| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Molecular Reproduction Research Laboratory, Clinical Research Institute of Montréal, Montréal, Québec, Canada H2W 1R7
Address all correspondence and requests for reprints to: M Ram Sairam, Ph.D., Molecular Reproduction Research Laboratory, Clinical Research Institute of Montreal, 110 Pine Avenue West, Montréal, Québec, Canada H2W 1R7. E-mail: sairamm{at}ircm.qc.ca
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The ability of FSH to modulate ovarian function depends not only on the circulating levels of the hormone, but also on the expression of appropriate receptor proteins by potential target cells in the ovary and their connections with specific signal transduction pathways. FSH acts on granulosa cells of the follicle by binding to its specific receptors (FSH-R). The membrane-localized receptor long known to be Gs coupled (designated FSH-R1) has been cloned from many species and shown to be a transmembrane glycosylated protein (12). Although it is currently believed that the various pleiotropic effects of the hormone on granulosa cells are mediated by this single Gs receptor motif (12), actions via other receptor motifs are also possible. The propensity of the FSH-R gene to undergo extensive alternative splicing is also well known (12, 13). Thus, our own investigations in sheep testis have led to the cloning of at least three other FSH-R forms with different structural motifs (13, 14, 15, 16, 17, 18) that might be of biological significance. One of these proteins, which we have designated FSH-R3, has been demonstrated to be a single transmembrane growth factor type I receptor (16) that is expressed on the cell membrane upon transfection of the complementary DNA (cDNA). The FSH-R3 receptor-bearing cells stimulated DNA synthesis after FSH addition (16), and recently, this receptor, but not the Gs-coupled FSH-R1, was also shown to function by enhancing Ca2+ signaling in transfected cells (18). Extending this work further, we not only cloned the FSH-R3 cDNA from the sheep ovary, but also identified the expression of the corresponding protein predicted by the transcript (19).
The mouse FSH-R gene is known to undergo extensive alternative splicing during gonadal development. Several events, such as the increase in synthesis of inhibin B and cytochrome P450 aromatase by FSH in postnatal ovaries, occur well before the expression of the Gs-coupled FSH-R1 receptor (20) and increase in the rate of follicular growth in the early stages in response to exogenous FSH (21). These suggest that other FSH-R motifs might also be functional to play a role during development. However, little information other than demonstration by PCR of certain exons is available on the presence of the FSH receptor types (22) in this species. An important question in fully elucidating the role of FSH in ovarian function and its relation to follicular dynamics is to determine whether any other FSH receptor motif besides the well established Gs protein-coupled FSH-R1 is also involved in follicular growth. We could not derive any information on the discriminatory roles of potentially different types of FSH-R in the mouse from our homologous recombination study (11), because the knockout strategy that we designed was effective in eliminating all types of FSH-Rs. We recently demonstrated the presence of the growth factor type I FSH-R3 protein in the sheep ovary (19) and provided evidence for coupling of this motif to the activation of extracellular regulated kinase pathways in ovarian granulosa cells (23). This has prompted us to explore the possible existence of this novel receptor motif in the mouse ovary at different stages of development. Thus, the aim of this study was to examine its expression and to investigate its hormonal regulation. By using normal and hormone-manipulated mice we now demonstrate the expression of the novel FSH-R3 transcript as well as the protein. Interestingly, FSH treatment of immature mice causes enhanced expression of the growth factor type I receptor that may be required to sustain rapid cell proliferation. Thus, expression of this growth factor type 1 receptor for FSH in the developing follicle might also account for the hormone’s action during follicular growth and dominance.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RT-PCR
Ovaries were dissected from adult wild-type (+/+), FORKO
(-/-), as well as PMSG-treated immature wild-type mice. As the
ovaries of FORKO mice are very small, a larger number was required to
obtain adequate material. Total RNA was extracted as described
previously using the midi RNA isolation kit (19) following
instructions of the manufacturer (Ambion, Inc., Austin,
TX). Multiplex RT-PCR was used to determine the expression of the two
FSH-R transcripts, designated FSH-R1 and FSH-R3, with ß-actin serving
as a control in each amplification reaction. For amplifying the FSH-R3
transcript we used sheep FSH-R3 (13, 19)-specific primers
SM 156 (TCTCCACTGCTGCACTGTTGGGCT) and SM157 (ATTCAAATACAGGAAATAGAGAAA)
expected to amplify a 382-bp product [corresponding to sequence
670-1051 of clone HK18 (13)]. For mouse FSH-R1
verification, we designed sense AGCAAGTTTGGCTGTTATGAGG and antisense
GTTCTGGACTGAATGATTTAGAGG primers based on the published sequence
(GenBank accession no. AF095642), such that a product of the expected
size of 156 bp would be from the coding 3'-end of that transcript
(bases 1921–2076). For mouse ß-actin the primers were designed to
amplify the sequence 48–561 (GenBank accession no. X03765).
Preliminary trials were performed to optimize a single set of
conditions for multiplex PCR in which the amplifications of the genes
would be in the exponential range. The final conditions for
amplification were 95 C for 4 min followed by 25 cycles of 50 sec each
at 94, 55, and 72 C, respectively. The final extension was for 7 min.
The products were separated on 1.5% agarose gel and stained with
ethidium bromide. For Southern hybridization, the RT-PCR products from
+/+ and -/- ovaries were transferred to nylon membrane using standard
protocols. The amplification of a 382-bp product was further confirmed
by using a 32P-labeled FSH-R3-specific 3'-end
fragment of ovine (o) FSH-R3 (13, 19) by hybridizing
overnight at 65 C and washing at high stringency followed by
autoradiography.
Preparation and characterization of FSH-R3- specific
antibody
A 20-amino acid residue peptide corresponding to the C-terminal
segment of oFSH-R3 (CYGQREHISEFGLKSKQHPN; see Fig. 1
) was synthesized using an automated
peptide synthesizer. This sequence, unique to ovine FSH-R3, showed no
similarity with other glycoprotein hormone receptors (TSH or LH
receptors) or other proteins (GenBank data search). The peptide was
conjugated to human serum albumin (Sigma, St. Louis, MO)
using EDC-HCl (Pierce Chemical Co., Rockford, IL) as a
coupling reagent. A preimmune serum taken from the rabbits served as
control. Antiserum was prepared in rabbits by multipoint injections of
250 µg conjugate in Freund’s compete adjuvant. Blood was collected
on day 8 after the fourth booster and periodically thereafter. Serum
was separated and stored at -20 C.
|
Cell culture and deglycosylation
For purposes of characterization and comparison, an immortal pig
granulosa cell line lacking endogenous FSH receptors was transfected
with the FSH-R3 cDNA cloned in the pcDNA1 neo vector
(Invitrogen, San Diego, CA). Stable cells (designated
JC-R3) were selected after 8 weeks by using 400 µg/ml G418
(Life Technologies, Inc., Mississauga, Canada) in the
culture medium. These procedures have been described recently
(23).
Granulosa cells expressing FSH-R3 (JC-R3 or vector transfected controls) were scraped in cold PBS and collected by centrifugation at 800 x g for 10 min at 4 C. They were lysed in lysis buffer [20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Nonidet P-40, and 1 mM phenylmethylsulfonylfluoride (PMSF)] and left on ice for 30 min for solubilization of membrane proteins. The solubilized receptor was deglycosylated using N-glycosidase F (Roche Molecular Biochemicals, Indianapolis, IN), which cleaves all N-linked glycomoieties of the FSH receptor. Approximately 200 µg membrane protein were suspended in 0.1 M Tris-HCl buffer (pH 7.4) with 0.1 mM PMSF and incubated with 50 U/ml N-glycosidase F.
Western blotting
Protein extracts were prepared from mouse ovary or JC-R3 cells
that were engineered to express FSH-R3 cDNA as describe above. Tissue
or cells collected by scraping in PBS were washed and then homogenized
in lysis buffer [50 mM Tris-HCl (pH 7.4), 150
mM NaCl, 1 mM EDTA, 1% Nonidet P-40, and
protease inhibitors mixture made up of PMSF (100 µM),
aprotinin (20 µg/ml), and leupeptin (20 µg/ml)]. Protein contents
of the high speed supernatant samples were estimated using the
Bio-Rad Laboratories, Inc., assay reagent (Richmond,
CA).
Protein samples (100 µg) from total cell extracts or tissue-solubilized fractions were separated by 10% SDS-PAGE minigel and then transferred on to a polyvinylidene difluoride membrane for Western blotting. After blocking for nonspecific sites, membranes were incubated with R3 peptide IgG antibody (1 µg/ml) in Tris-buffered saline containing 1% (wt/vol) skim milk powder and 0.05% Tween-20 for 1 h at room temperature. The washed blot was then incubated with goat antirabbit IgG conjugated to horseradish peroxidase (Sigma; 1:5000). Antibody binding to the membrane was visualized using Super Signal Ultra (Pierce Chemical Co.) chemiluminescent detection system. In some experiments the blots were stripped and reprobed with specific antibody to glyceraldehyde phosphate dehydrogenase (GAPDH; Sigma, Ontario, Canada) to serve as an internal control and verify equivalent protein loading.
Immunohistochemistry
Paraffin-embedded sections (5 µm) from saline- and
PMSG-treated mouse ovaries were analyzed in parallel after treatment
with CAS block solution for 10 min to clear background staining
(Zymed Laboratories, Inc., South San Francisco, CA). The
FSH-R3 IgG (19) was used at a dilution of 10 µg/ml and
was detected using a Histostain kit according to the manufacturer’s
instructions (Zymed Laboratories, Inc.).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
the diagrams
of the Gs-coupled oFSH-R1 and the growth factor
type I receptor oFSH-R3 to emphasize the major differences in
topography. The corresponding mature receptors cloned in the sheep are
single polypeptide chains of 678 and 242 amino acids, respectively. The
first 206 residues in the two mature receptor forms are identical. The
oFSH-R3 differs from R1 after the eighth exon (arrow in Fig. 1, right) by having a 34-amino acid extension contributed by
a splicing event (13, 19). Hydropathy analysis predicts a
single transmembrane segment in the putative FSH-R3 protein
(16). As shown at the top of Fig. 1 we have
proposed that the single transmembrane structure as well as the short
intracellular domain in FSH-R3 are contributed by a different exonic
segment of the large FSH-R gene (16). Two other receptor
forms cloned in our laboratory (13, 14, 17) are designated
FSH-R2 and FSH-R4 (not shown).
Rabbit antibody was generated against the indicated peptide segment of
oFSH-R3 predicted to be in the cytoplasmic tail (Fig. 1). The
specificity of antiserum was established in several ways, as shown in
Fig. 2. First, in a solid phase test the
antibody recognized only the R3 peptide coated on plastic wells.
Neither preimmune serum nor the R3 antiserum preabsorbed with the
corresponding peptide could bind the immobilized peptide (Fig. 2A). The
antibody also reacted efficiently with the recombinant FSH-R3 protein
produced in Escherichia coli, but not with other sequences
such as the C-terminal peptide of ovine FSH-R1 (Fig. 2B) or the exon
1–4 recombinant protein coded by another alternatively spliced product
FSH-R4 (17). The peptide 9–30 of the extracellular domain
of the rat FSH-R or the C-terminal peptide of oFSH-R2 also showed no
reaction (data not shown). Confirmation of these data was provided in
our recent report (19) showing Western blots that
demonstrated reaction of the R3 peptide IgG with the recombinant
E. coli FSH-R3 protein or the glycosylated protein expressed
in mammalian cells.
|
, top). These primers fail to amplify any
sequence from FSH-R1 cDNA). The amplified mouse R3 fragment
subsequently hybridized with the oFSH-R3 probe, confirming specificity.
The positive reaction persisted under high stringency washing
conditions. Although RNA extracted from the tissue of the adult FORKO
(-/-) mouse did not react (Fig. 3A, lane 1), the adult wild-type (+/+) mouse ovary sample showed a single
band of the expected size (lane 2 in Fig. 3A).
|
) and immunohistochemistry of ovarian tissues (Fig. 4), using a specific antibody directed
against the C-terminal end of oFSH-R3. In a granulosa cell line that
had been engineered to express the oFSH-R3 cDNA (Fig. 3B, lane 2) this
antibody readily recognized a 39-kDa protein. When this protein extract
was treated with the enzyme N-glycosidase F to remove
covalently bound N-linked sugars, the apparent molecular
mass was reduced to approximately 28 kDa (lane 3). In control granulosa
cells transfected with the expression vector alone (lane 1), there was
no reaction with the antibody under identical conditions. In the
extract of ovaries from the FORKO (-/- FSH-R) mouse, there was also
no reaction (lane 4). However, the immunoblot in Fig. 3B (lane 5)
clearly revealed the presence of the same 39-kDa protein in the
wild-type (+/+) mouse ovary. Approximately equal protein loading of the
extracts for each lane is evident by similar intensities seen for the
control GAPDH protein upon reprobing of the stripped blot (Fig. 3B, bottom panel).
|
. Ovarian sections treated with preimmune serum did not
reveal any staining (Fig. 4, A and B) under identical conditions. In
the PMSG-primed ovary, FSH-R3 is induced at early stages of follicular
development, i.e. in small preantral follicles, reaching
higher levels in the granulosa cells in a time-dependent manner. The
intensity of staining at 48 h post-PMSG treatment (Fig. 4, E, F,
and H) was much higher than that observed at 24 h (Fig. 4, C and
D), which also corroborates the Western blot data (see Fig. 6). The
novel FSH receptor (FSH-R3) in the mouse ovary appeared to be localized
exclusively in granulosa cell membranes. Interestingly, the intensity
of staining was higher in granulosa cells in close proximity to the
developing oocyte. Analysis with FSH-R3 IgG applied to the adult mouse
ovary (Fig. 4G) showed specific staining on granulosa cell membranes of
the large mature follicle.
|
, top panel) of receptor gene expression in the ovary reveal
that the expression of both FSH-R3 and FSH-R1 message is clearly
detectable and about equal in saline-treated control immature animals.
PMSG treatment increased the expression of both FSH-R1 and FSH-R3 in
the immature ovary, and interestingly, the relative expression of
FSH-R3 was definitely higher than that of FSH-R1. This result was
highly reproducible. The increase in FSH-R1 expression over that in
saline-treated controls was 2.5- and 3.1-fold compared with 5- and
6.1-fold with FSH-R3 after 24 and 48 h of hormone treatment (Fig. 5, bottom panel). Thus, the relative expression of FSH-R3
message was about twice that of FSH-R1 at both times.
|
. The FSH-R3 protein that was not
detectable in saline-treated immature ovary (lane 1), probably because
of low abundance, was clearly induced 24 h after PMSG
administration (lane 2). This band intensity increased further in
48 h of treatment (lane 3). The middle panel of Fig. 6
reveals that protein loading for the three lanes was equivalent.
Densitometric scanning of the FSH-R3 bands and normalization using
GAPDH indicated that there was a clear increase in R3 receptor protein
(
50% increase) from 24 to 48 h (Fig. 6B). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Until recently it was generally believed that a single signaling entity in the form of the Gs-coupled receptor mediates all the diverse functions of the hormone, as this form was the most extensively investigated. In addition, the poor characterization and lack of specific reagents (probes and antibodies) for each FSH-R transcript impeded consideration of other entities. Investigations involving radioautography or binding studies using labeled hormone or in situ hybridization with probes designed for the extracellular domain or the seven transmembrane regions may lack the discriminatory power to distinguish other FSH receptor entities. If some of these new motifs appear on the cell surface, they may also interact with the hormone. Thus, total hormone binding detected in the stimulated ovary or pooled granulosa cells may represent the aggregate value contributed by the Gs-coupled FSH-R1 as well as other forms. Recently, we demonstrated that a distinct growth factor receptor type I motif FSH-R3 transcript and protein are both present in the sheep ovary and testis (19). We also showed that the receptor is expressed on the cell surface in transfected cells exhibiting the same affinity for the labeled hormone as FSH-R1 (16). Membrane localization of FSH-R3 was also shown using receptor-specific peptide antibody (19), which was also used in the current investigation. A physiological role for this receptor was implicated by the demonstration of its functional coupling to well known actions of FSH (18, 23).
Our finding presented in this report is the first identification of the
presence in the adult mouse ovary of the FSH-R3-like transcript and
protein similar to those in sheep (Fig. 3). The failure of previous
investigations to observe this new transcript(s) is probably due to the
incorrect choice of primers used in the RT-PCR screenings (20, 22). That the transcript was detectable only in the wild-type
ovary but not in the FORKO mouse ovary clearly shows that this receptor
type has also been eliminated in our receptor knockout strategy
(11). Therefore, the infertility observed in these females
may be due to the total loss of the FSH receptor signaling repertoire.
The detection of a 39-kDa protein by Western blotting in the wild-type
adult ovary but not in the FORKO mouse ovary using oFSH-R3-specific IgG
is compelling evidence for efficient expression of the novel receptor
form. Because the molecular mass of the mouse protein (39 kDa) is same
as that of sheep FSH-R3, we further suggest similar structural features
of the first eight exons spliced to a variant DNA sequence to produce
an N-glycosylated receptor (19). This latter
feature would confer a slower migration on SDS-PAGE to show an
apparently higher molecular mass for the protein. Before using the R3
peptide antibody we carefully verified its specificity by testing it
with other FSH receptor peptides or proteins. The fact that it reacted
solely with its own peptide antigen or the recombinant R3 protein
produced in E. coli suggests that the right protein is
detected, a conclusion supported by previous studies
(19).
The variation of the FSH-R3 transcript coincident with PMSG-induced follicular development in the immature mouse ovary suggests that this receptor might also contribute in a significant manner to FSH signal transduction mechanisms. The FSH-R1 transcript showed a similar trend, increasing from 0–48 h. By selecting primers specific for the 3'-region we restricted our examination solely to these two receptor entities for which some signaling information is available. This, however, does not preclude variations in other splice variants that may also exist in this state of induced development. A comparison of the relative intensities of FSH-R3 vs. FSH-R1 indicates several interesting features that may be of significance during ovarian development. Both transcripts that appeared to be expressed at about equal levels in the untreated immature ovary are quickly up-regulated after hormone treatment, suggesting that transcriptional activation mechanisms, including splicing, are initiated very quickly. The consistently higher (2-fold) FSH-R3 expression compared with FSH-R1 at both time points and coinciding with the increase in growth of the follicle suggests an important role for the FSH-R3 protein. Although this novel observation does not diminish the widely accepted role of FSH-R1 in follicular development, it implicates another candidate receptor(s) in the regulatory process. This conclusion is strongly supported by the immunohistochemical data, which also detected the corresponding FSH-R3 protein in the extracts of the PMSG-primed ovaries. Here again, the increase in R3 protein with time of hormonal stimulation showed a close correlation with follicular development. Considering the careful characterization studies we have performed on the FSH-R3 peptide antibody (unpublished data) showing that it does not react with other receptor forms, it is reasonable to conclude that we are selectively detecting the expression of the R3 protein in the ovary. Localization of this receptor to the surface of the granulosa cells in the large follicles of the adult ovary and also in follicles recruited for development in PMSG-primed immature animals supports the argument for its role in hormone action. The single difference in our observation in this regard should be pointed out. Although we did not observe immunochemical staining of the oocyte in the adult ovary, some staining was observed in this structure in sections of the PMSG-primed mouse ovary. As FSH binding to oocytes has not been reported, implying lack of FSH receptor, we have no direct explanation at this time for the apparent discrepancy.
Several controversies concerning FSH action are already known (12). Our recent findings of the signaling potential of FSH-R3 (16, 18, 19, 23) may help to reconcile and rationalize the existence of different receptor motifs in this highly dynamic compartment of the ovary. FSH and LH are known to activate the mitogen-activated protein kinases in granulosa cells derived from normal or hormone-primed animals (29, 30). In addition to other events, differences in the activation of mitogen-activated protein kinases by cAMP and gonadotropins (LH and FSH) suggest that the hormones activate these enzymes via pathways that operate at least in part independently of cAMP (30, 31). Events such as FSH-induced rapid induction of oncogenes (31), DNA synthesis in the early stages of follicular growth (6), and absence of FSH-mediated calcium signaling in FSH-R1-transfected cell lines (18, 32) suggest that other receptor structural motifs may also be involved in hormone action. In many systems it has been established that a significant elevation of intracellular cAMP levels may potently inhibit cell proliferation and division (33). However, FSH-induced cell proliferation in ovarian follicles is a major effect of the hormone that may be incompatible with elevation of cAMP, a second messenger that is clearly elevated by FSH-R1 (34). Therefore, it is reasonable to propose that a counterbalancing signaling pathway that operates independently of cAMP, such as FSH-R3, may be critical at this juncture. A receptor motif such as FSH-R3 that is coupled to rapid calcium mobilization (18) and extracellular regulated kinase 1/2 activation without elevating cAMP (23) may serve to stimulate rapid cell proliferation required for follicular expansion. The rapid effects of FSH on DNA synthesis in follicles would be consistent with these mechanisms (6).
In conclusion, these studies show that a different FSH receptor motif other than the widely accepted Gs-coupled entity is also expressed in the mouse ovary and is up-regulated in the developing ovary under hormonal influence. This is also the first report documenting that gonadotropin treatment induces a different functional FSH receptor during follicular growth, introducing a new experimental paradigm in the control mechanisms of ovarian biology. Further studies will be necessary to delineate stage-specific expression of both FSH-R1 and FSH-R3 proteins during folliculogenesis, a task that requires the design of discriminating reagents specific for the Gs-coupled receptor.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received June 12, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
gene promoter. Mol Endocrinol 9:1356–1366 subunit)
by a recombinant receptor protein domain coded by an alternately
spliced messenger RNA and expressed in E. coli. J Mol
Endocrinol 19:183–190This article has been cited by other articles:
 |
|
 |
|
  Z. Blumenfeld and M. von Wolff GnRH-analogues and oral contraceptives for fertility preservation in women during chemotherapy Hum. Reprod. Update, November 1, 2008; 14(6): 543 - 552. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Blumenfeld How to Preserve Fertility in Young Women Exposed to Chemotherapy? The Role of GnRH Agonist Cotreatment in Addition to Cryopreservation of Embrya, Oocytes, or Ovaries Oncologist, September 1, 2007; 12(9): 1044 - 1054. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Tomic, K. P. Miller, H. A. Kenny, T. K. Woodruff, P. Hoyer, and J. A. Flaws Ovarian Follicle Development Requires Smad3 Mol. Endocrinol., September 1, 2004; 18(9): 2224 - 2240. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Borgeest, K. P. Miller, R. Gupta, C. Greenfeld, K. S. Hruska, P. Hoyer, and J. A. Flaws Methoxychlor-Induced Atresia in the Mouse Involves Bcl-2 Family Members, but Not Gonadotropins or Estradiol Biol Reprod, June 1, 2004; 70(6): 1828 - 1835. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Adriaens, R. Cortvrindt, and J. Smitz Differential FSH exposure in preantral follicle culture has marked effects on folliculogenesis and oocyte developmental competence Hum. Reprod., February 1, 2004; 19(2): 398 - 408. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ulloa-Aguirre, C. Timossi, J. Barrios-de-Tomasi, A. Maldonado, and P. Nayudu Impact of Carbohydrate Heterogeneity in Function of Follicle-Stimulating Hormone: Studies Derived from in Vitro and in Vivo Models Biol Reprod, August 1, 2003; 69(2): 379 - 389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Danilovich, D. Javeshghani, W. Xing, and M. R. Sairam Endocrine Alterations and Signaling Changes Associated with Declining Ovarian Function and Advanced Biological Aging in Follicle-Stimulating Hormone Receptor Haploinsufficient Mice Biol Reprod, August 1, 2002; 67(2): 370 - 378. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wang, S. Chan, and B. K. Tsang Involvement of Inhibitory Nuclear Factor-{kappa}B (NF{kappa}B)-Independent NF{kappa}B Activation in the Gonadotropic Regulation of X-Linked Inhibitor of Apoptosis Expression during Ovarian Follicular Development in Vitro Endocrinology, July 1, 2002; 143(7): 2732 - 2740. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Manikkam, Y. Li, B. M. Mitchell, D. E. Mason, and L. C. Freeman Potassium Channel Antagonists Influence Porcine Granulosa Cell Proliferation, Differentiation, and Apoptosis Biol Reprod, July 1, 2002; 67(1): 88 - 98. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Richards Perspective: The Ovarian Follicle--A Perspective in 2001 Endocrinology, June 1, 2001; 142(6): 2184 - 2193. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
