.), and recrystallized BSA was used as a standard. All experiments were performed a minimum of three times with similar results. Results of experiments were analyzed using ANOVA.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TG mRNA levels are decreased by TGF-ß1
To show that TGF-ß1 decreases the gene expression of TG, we performed Northern blot analysis (Fig. 1Go). FRTL-5 cells were treated with various concentrations of TGF-ß1 for 12 h, in the absence (-) or presence (+) of TSH to verify the effect of TGF-ß1 on both quiescent and proliferating thyroid cells. TG mRNA was detected as a single band of about 8.5-kb in size, which is consistent with previous reports (10, 27). Incubation of FRTL-5 cells with TGF-ß1 for 12 h had a concentration-dependent inhibitory effect on TG gene expression, both in the absence and in the presence of TSH. Thus, a significant decrease in TG mRNA levels was measured at 0.1 ng/ml, near 50% inhibition occurred with 0.5 ng/ml, and maximal inhibition was achieved with 5 ng/ml TGF-ß1 (Fig. 1Go). These results are similar to a previous report by Colletta et al. (10), where TGF-ß1 time-dependently reduced TG mRNA levels in both quiescent and proliferating FRTL-5 cells. The molecular mechanism by which TGF-ß1 acts to decrease TG gene expression in FRTL-5 cells, is characterized below.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 1. Effect of TGF-ß1 on expression of TG mRNA transcripts in FRTL-5 cells. A, FRTL-5 cells were maintained in the basal medium containing 5% calf serum for 7 days and then treated with the indicated concentration of TGF-ß1 for 12 h in the absence (-) or presence (+) of 10 mU/ml TSH. Total RNA was prepared from the cells, and equal amounts (10 µg/lane) were subjected to sequential Northern blot analysis using rat TG and ß-actin cDNA probes. A typical autoradiogram is presented with 18S/28S RNA staining. B, The ratio of TG to ß-actin mRNA levels was calculated after quantitation by a Bas 2000 Image Analyzer. Basal (no TSH and no TGF-ß1) values are normalized to a 1.0 arbitrary unit in each experiment, and the data are shown as the mean ± SD from four separate experiments. *, Statistically significant decrease induced by TGF-ß1. **, Significant increase induced by TSH.

 
TGF-ß1 suppresses TG promoter activity
To investigate whether the suppressive effect of TGF-ß1 on TG mRNA levels is transcriptional, we transfected 2 chimeric luciferase plasmids containing the TG promoter into FRTL-5 cells and measured luciferase activity expressed in the absence or presence (0.5 and 1 ng/ml) of TGF-ß1 under both TSH (-) and TSH (+) conditions. The pTG Luc (-688) and pTG Luc (-168) constructs contain the TG promoter region from -688 to +75 bp and from -168 to +36 bp, respectively. They have three TTF-1-, one TTF-2-, and one Pax-8-binding elements (20) (Fig. 2AGo). Both constructs expressed significantly higher activity compared with the promoterless control plasmid, pGL2-Basic, which expressed very weak activity (Fig. 2BGo). When TGF-ß1 was added to the basal medium (-TSH), the promoter activities of both pTG Luc (-688) and pTG Luc (-168) were significantly suppressed in a concentration-dependent manner (Fig. 2BGo). The suppression by TGF-ß1 was also observed in the presence of TSH (+TSH). The addition of TSH significantly increased the luciferase activities of these two plasmids. However, the simultaneous addition of TGF-ß1 and TSH significantly decreased the luciferase activity compared with the activity seen with the addition of TSH without TGF-ß1 (Fig. 2BGo). Promoterless pGL2-Basic showed very weak basal activity and no responsiveness to TSH. There seems to be no significant differences in the basal promoter activity or TSH-responsiveness between pTG Luc (-688) and pTG Luc (-168). These results are in conformity with the report that the minimal TG promoter, 170 bp sequence upstream of the transcription initiation site, is enough for full promoter activity of TG (30). Also, there seems to be no significant difference in the TGF-ß1-responsiveness between these two plasmids. This suggests little involvement of the region upstream to the 168-bp 5'-flanking region in the response of the TG gene to TGF-ß1. As transcriptional regulation of the TG gene expression by TGF-ß1 was clearly shown, we examined the effect of TGF-ß1 on thyroid-specific transcription factors that play a decisive role in the regulation of TG promoter activity (20).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. TGF-ß1 suppresses TG promoter activity. A, Schematic drawing of the rat TG promoter (20 ). The locations of the oligonucleotides C (Oligo C) and K (Oligo K) mimicking the sequences of the TG promoter and used in this report are diagrammatically presented. TG promoter-luciferase chimeric plasmids, pTG Luc (-688) and pTG Luc (-168), contain three TTF-1-, one TTF-2- and one Pax-8-binding elements and a TATAA, TATA box-like motif. B, The pTG Luc (-688) (left), and pTG Luc (-168) (middle) were transfected into FRTL-5 cells. After transfection, the cells were treated with increasing concentrations (0, 0.5 or 1 ng/ml) of TGF-ß1 in the absence (-) or presence (+) of TSH, and then harvested for luciferase assay. The promoterless pGL2-Basic was also transfected as a control. Promoter activities are presented as the mean ± SD of three separate experiments. *, Statistically significant decrease induced by TGF-ß1. **, Statistically significant increase induced by TSH.

 
DNA-binding activity of Pax-8 is decreased in TGF-ß1-treated FRTL-5 cell nuclear extracts
Electrophoretic mobility shift assays (EMSAs) were employed to test the effect of TGF-ß1 on DNA-binding activity of the thyroid-specific transcription factors, TTF-1, TTF-2, and Pax-8. TTF-1 and Pax-8 binding was studied using a radiolabeled synthetic oligonucleotide probe spanning -77 to -54 bp of the rat TG promoter, Oligo C (Fig. 2AGo, and Ref. 21), which includes the TTF-1- and Pax-8-binding sites. The radiolabeled synthetic oligonucleotide, Oligo K, spanning -106 to -83 bp of the TG promoter (Fig. 2AGo, and Ref. 21), was used to study the DNA-binding activity of TTF-2. As reported previously (23, 25), nuclear extracts from FRTL-5 cells formed two protein-DNA complexes with Oligo C (Fig. 3AGo, arrows). To clearly separate these two complexes, we employed a longer time for electrophoresis in comparison with the previous report (25). The nature of these two complexes was clarified by adding specific antibodies. Anti-TTF-1 antibodies supershifted the upper complex (Fig. 3AGo, lane 2), and anti-Pax-8 antibodies inhibited the formation of the lower complex (Fig. 3AGo, lane 4). Each preimmune serum had no effect on TTF-1 or Pax-8 complex formation (Fig. 3AGo, lanes 1 and 3). Thus, the upper band is the TTF-1/DNA complex and the lower one is the Pax-8/DNA complex.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Formation of Pax-8/DNA complex is decreased by TGF-ß1 treatment. A, The radiolabeled synthetic oligonucleotide C (Oligo C) was used as a probe and incubated with nuclear extracts from FRTL-5 cells in the absence (-) or presence (+) of rabbit antiserum against TTF-1 or Pax-8, or the corresponding preimmune serum. DNA-protein complexes were electrophoresed for a longer period to distinguish two complexes. The upper arrow denotes a protein/DNA complex up-shifted after incubation with anti-TTF-1 antibodies but not with the corresponding preimmune serum. The lower arrow depicts a protein/DNA complex missing in FRTL-5 cell extracts after incubation with anti-Pax-8 antibodies but not with the corresponding preimmune serum. B, The radiolabeled Oligo C was incubated with nuclear extracts prepared from FRTL-5 cells that were maintained in the basal medium with 5% calf serum for 7 days and then cultured for 12 h in the presence (+) or absence (-) of TGF-ß1 (5 ng/ml), with or without TSH (10 mU/ml). C, The radiolabeled synthetic oligonucleotide K (Oligo K) was incubated with the same nuclear extracts as used in panel B.

 
Nuclear extracts from 5 ng/ml TGF-ß1 treated FRTL-5 cells also formed the same protein-DNA complexes (Fig. 3BGo). TSH had different effects on the DNA-binding activities of TTF-1 and Pax-8 in that TSH decreased TTF-1/DNA complex formation but increased Pax-8/DNA complex formation (Fig. 3BGo, lane 1 vs. lane 3). The intensity of the Pax-8/DNA complex was decreased by the addition of TGF-ß1 in both TSH (-) and TSH (+) conditions. There was no TGF-ß1-induced change in TTF-1/DNA complex formation (Fig. 3BGo, upper bands). Next, we studied TTF-2 DNA-binding activity using the same nuclear extracts and Oligo K. TSH decreased TTF-2/DNA complex formation (Fig. 3CGo, lane 1 vs. lane 3), and TGF-ß1 had no significant effect on the formation of TTF-2/DNA complex (Fig. 3CGo, lanes 1 vs. 2, and lanes 3 vs. 4).

Based on the above data, we assumed that the altered DNA-binding activity of Pax-8 is involved in the TGF-ß1-induced suppression of TG promoter activity. To study the effect of TGF-ß1 on Pax-8 DNA-binding activity in more detail, we examined the concentration-dependency of TGF-ß1 action on Pax-8/DNA complex formation (Fig. 4AGo). FRTL-5 cells were treated with various concentrations of TGF-ß1 (0.5, 1, and 5 ng/ml) for 12 h in the absence or presence of TSH. Regardless of the presence of TSH, the Pax-8/DNA complex was unequivocally decreased by TGF-ß1 in a concentration-dependent manner (Fig. 4AGo, lower bands). In contrast, TTF-1/DNA complex was not affected by TGF-ß1 in both TSH (-) and TSH (+) conditions (Fig. 4AGo, upper bands). In addition, Pax-8 protein levels in nuclear extracts were assessed by Western blot analysis (Fig. 4BGo). A protein of approximately 60 kDa, which corresponds to Pax-8 (25), was detected in both TGF-ß1-treated and nontreated nuclear extracts from FRTL-5 cells. The amount of the Pax-8 protein was decreased by TGF-ß1 with a concentration-dependency in both TSH (-) and TSH (+) conditions. TGF-ß1 comparably decreased Pax-8 DNA-binding activity and its protein levels in nuclear extracts (Fig. 4Go, A vs. B).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Effect of TGF-ß1 on Pax-8 DNA-binding activity and Pax-8 protein levels in nuclear extracts. A, The radiolabeled Oligo C was incubated with nuclear extracts prepared from FRTL-5 cells treated with the noted concentration of TGF-ß1 for 12 h in the absence (-) or presence (+) of TSH. The data represent a typical experiment that was repeated three times. In the lower panel, radioactivities of the specific Pax-8/DNA complex were measured by a Bas 2000 Image Analyzer. The radioactivity of the band formed in the absence of both TSH and TGF-ß1 was set at unity in each experiment, and the data are shown as the mean ± SD from three separate experiments. *, Statistically significant decrease induced by TGF-ß1. **, Statistically significant increase induced by TSH. B, FRTL-5 cells were maintained in the basal medium with 5% calf serum for 7 days and then treated with the indicated concentration of TGF-ß1 for 12 h in the absence (-) of presence (+) of TSH. Nuclear extracts were prepared from the cells, and equal amounts (15 µg/lane) were subjected to sequential Western blot analysis using the anti-Pax-8 antibodies. The data represent a typical experiment that was repeated three times. In the lower panel, intensities of the Pax-8 band were measured by a NIH Image. The intensity of the band formed in the absence of both TSH and TGF-ß1 was set at unity in each experiment, and the data are shown as the mean ± SD from three separate experiments. *, Statistically significant decease induced by TGF-ß1. **, Statistically significant increase induced by TSH.

 
Pax-8 mRNA levels are down-regulated by TGF-ß1
Reduced DNA-binding activity of Pax-8 in nuclear extracts prepared from TGF-ß1-treated FRTL-5 cells could be due to suppression of Pax-8 gene transcription by TGF-ß1. We therefore performed Northern blot analyses to examine the expression of Pax-8 mRNA in TGF-ß1-treated FRTL-5 cells (Fig. 5Go). Total RNA was prepared from FRTL-5 cells treated for 12 h with various concentrations of TGF-ß1 (0.1 - 5 ng/ml) in the absence or presence of TSH. When TGF-ß1 was added to the basal medium (-TSH), Pax-8 mRNA levels were decreased in a concentration-dependent manner (Fig. 5AGo). The reduction by TGF-ß1 was also observed with the presence of TSH in the incubation medium. Thus, a significant and near 50% decrease in Pax-8 mRNA levels was measured at 0.5 ng/ml, and maximal inhibition was achieved at 5 ng/ml TGF-ß1 in both TSH (-) and TSH (+) conditions (Fig. 5AGo). The TGF-ß1-induced decrease of Pax-8 mRNA levels occurred to the same extent as those observed in the DNA-binding activity of Pax-8 as well as the TG gene expression (Figs. 1Go, 2Go, and 4Go).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 5. Effect of TGF-ß1 on Pax-8 mRNA levels in FRTL-5 cells. A, FRTL-5 cells were maintained in the basal medium with 5% calf serum for 7 days and then treated with the indicated concentration of TGF-ß1 for 12 h in the absence (-) or presence (+) of TSH. Total RNA was prepared from the cells, and equal amounts (10 µg/lane) were subjected to sequential Northern blot analysis using Pax-8 and ß-actin cDNA probes. A typical autoradiogram is presented with 18S/28S RNA staining. B, The ratio of Pax-8 to ß-actin mRNA levels was calculated after quantitation by a Bas 2000 Image Analyzer. Basal (no TSH and no TGF-ß1) values are normalized to a 1.0 arbitrary unit in each experiment, and the data are shown as the mean ± SD from four separate experiments. A statistically significant decrease induced by TGF-ß1 and TSH is noted by * and **, respectively. C, FRTL-5 cells were maintained in the basal medium with 5% calf serum for 7 days and then treated with 1 ng/ml TGF-ß1 for the indicated hours. Total RNA was prepared from the cells, and equal amounts (10 µg/lane) were subjected to sequential Northern blot analysis using Pax-8 and ß-actin cDNA probes. For comparison, nuclear extracts were prepared from the above conditioned cells, and equal amounts (15 µg/lane) were subjected to sequential Western blot analysis using the anti-Pax-8 antibodies. The typical data are presented.

 
Further, we examined the time course of TGF-ß1 effect on Pax-8 mRNA by comparison with that of Pax-8 protein levels (Fig. 5CGo). The Pax-8 mRNA levels were decreased after 6 h of TGF-ß1 addition by Northern blot analysis (Fig. 5CGo). Pax-8 protein levels in nuclear extracts were also decreased after 6 h of TGF-ß1 treatment of FRTL-5 cells by Western blot analysis (Fig. 5CGo). Thus, the time course of the TGF-ß1-induced decrease in Pax-8 mRNA is similar to that of Pax-8 protein.

Pax-8-binding site mutant loses the TGF-ß1-responsiveness
To investigate the functional relevance of Pax-8 and/or the Pax-8-binding element on the TG promoter, the Pax-8-binding element was mutated in the pTG Luc (-168) chimeric construct having a minimal TG promoter (Fig. 6AGo). Both TTF-1 and Pax-8 bind to Oligo C site on the TG promoter, and their binding sequences (20) are overlapping (Fig. 6AGo). To minimize the influence of the mutations on the binding of TTF-1, we mutated four residues (Fig. 6AGo, underlined) that surround the core sequence for TTF-1 binding. According to our expectation, TTF-1 but not Pax-8 can bind to the mutated sequence in EMSAs, using the wild-type Oligo C (WT) and its mutated counterpart (PMT) as probes (Fig. 6BGo). When pTG Luc (-168) was transfected into FRTL-5 cells, it exhibited both a TGF-ß1-induced decrease in promoter activity and TSH-responsiveness (Fig. 6CGo), as shown in Fig. 2BGo. In contrast, the basal promoter activity expressed by pTG Luc (-168PMT), which does not bind Pax-8 but does retain binding activity to TTF-1, was halved by comparison to the activity of wild-type pTG Luc (-168) (Fig. 6CGo, fifth vs. first bar). The activity was not, however, reduced to the level of promoterless pGL2-Basic (Fig. 2BGo) or that of pTG Luc (-168MT) (25), which binds neither TTF-1 nor Pax-8. pTG Luc (-168PMT) lost the TGF-ß1-induced decrease in activity as well as TSH-responsiveness (Fig. 6CGo). It retained the responsiveness to TTF-1 when TTF-1 expression vector was cotransfected with pTG Luc (-168PMT) into FRTL-5 cells (data not shown).

Another result did support Pax-8 involvement in TGF-ß1-mediated decrease in TG gene expression. When we cotransfected pTG Luc (-168) construct with Pax-8-expressing vector pRc/CMV-Pax-8 or its control vector pRc/CMV (Fig. 7Go), overexpression of Pax-8 cDNA increased pTG Luc (-168) activity. Overexpression of Pax-8 resulted in the near-complete loss of TGF-ß1-induced suppression of TG promoter activity (Fig. 7Go). Overexpression of the control vector had no effect on activity with or without TGF-ß1 (Fig. 7Go vs. Figure 6CGo, -TSH). pTG Luc (-168PMT) lost not only TGF-ß1-responsiveness but also Pax-8-induced increase in activity (Fig. 7Go). These results indicate that Pax-8 is involved in TGF-ß1-induced decrease, as well as TSH-responsiveness, of the TG promoter.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 7. Effect of overexpression of Pax-8 on the TGF-ß1-induced decrease in TG promoter activity. The pTG Luc (-168) and its mutant pTG Luc (-168PMT) were cotransfected with each of the pRc/CMV vectors with or without the full length Pax-8 into FRTL-5 cells. After transfection, the cells were cultured with or without 0.5 ng/ml TGF-ß1 in the absence of TSH, and then harvested for luciferase assay. *, Statistically significant decrease induced by TGF-ß1. **, Statistically significant increase induced by overexpression of Pax-8.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fine-tuning the growth and differentiation of thyrocytes is essential for the maintenance of homeostasis of the thyroid gland as well as the organism as a whole. This fine-tuning is enabled by the complex interactions between TSH and other non-TSH growth factors or cytokines. Evidence supporting that TGF-ß1 is an important regulator of thyroid growth and function has been accumulating (5, 6, 7, 8, 9, 10, 11, 12, 13). Furthermore, there has been an increasing interest in non-TSH growth factors, especially in their roles in pathologic conditions (31). TGF-ß1 is unique for its functional diversity. It is involved not only in regulation of thyroid growth and function (5, 6, 7, 8, 9, 10, 11, 12), but also in extracellular matrix formation (32), apoptosis (33), immune regulation (17, 18), and even in carcinogenesis of the thyroid gland (15).

In this paper, we examined the molecular mechanisms of TGF-ß1 action on thyroid using the TG promoter and FRTL-5 cells. We showed that TGF-ß1 down-regulates TG mRNA levels and TG promoter activity in FRTL-5 cells. We also showed that TGF-ß1 decreases DNA-binding activity of Pax-8, but not that of TTF-1 or TTF-2. TGF-ß1 comparably reduces Pax-8 mRNA and protein levels, resulting in the decreased DNA-binding activity of Pax-8. Moreover, we confirmed the functional relevance of the Pax-8-binding element in the TGF-ß1-induced decrease as well as the TSH-induced increase in TG promoter activity.

TG is the major product of thyroid follicular cells, and its exclusive transcription in thyroid is dependent on a set of thyroid-specific transcription factors (20, 21, 22, 23). Colletta et al. (10) first reported that TGF-ß1 decreases TG mRNA levels in FRTL-5 cells. TG has been reported to have intrinsic TGF-ß-like activity (34) and autoregulatory functions that counterbalance the actions of TSH in thyroid (19). In this respect, the TGF-ß1 may dampen its own negative influence on the thyroid gland by down-regulating TG expression, and thus providing an autoregulatory feedback loop participating in the delicate control of thyroid homeostasis.

We previously reported that TGF-ß1 decreases NIS mRNA and protein levels in FRTL-5 cells (8). Other thyroid-specific gene products such as thyroperoxidase (TPO) (7) and TSHR (11) were also reported to be down regulated by TGF-ß1. Thus, all thyroid-specific gene products are negatively regulated by TGF-ß1. Our finding of the TGF-ß1-induced decrease in Pax-8 activity might account for the mechanism by which TGF-ß1 down-regulates both the TPO and NIS genes as there have been increasing reports that Pax-8 is essential for expression of these thyroid-specific genes. The arrangement of regulatory elements in the TPO proximal promoter is analogous to that of the TG promoter (20). Esposito et al. (35) reported that Pax-8 activates the enhancer of the human TPO gene, which is located approximately 5.5 kb upstream of the gene. Recently, Ohno et al. (36) reported that the NIS upstream enhancer (NUE) located between -2264 and -2495 bp in the 5'-flanking region of the rat NIS gene, interact with Pax-8, resulting in transcriptional activation. We may therefore speculate that a common mechanism, which is mediated by decreased activity of Pax-8, is involved in TGF-ß1-induced down-regulation of the TG, TPO, and NIS genes. This simple paradigm, however, cannot apply to TSHR, as there has been no report concerning Pax-8 involvement in the transcriptional regulation of TSHR. There seem to be different mechanisms mediating the TGF-ß1 effect on the TSHR gene, which must await further elucidation.

Pax-8 is a paired domain-containing thyroid-specific transcription factor essential for thyroid development during embryogenesis and the maintenance of differentiated thyrocytes in the adult. Furthermore, Pax-8 knock-out mice have been shown to possess a complete absence of thyroid follicular structure (37). Macchia et al. (38) reported that the presence of Pax-8 mutations cause severe reductions in Pax-8 DNA-binding activity in a patient with congenital hypothyroidism. In the mutant rat thyroid cell line FRTL-5/TA that is devoid of the expression of TG and TPO, the Pax-8 mRNA transcript signal is markedly reduced, whereas TTF-1 mRNA and protein levels were comparable to wild-type FRTL-5 cells (39). It has been demonstrated that Pax-8 mRNA levels correlate well with the degree of TG expression, and that Pax-8 protein levels control the expression of the TG gene in FRTL-5 cells (40). Given all these reports, it may be speculated that TGF-ß1-mediated suppression of Pax-8 activity down- regulates the expression of TG gene. To date, there has been no report on the cytokine regulation of Pax-8 except our recent report, in which TNF-{alpha} decreases Pax-8 DNA-binding activity by cytoplasmic trapping (25). In the present report, we show that TSH increase Pax-8 DNA-binding activity with no increase in Pax-8 mRNA levels. Kambe et al. (41) report that the TSH-induced increase in Pax-8 DNA-binding activity is higher than can be accounted for by Pax-8 mRNA levels, and may possibly act through redox regulation. Our mRNA data using FRTL-5 cells are not compatible with previous reports showing that the Pax-8 mRNA transcript is increased by TSH in primary cultured dog thyrocytes (42) and in FRTL-5 cells (43). Medina et al. (43) compared the Pax-8 mRNA levels in FRTL-5 cells at 6 or 24 h after TSH treatment with those cells before exposure to TSH (0 h). We examined the mRNA levels of Pax-8 in TSH-treated and nontreated FRTL-5 cells at 12 h after addition of fresh medium. Further investigation is required for resolution of this discrepancy. There are several reports examining which mechanisms regulate Pax-8 binding activity at a posttranscriptional level. The conformational change of the paired domain, {alpha}-helical gain, induced upon DNA binding, the so-called "induced fit," enables Pax-8 to bind to specific DNA sequences. It has been shown that this process is under the control of redox potential (44). TSH increases the expression of the reducing molecules thyroredoxin and ubiquitous nuclear redox factor-1 (Ref-1), resulting in both increased amounts of, and the increased DNA-binding activity of, Pax-8 (41, 45). In this context, it is of interest that TGF-ß1 induces the production of hydrogen peroxide in several cell types such as osteoblastic cells, hepatocytes, and lung fibroblasts (46). Therefore, a TGF-ß1-induced change in the intracellular redox state could be a candidate for the mechanism by which TGF-ß1 induces a decrease in the DNA-binding activity of Pax-8. However, as our data suggest that TGF-ß1 decreases Pax-8 mRNA levels and Pax-8 DNA-binding activity to the same extent, there may be little involvement of TGF-ß1 in the redox regulation in thyroid cells. In addition to the redox mechanism, Pax-8 DNA-binding activity can be modified by protein kinase A (PKA)-mediated phosphorylation at the posttranscriptional level (47).

Napolitano et al. (18) recently reported that the TGF-ß1 down-regulation of both TTF-1 mRNA levels and DNA-binding activity is, at least in part, involved in the TGF-ß1-induced decrease in major histocompatibility complex class I gene expression. At present, the reason for the discrepancy between our data using Oligo C and their using Oligo TSHR TTF-1 remains to be determined.

For the preceding several years, there has been much progress in understanding the molecular mechanisms of TGF-ß1 action. The functional diversity of TGF-ß1 is explained by a relatively simple TGF-ß1-signaling system, which involves the specific type I and type II TGF-ß1 receptors harboring intrinsic serine/threonine kinase activity, and their substrate molecules, the Smads proteins (4, 48). The cell-type-specific responses of TGF-ß1 is determined by the nuclear partner proteins of the given cell type with which the Smad complex binds. In the nucleus, Smads can either positively or negatively regulate activation of target genes, and function as either a transcriptional factor or a comodulator, recruiting either coactivators or corepressors (4). Recently, the presence of the TGF-ß1 superfamily members including TGF-ß1, activin, and bone morphogenic protein-7 (BMP-7), and the translocation of Smad2, Smad3, and Smad4 in response to ligand binding, has been reported in porcine thyroid follicular cells in primary culture (11). To date, there has been no report documenting the direct role of Smads in the regulation of thyroid-specific genes. Whether Smad binding elements exists in the Pax-8 promoter region requires further investigation.

In conclusion, we provide evidence that TGF-ß1 down-regulates TG gene expression by suppressing the Pax-8 binding to the TG promoter. TGF-ß1 through Pax-8 may regulate other thyroid-specific and nonthyroid-specific genes in addition to TG, playing an important role in the physiological and pathological conditions of the thyroid.

Received July 12, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Roberts AB, Anzano MA, Lamb LC, Smith JM, Sporn MB 1981 New class of transforming growth factors potentiated by epidermal growth factor: isolation from non-neoplastic tissues. Proc Natl Acad Sci USA 78:5339–5343[Abstract/Free Full Text]
  2. Sporn MB, Roberts AB, Wakefield LM, Assoian RK 1986 Transforming growth factor-ß: biological function and chemical structure. Science 233:532–534[Abstract/Free Full Text]
  3. Lyons RM, Moses HL 1990 Transforming growth factors and the regulation of cell proliferation. Eur J Biochem 187:467–473[Medline]
  4. Massague J, Wotton D 2000 Transcriptional control by the TGF-ß/Smad signaling system. EMBO J 19:1745–1754[CrossRef][Medline]
  5. Morris 3rd JC, Ranganathan G, Hay ID, Nelson RE, Jiang NS 1988 The effects of transforming growth factor-ß on growth and differentiation of the continuous rat thyroid follicular cell line, FRTL-5. Endocrinology 123:1385–1394[Abstract/Free Full Text]
  6. Tsushima T, Arai M, Saji M, Ohba Y, Murakami H, Ohmura E, Sato K, Shizume K 1988 Effects of transforming growth factor-ß on deoxyribonucleic acid synthesis and iodine metabolism in porcine thyroid cells in culture. Endocrinology 123:1187–1194[Abstract/Free Full Text]
  7. Taton M, Lamy F, Roger PP, Dumont JE 1993 General inhibition by transforming growth factor ß1 of thyrotropin and cAMP responses in human thyroid cells in primary culture. Mol Cell Endocrinol 95:13–21[CrossRef][Medline]
  8. Kawaguchi A, Ikeda M, Endo T, Kogai T, Miyazaki A, Onaya T 1997 Transforming growth factor-ß1 suppresses thyrotropin-induced Na+/I- symporter messenger RNA and protein levels in FRTL-5 rat thyroid cells. Thyroid 7:789–794[Medline]
  9. Pekary AE, Hershman JM 1998 Tumor necrosis factor, ceramide, transforming growth factor-ß1, and aging reduce Na+/I- symporter messenger ribonucleic acid levels in FRTL-5 cells. Endocrinology 139:703–712[Abstract/Free Full Text]
  10. Colleta G, Cirafici AM, Di Carlo A 1989 Dual effect of transforming growth factor ß on rat thyroid cells: inhibition of thyrotropin-induced proliferation and reduction of thyroid-specific differentiation markers. Cancer Res 49:3457–3462[Abstract/Free Full Text]
  11. Franzen A, Piek E, Westermark B, ten Dijke P, Heldin NE 1999 Expression of transforming growth factor-ß1, activin A, and their receptors in thyroid follicle cells: negative regulation of thyrocyte growth and function. Endocrinology 140:4300–4310[Abstract/Free Full Text]
  12. Pekary AE, Berg L, Wang J, Lee P, Dubinett SM, Hershman JM 1995 TNF-{alpha}, TSH, and aging regulate TGF-ß synthesis and secretion in FRTL-5 rat thyroid cells. Am J Physiol 268:R808–R815
  13. Bidey SP, Hill DJ, Eggo MC 1999 Growth factors and goitrogenesis. J Endocrinol 160:321–332[Abstract]
  14. Grubeck-Loebenstein B, Buchan G, Sadeghi R, Kissonerghis M, Londei M, Turner M, Pirich K, Roka R, Niederle B, Kassal H, Waldhausl W, Feldmann M 1989 Transforming growth factor ß regulates thyroid growth. Role in the pathogenesis of nontoxic goiter. J Clin Invest 83:764–770
  15. Holting T, Zielke A, Siperstein AE, Clark OH, Duh QY 1994 Transforming growth factor-ß1 is a negative regulator for differentiated thyroid cancer: studies of growth, migration, invasion, and adhesion of cultured follicular and papillary thyroid cancer cell lines. J Clin Endocrinol Metab 79:806–813[Abstract]
  16. Contempre B, Le Moine O, Dumont JE, Denef JF, Many MC 1996 Selenium deficiency and thyroid fibrosis. A key role for macrophages and transforming growth factor ß (TGF-ß). Mol Cell Endocrinol 124:7–15[CrossRef][Medline]
  17. Seddon B, Mason D 1999 Regulatory T cells in the control of autoimmunity: the essential role of transforming growth factor ß and interleukin 4 in the prevention of autoimmune thyroiditis in rats by peripheral CD4+CD45RC- cells and CD4+CD8- thymocytes. J Exp Med 189:279–288[Abstract/Free Full Text]
  18. Napolitano G, Montani V, Giuliani C, Di Vincenzo S, Bucci I, Todisco V, Laglia G, Coppa A, Singer DS, Nakazato M, Kohn LD, Colletta G, Monaco F 2000 Transforming growth factor-ß1 down-regulation of major histocompatibility complex class I in thyrocytes: coordinate regulation of two separate elements by thyroid-specific as well as ubiquitous transcription factors. Mol Endocrinol 14:486–505[Abstract/Free Full Text]
  19. Suzuki K, Lavaroni S, Mori A, Ohta M, Saito J, Pietrarelli M, Singer DS, Kimura S, Katoh R, Kawaoi A, Kohn LD 1998 Autoregulation of thyroid-specific gene transcription by thyroglobulin. Proc Natl Acad Sci USA 95:8251–8256[Abstract/Free Full Text]
  20. Damante G, Di Lauro R 1994 Thyroid-specific gene expression. Biochim Biophys Act 1218:255–266[Medline]
  21. Guazzi S, Price M, De Felice M, Damante G, Mattei M-G, Di Lauro R 1990 Thyroid nuclear factor 1 (TTF-1) contains a homeodomain and displays a novel DNA binding specificity. EMBO J 9:3631–3639[Medline]
  22. Zannini M, Avantaggiato V, Biffali E, Arnone MI, Sato K, Pischetola M, Taylor BA, Phillips SJ, Simeone A, Di Lauro R 1997 TTF-2, a new forkhead protein, shows a temporal expression in the developing thyroid which is consistent with a role in controlling the onset of differentiation. EMBO J 16:3185–3197[CrossRef][Medline]
  23. Zannini, Francis-Lang H, Plachov D, Di Lauro R 1992 Pax-8, a paired domain-containing protein, binds to a sequence overlapping the recognition site of a homeodomain and activates transcription from two-thyroid-specific promoters. Mol Cell Biol 12:4230–4241[Abstract/Free Full Text]
  24. Ohmori M, Endo T, Harii N, Onaya T 1998 A novel thyroid transcription factor is essential for thyrotropin-induced up-regulation of Na+/I- symporter gene expression. Mol Endocrinol 12:727–736[Abstract/Free Full Text]
  25. Ohmori M, Harii N, Endo T, Onaya T 1999 Tumor necrosis factor-{alpha} regulation of thyroid transcription factor-1 and Pax-8 in rat thyroid FRTL-5 cells. Endocrinology 140:4651–4658[Abstract/Free Full Text]
  26. Ambesi-Impiombato FS 1986 Fast-growing thyroid cell strain. US Patent 4:608, 341
  27. Bone E, Kohn LD, Chomczynski P 1986 Thyroglobulin gene activation by thyrotropin and cAMP in hormonally depleted FRTL-5 thyroid cells. Biochem Biophys Res Commun 141:1261–1266[CrossRef][Medline]
  28. de Wet JR, Wood KV, DeLuca M, Helinski DR, Subramani S 1987 Firefly luciferase gene: structure and expression in mammalian cells. Mol Cell Biol 7:725–737[Abstract/Free Full Text]
  29. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning - A Laboratory Manuel, ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York
  30. Lee NT, Kamikubo K, Chai KJ, Kao LR, Sinclair AJ, Nayfeh SN, Chae CB 1991 The deoxyribonucleic acid regions involved in the hormonal regulation of thyroglobulin gene expression. Endocrinology 128:111–118[Abstract/Free Full Text]
  31. Derwahl M, Broecker M, Kraiem Z 1999 Thyrotropin may not be the dominant growth factor in benign and malignant thyroid tumors. J Clin Endocrinol Metab 84:829–834[Free Full Text]
  32. Pellerin S, Croizet K, Rabilloud R, Feige JJ, Rousset B 1999 Regulation of the three-dimensional organization of thyroid epithelial cells into follicle structures by the matricellular protein, thrombospondin-1. Endocrinology 140:1904–1103
  33. Bechtner G, Froschl H, Sachse A, Schopohl D, Gartner R 1999 Induction of apoptosis in porcine thyroid follicles by transforming growth ß1 and epidermal growth factor. Biochimie (Paris) 81:315–320[Medline]
  34. Huang SS, Cerullo MA, Huang FW, Huang JS 1998 Activated thyroglobulin possesses a transforming growth factor-ß activity. J Biol Chem 273:26036–26041[Abstract/Free Full Text]
  35. Esposito C, Miccadei S, Saiardi A, Civitareale D 1998 PAX 8 activates the enhancer of the human thyroperoxidase gene. Biochem J 331:37–40
  36. Ohno M, Zannini M, Levy O, Carrasco N, Di Lauro R 1999 The paired-domain transcription factor Pax8 binds to the upstream enhancer of the rat sodium/iodide symporter gene and participates in both thyroid-specific and cyclic-AMP-dependent transcription. Mol Cell Biol 19:2051–2060[Abstract/Free Full Text]
  37. Mansouri A, Chowdhury K, Gruss P 1998 Follicular cells of the thyroid gland require Pax8 gene function. Nat Genet 19:87–90[CrossRef][Medline]
  38. Macchia PE, Lapi P, Krude H, Pirro MT, Missero C, Chiovato L, Souabni A, Baserga M, Tassi V, Pinchera A, Fenzi G, Gruters A, Busslinger M, Di Lauro R 1998 PAX8 mutations associated with congenital hypothyroidism caused by thyroid dysgenesis. Nat Genet 19:83–86[CrossRef][Medline]
  39. van der Kallen CJ, Spierings DC, Thijssen JH, Blankenstein MA, de Bruin TW 1996 Disrupted co-ordination of Pax-8 and thyroid transcription factor-1 gene expression in a dedifferentiated rat thyroid tumour cell line derived from FRTL-5. J Endocrinol 150:377–382[Abstract/Free Full Text]
  40. Fabbro D, Pellizzari L, Mercuri F, Tell G, Damante G 1998 Pax-8 protein levels regulate thyroglobulin gene expression. J Mol Endocrinol 21:347–354[Abstract]
  41. Kambe F, Nomura Y, Okamoto T, Seo H 1996 Redox regulation of thyroid-transcription factors, Pax-8 and TTF-1, is involved in their increased DNA-binding activities by thyrotropin in rat thyroid FRTL-5 cells. Mol Endocrinol 10:801–812[Abstract/Free Full Text]
  42. Van Renterghem P, Vassart G, Christophe D 1996 Pax 8 expression in primary cultured dog thyrocyte is increased by cyclic AMP. Biochim Biophys Acta 1307:97–103[Medline]
  43. Medina DL, Suzuki K, Pietrarelli M, Okajima F, Kohn LD, Santisteban P 2000 Role of insulin and serum on thyrotropin regulation of thyroid transcription factor-I and Pax-8 genes expression in FRTL-5 thyroid cells. Thyroid 10:295–303[Medline]
  44. Tell G, Scaloni A, Pellizzari L, Formisano S, Pucillo C, Damante G 1998 Redox potential controls the structure and DNA binding activity of the paired domain. J Biol Chem 273:25062–25072[Abstract/Free Full Text]
  45. Asai T, Kambe F, Kikumori T, Seo H 1997 Increase in Ref-1 mRNA and protein by thyrotropin in rat thyroid FRTL-5 cells. Biochem Biophys Res Common 236:71–74[CrossRef][Medline]
  46. Thannickal VJ, Fanburg BL 1995 Activation of an H2O2-generating NADH oxidase in human lung fibroblasts by transforming growth factor ß1. J Biol Chem 270:30334–30338[Abstract/Free Full Text]
  47. Poleev A, Okladnova O, Musti AM, Schneider S, Royer-Pokora B, Plachov D 1997 Determination of functional domains of the human transcription factor PAX8 responsible for its nuclear localization and transactivating potential. Eur J Biochem 247:860–869[Medline]
  48. Hu PP, Datto MB, Wang XF 1998 Molecular mechanisms of transforming growth factor-ß signaling. Endocr Rev 19:349–363[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
G. Riesco-Eizaguirre, I. Rodriguez, A. De la Vieja, E. Costamagna, N. Carrasco, M. Nistal, and P. Santisteban
The BRAFV600E Oncogene Induces Transforming Growth Factor {beta} Secretion Leading to Sodium Iodide Symporter Repression and Increased Malignancy in Thyroid Cancer
Cancer Res., November 1, 2009; 69(21): 8317 - 8325.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
C Crescioli, L Cosmi, E Borgogni, V Santarlasci, S Gelmini, M Sottili, E Sarchielli, B Mazzinghi, M Francalanci, A Pezzatini, et al.
Methimazole inhibits CXC chemokine ligand 10 secretion in human thyrocytes
J. Endocrinol., October 1, 2007; 195(1): 145 - 155.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
L. Fozzatti, M. L Velez, A. M Lucero, J. P Nicola, I. D Mascanfroni, D. R Maccio, C. G Pellizas, G. A Roth, and A. M Masini-Repiso
Endogenous thyrocyte-produced nitric oxide inhibits iodide uptake and thyroid-specific gene expression in FRTL-5 thyroid cells
J. Endocrinol., March 1, 2007; 192(3): 627 - 637.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. L. Velez, E. Costamagna, E. T. Kimura, L. Fozzatti, C. G. Pellizas, M. M. Montesinos, A. M. Lucero, A. H. Coleoni, P. Santisteban, and A. M. Masini-Repiso
Bacterial Lipopolysaccharide Stimulates the Thyrotropin-Dependent Thyroglobulin Gene Expression at the Transcriptional Level by Involving the Transcription Factors Thyroid Transcription Factor-1 and Paired Box Domain Transcription Factor 8
Endocrinology, July 1, 2006; 147(7): 3260 - 3275.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Kesmodel, I. Prabakaran, R. Canter, C. Menon, K. Molnar-Kimber, and D. Fraker
Virus-Mediated Oncolysis of Thyroid Cancer by a Replication-Selective Adenovirus Driven by a Thyroglobulin Promoter-Enhancer Region
J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3440 - 3448.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Costamagna, B. Garcia, and P. Santisteban
The Functional Interaction between the Paired Domain Transcription Factor Pax8 and Smad3 Is Involved in Transforming Growth Factor-{beta} Repression of the Sodium/Iodide Symporter Gene
J. Biol. Chem., January 30, 2004; 279(5): 3439 - 3446.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kang, H.-C.
Right arrow Articles by Onaya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, H.-C.
Right arrow Articles by Onaya, T.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
*Genetics Home Reference
Hazardous Substances DB
*THYROGLOBULIN


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals