| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Odontology (P.L., I.L., H.M., U.H.L.), Oral Cell Biology, Umeå University, Umeå, Sweden; Department of Musculoskeletal Research (P.L., I.L., U.H.L.), National Institute for Working Life, Umeå, Sweden; and Bone and Mineral Centre (P.P.L., M.A.H.), Department of Medicine, The Rayne Institute, University College London, London WC1E 6JJ, United Kingdom
Address all correspondence and requests for reprints to: Pernilla Lund-berg, Department of Odontology, Oral Cell Biology, Umeå University, Umeå, SE-901 87, Sweden. E-mail: Pernilla Lundberg{at}odont.umu.se
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Early reports suggested an influence on bone development and metabolism by the nervous system, although the skeleton at that time was regarded as being poorly innervated. Children, prenatally exposed to the drug thalidomide, developed congenital limb abnormalities. It has been suggested that this was due to embryonic peripheral neuropathy of the embryo (6). In addition, patients with neurological disorders were reported to show enhanced bone fragility, altered fracture healing, and excessive callus formation (7, 8, 9). These observations have been revisited because it has been become possible, using immunohistochemical techniques, to demonstrate the presence of an intense network of nerve fibers in bone tissues (4). An intense network of nerve fibers expressing neuropeptides is found in regions of high osteogenic activity, and this may reflect local osteogenic regulatory functions of these nerves.
Neuropeptides that have been demonstrated in bone include vasoactive intestinal peptide (VIP), calcitonin gene-related peptide, substance P, and neuropeptide Y (10, 11). Recently, the VIP analog, pituitary adenylate cyclase-activating peptide (PACAP), has been demonstrated immunocytochemically in the porcine epiphyseal cartilage canals (12).
VIP is a 28-amino acid neuropeptide structurally related to a large number of regulatory peptides in the VIP/secretin/glucagon family. These include VIP, PACAP 38, PACAP 27, secretin, glucagon, peptide histidine-isoleucine (PHI), growth releasing factor, and the reptilian venom peptides helodermin, helospectin, and exendin. PACAPs and VIP are widely distributed in both central and peripheral nervous systems and show a broad spectrum of biological actions (13, 14). PACAP exists in both a 38 amino acid form (PACAP 38) and a 27 amino acid form (PACAP 27), of which PACAP 27 represents a minor portion of total PACAP immunoreactivity in many tissues (14).
Three receptors for VIP and PACAP have been cloned and characterized, and their distribution in different tissues has been described (15, 16). PACAP receptors (PACAP-R) are mainly expressed in the central nervous system and show higher affinity (100- to 1000-fold) for PACAP than for VIP. VIP-1 receptors (VIP-1R) and VIP-2 receptors (VIP-2R) show equal affinity for both VIP and PACAP, and these receptors can be distinguished by the fact that VIP-1R binds secretin, whereas VIP-2R do not (16). VIP-1R and VIP-2R are widely distributed but preferentially expressed in the peripheral nervous system (16).
Tashjian and co-workers provided the first in vitro evidence for functional neuropeptide receptors on bone cells by demonstrating that VIP stimulates calcium release in cultured neonatal mouse calvariae (17). Recently, we have observed that osteoclasts express specific binding sites for VIP and that VIP regulates the bone resorbing activity of isolated rat osteoclasts (18). In addition, VIP stimulates alkaline phosphatase (ALP) activity and messenger RNA (mRNA) expression as well as calcium accumulation in mouse calvarial osteoblasts (19). Hohmann and Tashjian reported that the human osteosarcoma cell line (Saos-2) expresses receptors for VIP (20). Later, the presence of VIP binding receptors linked to enhanced formation of cAMP was demonstrated in the rat osteosarcoma cell line UMR 106–01 (21, 22), in a mouse osteoblastic cell line MC3T3-E1 (21, 23), in primary cultures of isolated mouse osteoblasts (21, 24) and in human osteoblast-like cells (25). The VIP analogs helodermin, helospectin, PACAP 38, and PACAP 27-stimulated cAMP formation in intact bone, primary osteoblasts, and osteoblastic cell lines (24).
Our recent observations that several of the peptides in the VIP/glucagon/secretin peptide family, but not secretin, stimulate ALP activity and interleukin-6 release in primary mouse calvarial osteoblasts (26) prompted us to investigate which VIP/PACAP receptors are expressed by these cells. Using cAMP formation, radioligand binding, atomic force microscopy, and RT-PCR, we present evidence that mouse calvarial osteoblasts express PACAP-preferring VIP-2R and that expression of VIP-1R are induced during osteoblastic differentiation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-MEM, Life Technologies Ltd. (Paisley, Scotland, UK); bensylpenicillin (Astra USA, Inc., Sodertaljic, Sweden); gentamycin sulfate and
noradrenalin (NA), Sigma (MO); streptomycin, Heyl (Berlin,
Germany); VIP (VIP1–12,
VIP10–28, VIP1–28), PACAP
27, PACAP 38 (PACAP1–38,
PACAP6–38), helodermin, helospectin, PHI,
glucagon and secretin, Peninsula Laboratories, Inc. (San
Carlos, CA); highly purified porcine
VIP1–28, late Prof V Mutt, Karolinska Institutet
(Stockholm, Sweden); synthetic bovine PTH1–34,
Bachem (Bubendorf, Switzerland); cAMP RIA kit, NEN Life Science Products (Boston, MA);
125I-VIP and 125I-PACAP,
Euro Diagnostica AB (Lund, Sweden); PEG, Sigma (St. Louis,
MO); TRIzol LS, first strand complementary DNA (cDNA) synthesis
kit, PCR core kit, oligo primers for GAPDH, VIP-1R, VIP-2R, and
PACAP-R, Life Technologies Ltd.; Thermo Sequenase II dye
terminator cycle sequencing premix kit, Amersham Pharmacia Biotech (Little Chalfont, Buckinghamshire, UK); rolipram
[4-(3-cyclopentyloxy-4-methoxy-phenyl)-2-pyrrolidone; ZK 62.711], was
kindly donated by Dr. Sprzgala of Schering AG (Berlin,
Germany).
Cell isolation and culture
Calvarial bones from 2- to 3-days old mice
(CSA) were dissected aseptically in PBS
containing 10% FBS, and cells were isolated by time sequential
collagenase (bacterial collagenase clostridium type I) digestion
technique described by Boonekamp et al. (27).
Cells from digestions 6–8 (10–25 x 106
cells) were pooled and seeded at a density of 2 x
106 cells/175 cm2 in
culture flasks containing -modification of -MEM supplemented with
10% FBS and antibiotics (bensylpenicillin, gentamycin sulfate, and
streptomycin). The cells were cultured for 4–6 days, with change of
medium every 2 or 3 days at 37 C in a humidified atmosphere that
contained 5% CO2 in air. These mouse calvarial
cells present an osteoblastic phenotype because they express PTH
binding receptors, stain positively for ALP, and form mineralized bone
nodules if cultured in the presence of ß-glycerophosphate (19, 24).
The experiments were approved by the Ethical Committee for Animal Experiments at Umeå University.
CAMP accumulation in isolated osteoblasts
Before the experiments, the cells were seeded in
2-cm2 culture wells at a density of 15 x
104 cells/well and grown to confluence in
-MEM/10% FBS. Then the cells were washed in serum-free medium and
preincubated in 37 C serum free HEPES-buffered -MEM supplemented
with the phosphodiesterase inhibitor rolipram (ZK 62.711)
10-5 M.
Rolipram at 10-5
causes 50% inhibition of cAMP phosphodiesterase (28);
however, higher concentrations are cytotoxic in cell cultures. After 30
min, medium with or without test substances was added. The incubation
time was 5 min in all experiments except for the time-course studies.
At the end of the incubation, the media were withdrawn, and cellular
cAMP was extracted with 90% n-propanol. The samples were evaporated
under vacuum and reconstituted in assay buffer. cAMP was then
quantified by a commercially available RIA kit. In parallel wells, the
number of cells was counted using a hemocytometer. Individual
replicates were expressed as % of control and analyzed for sigmoidal
dose-response curves with fixed slope (i.e.
nH = 1), and a fixed bottom value of 100, using
the GraphPad Software, Inc. Prism Computer Program
(GraphPad Software, Inc., San Diego, CA).
Receptor-ligand binding studies with [125I]-labeled
peptides
Osteoblasts were seeded (20 x
104/cm2) in
2-cm2 multiwell dishes and cultured to confluent
monolayers. Then the cells were rinsed twice with PBS and once with
serum free HEPES-buffered -MEM. Subsequently, cells were incubated
in 250 µl HEPES-buffered -MEM supplemented with 10
µM phosphoramidone, 1 mg/ml BSA, and 0.2 µCi
125I-VIP or 125I-PACAP. In
displacement experiments, cells were preincubated for 10 min with
unlabeled agonists. Cells were incubated at 4 C, 15 C, or 25 C for
5–180 min. In inhibition experiments, cells were incubated for 120 min
at 15 C. At the end of the incubation, medium was aspirated and cells
washed 5 times with PBS. Finally, 500 µl Ca2+-
and Mg2+- free phosphate buffer (137 mmol/liter
NaCl, 2.7 mmol/liter KCl, 3 mmol/liter
NaH2PO4; pH 7.2) containing
EDTA (187 mg/liter) and trypsin (100 mg/liter) was added for 10 min and
then the radioactivity in the lysate was analyzed using a 
counter
(Clinicgamma, 1272). In the experiments with
125I-PACAP 38 7–30% of the applied radioligand
bound to the cells, of which 80–90% was specific binding. In the
experiments with 125I-VIP, 2–3% of the applied
radioligand bound to the cells, of which 60% was specific binding.
Individual replicates were expressed as % of control and analyzed for 1 vs. 2 sites using fixed top and bottom values (of 100 and 0, respectively) using the GraphPad Software, Inc. Prism Computer Program. Two-site values are given when they provide a significantly (P < 0.05) better fit to the data than the one-site model.
AFM binding studies
Atomic Force Microscopy (AFM) was used to identify binding sites
for VIP, PACAP 38 (and secretin) on murine calvarial osteoblast
cultures. It is well established that AFM can be used to evaluate
intermolecular binding forces with isolated proteins (for example, see
Refs. 29, 30); we (31, 32) and others
(33) have developed the AFM technique further for cell
biology to measure receptor-ligand binding forces and to map the
distribution of receptor sites in living cells.
AFM is a specialized form of high resolution, nonoptical scanning probe microscopy (34) in which a microfabricated cantilever with a very small tip (with a few nm2 contact area) is used to probe a surface whose features are to be examined. The position of the cantilever is regulated precisely in three dimensions and the force of interaction (in the nano-Newton range) controlled. Using the AFM, it is now possible to evaluate specifically, by coating the tip of the cantilever with known molecule, the binding force between a receptor molecules and their ligands (35), including in cells (31). Thus, we used AFM as an independent technique to demonstrate and validate the presence of specific binding sites for VIP and PACAP 38 in osteoblasts at the single cell level. The force measurements and AFM imaging were performed with a modified Topometrix Explorer system as described recently (31, 32). Briefly, the measurements were carried out on a Nikon inverted microscope using 10 µm liquid scanner and silicon nitride cantilevers. The AFM was fitted onto the microscope with a specially constructed holder. Before the experiments, cells were seeded on 22-mm glass coverslips at a density of 1 x 104 cells/cm2 and cultured for 2 days. The coverslips were mounted into a special sample holder that was equipped with a 1 ml volume chamber. All measurements were performed in liquid on living cells in buffer under ambient temperatures. The buffer used contained 127 mM NaCl, 5 mM KCl, 2 mM MgCl2, 0.5 mM NaH2PO4, 2 mM CaCl2, 5 mM NaHCO3, 10 mM glucose, 10 mM HEPES, and 0.1% BSA. The AFM was calibrated as described by Hutter and Bechhoefer (36); the cantilever spring constant was determined in air with measured values from 0.03 to 0.045 Newton/meter (N/m). To functionalize the cantilever tip, we used polyethylene glycol (PEG, molecular range up to 8000) to attach VIP, PACAP 38, and secretin peptides. The coating was performed only on the extreme end of the cantilever to avoid any influence on the cantilever spring constant and any possible binding to other parts of the cantilever, which might interfere with the measurements.
RNA isolation and first-strand cDNA synthesis
Mouse calvarial osteoblasts were seeded in
60-cm2 culture dishes at a density of 7.5 x
103 cells/cm2 in -MEM
and 10% FBS. After 24 h attachment, medium was changed and the
cells were cultured for 20 days, with change of medium every 2 or 3
days, at 37 C in a humidified atmosphere that contained 5%
CO2 in air. After 4, 8, 12, 16, and 20 days of
culture, cells were lysed with TRIzol LS reagent and total RNA was
extracted following manufacturer’s protocol. As a positive control
tissue, mouse brain was homogenized and lysed in TRIzol LS and total
RNA was extracted. The RNA was quantified spectrophotometrically and
the integrity was analyzed by agarose gel electrophoresis. One
microgram of total RNA was reversed transcribed to cDNA with a first
strand cDNA synthesis kit using random primers. After incubation at 25
C for 10 min and at 42 C for 60 min, cDNA was kept at -20 C until used
for PCR.
PCR
Two microliters the first-strand cDNA mixture was processed by
PCR using a PCR core kit (Life Technologies, Ltd.). The
PCR conditions were: denaturing at 94 C, followed by annealing for
glyceraldehyde-phosphate dehydrogenase (GAPDH) at 57 C, for VIP-1R at
68 C, for VIP-2R at 63 C, for PACAP-R at 58 C, and polymerizing at 72
C. The sequences of primers used were: GAPDH sense,
ACTTTGTCAAGCTCATTTCC and antisense, TGCAGCGAACTTTATTGATG; VIP-1R sense,
TGAGCCTGTTCAGGA AGCT GCACT and antisense, CTCGAATATGGGCTGCTATCATTCTT;
VIP-2R sense, GTCAA GGACAGCGTGCTCTACTCC and antisense
CCTTACAATGCTGATGAAGAGGGC; PACAP-R sense, CAAGAA GGA GGAGCAAGCCATGTG C
and antisense, CATCGAAGTAATGG GGAAGGAGGG. The primers used for the
PACAP-R amplify all known splice variants (37). The
numbers of PCR cycles were 35. The PCR products were
electrophoretically size fractionated and analyzed on ethidium bromide
stained 2% agarose gels. The sizes of the PCR products were GAPDH 270
bp, VIP-1R 520 bp, VIP-2R 381 bp, and PACAP-R 317 bp. Mouse brain RNA
was used as positive control. The identity of the PCR products was
confirmed using Thermo Sequenase II dye terminator cycle sequencing
premix kit with sequences analyzed on ABI 377 XL DNA Sequencer.
Bone mineralized nodule formation
Mouse calvarial osteoblasts were seeded in
9.5-cm2 culture wells 7.5 x
103 in -MEM/10% FBS. After 24 h, medium
was changed to -MEM/10% FBS supplemented with 50 mg/ml
Fe(NO3)3, 50 mg/ml ascorbic
acid and 10 mM ß-glycerophosphate. Cells were cultured 20
days, the cells were washed with PBS, and the cell layers decalcified
with 6 M HCl. Calcium concentration was determined using
atomic absorption spectrometry (38).
Statistics
Statistical analysis of multiple treatment groups was performed
using one-way ANOVA after logarithmic transformation of data, and
subsequently Dunnett’s two- or three-sided comparison was used as post
hoc tests. Results are expressed as means ± SE of
means (SEM). SEM is given when the height of
the error bar is larger than the radius of the symbol.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, a and b). Maximal cAMP rise was seen
from 1 to 4 min in VIP treated cells (Fig. 1a) and in the PACAP 38
treated cells from 1 to 15 min (Fig. 1b). Thereafter, the intracellular
amounts of cAMP gradually decreased with a more rapid decline in
VIP-treated cells. Similar data were obtained in three independent
experiments. The decline was seen also when total cAMP levels (cAMP in
cells + medium) was analyzed in cells exposed to either VIP or PACAP 38
(data not shown). The decline is most likely due to the fact that, at
concentrations used (10-5
M), rolipram only causes 50% inhibition of cAMP
phosphodiesterase activity (28), although we cannot
exclude the possibility that the phenomenon may also be due to
proteolytic breakdown of agonists. In experiments comparing the effect
on cAMP formation by peptides in the VIP/secretin/glucagon family, we
decided to use an incubation time of 5 min.
|
). Using the GraphPad Software, Inc. algorithm described in Materials and
Methods, maximum rates of stimulation,
pEC50, and EC50 values
(nM) were calculated and shown in Table 1. By comparing the calculated
EC50 values, the rank order of response for cAMP
stimulation for peptides of the VIP/secretin/glucagon family was PACAP
38 > PACAP 27 > helodermin > VIP >
helospectin > glucagon> PHI[tmt]secretin (Fig. 2, Table 1, and
data not shown).
|
|
).
|
). In contrast, the stimulatory
effects of PTH (10-7
M) and NA
(10-4
M) were unaffected by PACAP 6–38 (Fig. 3b).
Decreasing VIP concentration to 3 x
10-8
M resulted in complete inhibition by PACAP 6–38
(3 x 10-6
M) and by increasing the concentration to
10-5 or 3 x
10-5
M, no inhibition by the antagonist could be
obtained (data not shown). These results indicate that PACAP 6–38
specifically inhibited VIP and PACAP 38 induced cAMP formation and that
both neuropeptides exert their action through either VIP-2R, PACAP-R or
via both receptor subtypes.
|
The ability of increasing concentrations of unlabeled VIP and PACAP 38
to inhibit 125I-VIP binding to primary mouse
osteoblasts was examined. Unlabeled VIP and PACAP 38, in a
concentration-dependent way, decreased 125I-VIP
bound radioactivity. The lowest concentrations that caused a
statistically significant effect were 3 x
10-7 M VIP
(P < 0.05) and
10-8
M PACAP 38 (P < 0.01) (Fig. 4). Further analysis with GraphPad Software, Inc. Prism program (see Materials and
Methods) indicated that in both cases, the binding was fitted
significantly better by a two-sided model. pIC50
for high and low affinity binding of PACAP 38 was 10.99 ± 0.50
and 7.16 ± 0.08, respectively, with the fraction in high affinity
state of 17 ± 3%. pIC50 values for high
and low affinity binding of VIP was 10.87 ± 0.86 and 5.16 ±
0.16, respectively, with the fraction in high affinity of 25 ±
3%. The pIC50 values corresponds to
IC50 values for high and low affinity sites of 14
pM and 7 µM,
respectively, for VIP; and 10 pM and 70
nM, respectively, for PACAP 38.
|
PACAP 38 (10-7 to 3
x 10-5 M),
PACAP 27 (3 x 10-7
to 3 x 10-5
M), helodermin (3 x
10-6 to 3 x
10-5 M), and
VIP (3 x 10-6 to
3 x 10-5
M), each significantly inhibited binding of
125I-PACAP 38 in a concentration-dependent manner
(P < 0.05 for all concentrations, Fig. 5). In contrast, secretin (Fig. 5),
helospectin, glucagon, and PHI (data not shown) could not influence
binding. The rank order potency observed was PACAP 38 >> PACAP 27
> helodermin > VIP > helospectin = glucagon =
PHI = secretin. GraphPad Software, Inc. analysis of
these data suggested again the presence of two sites, although in the
case of PACAP 27, PACAP 38 and helodermin the fraction in the high
affinity state was rather low (
11%), precluding accurate
determination of their pIC50 values. For the low
affinity site, the pIC50 values were 4.60 ±
0.06 for PACAP 27 (IC50 25
µM), 6.11 ± 0.05 for PACAP 38
(IC50 70 nM) and 4.19
± 0.07 for helodermin (IC50 >30
µM). In the case of VIP, two sites were also
found, although the second site (representing 76 ± 6% of total)
was not inhibited by the concentration range tested. The VIP-sensitive
site was inhibited with a pIC50 value of
4.92 ± 1.09 (IC50 >10
µM).
|
, a and b), but not of the sequence
related peptide secretin (Fig. 6c), when introduced to cells using
functionalized small conical AFM tips. For technical reasons (mainly
the high error signal in the z-piezo position that occurs when living
cells are used), the actual binding force value was not quantitated,
and the measured value at snap off (1 in Fig. 6, a and b) cannot be
interpreted as representing a measure of relative affinity of a
receptor for a given ligand.
|
). Unstimulated mouse calvarial
osteoblasts, cultured for 4 and 8 days, only expressed VIP-2R
transcripts (Fig. 7a). At 12, 16, and 20 days, expression of both
VIP-2R and VIP-1R transcripts could be demonstrated. At no time point,
expression of PACAP-R was observed. The VIP-2R seemed to be more
expressed at 8–20 days than at <8 days. In two separate experiments,
preferential expression of VIP-2R was seen at 2 and 8 days with larger
expression seen at 8 than 2 days. The identity of the PCR products was
confirmed by sequencing. The fact that no reaction product was obtained
when the PCR was performed in samples in which the reverse
transcriptase phase was omitted, indicated that we did not amplify
genomic DNA.
|
). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Using AFM, we demonstrated specific binding of VIP and PACAP 38 to all mouse calvarial osteoblasts, whereas secretin failed to bind. These findings strongly support the view, based on analyzing cAMP enhancement, that osteoblasts are equipped with cell surface receptors with affinity for VIP and PACAP 38, whereas secretin failed to bind. By comparing the rank order of response of peptides in the VIP/secretin/glucagon family on cAMP formation we found that PACAP 38 (EC50, 19 nM) was slightly more potent than PACAP 27 (EC50, 44 nM) and helodermin (EC50, 84 nM), and 10-fold more potent than VIP (EC50, 143 nM). A similar 10-fold difference in potency between PACAP and VIP has also been seen in the rat osteoblast-like tumor cell line UMR 106 (22) and in a nontransformed murine calvarial cell line MC3T3-E1 (23). The relative potency for all examined peptides was PACAP 38 > PACAP 27 > helodermin > VIP > helospectin > glucagon> PHI[tmt]secretin. The higher potency for PACAP could reflect that specific PACAP-R are present in mouse calvarial osteoblasts because PACAP is more potent than VIP in PACAP-R mediated cAMP enhancement. However, usually this difference is 100- to 1,000-fold (14), indicating the alternative possibility that PACAP is exerting the effect via PACAP-preferring VIP receptors. By comparing the relative potency of VIP and related peptides to displace 125I-PACAP binding, we found a rank order of response similar to that obtained when cAMP enhancement was quantified, though the radioligand competition curves were shifted to the right in comparison with the cAMP curves. This discrepancy between radioligand binding and second messenger measurements is a known phenomenon and may reflect the presence of a receptor reserve in the cells. The radioligand studies also demonstrated a higher specific binding for 125I- PACAP 38 (85%) than for 125I- VIP (60%). Secretin failed to displace 125I-VIP or 125I-PACAP 38 binding and did not elevate cAMP. Furthermore, we were unable to show detectable binding of secretin to osteoblasts using our AFM technique. These data indicate that mouse calvarial osteoblasts do not express VIP-1R.
The observation that a specific PACAP-R/VIP-2R antagonist, PACAP 6–38, significantly blocked the VIP, PACAP 38, and PACAP 27 stimulated cAMP formation, but not PTH and NA mediated stimulation further confirms that a specific VIP/PACAP receptor mediates the effects of VIP and PACAP. PACAP 6–38 inhibited the effect of VIP (10-7 M, 80%) more efficiently than that of PACAP 38 (10-7 M, 45%) probably due to the higher affinity binding for PACAP 38. In agreement with our observations, Kovacs et al. (22) found that PACAP 6–38 inhibited VIP, PACAP 38 and PACAP 27 stimulated cAMP formation in the rat osteosarcoma cell line UMR 106. Suzuki and colleagues demonstrated that [Lys1, Pro2,5, Arg3,4, Tyr6]-VIP, an VIP receptor antagonist, inhibited VIP but not PACAP 38 stimulated cAMP formation in MC3T3-E1 cells (23). The authors concluded that PACAP used a binding site other than VIP, but an alternative explanation could be that the antagonist more easily displaced VIP binding than PACAP binding to VIP receptors. Moreover, the response to the antagonist alone was not shown and this makes the results difficult to interpret.
To determine which receptor subtype(s), the PACAP-R, VIP-2R or both, is/are expressed in mouse calvarial osteoblasts, we performed RT-PCR analysis using specific primers for the three VIP/PACAP receptor subtypes. This analysis clearly showed that mouse calvarial osteoblasts only express mRNA for VIP-2R and not for PACAP-R or VIP-1R. Thus, the receptor to which peptides in the VIP/secretin/glucagon family bind to in mouse osteoblasts is a PACAP-preferring VIP-2R. VIP-2R has been designated as helodermin-preferring (41) and in our study using mouse calvarial osteoblasts, helodermin was slightly more potent than VIP in stimulating cAMP and in displacement of 125I-PACAP 38.
It seems to be a species difference regarding the expression of VIP/PACAP receptors because Togari et al. (42) have reported that primary human osteoblasts and human osteosarcoma cell lines express VIP-1R but not VIP-2R and PACAP-R. An alternative explanation may be that VIP-R subtypes are regulated by cell differentiation and that the mouse calvarial osteoblasts used in our experiments and those used by Togari et al. (42) may represent different stages during the osteoblastic differentiation pathway. We therefore studied VIP-R subtype expression in mouse calvarial osteoblasts at different levels of differentiation. Culture of osteoblasts for 20 days resulted in enhanced differentiation and subsequent formation of bone nodules. In the presence of ß-glycerophosphate, these nodules are eventually mineralized (43). In the present experiments, bone nodules started to mineralize at 12 days. At this time point, and thereafter, the mouse calvarial osteoblasts expressed not only VIP-2R, but also VIP-1R. Thus, VIP-2R seems to be expressed in both undifferentiated and differentiated mouse osteoblasts, whereas VIP-1R seems to be induced during differentiation. These data may explain the observed difference in VIP-R expression in mouse and human osteoblasts, although we cannot exclude that the differences are simply due to species differences. The functional implication of differentiationinduced expression of VIP-1R still remains to be shown. Interestingly, enhanced differentiation seems to result also in increased expression of VIP-2R.
In summary, we have demonstrated that undifferentiated mouse osteoblasts express mRNA for VIP-2R, but not for VIP-1R or PACAP-R, and that this message results in expression of cell surface binding sites recognizing peptides in the VIP/secretin/glucagon family. These binding sites preferentially bind PACAP 38, but can also recognize PACAP 27 and VIP, which all are expressed in skeletal nerve fibers. In line with this view, we have recently found that VIP and PACAP, but not secretin, stimulate ALP expression in mouse calvarial osteoblasts (26). These results point to a functional role of VIP-2R mediating ALP effects by VIP and PACAP in bone. Interestingly, terminal differentiation of mouse osteoblasts results in differentiation-induced expression of VIP-1R, which may indicate specific role for these receptors during bone formation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received March 23, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  C. Collet, C. Schiltz, V. Geoffroy, L. Maroteaux, J.-M. Launay, and M.-C. de Vernejoul The serotonin 5-HT2B receptor controls bone mass via osteoblast recruitment and proliferation FASEB J, February 1, 2008; 22(2): 418 - 427. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Lundberg, S. J. Allison, N. J. Lee, P. A. Baldock, N. Brouard, S. Rost, R. F. Enriquez, A. Sainsbury, M. Lamghari, P. Simmons, et al. Greater Bone Formation of Y2 Knockout Mice Is Associated with Increased Osteoprogenitor Numbers and Altered Y1 Receptor Expression J. Biol. Chem., June 29, 2007; 282(26): 19082 - 19091. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Delgado, D. Pozo, and D. Ganea The Significance of Vasoactive Intestinal Peptide in Immunomodulation Pharmacol. Rev., June 1, 2004; 56(2): 249 - 290. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sato, T. W. Gettys, and S. M. Lanier AGS3 and Signal Integration by G{alpha}s- and G{alpha}i-coupled Receptors: AGS3 BLOCKS THE SENSITIZATION OF ADENYLYL CYCLASE FOLLOWING PROLONGED STIMULATION OF A G{alpha}i-COUPLED RECEPTOR BY INFLUENCING PROCESSING OF G{alpha}i J. Biol. Chem., April 2, 2004; 279(14): 13375 - 13382. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Cecconi, G. Rossi, M. Barberi, L. Scaldaferri, and R. Canipari Effect of Pituitary Adenylate Cyclase-Activating Polypeptide and Vasoactive Intestinal Polypeptide on Mouse Preantral Follicle Development in Vitro Endocrinology, April 1, 2004; 145(4): 2071 - 2079. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. V. Morris, C. B. Shoemaker, J. R. David, G. C. Lanzaro, and R. G. Titus Sandfly Maxadilan Exacerbates Infection with Leishmania major and Vaccinating Against It Protects Against L. major Infection J. Immunol., November 1, 2001; 167(9): 5226 - 5230. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
