| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Departments of Obstetrics and Gynecology and Biochemistry and Molecular Biology, University of South Florida, College of Medicine, Tampa, Florida 33606
Address all correspondence and requests for reprints to: Dr. Mark P. McLean, Departments of Obstetrics and Gynecology, 4 Columbia Drive, Room 529, Tampa, Florida 33606. E-mail: mmclean{at}com1.med.usf.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cholesterol homeostasis in rat luteal cells is regulated through an intricate feedback mechanism that can detect the amount and availability of cellular cholesterol (17). Decreased cholesterol availability results in the specific proteolysis of the precursor form of the sterol regulatory element (SRE) binding protein (SREBP) from the endoplasmic reticulum and the subsequent translocation of the smaller mature NH2-terminal segment to the nucleus, where it can bind to SREs and eventually cause activation of the genes involved with cholesterol uptake and biosynthesis (18, 19). Results of earlier studies in our laboratory (20) found that the rat HDL-R promoter contains two SREs through which SREBP-1a is able to activate transcription. SREBP proteins are inefficient activators by themselves and require additional coregulatory factors for maximum transcription. For the human fatty acid synthase promoter and the low-density lipoprotein receptor (LDL-R), simian-virus-40-protein-1 (Sp1) has been found to be the coactivator for SREBP-1a (21, 22). Nuclear factor Y and SREBP-1a have been shown to cause synergistic activation of the rat farnesyl diphosphate synthase gene (23).
The multifaceted Yin Yang-1 zinc finger transcription factor (YY1) has been shown to be capable of both positive and negative regulation of transcription (24, 25, 26, 27, 28, 29). In a recent study, YY1 was shown to bind to the 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase, farnesyl diphosphate synthase, and LDL-R promoters and result in the displacement of nuclear factor Y (30). In an additional study using the LDL-R promoter, YY1 was able to repress the LDL-R promoter by disruption of SREBP-1a- and Sp1-positive stimulation (31).
In the current studies, we proposed to determine whether YY1 could inhibit transcription of the rat HDL-R promoter and to investigate whether this repression was the result of cis-acting factors, protein-protein interactions, or a combination of both mechanisms. For these experiments, electrophoretic mobility shift assays (EMSAs), the Mammalian Two-hybrid system, and luciferase reporter constructs were used to investigate activation of the rat HDL-R promoter. These studies investigate the importance of the Sp1/SREBP-1a interactions in HDL-R gene regulation and demonstrate the ability of YY1 to disrupt SREBP-1a binding in the presence or absence of Sp1, with subsequent attenuation of HDL-R promoter activity.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
32P]-adenosine
5'-triphosphate (6000 Ci/mmol) was obtained from DuPont/NEN Life Science Products (Wilmington, DE). DMEM:nutrient mixture F-12
(DMEM/F12) was obtained from Life Technologies, Inc./BRL
(Grand Island, NY). FBS was purchased from Summit Biotechnology (Ft. Collins, CO).
Polydeoxyinosinic-deoxycytidylic acid was obtained from
Pharmacia Biotech (Piscataway, NJ). BioMax-MR films were
obtained from Fisher Scientific (Norcross, GA). The rabbit
polyclonal anti-SREBP-1 and the horseradish peroxidase-conjugated goat
antirabbit antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The YY1 Nushift Plus Kit
containing K562 cell nuclear extract, YY1 specific oligonucleotides,
and specific YY1 supershift antibody was obtained from Geneka
Biotechnology Inc. (Montréal, Québec, Canada). The
SuperSignal ULTRA Chemiluminescent Substrate was obtained from
Pierce Chemical Co. (Rockford, IL). Nitrocellulose
membrane was obtained from Schleicher & Schuell, Inc.
(Keene, NH). All other chemicals were purchased from Fisher Scientific or Sigma (St. Louis, MO).
GST-fusion protein production
Glutathione S-transferase-YY1 or -Sp1 fusion proteins or
histidine-tagged SREBP-1a proteins were over expressed in
Escherichia coli by induction of midlogarithmic-phase
cultures with 1 mM
isopropyl-ß-D-thiogalactopyranoside. After
incubating for 6 h at 27 C, cells were sedimented by centrifuging
at 7,700 x g for 10 min at 4 C. For GST-protein
purification, the cell pellet was resuspended in PBS and sonicated
using a Sonic Dimembrator 60 (Fisher Scientific) with a
1/4-inch tip, at full strength, in 10-sec bursts, until cells
were lysed. Triton X-100 was then added to a final concentration of
1%, and the sample was incubated for 30 min at 4 C. The suspension was
centrifuged at 12,000 x g for 10 min at 4 C. Affinity
purification of the fusion protein was performed using the GST-fusion
Purification Kit (Pharmacia Biotech) as per the
manufacturer’s recommendations. Briefly, cleared lysate was passed
through the glutathione Sepharose 4B column. After washing with PBS,
the fusion protein was digested with thrombin (YY1) or precision (Sp1)
protease to remove the GST moiety and was used in gel mobility shift
assays. For histidine-tagged SREBP-1a protein purification, the cell
pellet, after the initial centrifugation, was resuspended in guanidium
lysis buffer provided in the XPRESS System (Invitrogen)
and eventually eluted off an immobilized metal affinity column
according to the manufacturer’s recommendations. Recombinant protein
samples were concentrated approximately 4- to 6-fold using Centricon-10
concentrators (Millipore Corp., Bedford MA). Protein
concentrations were determined using the Bio-Rad Laboratories, Inc. protein assay (Bio-Rad Laboratories, Inc.,
Hercules, CA).
Mammalian two-hybrid assay
The pBIND and pACT plasmids used in these assays were provided
by the Mammalian Two-Hybrid System (Promega Corp.).
The plasmid pSREBP-1a-pACT was constructed using full-length human
SREBP-1a complementary DNA inserted into the EcoRI and
KpnI sites. To construct the YY1-pBIND plasmid, the
full-length mouse YY1 complementary DNA was inserted into the
XbaI and ScaI/EcoRV sites. To examine
luciferase activities, HTB9 cells were cotransfected with the
pG5-luciferase vector, either in the presence or absence of
pSREBP-1a-BIND or pYY1-ACT. For these experiments, transfections were
performed on 3 x 106 HTB9 cells/well with 2
µg of each plasmid using the Fugene 6 transfection method according
to the manufacturer’s instructions. After transfection, cells were
incubated for 48 h at 37 C before harvesting. Transfection
efficiencies were corrected using renilla activity expressed by the
pBIND plasmid.
Plasmids for luciferase assays
All HDL-R promoter-luciferase gene constructs were derivatives
of the pGL3-basic luciferase vector and used for transfections
involving mammalian cells or insect cells. Standard molecular biology
techniques were used for preparation of nested deletions, PCR and
cloning procedures to generate the entire HDL-R promoter or subsequent
deletion constructs were described in detail elsewhere
(20).
Cell transfections
For mammalian cell transfections, HTB9 cells were transfected
with the specified HDL receptor promoter-luciferase reporter gene
construct, either in the presence or absence of SREBP-1a-pCMV5 or
YY1-pCMV5, using Fugene 6 according to the manufacturer’s
specifications. Cells were first plated out in 6-well (3 x
106 cells per well) or 12-well (7.5 x
104 cells per well) tissue culture plates and
incubated for 24 h at 37 C (5% CO2). Fresh
DMEM/F12 medium + 10% FBS was added 2 h before transfections.
Forty-eight hours after transfection, the cells were washed twice with
PBS, treated with Passive Lysis Buffer for 20 min, and then scraped
with a rubber policeman. Lysates were transferred to a microcentrifuge
tube and stored at -80 C until determination of luciferase activity
was performed. Cotransfection of a plasmid, containing the renilla
luciferase gene under control of the SV40 early enhancer/promoter
region, was used as a control to correct for differences in
transfection efficiencies. For Drosophila transfections, Drosophila SL2
cells were transfected with the specified HDL receptor
promoter-luciferase reporter gene construct, either in the presence or
absence of SREBP-1a-pPac, Sp1-pPac, or YY1-pPac, using Fugene 6
according to the manufacturer’s specifications. Cells were plated out
at a density of 3 x 106 cells per 6-well
plate and incubated for 24 h at 37 C (5%
CO2) before transfection. The cells were
transfected using Fugene 6; and after 48 h, the cells were
pelleted by centrifugation and treated with Passive Lysis Buffer and
processed as listed above.
Luciferase assays
Luciferase assays were performed using the Dual Luciferase
Reporter Assay System according to the manufacturer’s instructions
(Promega Corp.). Briefly, 100 µl luciferase substrate
was added to 20 µl lysate, and luciferase activity was measured using
a 20/20 luminometer (Turner Designs, Sunnyvale, CA).
Gel mobility shift assay
Complementary oligonucleotides corresponding to the HDL receptor
promoter regions from -1966 to -1940 [distal SRE (dSRE):
5'-CTGCCCCCCTCACACCCTCCTCTGTAG-3'] and from -246 to -220 [plasmid
SRE (pSRE): 5'-CCATCAGAGCACCGCCCACTCCCCGCC-3'], or -1335 to -1312
(distal YY1 BS1 binding site: 5'CTGCTGAGCCATCTCTCCAGCCCT-3') and -1217
to -1194 (proximal YY1 BS2: 5'- ACTCTGGGTCATGTTGCTGAAGGT) were
synthesized and annealed in 10 mM Tris-HCl (pH 7.5), 1
mM EDTA, 25 mM NaCl, 10 mM
MgCl2, and 1 mM dithiothreitol. A
control oligo containing a consensus YY1 binding site
(5'-GGGGATCAGGGTCTCCATTTTGAAGCGGGATCTCCC-3') was provided with the
Nushift Kit. The oligonucleotide probe was then labeled using
polynucleotide kinase and [32P]-adenosine
5'-triphosphate (6000 Ci/mmol). To determine binding specificity, the
appropriate unlabeled double-stranded oligonucleotides were used as
competitors. Five micrograms of nuclear proteins (or 500 ng each of
recombinant protein unless otherwise indicated) were incubated, either
in the presence or absence of competitor, for 30 min at room
temperature in binding buffer [12 mM HEPES (pH 7.9), 12%
glycerol, 60 mM KCl, 1 mM EDTA, 1
mM dithiothreitol, and 4 mM Tris-HCl (pH
8.0)], 2 µg polydeoxyinosinic-deoxycytidylic acid, and 1 µg BSA.
After incubation, 50,000–100,000 cpm of the radiolabeled probe was
added, and the mixture was incubated for 20 min at 15 C. To demonstrate
a supershift, antibody was added after incubation with the labeled
probe, and the incubation was continued for 15 min at room temperature.
The DNA-protein complexes were resolved on a 4% nondenaturing
acrylamide gel at 4 C in 1x Tris-borate buffer (TBE, 0.05
M Tris, 0.05 M boric acid, and 0.001
M EDTA). Gels were then vacuum-dried and exposed to
Bio-Max-MR films at -80 C for 12–24 h or developed using a
Cyclone Storage Phosphor System (Packard Instrument Co., Meriden,
CT).
Western blot analysis
After electrophoresis, under EMSA conditions, one unlabeled EMSA
gel was electroblotted onto nitrocellulose membranes (0.2-µm pore) in
buffer containing 0.25 M Tris hydrochloride (Tris-HCl) (pH
8.3) and 1.92 M glycine and 20% methanol at 4 C overnight
using 200 mA. Western blot analysis of YY1 protein was carried out with
a 1:1000 dilution of the rabbit polyclonal antiserum to YY1
(Santa Cruz Biotechnology, Inc.) in 3% milk.
Immunoreactive proteins were then visualized using a 1:6000 dilution of
horseradish peroxidase-conjugated goat antirabbit antisera (Santa Cruz Biotechnology, Inc.) in 3% milk and the SuperSignal ULTRA
Chemiluminescent Substrate method.
Data analysis
Luciferase data were expressed as the mean ±
SEM. Each luciferase assay experiment was performed in
triplicate. Statistical significance was determined using the
two-tailed ANOVA method followed by the Student-Newman Keuls
multiple-comparison test when applicable (32).
P < 0.05 was considered significant for all tests.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) or the distal YY1
binding site (BS1) found in the HDL-R promoter (Fig. 1B), EMSA was
performed to ascertain whether YY1 protein could bind specifically to
these sites. Nuclear extracts from K562 cells, a cell line expressing
high levels of YY1 protein, were incubated with
[32P]-labeled oligonucleotides. The EMSA
results demonstrate that YY1 bound specifically to both the control YY1
binding site and to the distal YY1 BS1 found in the HDL-R promoter. The
specificity of the binding reaction was measured by incubation of the
YY1 protein/DNA complex with YY1 antibody and resulted in the
disappearance of the major protein/DNA complex, with the subsequent
appearance of a supershifted band (lanes 4 and 8). Additional EMSA
studies were performed with the proximal YY1 BS2 run on the same gel
with similar results, although it was apparent that the distal YY1 BS1
bound YY1 protein with higher affinity than the proximal YY1 BS2 (data
not shown).
|
) or presence (Fig. 2B) of the
SREBP-1a-pCMV5 expression vector. The basal luciferase activity under
the control of the HDL-R promoter decreased significantly when YY1
concentrations of 300 ng or greater were used (Fig. 2A). In the
presence of an equimolar ratio (500 ng each) of HDL-R promoter to
SREBP-1a (Fig. 2B), the luciferase activity of the HDL-R promoter was
stimulated 8-fold. Cotransfections of increasing amounts of YY1-pCMV
had no significant inhibitory effects until concentrations of 150 ng or
greater were used.
|
, removal of both YY1 binding sites
along with the dSRE (p-719) caused a reduction in basal luciferase
activity (empty bars), when compared with basal activity in
the full-length p2267 construct (52%), but did not have a noticeable
effect on SREBP-1a-induced luciferase activity (hatched
bars). SREBP-1a was still able to significantly stimulate HDL-R
promoter luciferase activity in the absence of any known SRE, Sp1, or
YY1 binding site (p-170, hatched bars, 6-fold), which could
be attributable to binding of positive regulatory transcription factors
like SREBP-1a to a single remaining E-box in this construct, as
suggested by previous studies (20, 33). YY1 was still able
to repress this SREBP-1a-induced activity in the p170 construct by
44%, suggesting that YY1 protein is able to function in the absence of
any known YY1 binding sites.
|
, B and C). When both YY1 binding sites are present
(Fig. 3B), YY1 represses both basal and SREBP-1a-induced HDL-R promoter
luciferase activity by 30% and 80%, respectively. In the absence of
YY1 binding sites (Fig. 3C), YY1 was unable to reduce basal promoter
activity but was still capable of significantly inhibiting
SREBP-1a-induced activation by 68%. This data suggested that the
presence of YY1 binding sites did have a role in YY1-induced repression
under basal conditions. However, these YY1 binding sites are not
required for YY1-induced repression in the presence of exogenously
added SREBP-1a, suggesting that, under these conditions, an additional
repressive regulatory mechanism must be active.
Further EMSA studies were performed to characterize YY1 protein
interaction with the SREBP-1a protein/DNA complex using the HDL-R dSRE
(Fig. 4). Increasing concentrations of
rYY1 were able to inhibit SREBP-1a/DNA complex formation in a
dose-dependent manner. This was not attributable to a general
inhibition of complex formation caused by the addition of small
(nanogram) quantities of rYY1, because BSA was present in microgram
amounts in each binding reaction as a nonspecific-blocking agent. In
addition, there was no inhibition of SREBP-1a/DNA complex formation
when increasing concentrations of recombinant Sp1 (rSp1) were
added. The rYY1 inhibition of SREBP-1a binding to the dSRE was more
efficient if rYY1 was incubated with rSREBP-1a protein before addition
of the SRE. The YY1-induced inhibition was attenuated if rYY1 was added
after SREBP-1a was bound to the SRE (data not shown). The binding
pattern of rYY1 alone to the pSRE and dSRE of the HDL-R promoter was
examined in a separate EMSA, and rYY1 was shown to have very low
affinity for the SREs (data not shown).
|
). The 6-fold induction of luciferase
activity (P < 0.001) in the presence of pBIND/SREBP-1a
and pACT/YY1 confirmed that these proteins interact with high affinity,
because maximal luciferase activity of the VP-16 and Gal4 proteins used
in the Two-hybrid system necessitate a direct protein-protein
interaction to force the promoters into close contact. These data
confirm earlier studies that demonstrate an interaction between YY1 and
SREBP-1a protein using GST-pulldown columns (31). In these
studies, binding of YY1 to SREBP-1a was shown to prevent subsequent
interactions between SREBP-1a and Sp1.
|
). Duplicate EMSA gels were
run as follows: samples for the gel on the right were
incubated with the normal amount of
[-32P]-labeled dSRE, whereas samples for the
gel on the left were incubated with a similar amount of
unlabeled dSRE. Standard autoradiography was performed using the gel
on the right, whereas the left gel was
transferred to nitrocellulose membrane and treated as a Western blot
and probed with YY1 antibody. Note that YY1 protein was found as part
of the major SREBP-1a/dSRE complex (Fig 6, lanes 6 and 12), as well as
part of a large aggregate of YY1/SREBP1a proteins, which tie up
SREBP-1a proteins and prevent the formation of the SREBP-1a/dSRE
complex (Fig. 6, lanes 4–6 vs. lanes 10–12). The addition
of similar amounts of rYY1 or rSREBP-1a alone did not cause this
aggregation near the sample wells (data not shown).
|
). Drosophila SL2 cells
were chosen because they lack endogenous SREBP-1a and Sp1 but possess
all the cofactors necessary to respond to exogenously expressed
transcription factors. There was a significant decrease in HDL-R
promoter activity after addition of YY1, when compared with luciferase
activity in the presence of the HDL-R promoter, Sp1, and SREBP-1a.
|
). As shown in Fig. 8, lane 1, rSp1 did
not bind directly to the dSRE or significantly affect SREBP-1a/dSRE
complex formation (lane 2 vs. lane 3). However, Sp1 proteins
are present in the major SREBP-1a/dSRE complex in small amounts, as
evidenced by the slight decrease in complex formation after addition of
Sp1 antibody (Fig. 8, lane 5), but do not prevent supershift of the
complex by SREBP antibody (lane 6). The presence of equimolar amounts
of rYY1, however, prevents complex formation (Fig. 8, lane 4); and
addition of SREBP antibody, after rYY1 and rSREBP-1a are allowed to
interact with the dSRE, resulted in the formation of two distinct
complexes (SY complexes) midway between the major SREBP-1a/dSRE complex
and the normal SREBP antibody-supershifted complex (Fig 8, lane 7).
Similar results were seen with the proximal SRE under the same
conditions (data not shown). The formation of uniquely sized (SY)
complexes suggested SREBP-1a/YY1 heterodimer formation or that YY1 was
preventing SREBP-1a protein from binding to the SRE as a multimer,
because previous EMSA data failed to demonstrate any appreciable
binding to the pSRE or dSRE by rYY1 alone (data not shown). Finally,
EMSA was performed to examine the ability of rYY1 to disrupt any
positive interactions between rSp1 and rSREBP-1a on SREBP-1a/dSRE
complex formation (Fig. 9). rSp1 alone
did not bind to the dSRE (Fig. 9, lane 7); however, it did slightly
increase the amount of the major SREBP-1a/dSRE complex (lanes 8–10)
and, in addition, overexposure of the autoradiogram resulted in the
appearance of a higher-molecular-weight complex in the presence of
SREBP-1a and Sp1. Addition of rYY1 (Fig. 9, lane 11) in the presence of
rSREBP-1a and rSp1 resulted in a dramatic loss of the major complex and
the complete disappearance of the higher-molecular-weight complex. This
is not a nonspecific inhibition of binding caused by protein
overloading, because lanes 10 and 11 in Fig. 9 both have the same
amount of recombinant protein/well (1500 ng total). rYY1 and rSp1 in
the absence of rSREBP-1a do not bind to the dSRE (Fig 9, lane 12).
Similar results were found with the HDL-R pSRE (data not shown).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
injection, in parallel with a significant decrease in serum
progesterone levels. The use of cholesterol for steroidogenesis is
inhibited in the ovary after treatment with PGF2, which results in
an elevation in intracellular cholesterol, along with an elevation in
YY1 protein (data not shown) that could contribute to the subsequent
decline in HDL-R expression. SREBPs lack the capacity to elicit maximum gene activation on their own and, instead, require the presence of one or more coactivators. In the case of the LDL-R and fatty acid synthase promoter, the coactivator was Sp1 (22). Earlier studies by this laboratory have shown that the two Sp1 sites surrounding the pSRE have the highest affinity for Sp1 (data not shown). In the present study, we found that, although rSp1 protein did not bind directly to either SRE in the HDL-R promoter, rSp1 was present in the major SREBP/DNA complex, as evidenced by the ability of Sp1 antibody to cause a small (but definite) supershift in a portion of the major complex. This study provides additional information on the complexity of Sp1/SREBP synergism. Sp1 enhances SREBP-1a-induced activation in at least two distinct ways; first, by SREBP-enhancement of Sp1 binding to its Sp1 binding site, proposed by Bennett et al. (31); and second, Sp1 acts as a stabilizing component of the SREBP-1a/SRE complex (current study). This enhancement of transcription factor binding subsequently leads to synergistic activation of the promoter.
Maintenance of cholesterol homeostasis requires the presence of negative regulatory factors in addition to coactivators to provide a means of turning off gene expression when sufficient amounts of cholesterol are available for steroidogenesis. One candidate for negative regulation of HDL-R promoter activity is the transcription factor YY1, which was previously shown to cause repression of three SREBP-regulated genes (30). In the current study, YY1 was shown to bind specifically to YY1 binding sites in the HDL-R promoter. When both sites were available for binding, YY1 was able to repress basal and SREBP-1a-induced increases in HDL-R promoter activity. Deletion of these YY1 binding sites attenuated repression under basal conditions but still resulted in a decrease in SREBP-1a-induced activation, suggesting that repression was not dependent on YY1 DNA binding. The same pattern of repression was evident after mutational analysis of the YY1 binding sites in the HDL-R promoter (our unpublished observations). This data suggested that YY1 was capable of using multiple cofactor-specific mechanisms to exert a negative regulatory effect on the HDL-R promoter. Two-hybrid and EMSA data confirm that YY1 and SREBP-1a proteins interact. Under EMSA conditions, SREBP-1a complexed with YY1 could not efficiently bind to its SRE, suggesting that disruption of SREBP-1a binding by YY1 is one possible mechanism to down-regulate HDL-R. Sp1 was able to complex with SREBP-1a as well, but this complex did not reduce DNA binding and enhanced HDL-R transcription, demonstrating that negative regulation only occurred in the presence of the proper cofactor. Therefore, the interaction of cofactors with SREBP-1a provides an additional level of control to regulate SREBP-1a-sensitive genes. YY1 was still able to reduce SREBP-1a/SRE binding if SREBP-1a was allowed to bind to the DNA first and then YY1 protein was added, although the decrease in complex formation was much less than if the two proteins were allowed to interact directly before the addition of DNA (data not shown). RNA polymerase II is known to bind to the promoter adjacent to specific transcription factor binding sites (38), and this binding is dependent on the recognition of the protein bound at that site, not on any specific DNA sequence. It is possible that YY1 interaction with SREBP-1a protein bound to the SRE occludes the recognition domain on SREBP-1a for RNA polymerase II (or an additional member of the transcriptional apparatus), leading to the subsequent inhibition of transcription. YY1 seems to be a dominant regulator of SREBP-1a function, because it was able to disrupt SREBP-1a binding and reduce SREBP-1a-induced HDL-R transcription in the presence of the coactivator Sp-1. Unexpectedly, YY1 repression of the HDL-R promoter, in the absence of SREBP-1a (basal levels), involved a different regulatory mechanism. In this case, YY1-mediated repression was found to be dependent on YY1 binding to specific sites on the HDL-R promoter, perhaps because YY1 protein recruits a potential corepressor to the site. Recently, YY1 was shown to interact with a histone deacetylase (39). Deacetylation of DNA leaves the chromatin in a more tightly wound configuration and thus discourages protein factor binding and transcription, which could explain the decrease in basal HDL-R promoter activity after transfection with YY1. However, HTB9 cells do contain endogenous Sp1, and YY1 seems to inhibit Sp1 activity somewhat; therefore, it is possible that the decrease in HDL-R promoter activity was mediated by interference with Sp1-induced activation. Whether these binding patterns are true in vivo still needs to be determined. To do this, it will be necessary to address the question of HDL-R promoter transcription factor binding site availability using in vivo footprinting. It will be interesting to compare interactions between SREBP-1a and YY1 with the HDL-R promoter and the HMG-CoA reductase promoter, because both are SREBP-1a/sterol-responsive genes; and yet, YY1 did not inhibit the HMG-CoA reductase promoter reporter gene (30).
These data are the first to report on the negative transcriptional regulation of the rat HDL-R promoter by YY1 and to demonstrate that YY1 uses multiple mechanisms to elicit repression of HDL-R promoter activity. Under basal conditions, YY1 binding to the promoter is necessary for YY1-induced repression. YY1 repression of SREBP-1a-mediated activation does not require YY1 binding to the promoter but, instead, uses an indirect mechanism involving interaction of YY1 and SREBP-1a, which leads to the eventual disruption of SREBP-1a/SRE binding.
|
Footnotes |
|---|
Received July 14, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  Q. Liu, K. A. Merkler, X. Zhang, and M. P. McLean Prostaglandin F2{alpha} Suppresses Rat Steroidogenic Acute Regulatory Protein Expression via Induction of Yin Yang 1 Protein and Recruitment of Histone Deacetylase 1 Protein Endocrinology, November 1, 2007; 148(11): 5209 - 5219. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Stocco, C. Telleria, and G. Gibori The Molecular Control of Corpus Luteum Formation, Function, and Regression Endocr. Rev., February 1, 2007; 28(1): 117 - 149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. A. LaVoie, D. Singh, and Y. Y. Hui Concerted Regulation of the Porcine Steroidogenic Acute Regulatory Protein Gene Promoter Activity by Follicle-Stimulating Hormone and Insulin-Like Growth Factor I in Granulosa Cells Involves GATA-4 and CCAAT/Enhancer Binding Protein {beta} Endocrinology, July 1, 2004; 145(7): 3122 - 3134. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. L. Ettinger, R. Sobel, T. G. Whitmore, M. Akbari, D. R. Bradley, M. E. Gleave, and C. C. Nelson Dysregulation of Sterol Response Element-Binding Proteins and Downstream Effectors in Prostate Cancer during Progression to Androgen Independence Cancer Res., March 15, 2004; 64(6): 2212 - 2221. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Nackley, W. Shea-Eaton, D. Lopez, and M. P. McLean Repression of the Steroidogenic Acute Regulatory Gene by the Multifunctional Transcription Factor Yin Yang 1 Endocrinology, March 1, 2002; 143(3): 1085 - 1096. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Lopez, W. Shea-Eaton, M. D. Sanchez, and M. P. McLean DAX-1 Represses the High-Density Lipoprotein Receptor Through Interaction with Positive Regulators Sterol Regulatory Element-Binding Protein-1a and Steroidogenic Factor-1 Endocrinology, December 1, 2001; 142(12): 5097 - 5106. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. K. Shea-Eaton, M. J. Trinidad, D. Lopez, A. Nackley, and M. P. McLean Sterol Regulatory Element Binding Protein-1a Regulation of the Steroidogenic Acute Regulatory Protein Gene Endocrinology, April 1, 2001; 142(4): 1525 - 1533. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
