help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Babu, P. S.
Right arrow Articles by Sairam, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Babu, P. S.
Right arrow Articles by Sairam, M. R.
Endocrinology Vol. 142, No. 1 381-389
Copyright © 2001 by The Endocrine Society


ARTICLES

Hormone-Induced Receptor Gene Splicing: Enhanced Expression of the Growth Factor Type I Follicle-Stimulating Hormone Receptor Motif in the Developing Mouse Ovary as a New Paradigm in Growth Regulation1

P. Suresh Babu, N. Danilovich and M. R. Sairam

Molecular Reproduction Research Laboratory, Clinical Research Institute of Montréal, Montréal, Québec, Canada H2W 1R7

Address all correspondence and requests for reprints to: M Ram Sairam, Ph.D., Molecular Reproduction Research Laboratory, Clinical Research Institute of Montreal, 110 Pine Avenue West, Montréal, Québec, Canada H2W 1R7. E-mail: sairamm{at}ircm.qc.ca


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The acquisition of FSH receptor(s) during follicular growth and their coupling to signaling pathways are key events in follicular development and dominance. However, little is known about the precise nature of the FSH receptor(s) involved in the growth-promoting phases of hormone action. To investigate the hormonal regulation of a newly discovered, alternatively spliced, growth factor type 1 receptor (designated FSH-R3) for the hormone, we examined expression in the adult mouse and the effect of PMSG treatment in the immature mouse ovary. Using RT-PCR and primers based on the established sheep ovarian transcript, a part of the FSH-R3 message was amplified only in wild-type (+/+), but not in the FSH-R knockout (-/-), mouse ovary. Semiquantitative RT-PCR using 3'-end primers specific for FSH-R1 (Gs-coupled) and FSH-R3 indicated expression levels of the latter to be higher when follicular growth was induced by PMSG. Using FSH-R3-specific peptide IgG, FSH-R3 protein was detected by Western blotting in extracts of adult mouse ovary and was localized in granulosa cell membrane of mature follicles. In the immature mouse, levels of FSH-R3 protein that increased after PMSG administration in a time-dependent manner were also localized only on granulosa cell membranes of large follicles. The results reveal for the first time the expression of a different growth-promoting receptor for FSH in the developing and cycling mouse ovary. These observations introduce a new paradigm in the control of ovarian function.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE OVARIAN follicle is critically dependent on an appropriate milieu of steroids, hormones, and growth factors for its maintenance and eventual maturation (1, 2). Although all ovarian follicles are apparently accessible to the same cyclic pattern of regulatory signals, only a few are able to complete the rigorous maturation path required for successful ovulation. The maturation of ovarian follicles comprises several successive events that include recruitment from the primordial pool, growth, selection, dominance, and eventually ovulation followed by luteinization. Depending on the species (or treatment), this process may result in a single or multiple ovulation(s). Although the nature of cues that initiate growth and the mechanisms that ensure that follicles leave the resting pool gradually are still unknown, some recent studies have implicated genes such as the Wilm’s tumor protein (3) and growth differentiation factor-9 (4) in this process. Once the growth of the follicle is initiated, the process becomes dependent on gonadotropic support for maintenance and maturation without which the structure undergoes atresia by apoptosis (5). Thus, the gonadotropic hormones FSH and LH have important regulatory roles in folliculogenesis by enhancing the rate of cell division (6) and increasing the synthesis of the FSH receptor as well as estrogen production in granulosa cells (7, 8, 9). The recent knockout of FSH ß-subunit (10) and FSH receptor (11) genes substantiates and extends the significance of hormone and receptor interactions in follicular development by demonstrating lack of Graffian follicles and ovulation in the mutants. These females are sterile.

The ability of FSH to modulate ovarian function depends not only on the circulating levels of the hormone, but also on the expression of appropriate receptor proteins by potential target cells in the ovary and their connections with specific signal transduction pathways. FSH acts on granulosa cells of the follicle by binding to its specific receptors (FSH-R). The membrane-localized receptor long known to be Gs coupled (designated FSH-R1) has been cloned from many species and shown to be a transmembrane glycosylated protein (12). Although it is currently believed that the various pleiotropic effects of the hormone on granulosa cells are mediated by this single Gs receptor motif (12), actions via other receptor motifs are also possible. The propensity of the FSH-R gene to undergo extensive alternative splicing is also well known (12, 13). Thus, our own investigations in sheep testis have led to the cloning of at least three other FSH-R forms with different structural motifs (13, 14, 15, 16, 17, 18) that might be of biological significance. One of these proteins, which we have designated FSH-R3, has been demonstrated to be a single transmembrane growth factor type I receptor (16) that is expressed on the cell membrane upon transfection of the complementary DNA (cDNA). The FSH-R3 receptor-bearing cells stimulated DNA synthesis after FSH addition (16), and recently, this receptor, but not the Gs-coupled FSH-R1, was also shown to function by enhancing Ca2+ signaling in transfected cells (18). Extending this work further, we not only cloned the FSH-R3 cDNA from the sheep ovary, but also identified the expression of the corresponding protein predicted by the transcript (19).

The mouse FSH-R gene is known to undergo extensive alternative splicing during gonadal development. Several events, such as the increase in synthesis of inhibin B and cytochrome P450 aromatase by FSH in postnatal ovaries, occur well before the expression of the Gs-coupled FSH-R1 receptor (20) and increase in the rate of follicular growth in the early stages in response to exogenous FSH (21). These suggest that other FSH-R motifs might also be functional to play a role during development. However, little information other than demonstration by PCR of certain exons is available on the presence of the FSH receptor types (22) in this species. An important question in fully elucidating the role of FSH in ovarian function and its relation to follicular dynamics is to determine whether any other FSH receptor motif besides the well established Gs protein-coupled FSH-R1 is also involved in follicular growth. We could not derive any information on the discriminatory roles of potentially different types of FSH-R in the mouse from our homologous recombination study (11), because the knockout strategy that we designed was effective in eliminating all types of FSH-Rs. We recently demonstrated the presence of the growth factor type I FSH-R3 protein in the sheep ovary (19) and provided evidence for coupling of this motif to the activation of extracellular regulated kinase pathways in ovarian granulosa cells (23). This has prompted us to explore the possible existence of this novel receptor motif in the mouse ovary at different stages of development. Thus, the aim of this study was to examine its expression and to investigate its hormonal regulation. By using normal and hormone-manipulated mice we now demonstrate the expression of the novel FSH-R3 transcript as well as the protein. Interestingly, FSH treatment of immature mice causes enhanced expression of the growth factor type I receptor that may be required to sustain rapid cell proliferation. Thus, expression of this growth factor type 1 receptor for FSH in the developing follicle might also account for the hormone’s action during follicular growth and dominance.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
All experiments involving animals were performed according to institutionally approved and current animal care guidelines. Immature female mice (129SV) bred in our facility were injected ip at 21 days of age with 5 IU PMSG (Horizon Technology Pty. Ltd., Sydney, Australia) to promote growth of a cohort of healthy antral follicles during 24 and 48 h of treatment. Age-matched mice that had been treated with saline were used as controls in these experiments. In addition, ovaries of 12-week-old wild-type (+/+) females in proestrus and acyclic FSH receptor knockout mice (-/-; abbreviated FORKO mice) (23A ) of the same age but selected at random were also used for experiments. These animals were genotyped upon weaning by PCR of DNA from the tail digest (24) and maintained under standard conditions of temperature (22 C) and lighting (14 h of light, 10 h of darkness). Animals were killed by decapitation, and ovaries were rapidly removed, frozen in liquid nitrogen, and stored until use at -80 C. For immunohistochemistry, ovaries were fixed in 4% paraformaldehyde for paraffin embedding. After manipulations in a tissue processor, 5-µm sections were cut for various treatments as noted below.

RT-PCR
Ovaries were dissected from adult wild-type (+/+), FORKO (-/-), as well as PMSG-treated immature wild-type mice. As the ovaries of FORKO mice are very small, a larger number was required to obtain adequate material. Total RNA was extracted as described previously using the midi RNA isolation kit (19) following instructions of the manufacturer (Ambion, Inc., Austin, TX). Multiplex RT-PCR was used to determine the expression of the two FSH-R transcripts, designated FSH-R1 and FSH-R3, with ß-actin serving as a control in each amplification reaction. For amplifying the FSH-R3 transcript we used sheep FSH-R3 (13, 19)-specific primers SM 156 (TCTCCACTGCTGCACTGTTGGGCT) and SM157 (ATTCAAATACAGGAAATAGAGAAA) expected to amplify a 382-bp product [corresponding to sequence 670-1051 of clone HK18 (13)]. For mouse FSH-R1 verification, we designed sense AGCAAGTTTGGCTGTTATGAGG and antisense GTTCTGGACTGAATGATTTAGAGG primers based on the published sequence (GenBank accession no. AF095642), such that a product of the expected size of 156 bp would be from the coding 3'-end of that transcript (bases 1921–2076). For mouse ß-actin the primers were designed to amplify the sequence 48–561 (GenBank accession no. X03765). Preliminary trials were performed to optimize a single set of conditions for multiplex PCR in which the amplifications of the genes would be in the exponential range. The final conditions for amplification were 95 C for 4 min followed by 25 cycles of 50 sec each at 94, 55, and 72 C, respectively. The final extension was for 7 min. The products were separated on 1.5% agarose gel and stained with ethidium bromide. For Southern hybridization, the RT-PCR products from +/+ and -/- ovaries were transferred to nylon membrane using standard protocols. The amplification of a 382-bp product was further confirmed by using a 32P-labeled FSH-R3-specific 3'-end fragment of ovine (o) FSH-R3 (13, 19) by hybridizing overnight at 65 C and washing at high stringency followed by autoradiography.

Preparation and characterization of FSH-R3- specific antibody
A 20-amino acid residue peptide corresponding to the C-terminal segment of oFSH-R3 (CYGQREHISEFGLKSKQHPN; see Fig. 1Go) was synthesized using an automated peptide synthesizer. This sequence, unique to ovine FSH-R3, showed no similarity with other glycoprotein hormone receptors (TSH or LH receptors) or other proteins (GenBank data search). The peptide was conjugated to human serum albumin (Sigma, St. Louis, MO) using EDC-HCl (Pierce Chemical Co., Rockford, IL) as a coupling reagent. A preimmune serum taken from the rabbits served as control. Antiserum was prepared in rabbits by multipoint injections of 250 µg conjugate in Freund’s compete adjuvant. Blood was collected on day 8 after the fourth booster and periodically thereafter. Serum was separated and stored at -20 C.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 1. Comparison of the structural motifs of oFSH-R1 (Gs-coupled) and oFSH-R3 (growth factor receptor type I). At the top are the splicing patterns of the FSH-R gene that create these two receptor motifs. It is predicted that the oFSH-R3 transcript arises by splicing the segment shown as exon 11 to the junction at the eighth exon. The forward and backward arrows indicated for R1 and R3 show the locations of primers (see Materials and Methods for details) selected for specific amplification by PCR of respective receptors. The bottom portion of the figure depicts the topography of FSH-R1 and FSH-R3 proteins. The residue numbers shown are those of the mature receptor cloned in sheep. Two of the three glycosylation sites of R1 are also present in R3 and are shown as branched structures. The mouse Gs receptor (GenBank no. AF095642) is very similar to sheep FSH-R1. The 20-amino acid peptide specific to FSH-R3 and used for generation of the antibody is shown below the diagram.

 
Sera were tested for antibody titer by solid phase RIA using multiwell plates coated with unconjugated peptide (2 µg/well) in 10 mM glycine, pH 9.2, buffer. Immune complex formation was detected by incubation with 125I-labeled protein G (17). The antiserum showing high titer was purified by affinity chromatography on human serum albumin coupled to Affigel-15 (Bio-Rad Laboratories, Inc., Richmond, CA). The unadsorbed fraction was further subjected to fractionation on a protein A-Sepharose CL-4B column (Pharmacia Biotech, Baie d’Urfe, Canada) to prepare the final purified oFSH-R3 antipeptide IgG. For some experiments the antiserum was preabsorbed by incubating with excess free peptide antigen (200 µg/ml) for 12 h at 4 C. Any resultant precipitate was removed by high speed centrifugation for 10 min, and the clear supernatant was used for solid phase RIA. Recombinant FSH receptor proteins corresponding to two alternatively spliced transcripts (FSH-R3 and FSH-R4) were expressed in Escherichia coli and purified according to published procedure (17). These purified proteins along with stable transfected HEK 293 cells expressing oFSH-R1 and oFSH-R3 cDNA (16, 19) were employed in characterization of the antibody. Other synthetic peptides used for testing the specificity of the R3 peptide antibody included the following: 1) the C-terminal peptide of the Gs-coupled oFSH-R1 with sequence APRVTNGSNYTLIPLRHLAKN (sequence 658–678), 2) the C-terminal peptide of oFSH-R2 CNHFSSLYVARGNIFLNLD (sequence 634–652, except for Y replacing F) (14), and 3) peptide NSY amide corresponding to residues 9–30 in the N-terminal part of the rat FSH-R1 (25) (provided by Dr. J. Rivier).

Cell culture and deglycosylation
For purposes of characterization and comparison, an immortal pig granulosa cell line lacking endogenous FSH receptors was transfected with the FSH-R3 cDNA cloned in the pcDNA1 neo vector (Invitrogen, San Diego, CA). Stable cells (designated JC-R3) were selected after 8 weeks by using 400 µg/ml G418 (Life Technologies, Inc., Mississauga, Canada) in the culture medium. These procedures have been described recently (23).

Granulosa cells expressing FSH-R3 (JC-R3 or vector transfected controls) were scraped in cold PBS and collected by centrifugation at 800 x g for 10 min at 4 C. They were lysed in lysis buffer [20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Nonidet P-40, and 1 mM phenylmethylsulfonylfluoride (PMSF)] and left on ice for 30 min for solubilization of membrane proteins. The solubilized receptor was deglycosylated using N-glycosidase F (Roche Molecular Biochemicals, Indianapolis, IN), which cleaves all N-linked glycomoieties of the FSH receptor. Approximately 200 µg membrane protein were suspended in 0.1 M Tris-HCl buffer (pH 7.4) with 0.1 mM PMSF and incubated with 50 U/ml N-glycosidase F.

Western blotting
Protein extracts were prepared from mouse ovary or JC-R3 cells that were engineered to express FSH-R3 cDNA as describe above. Tissue or cells collected by scraping in PBS were washed and then homogenized in lysis buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, and protease inhibitors mixture made up of PMSF (100 µM), aprotinin (20 µg/ml), and leupeptin (20 µg/ml)]. Protein contents of the high speed supernatant samples were estimated using the Bio-Rad Laboratories, Inc., assay reagent (Richmond, CA).

Protein samples (100 µg) from total cell extracts or tissue-solubilized fractions were separated by 10% SDS-PAGE minigel and then transferred on to a polyvinylidene difluoride membrane for Western blotting. After blocking for nonspecific sites, membranes were incubated with R3 peptide IgG antibody (1 µg/ml) in Tris-buffered saline containing 1% (wt/vol) skim milk powder and 0.05% Tween-20 for 1 h at room temperature. The washed blot was then incubated with goat antirabbit IgG conjugated to horseradish peroxidase (Sigma; 1:5000). Antibody binding to the membrane was visualized using Super Signal Ultra (Pierce Chemical Co.) chemiluminescent detection system. In some experiments the blots were stripped and reprobed with specific antibody to glyceraldehyde phosphate dehydrogenase (GAPDH; Sigma, Ontario, Canada) to serve as an internal control and verify equivalent protein loading.

Immunohistochemistry
Paraffin-embedded sections (5 µm) from saline- and PMSG-treated mouse ovaries were analyzed in parallel after treatment with CAS block solution for 10 min to clear background staining (Zymed Laboratories, Inc., South San Francisco, CA). The FSH-R3 IgG (19) was used at a dilution of 10 µg/ml and was detected using a Histostain kit according to the manufacturer’s instructions (Zymed Laboratories, Inc.).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Characterization of the anti-oFSH-R3 peptide antibody
To facilitate the better understanding of the experimental approach of our current study we have depicted in Fig. 1Go the diagrams of the Gs-coupled oFSH-R1 and the growth factor type I receptor oFSH-R3 to emphasize the major differences in topography. The corresponding mature receptors cloned in the sheep are single polypeptide chains of 678 and 242 amino acids, respectively. The first 206 residues in the two mature receptor forms are identical. The oFSH-R3 differs from R1 after the eighth exon (arrow in Fig. 1Go, right) by having a 34-amino acid extension contributed by a splicing event (13, 19). Hydropathy analysis predicts a single transmembrane segment in the putative FSH-R3 protein (16). As shown at the top of Fig. 1Go we have proposed that the single transmembrane structure as well as the short intracellular domain in FSH-R3 are contributed by a different exonic segment of the large FSH-R gene (16). Two other receptor forms cloned in our laboratory (13, 14, 17) are designated FSH-R2 and FSH-R4 (not shown).

Rabbit antibody was generated against the indicated peptide segment of oFSH-R3 predicted to be in the cytoplasmic tail (Fig. 1Go). The specificity of antiserum was established in several ways, as shown in Fig. 2Go. First, in a solid phase test the antibody recognized only the R3 peptide coated on plastic wells. Neither preimmune serum nor the R3 antiserum preabsorbed with the corresponding peptide could bind the immobilized peptide (Fig. 2AGo). The antibody also reacted efficiently with the recombinant FSH-R3 protein produced in Escherichia coli, but not with other sequences such as the C-terminal peptide of ovine FSH-R1 (Fig. 2BGo) or the exon 1–4 recombinant protein coded by another alternatively spliced product FSH-R4 (17). The peptide 9–30 of the extracellular domain of the rat FSH-R or the C-terminal peptide of oFSH-R2 also showed no reaction (data not shown). Confirmation of these data was provided in our recent report (19) showing Western blots that demonstrated reaction of the R3 peptide IgG with the recombinant E. coli FSH-R3 protein or the glycosylated protein expressed in mammalian cells.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Verification of FSH-R3 peptide antibody specificity. A, Solid phase binding assay using plastic wells coated with 2 µg/well R3 peptide. These wells were treated in the following manner: PIS, preimmune serum; R3-As, R3 antiserum; Abs R3-As, antiserum preabsorbed with R3 peptide. Boxes in the right top corner indicate antiserum dilution. Primary antibody binding to coated wells was detected by 125I-labeled protein G. B, Specificity of R3 antibody binding using different antigens. The experiment was performed as indicated above with the R3 antiserum challenged with different peptides coated on wells. rFSHR3, Recombinant and purified R3 protein expressed in E. coli (1 µg/well); FSHR1 peptide, FSH-R1 carboxyl-terminal peptide of the Gs-coupled receptor (see Materials and Methods; 2 µg/well); rFSHR4, recombinant and purified FSH-R4 protein (exons 1–4) produced in E. coli (1 µg/well) (17 ). Other peptides mentioned in Materials and Methods did not react with the R3 antiserum (data not shown).

 
Expression of spliced FSH-R3 in adult mouse ovary: messenger RNA (mRNA) and protein
To study the presence of FSH-R3 receptor transcript in the adult mouse ovary, we first examined the expression of a 382-bp product unique for the FSH-R3 receptor. This sequence was correctly amplified using primers specific for the 3'-end of the ovine FSH-R3 (comprising 100 bases of 3'-translated and 282 bases of 3'-untranslated region; see also Fig. 1Go, top). These primers fail to amplify any sequence from FSH-R1 cDNA). The amplified mouse R3 fragment subsequently hybridized with the oFSH-R3 probe, confirming specificity. The positive reaction persisted under high stringency washing conditions. Although RNA extracted from the tissue of the adult FORKO (-/-) mouse did not react (Fig. 3AGo, lane 1), the adult wild-type (+/+) mouse ovary sample showed a single band of the expected size (lane 2 in Fig. 3AGo).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. Southern hybridization of RT-PCR product from pooled ovaries from adult FORKO (-/-) mouse (lane 1) and wild-type mouse (+/+; lane 2) generated using specific 3'-end sheep FSH-R3 primers (see Fig. 1Go, top, and Materials and Methods for location). B, Western blot analysis of FSH-R3 expression in granulosa cells transfected with oFSH-R3 cDNA and ovaries of adult wild-type (+/+) mice. Blots were first probed with FSH-R3-specific IgG (19 ) and then stripped for reprobing with the GAPDH antibody to verify loading. Lane 1, Immortal granulosa cells transfected with vector alone; lane 2, cells transfected with oFSH-R3 receptor cDNA (JC-R3 cells) as a positive control; lane 3, JC-R3 cells treated with the enzyme N-glycosidase-F; lanes 4 and 5, solubilized membrane extracts of FSH-R knockout (-/-) and wild-type adult mouse ovaries, respectively.

 
To confirm and extend the above results, we employed two additional methods that directly verify the presence of the protein in the ovary. These included Western blotting of soluble mouse ovarian extracts (Fig. 3BGo) and immunohistochemistry of ovarian tissues (Fig. 4Go), using a specific antibody directed against the C-terminal end of oFSH-R3. In a granulosa cell line that had been engineered to express the oFSH-R3 cDNA (Fig. 3BGo, lane 2) this antibody readily recognized a 39-kDa protein. When this protein extract was treated with the enzyme N-glycosidase F to remove covalently bound N-linked sugars, the apparent molecular mass was reduced to approximately 28 kDa (lane 3). In control granulosa cells transfected with the expression vector alone (lane 1), there was no reaction with the antibody under identical conditions. In the extract of ovaries from the FORKO (-/- FSH-R) mouse, there was also no reaction (lane 4). However, the immunoblot in Fig. 3BGo (lane 5) clearly revealed the presence of the same 39-kDa protein in the wild-type (+/+) mouse ovary. Approximately equal protein loading of the extracts for each lane is evident by similar intensities seen for the control GAPDH protein upon reprobing of the stripped blot (Fig. 3BGo, bottom panel).



View larger version (118K):
[in this window]
[in a new window]
 
Figure 4. Immunohistochemistry of FSH-R3 protein in the mouse ovary. A and B, PMSG-primed ovary (24 h) sections treated with normal rabbit serum as control. C–F, Immunostaining patterns for FSH-R3 expression in immature mouse ovaries after 24-h (C and D) and 48-h (E and F) PMSG administration. Small and large follicles from adult unprimed and immature gonadotropin-primed (48-h) ovaries are depicted in G and H, respectively. sm, Small follicle; Lg, large follicle. Arrows indicate specific binding. Original magnifications: A, C, and E, x100; B, D, and F, x315; G and H, x50.

 
Immunohistochemical detection in the hormone-primed immature mouse and normal adult ovary
Immunohistochemistry performed using ovarian sections from these groups of hormonally treated immature animals and normal adults is shown in Fig. 4Go. Ovarian sections treated with preimmune serum did not reveal any staining (Fig. 4Go, A and B) under identical conditions. In the PMSG-primed ovary, FSH-R3 is induced at early stages of follicular development, i.e. in small preantral follicles, reaching higher levels in the granulosa cells in a time-dependent manner. The intensity of staining at 48 h post-PMSG treatment (Fig. 4Go, E, F, and H) was much higher than that observed at 24 h (Fig. 4Go, C and D), which also corroborates the Western blot data (see Fig. 6Go). The novel FSH receptor (FSH-R3) in the mouse ovary appeared to be localized exclusively in granulosa cell membranes. Interestingly, the intensity of staining was higher in granulosa cells in close proximity to the developing oocyte. Analysis with FSH-R3 IgG applied to the adult mouse ovary (Fig. 4GGo) showed specific staining on granulosa cell membranes of the large mature follicle.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 6. Western blot analysis of FSH-R3 induction in hormone (PMSG)-primed immature mouse ovary detected by R3-specific IgG. Lane 1, Saline-treated ovary; lanes 2 and 3, 24- and 48-h hormone-treated ovary extracts. Middle panel, Internal control of GAPDH expression performed after stripping the membranes and reprobing with that antiserum. Note approximately equal loading in the three lanes. Bottom panel, Densitometric scanning of the above blots expressed as a ratio of GAPDH at each time point.

 
Relative expression patterns of FSH-R1 and FSH-R3 transcripts in immature mouse ovary
It has been known for over 4 decades that PMSG treatment accelerates follicular development in the intact, sexually immature female rodent (26). Accordingly, we used this model to examine whether hormone treatment would influence the pattern of FSH receptor expression with special attention to the detection of alternatively spliced receptor protein motif. As expected, a single injection of PMSG used as a surrogate for FSH caused follicular development in 24 h that further enlarged by 48 h. Multiplex RT-PCR and semiquantitative data (Fig. 5Go, top panel) of receptor gene expression in the ovary reveal that the expression of both FSH-R3 and FSH-R1 message is clearly detectable and about equal in saline-treated control immature animals. PMSG treatment increased the expression of both FSH-R1 and FSH-R3 in the immature ovary, and interestingly, the relative expression of FSH-R3 was definitely higher than that of FSH-R1. This result was highly reproducible. The increase in FSH-R1 expression over that in saline-treated controls was 2.5- and 3.1-fold compared with 5- and 6.1-fold with FSH-R3 after 24 and 48 h of hormone treatment (Fig. 5Go, bottom panel). Thus, the relative expression of FSH-R3 message was about twice that of FSH-R1 at both times.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 5. Multiplex RT-PCR. RNA was isolated from both saline-treated and hormone-treated ovaries of immature mice. Five micrograms of RNA were reverse transcribed as described in Materials and Methods. Equal amount of cDNA was multiplexed (25 cycles) either with FSH-R1- and FSH-R3-specific 3'-primers (see Fig. 1Go, top, and Materials and Methods). Amplification of ß-actin served as an internal control. At the extreme left of lane 1 are DNA Mr markers. Lanes 1 and 2, Saline-treated FSH-R1 and FSH-R3; lanes 3 and 4, FSH-R1 and FSH-R3 after 24-h hormone treatment; lanes 5 and 6, FSH-R1 and FSH-R3 from ovaries of 48-h hormone-treated mice. The sizes of R3 and R1 fragments are 382 and 156 bp, respectively. The ß-actin fragment is 514 bp. Bottom panel, Densitometric analysis of PCR products to evaluate relative expression. *, Significant difference from saline controls, P < 0.05. Error bars are ± SEM (n = 3).

 
Hormone-induced up-regulation of FSH-R3 protein in developing mouse ovary
To determine whether the gonadotropin could also directly modulate the levels of FSH-R3 protein in the ovary during a state of induced rapid follicular development, we performed immunoblotting. A representative Western blot analysis is presented in Fig. 6Go. The FSH-R3 protein that was not detectable in saline-treated immature ovary (lane 1), probably because of low abundance, was clearly induced 24 h after PMSG administration (lane 2). This band intensity increased further in 48 h of treatment (lane 3). The middle panel of Fig. 6Go reveals that protein loading for the three lanes was equivalent. Densitometric scanning of the FSH-R3 bands and normalization using GAPDH indicated that there was a clear increase in R3 receptor protein (~50% increase) from 24 to 48 h (Fig. 6BGo).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The main purpose of this study was to investigate whether FSH-R forms other than the well established classical Gs-coupled FSH-R1 exist in the mouse ovary and whether there is any variation during follicular development. While examining the presence of a novel receptor type designated FSH-R3 in this exercise, we have paid particular attention to the detection of the corresponding protein, because some gene sequences that may be transcribed are not always translated into protein for various reasons. The acquisition of FSH receptor(s) during follicular growth is believed to be a key event in the subsequent development of the follicle. The frequently used model for studying this process has been the hormonally primed immature animal, in which small follicles can be induced to develop in response to PMSG, a surrogate hormone with FSH-like activity. This treatment results in functional follicles that are ready to ovulate under the influence of hCG, inducing pseudopregnancy in the animal (26). A variety of processes such as apoptosis/atresia (5, 27), gene expression, steroidogenesis (28), and signaling pathways (29, 30, 31) have been examined in follicles or cells derived from this or a similar model. Despite recent advances in understanding the structure of the FSH receptor in different species (12) and hormonal regulation of ovarian FSHR(s) mRNA (1), very little information is available regarding the type of receptor motif(s), particularly at the protein level, that may be involved in follicular growth. This becomes important because the single large gene undergoes alternative splicing, creating discrete mRNAs that could produce different types of receptor motifs (13, 14, 15, 16, 18, 19).

Until recently it was generally believed that a single signaling entity in the form of the Gs-coupled receptor mediates all the diverse functions of the hormone, as this form was the most extensively investigated. In addition, the poor characterization and lack of specific reagents (probes and antibodies) for each FSH-R transcript impeded consideration of other entities. Investigations involving radioautography or binding studies using labeled hormone or in situ hybridization with probes designed for the extracellular domain or the seven transmembrane regions may lack the discriminatory power to distinguish other FSH receptor entities. If some of these new motifs appear on the cell surface, they may also interact with the hormone. Thus, total hormone binding detected in the stimulated ovary or pooled granulosa cells may represent the aggregate value contributed by the Gs-coupled FSH-R1 as well as other forms. Recently, we demonstrated that a distinct growth factor receptor type I motif FSH-R3 transcript and protein are both present in the sheep ovary and testis (19). We also showed that the receptor is expressed on the cell surface in transfected cells exhibiting the same affinity for the labeled hormone as FSH-R1 (16). Membrane localization of FSH-R3 was also shown using receptor-specific peptide antibody (19), which was also used in the current investigation. A physiological role for this receptor was implicated by the demonstration of its functional coupling to well known actions of FSH (18, 23).

Our finding presented in this report is the first identification of the presence in the adult mouse ovary of the FSH-R3-like transcript and protein similar to those in sheep (Fig. 3Go). The failure of previous investigations to observe this new transcript(s) is probably due to the incorrect choice of primers used in the RT-PCR screenings (20, 22). That the transcript was detectable only in the wild-type ovary but not in the FORKO mouse ovary clearly shows that this receptor type has also been eliminated in our receptor knockout strategy (11). Therefore, the infertility observed in these females may be due to the total loss of the FSH receptor signaling repertoire. The detection of a 39-kDa protein by Western blotting in the wild-type adult ovary but not in the FORKO mouse ovary using oFSH-R3-specific IgG is compelling evidence for efficient expression of the novel receptor form. Because the molecular mass of the mouse protein (39 kDa) is same as that of sheep FSH-R3, we further suggest similar structural features of the first eight exons spliced to a variant DNA sequence to produce an N-glycosylated receptor (19). This latter feature would confer a slower migration on SDS-PAGE to show an apparently higher molecular mass for the protein. Before using the R3 peptide antibody we carefully verified its specificity by testing it with other FSH receptor peptides or proteins. The fact that it reacted solely with its own peptide antigen or the recombinant R3 protein produced in E. coli suggests that the right protein is detected, a conclusion supported by previous studies (19).

The variation of the FSH-R3 transcript coincident with PMSG-induced follicular development in the immature mouse ovary suggests that this receptor might also contribute in a significant manner to FSH signal transduction mechanisms. The FSH-R1 transcript showed a similar trend, increasing from 0–48 h. By selecting primers specific for the 3'-region we restricted our examination solely to these two receptor entities for which some signaling information is available. This, however, does not preclude variations in other splice variants that may also exist in this state of induced development. A comparison of the relative intensities of FSH-R3 vs. FSH-R1 indicates several interesting features that may be of significance during ovarian development. Both transcripts that appeared to be expressed at about equal levels in the untreated immature ovary are quickly up-regulated after hormone treatment, suggesting that transcriptional activation mechanisms, including splicing, are initiated very quickly. The consistently higher (2-fold) FSH-R3 expression compared with FSH-R1 at both time points and coinciding with the increase in growth of the follicle suggests an important role for the FSH-R3 protein. Although this novel observation does not diminish the widely accepted role of FSH-R1 in follicular development, it implicates another candidate receptor(s) in the regulatory process. This conclusion is strongly supported by the immunohistochemical data, which also detected the corresponding FSH-R3 protein in the extracts of the PMSG-primed ovaries. Here again, the increase in R3 protein with time of hormonal stimulation showed a close correlation with follicular development. Considering the careful characterization studies we have performed on the FSH-R3 peptide antibody (unpublished data) showing that it does not react with other receptor forms, it is reasonable to conclude that we are selectively detecting the expression of the R3 protein in the ovary. Localization of this receptor to the surface of the granulosa cells in the large follicles of the adult ovary and also in follicles recruited for development in PMSG-primed immature animals supports the argument for its role in hormone action. The single difference in our observation in this regard should be pointed out. Although we did not observe immunochemical staining of the oocyte in the adult ovary, some staining was observed in this structure in sections of the PMSG-primed mouse ovary. As FSH binding to oocytes has not been reported, implying lack of FSH receptor, we have no direct explanation at this time for the apparent discrepancy.

Several controversies concerning FSH action are already known (12). Our recent findings of the signaling potential of FSH-R3 (16, 18, 19, 23) may help to reconcile and rationalize the existence of different receptor motifs in this highly dynamic compartment of the ovary. FSH and LH are known to activate the mitogen-activated protein kinases in granulosa cells derived from normal or hormone-primed animals (29, 30). In addition to other events, differences in the activation of mitogen-activated protein kinases by cAMP and gonadotropins (LH and FSH) suggest that the hormones activate these enzymes via pathways that operate at least in part independently of cAMP (30, 31). Events such as FSH-induced rapid induction of oncogenes (31), DNA synthesis in the early stages of follicular growth (6), and absence of FSH-mediated calcium signaling in FSH-R1-transfected cell lines (18, 32) suggest that other receptor structural motifs may also be involved in hormone action. In many systems it has been established that a significant elevation of intracellular cAMP levels may potently inhibit cell proliferation and division (33). However, FSH-induced cell proliferation in ovarian follicles is a major effect of the hormone that may be incompatible with elevation of cAMP, a second messenger that is clearly elevated by FSH-R1 (34). Therefore, it is reasonable to propose that a counterbalancing signaling pathway that operates independently of cAMP, such as FSH-R3, may be critical at this juncture. A receptor motif such as FSH-R3 that is coupled to rapid calcium mobilization (18) and extracellular regulated kinase 1/2 activation without elevating cAMP (23) may serve to stimulate rapid cell proliferation required for follicular expansion. The rapid effects of FSH on DNA synthesis in follicles would be consistent with these mechanisms (6).

In conclusion, these studies show that a different FSH receptor motif other than the widely accepted Gs-coupled entity is also expressed in the mouse ovary and is up-regulated in the developing ovary under hormonal influence. This is also the first report documenting that gonadotropin treatment induces a different functional FSH receptor during follicular growth, introducing a new experimental paradigm in the control mechanisms of ovarian biology. Further studies will be necessary to delineate stage-specific expression of both FSH-R1 and FSH-R3 proteins during folliculogenesis, a task that requires the design of discriminating reagents specific for the Gs-coupled receptor.


    Acknowledgments
 
We thank G. N. Jayashree for performing the solid phase immunoassays, and Dr. H. Krishnamurthy for the preparation of some figures. The technical help of Maria Gerdes and secretarial assistance of Odile Royer are also greatly appreciated. Dr. J. Rivier of The Salk Institute (La Jolla, CA) provided the 9–30 FSH receptor peptide used in the study.


    Footnotes
 
1 This work was supported by the Canadian Institutes of Health Research. Peptide NSY amide corresponding to residues 9–30 in the N-terminal part of the rat FSH-R1 was provided by Dr. J. Rivier under Contract NO1-HD-0–2906. Back

Received June 12, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Richards JS, Fitzpatrick SL, Clemens JW, Morris JK, Alliston C, Sirois J 1995 Ovarian cell differentiation: a cascade of multiple hormones, cellular signals, and regulated genes. Recent Prog Horm Res 50:223–254
  2. Fortune JE 1994 Ovarian follicular growth and development in mammals. Biol Reprod 50:225–232[Abstract]
  3. Hsu SY, Kubo M, Chun SY, Haluska FG, Housman DE, Hsueh AJ 1995 Wilms’ tumor protein WT1 as an ovarian transcription factor: decreases in expression during follicle development and repression of inhibin-{alpha} gene promoter. Mol Endocrinol 9:1356–1366[Abstract/Free Full Text]
  4. Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N, Matzuk MM 1996 Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature 383:485–486[CrossRef][Medline]
  5. Tilly JL 1996 Apoptosis and ovarian function. Rev Reprod 1:162–172[Abstract]
  6. Roy SK, Greenwald GS 1986 Effects of FSH and LH on incorporation of 3H-thymidine into follicular DNA. J Reprod Fertil 78:201–209[Abstract/Free Full Text]
  7. Sites CK, Patterson K, Jamison CS, Degen SJ, La Barbera AR 1994 Follicle-stimulating hormone (FSH) increases FSH receptor messenger ribonucleic acid while decreasing FSH binding in cultured porcine granulosa cells. Endocrinology 134:411–417[Abstract/Free Full Text]
  8. Richards JS, Ireland JJ, Rao MC, Bernath GA, Midgley Jr AR, Reichert Jr LE 1976 Ovarian follicular development in the rat: hormone receptor regulation by estradiol, follicle stimulating hormone and luteinizing hormone. Endocrinology 99:1562–1570[Abstract/Free Full Text]
  9. Tilly JL, LaPolt PS, Hsueh AJ 1992 Hormonal regulation of follicle-stimulating hormone receptor messenger ribonucleic acid levels in cultured rat granulosa cells. Endocrinology 130:1296–1302[Abstract/Free Full Text]
  10. Kumar TR, Wang Y, Lu N, Matzuk MM 1997 Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet 15:201–204[CrossRef][Medline]
  11. Dierich A, Sairam MR, Monaco L, Fimia GM, Gansmuller A, LeMeur M, Sassone-Corsi P 1998 Impairing follicle-stimulating hormone (FSH) signaling in vivo. Targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance. Proc Natl Acad Sci USA 95:13612–13617[Abstract/Free Full Text]
  12. Simoni M, Gromoll J, Nieschlag E 1997 The follicle stimulating hormone receptor. Biochemistry, molecular biology, physiology and pathophysiology. Endocr Rev 18:739–773[Abstract/Free Full Text]
  13. Khan H, Yarney TA, Sairam MR 1993 Cloning of alternative spliced mRNA transcripts coding for variants of ovine testicular follitropin receptor lacking the G protein coupling domains. Biochem Biophys Res Commun 190:888–894[CrossRef][Medline]
  14. Yarney TA, Jiang L, Khan H, MacDonald EA, Laird DW, Sairam MR 1997 Molecular cloning, structure, and expression of a testicular follitropin receptor with selective alteration in the carboxy terminus that affects signaling function. Mol Reprod Dev 48:458–470[CrossRef][Medline]
  15. Sairam MR, Jiang LG, Khan H, Yarney TA 1996 Follitropin signal transduction: alternative splicing of the FSH receptor gene produces a dominant negative form of receptor which inhibits hormone action. Biochem Biophys Res Commun 226:717–722[CrossRef][Medline]
  16. Sairam MR, Jiang LG, Yarney TA, Khan H 1997 Alternative splicing converts the G-protein coupled follitropin receptor gene into a growth factor type I receptor: implications for pleiotropic actions of the hormone. Mol Reprod Dev 48:471–479[CrossRef][Medline]
  17. Khan H, Jiang LG, Jayashree GN, Yarney TA, Sairam MR 1997 Recognition of follicle stimulating hormone ({alpha} subunit) by a recombinant receptor protein domain coded by an alternately spliced messenger RNA and expressed in E. coli. J Mol Endocrinol 19:183–190[Abstract/Free Full Text]
  18. Touyz RM, Jiang L, Sairam MR 2000 Follicle stimulating hormone mediated calcium signaling by the alternatively spliced growth factor type I receptor. Biol Reprod 62:1067–1074[Abstract/Free Full Text]
  19. Babu PS, Jiang J, Sairam AM, Touyz RM, Sairam MR 1999 Structural features and expression of an alternatively spliced growth factor type I receptor for follitropin signaling in the developing ovary. Mol Cell Biol Res Commun 2:21–27[CrossRef][Medline]
  20. O’Shaughnessy PJ, Dudley K, Rajapaksha WR 1996 Expression of follicle stimulating hormone-receptor mRNA during gonadal development. Mol Cell Endocrinol 125:169–175[CrossRef][Medline]
  21. McNatty KP, Smith P, Hudson NL, Heath DA, Luns S, Smith P 1991 Follicular development and steroidogenesis. In: Sjoberg NO, Hamberger L, Jansen PO, Owman C, Coelingh HIJ (eds) Local Regulation of Ovarian Function. The Pathenon Publishing Group, Carnforth, pp 21–28
  22. O’Shaughnessy PJ, Dudley K 1993 Discrete splicing alternatives in mRNA encoding the extracellular domain of the testis FSH receptor in the normal and hypogonadal (hpg) mouse. J Mol Endocrinol 10:363–366[Abstract/Free Full Text]
  23. Babu PS, Krishnamurthy H, Chedrese PJ, Sairam MR 2000 Activation of extracellular-regulated kinase pathways in ovarian granulosa cells by the novel growth factor type 1 follicle-stimulating hormone receptor. Role in hormone signaling and cell proliferation. J Biol Chem 275:27615–27626[Abstract/Free Full Text]
  24. Danilovich N, Suresh Babu P, Xing W, Gerdes M, Krishnamurthy H, Sairam MR 2000 Estrogen deficiency, obesity, and skeletal abnormalities in follicle-stimulating hormone receptor knockout (FORKO) female mice. Endocrinology 141:4295–4308[Abstract/Free Full Text]
  25. Krishnamurthy H, Danilovich N, Morales C, Sairam MR 2000 Qualitative and quantitative decline in spermatogenesis of the follicle stimulating hormone receptor knock-out (FORKO) mouse. Biol Reprod 62:1146–1159[Abstract/Free Full Text]
  26. Dattatreyamurty B, Reichert Jr LE 1993 Functional properties of polyclonal antibodies raised against the N-terminus region (residues 9–30) of the follicle-stimulating hormone (FSH) receptor: significance of this receptor region in FSH recognition and signal transduction. Endocrinology 133:1593–1601[Abstract/Free Full Text]
  27. Parlow AF 1961 Bio-assay of pituitary luteinizing hormone by depletion of ovarian ascorbic acid. In: Albert A (ed) Human Pituitary Gonadotropins. Thomas, Springfield, p 300
  28. Braw RH, Tsafariri A 1980 Effect of PMSG on follicular atresia in the immature rat ovary. J Reprod Fertil 59:267–272[Abstract/Free Full Text]
  29. Richards JS 1994 Hormonal control of gene expression in the ovary. Endocr Rev 15:725–751[Abstract/Free Full Text]
  30. Das S, Maizels ET, DeManno D, St Clair E, Adam SA, Hunzicker-Dunn M 1996 A stimulatory role of cyclic adenosine 3',5'-monophosphate in follicle-stimulating hormone-activated mitogen-activated protein kinase signaling pathway in rat ovarian granulosa cells. Endocrinology 137:967–974[Abstract]
  31. Cameron MR, Foster JS, Bukovsky A, Wimalasena J 1996 Activation of mitogen-activated protein kinases by gonadotropins and cyclic adenosine 5'-monophosphates in porcine granulosa cells. Biol Reprod 55:111–119[Abstract]
  32. Delidow BC, White BA, Peluso JJ 1990 Gonadotropin induction of c-Fos and c-Myc expression and deoxyribonucleic acid synthesis in rat granulosa cells. Endocrinology 126:2302–2306[Abstract/Free Full Text]
  33. Shibata EF, Matsuda JJ, Volk KA, Collison KA, Segaloff DL 1992 Evidence that the FSH receptor itself is not a calcium channel. Endocrinology 131:979–981[Abstract/Free Full Text]
  34. Cook SJ, McCormick F 1993 Inhibition by cAMP of ras-dependent activation of raf. Science 262:1069–1072[Abstract/Free Full Text]
  35. Sprengel R, Braun T, Nikolics K, Segaloff DL, Seeburg PH 1990 The testicular receptor for follicle stimulating hormone: structure and functional expression of cloned cDNA. Mol Endocrinol 4:525–530[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
Z. Blumenfeld and M. von Wolff
GnRH-analogues and oral contraceptives for fertility preservation in women during chemotherapy
Hum. Reprod. Update, November 1, 2008; 14(6): 543 - 552.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
Z. Blumenfeld
How to Preserve Fertility in Young Women Exposed to Chemotherapy? The Role of GnRH Agonist Cotreatment in Addition to Cryopreservation of Embrya, Oocytes, or Ovaries
Oncologist, September 1, 2007; 12(9): 1044 - 1054.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Tomic, K. P. Miller, H. A. Kenny, T. K. Woodruff, P. Hoyer, and J. A. Flaws
Ovarian Follicle Development Requires Smad3
Mol. Endocrinol., September 1, 2004; 18(9): 2224 - 2240.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. Borgeest, K. P. Miller, R. Gupta, C. Greenfeld, K. S. Hruska, P. Hoyer, and J. A. Flaws
Methoxychlor-Induced Atresia in the Mouse Involves Bcl-2 Family Members, but Not Gonadotropins or Estradiol
Biol Reprod, June 1, 2004; 70(6): 1828 - 1835.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
I. Adriaens, R. Cortvrindt, and J. Smitz
Differential FSH exposure in preantral follicle culture has marked effects on folliculogenesis and oocyte developmental competence
Hum. Reprod., February 1, 2004; 19(2): 398 - 408.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. Ulloa-Aguirre, C. Timossi, J. Barrios-de-Tomasi, A. Maldonado, and P. Nayudu
Impact of Carbohydrate Heterogeneity in Function of Follicle-Stimulating Hormone: Studies Derived from in Vitro and in Vivo Models
Biol Reprod, August 1, 2003; 69(2): 379 - 389.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
N. Danilovich, D. Javeshghani, W. Xing, and M. R. Sairam
Endocrine Alterations and Signaling Changes Associated with Declining Ovarian Function and Advanced Biological Aging in Follicle-Stimulating Hormone Receptor Haploinsufficient Mice
Biol Reprod, August 1, 2002; 67(2): 370 - 378.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Wang, S. Chan, and B. K. Tsang
Involvement of Inhibitory Nuclear Factor-{kappa}B (NF{kappa}B)-Independent NF{kappa}B Activation in the Gonadotropic Regulation of X-Linked Inhibitor of Apoptosis Expression during Ovarian Follicular Development in Vitro
Endocrinology, July 1, 2002; 143(7): 2732 - 2740.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Manikkam, Y. Li, B. M. Mitchell, D. E. Mason, and L. C. Freeman
Potassium Channel Antagonists Influence Porcine Granulosa Cell Proliferation, Differentiation, and Apoptosis
Biol Reprod, July 1, 2002; 67(1): 88 - 98.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. S. Richards
Perspective: The Ovarian Follicle--A Perspective in 2001
Endocrinology, June 1, 2001; 142(6): 2184 - 2193.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Babu, P. S.
Right arrow Articles by Sairam, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Babu, P. S.
Right arrow Articles by Sairam, M. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals