| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Departments of Pediatrics (Q.L., K.G.H., F.S.F., S.H.H.) and Cell and Developmental Biology (P.S., G.G., R.T.R., M.G.O., P.P.) and Laboratories for Reproductive Biology (Q.L., K.G.H., P.S., G.G., R.S., R.T.R., M.G.O., P.P., F.S.F., S.H.H.), University of North Carolina School of Medicine, Chapel Hill, North Carolina 27599; State Key Laboratory of Molecular Biology (Q.L.,Y.-L.Z.), Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Science, Sinica Academia, Shanghai 200031, China; and Department of Biochemistry (A.J.R.), Indian Institute of Science, Bangalore, India 560012
Address all correspondence and requests for reprints to: Susan H. Hall, Laboratories for Reproductive Biology, CB 7500, University of North Carolina, Chapel Hill, North Carolina 27599. E-mail: shh{at}med.unc.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human epididymal studies are constrained by the impracticality of experimentation and by the advanced age of available tissue donors. To overcome these difficulties and to identify and investigate unknown epididymal proteins closely related to human proteins and involved in sperm function, we constructed and analyzed a rhesus monkey epididymis-specific cDNA library. The library contains 36 nonoverlapping epididymis-specific clones. Sequencing revealed encoded proteins homologous to various enzymes, protease inhibitors, and ligand-binding proteins, but more than half showed no relationship to any known proteins. The most abundant of these novel clones, epididymis-specific clone 42 (ESC42), was characterized by sequence and expression analyses. The protein contains a cysteine-rich region similar to the signature motif of the trefoil family of motogenic proteins involved in wound healing.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Preparation of subtracted rhesus monkey epididymis cDNA
library
The subtracted cDNA library was prepared using the PCR-Select
cDNA Subtraction kit (CLONTECH Laboratories, Inc., Palo
Alto, CA) according to the manufacturer’s recommendations. Double
stranded cDNAs were synthesized from poly(A)+
mRNA from rhesus monkey epididymis (tester), rhesus monkey testis
(driver), and human skeletal muscle (control) using avian
myeloblastosis virus reverse transcriptase for the first strand
and T4 DNA polymerase for the second strand. RsaI-digested
epididymal cDNA (tester) was divided into two portions. Each portion
was ligated to a different adaptor, denatured, and hybridized to excess
testis cDNA (driver). The remaining population of single stranded cDNAs
was enriched for epididymis-specific expression with equalized
representation of abundant and rare sequences. The two portions of
epididymal cDNA were hybridized to each other. Duplexes containing both
adapters were amplified by PCR and cloned into pGEM-T Easy vector
(Promega Corp., Madison, WI). Blue/white screening in XL-1
Blue cells revealed that the library contains 667 insert-containing
clones.
The insert of each of the 667 clones was amplified by PCR using 1 µl
of each bacterial culture as a template. PCR products (3 µl each)
were arranged in arrays on Zeta-probe membranes (Bio-Rad Laboratories, Inc., Hercules, CA) using a Bio-Dot SF blotting
apparatus (Bio-Rad Laboratories, Inc.) according to the
manufacturer’s protocol. On each blot, 3 µl of glycerol 3-phosphate
dehydrogenase PCR product was loaded into one slot as a control. The
cDNA probes were prepared using rhesus monkey epididymis, testis,
brain, and liver poly(A)+ RNA,
[
-32P]dCTP, and SuperScript II reverse
transcriptase (Life Technologies, Inc., Rockville, MD).
The 511 clones that tested positive for epididymis expression and
negative for testis were hybridized to monkey epididymis, liver, and
brain cDNAs for a second cycle of screening. Clones hybridizing to
testis, brain, or liver cDNAs were eliminated, leaving a total of 424
clones.
Sequencing
To minimize repeated sequencing of identical clones, a
hybridization sequencing strategy was used. Initially, 10 clones with
different insert lengths were sequenced. Slot blots containing the 424
epididymis-specific clones were hybridized with a combined probe
containing these 10 clones. Clones that hybridized to the combined
probe were thus duplicates and were eliminated from further sequencing.
From among those clones that failed to hybridize to the original 10, a
second set of 10 clones with different insert lengths was sequenced and
hybridized to the remaining unknown clones. This screening procedure
was repeated until all of the different clones were sequenced.
Miniprep DNA was prepared by standard alkaline lysis of 5-ml overnight culture of each clone. Plasmid was further purified with ribonuclease A digestion and precipitation with PEG 8000. Plasmid DNA was subjected to sequencing at the University of North Carolina, Chapel Hill, Automated DNA Sequencing Facility using an ABI PRISM model 377 DNA sequencer (PE Applied Biosystems, Foster City, CA) and the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq Æ DNA Polymerase FS. Primers were synthesized on an automated PE Applied Biosystems DNA synthesizer (model 394) using standard cyanoethyl phosphoranidite chemistry.
Construction of rhesus monkey nonsubtracted epididymis cDNA
library
The library was prepared using the ZAP cDNA synthesis kit and
the ZAP cDNA Gigapack II packaging kit (Stratagene, La
Jolla, CA) according to the manufacturer’s recommendations. cDNAs
greater than 500 bp in length were inserted into UniZap XR and
transformed into XL1-Blue MRF'. The primary library contained 2.0
x 106 plaque-forming units (pfu) with an average
insert size of 1.6 kb. The library was amplified once by standard
methods to a titer of 3.5 x 109
pfu/µl.
Screening of rhesus monkey epididymis cDNA library for full length
clones
Duplicate 0.45-µm NitroPure (Osmonics, Inc., Minnetonka, MN)
nitrocellulose transfer membranes were placed on agarose plates
containing 5 x 104 plaques to allow the
transfer of the phage particles and hybridized to radiolabeled
subtracted library inserts. Positive clones were purified and confirmed
by insert amplification by PCR with universal primer M13R or M13F and a
gene-specific primer based on the sequence of each of the different
subtracted clones. In vivo excision of recombinant
pBluescript plasmids used host cells XL1-Blue MRF' and SOLR cells
(Stratagene) and ExAssist helper phage (1 x
106 pfu/µl). Well isolated single clones were
picked for overnight Luria-Bertani culture and plasmid prepared for
sequencing.
Northern blot hybridization
Northern hybridizations were performed as described previously
(13). Briefly, 10 µg of each RNA sample was glyoxalated
at 50 C for 1 h. The RNA samples were separated on 1% agarose
gels in 10 mM sodium phosphate (pH 7.0) at 6 V/cm with
buffer recirculation. The RNA was transferred to nylon membrane
(Biotrans, neutral; ICN, Costa Mesa, CA) by capillary
action in 10x standard saline citrate overnight and fixed by UV
treatment on the Autocrosslink setting in the StrataLinker UV
cross-linker (120,000 µJ of UV energy decreasing to 0 during 30
sec) (Stratagene). RNAs were stained and evaluated for
equality of loading and for degradation by soaking membranes in 5%
acetic acid for 5 min, covering with acidic methylene blue dye (0.4%
methylene blue, 0.5 M sodium acetate, pH 5.2) for 5 min,
and rinsing with water (14). Positions of 18S, 28S, and
RNA molecular mass standards were marked with a pencil, and the
membrane was allowed to air dry.
Peptide synthesis
A monkey ESC42 C-terminal peptide (QGTQTSPPNVHHTC) was
synthesized using a Rainin Instrument Co., Inc.
(Woburn, MA) multiple peptide synthesizer using
fluoroenylmethyloxycarbonyl chemistry in the University of North
Carolina Program in Molecular Biology Protein Chemistry Facility. The
peptide was purified by HPLC and conjugated to keyhole limpet
hemocyanin. The C-terminal cysteine was added to facilitate coupling.
Antibodies were raised in rabbits 5497 and 5498 at Bethyl Laboratories,
Inc. (Montgomery, TX). An affinity column was prepared by attaching 2
mg of this antigen peptide to SulfoLink gel (Pierce Chemical Co., Rockford, IL). Ten milliliters of antiserum was passed over
the column, and bound antibody was eluted in low pH according to the
column manufacturer’s recommendations.
Tissue sources
Human epididymides for immunohistochemistry and Northern blot
analyses were obtained from prostate cancer patients ranging in age
from 58 to 83 yr. The epididymides were trimmed of fat and connective
tissue and dissected into caput, corpus, and caudal regions before
freezing or fixation.
For analysis of androgen regulation, male rhesus monkeys of similar age, weight, and testicular size underwent subcapsular orchiectomy (15) or sham operation. One orchiectomized monkey was immediately injected im with T enanthate 30 mg/kg body weight (400 mg total), and the other was injected with vehicle. Epididymides and remaining testes were removed 6 d later and frozen in liquid nitrogen. Serum samples for T RIA were taken just before surgery on d 0 and 6. All animals used in these studies were maintained in accordance with the NIH Guide for the Care and Use of Laboratory Animals. The protocol follows accepted veterinary medical practice and was approved by the University of North Carolina Animal Care and Use Committee. The animals were given analgesics and were monitored closely after surgery.
Rhesus monkeys 10–12 yr of age with proven breeding history (Covance Research Products and Dr. Catherine VandeVoort, CA Regional Primate Center, Davis, CA) provided tissues for Northern analysis and immunostaining. Tissues for immunohistochemistry were fixed in Bouin’s solution (75 ml of saturated picric acid, 5 ml of glacial acetic acid, 25 ml of 37% formaldehyde) promptly after excision. Surplus human testes and epididymides were made available by Dr. James L. Mohler (Department of Urology/Surgery, University of North Carolina, Chapel Hill). Other human tissues were obtained from the Tissue Procurement Core Facility of the Lineberger Comprehensive Cancer Center (University of North Carolina, Chapel Hill). Human tissues are not accompanied by identifying information and cannot be traced to the donor.
Subcloning cDNAs into pSG5
The complete monkey cDNA was excised from pBluescript by
EcoRI/RsaI digestion and cloned into
EcoRI/BamHI-digested pSG5
(Stratagene) after blunting the BamHI site. The
cDNA without the signal peptide was obtained by PCR amplification from
the pBluescript clone using the high fidelity Pfu polymerase
(Stratagene) and the oligonucleotide primers
CCAAGGAATTCCAACCATGGGTGG (forward) and ACAGGGATCCGTGACATTCGAGAAGAAG
(reverse). The amplified product was digested with
EcoRI/BamHI, gel purified, and cloned into the
EcoRI/BamHI site of pSG5.
Transfection of COS cells for immunostaining and Western
blotting
Monkey kidney COS-1 cells (American Type Culture Collection, Rockville, MD) were cultured in DMEM with high
glucose. Cells were plated in 10-cm dishes (106
cells/dish) for protein extraction for Western blotting. Cells were
transfected with 10 µg of pSG5-ESC42 expression vector per 10-cm dish
using DEAE-Dextran (Sigma Inc., St. Louis, MO)
(16). Cells were washed once in 6 ml of PBS, harvested in
1 ml of PBS, and centrifuged for 1 min at 5,000 x g.
Cells were resuspended in 100 µl of RIPA buffer (PBS, pH 7.4, 1%
NP40, 0.5% sodium deoxycholate, 0.1% SDS, 0.5
mM phenylmethylsulfonyl fluoride, 10
µM pepstatin, 4 µM
aprotinin, 80 µM leupeptin, and 5
mM benzamidine) (17). DNA was
sheared through a 27-gauge needle. Lysates were centrifuged at
13,000 x g for 2 min to remove debris. Aliquots of 0.5
µl of COS lysate were denatured in 1% SDS loading buffer loaded on
12% polyacrylamide gels. Surplus swim-up sperm pellets were boiled in
200 µl of 1% SDS loading buffer for 5 min, and 5 µl was applied
per lane. Proteins were electroblotted to nitrocellulose membranes
and immunodetected using enhanced chemiluminescence (NEN Life Science Products, Boston, MA) or SuperSignal (Pierce Chemical Co., Inc., Rockford, IL).
Attempted amplification of alternative transcripts by PCR
Using a human caput/corpus cDNA library in Lambda Zap
(Stratagene) (18) as template, amplification
of alternative transcripts was attempted using a single reverse primer
(AGTGGGATCCGAGAGGAAGTCATGAGC) and three forward primers, the first to
the 5' region (GCGAATTCCCAAAGGCAAGTCTAAATGTTG), the second to the first
alternative exon (GCGAATTCTACCACCTCCTGCTTCCCAAG), and the third to the
second alternative exon (CGGAATTCTCTCCTGTTTCCCAGGGAC).
Immunohistochemical staining
Tissues were fixed by immersion in Bouin’s fluid and embedded
in paraffin according to standard protocols (19). For
immunohistochemical staining of rhesus monkey epididymis, the Tyramide
Signal Amplification Indirect kit (NEN Life Science Products) (20, 21) was used with diaminobenzidine
(Aldrich, Milwaukee, WI) as the chromogen. To
visualize ESC42 for confocal microscopy, the fluorophor cyanine-3
conjugated to tyramide was used with the Tyramide Signal Amplification
Direct kit (NEN Life Science Products). The DNA in nuclei
was stained using blue fluorescent 4',6-diamidino-2-phenylindole (DAPI)
in Vectashield mounting medium (Vector Laboratories, Inc.,
Burlingame, CA). Photographs of diaminobenzidine-stained sections were
taken with a Nikon (Tokyo, Japan) Eclipse E600 microscope
using a Spot digital camera and Spot Advanced software (Diagnostic
Instruments, Inc., Sterling Heights, MI). Digital photographs of
fluorescent sections were taken using a Carl Zeiss (Jena,
Germany) 410 laser scanning confocal microscope and Carl Zeiss software.
Surplus swim-up human sperm were provided by Dr. Stan Beyler (Assisted Reproductive Technology Clinic, Department of Obstetrics and Gynecology, University of North Carolina, Chapel Hill). Sperm were immunostained as described previously (18) using affinity-purified antibody 5497. Sperm images were arranged and labeled using Adobe Photoshop 5.0 (Adobe Systems, Mountain View, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) were
isolated and sequenced. In addition, monkey homologs of 7 known
epididymis-specific cDNAs encoding AEG (32), EAP-I, GPX-5,
HE1, HE3, HE5, and HE6 (33) were found, consistent with
expected library composition. Full length cDNA sequences and additional
sequence from the human genomic database revealed that a total of 25
independent expressed sequences were isolated. The predicted proteins
show motifs characteristic of enzymes, protease inhibitors, ligand
transport, extracellular matrix interaction, and nuclear regulatory
proteins. The motifs predicted in ESC42, ESC342, and ESC328 suggest
extracellular matrix adhesion, a protein group expanded in the human
genome compared with other eukaryotes (34).
|
To obtain full-length cDNAs, a nonsubtracted monkey epididymis
cDNA library was constructed and screened by plaque hybridization with
subtracted library cDNAs. The 11 full length cDNAs currently under
investigation are summarized in Table 2.
They encode proteins with less than 50% amino acid sequence identity
to the most closely related known protein except for the recently
published human and dog homologs of ESC342 and a mouse lipocalin
related to ESC384. These low levels of homology leave open the
possibility that these proteins in the epididymis serve different
functions from the related proteins. Expression of each gene in monkey
was regionally concentrated and at least partially regulated by
androgen, as determined by Northern blot hybridization to RNAs isolated
from intact, castrated, and T-replaced rhesus monkeys as described
below for ESC42 (data not shown for other clones).
|
). Signal peptides are predicted for
both proteins with cleavage sites between monkey amino acids 22 and 23
and between human amino acids 20 and 21 (35). The
predicted proteins have a calculated molecular mass of 11.2 kDa after
signal peptide removal. A PROSITE (36) scan identified
several sites for posttranslational processing, including an asparagine
glycosylation site (NRSG, amino acids 29–32), four
PKC phosphorylation sites (TCK, amino acids 47–49; TIR,
amino acids 86–88; SSK, amino acids 97–99; and
SKK, amino acids 98–100), and casein kinase C
phosphorylation sites (SNED, amino acids 58–61; and
SKKD, amino acids 98–101). The predicted human and monkey
proteins are novel and the functions are unknown, but database searches
reveal homologies to functional motifs in the cysteine-rich N-terminal
half of the mature protein. A motif similar to the CCHC-type zinc
finger found in DNA-binding proteins was identified in amino acids
25–40 by Profilescan (37). Similarities to the trefoil
three-loop domain (25) and to epidermal growth factor were
recognized in amino acids 35–56 by GeneFIND (38). The
cysteine-rich N-terminal region is also 49% similar across 68 amino
acids to the extracellular N terminus of low affinity nerve growth
factor receptor (p75) (39). This region is the first of
four similar cysteine-rich motifs forming the extracellular nerve
growth factor binding domain of the receptor. In addition, the N
terminus of ESC42 is 48% similar to a 57-amino acid segment near the C
terminus of HE2ß1 (18). These relationships are
consistent with the possibility that disulfide bonds linking the
cysteines in the N-terminal half of the ESC42 form functional
intrachain loop structures with the potential to mediate macromolecular
interactions.
|
). The
two first exons are nearly identical except for the splice junctions
and five base substitutions, two of which are silent; one leads to
amino acid L13 conversion to F, one leads to V17 conversion to G, and
one leads to P19 conversion to L. These changes might alter the
structure of the signal peptide but would not change the cleavage site
(35). Alternative splicing of the mRNA could result in a
coding sequence for either of the two exon 1 signal peptides or none.
However, attempts to amplify alternative transcripts by PCR yielded
only products containing the first of the two signal peptide exons
(data not shown). A putative TATA box near the cDNA 5' end and the stop
codon, polyadenylation signal, and poly(A) tail (tail removed in Fig. 2) in the cDNA suggest that the complete sequence was obtained. The
gene is not associated with the cluster of classic trefoil factors
(TFFs) on chromosome 21p22.3 (40).
|
). COS-1 monkey kidney cells were
transiently transfected with plasmids to overexpress monkey ESC42 with
or without the signal peptide. The recombinant proteins appeared
smaller than the protein derived from sperm but migrated close to the
18.5-kDa molecular mass marker on this 12% SDS polyacrylamide gel as
well as on 10–20% gradient polyacrylamide gels (data not shown).
Immunoreactive recombinant species of relative mol wt 32,000, 35,000,
and 50,000 may represent dimers and trimers because trefoil domains are
known to form intermolecular multimers through disulfide linkage.
Attempts to eliminate these species by additional reducing agents
succeeded in decreasing the quantity of larger species and increasing
the quantity of smaller species (data not shown).
|
) was
concentrated in specific cells of the columnar epithelium and absent
from adjacent, morphologically identical cells, forming a banded
pattern characteristic of epididymal gene expression (18).
Immunostaining was eliminated by preincubation of antibody with peptide
antigen (Fig. 4B). The ESC42 protein in the efferent duct epithelial
cells was located in some cells in a rounded pattern suggesting
location in nuclei (Fig. 4C). However, confocal microscopy using red
fluorescent ESC42 immunostaining and DAPI nuclear stain (Fig. 4, E and
F) demonstrated that ESC42 protein was not present in nuclei. In caput,
ESC42 was located in the perinuclear regions (Fig. 4, A, D, and F).
ESC42 was concentrated at the luminal surface of the epithelium and
associated with the microvilli (visible in Fig. 4D and especially clear
in Fig. 4F). Staining was also associated with sperm in the lumen.
Human ejaculated sperm were immunostained using Texas Red fluorescent
dye-conjugated secondary antibody (Fig. 5A). ESC42 was concentrated on the sperm
in the postacrosomal head and neck regions. The protein was less
abundant on the midpiece and tail.
|
|
). A weakly hybridizing species of the
same size was detected in oviduct, suggesting either low levels of
expression of ESC42 or the presence of a related sequence. To determine
if ESC42 expression is regulated by T, a key hormone in sperm
maturation, RNA was obtained from rhesus monkeys that were sham
operated, castrated at 6 d, and castrated at 6 d but given a
single injection of 400 mg of T enanthate immediately after testis
removal (Fig. 7). By 6 d after
castration, ESC42 mRNA levels in caput and corpus declined to 10% of
normal levels. Exogenous T maintained expression in caput but not in
corpus. Serum T levels in monkeys that were sham operated, castrated,
and castrated/androgen replaced before testis removal were 3.0, 3.8,
and 1.4 ng/ml, respectively. Six days after injection, at the time the
epididymides were removed, serum T levels were 2.0, 0.15, and 64.9
ng/ml in monkeys that were sham operated, castrated, and
castrated/androgen replaced, respectively.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BLAST searches using the 25 cDNAs identified 18 of the human gene sequences, confirming the similarity of these monkey and human gene sequences and the usefulness of the monkey model system in understanding human epididymal function. The remaining 7 genes should become available as the human genome sequencing project progresses. Alternatively, these 7 may not be well conserved and may represent sequences substantially different in the rhesus monkey.
The 25 cDNAs encode proteins related to modifying enzymes (ESC177, ESC300, ESC615) and inhibitors (ESC6, ESC13) that could activate or protect sperm surface proteins. Two new lipocalins (ESC384, ESC513) from the cluster on human chromosome 9 bind undetermined ligands but are similar to known proteins that bind and transport retinoic acid and pheromones, both of which are important in fertility (41). The vitamin D-binding motif of ESC9 may also serve a hydrophobic ligand-binding/transport function. Recent evidence supports a host defense role for secreted ribonucleases similar to ESC461 (30). ESC112 contains a motif similar to the C3HC4-class zinc finger (38) in addition to its low homology with the secreted acrosomal protein SP10. A predicted signal peptide (35) in the ESC112 amino acid sequence suggests a secreted protein more than a nuclear protein The fibronectin II domains of ESC342 may bind collagen or phospholipids, as proposed for HE12 (28). The von Willebrand (ESC328) cysteine-rich motifs may mediate interactions with other proteins. ESC342 and ESC328 may interact with extracellular matrix proteins to stimulate intracellular signal transduction.
Characterization of these epididymis-specific clones has begun with the most abundant. The ESC42 mRNA is highly epididymis specific and androgen regulated. It is most abundant in caput and corpus in the sham-operated animal, reduced in caput and corpus in the castrated animal, and maintained only in caput in the T-replaced animal. It is puzzling that the mRNA is not detectable in the corpus of the T-replaced epididymis. Similar loss of mRNA in the corpus in the T-replaced animal was seen for 3 of the 10 other full length clones (data not shown). Region-specific regulation of gene expression by androgens in the epididymis is complex and was discussed in a recent review (42). The delivery of exogenous T through the general circulation may affect regionalized gene expression differently from T reaching the caput from the testis at high concentrations in luminal fluid. The T administered to the T-replaced animals raised circulating serum total T to levels similar to those reported for caput fluid in the rat (43). Testis factors may have a role in regulating gene expression in different regions of the epididymis, and the absence of factors could have contributed to an alteration in ESC42 mRNA stability or synthesis in response to exogenous T. Further experiments would be required with this castrated model to explain the regional differences in T response.
The ESC42 protein is expressed mainly in the caput and efferent ducts, but it is also detected in areas of the corpus and cauda. Binding to sperm was indicated by immunofluorescent detection on ejaculated human sperm and on Western blots of sperm extract. The protein contains a cysteine-rich region similar to the trefoil motif characteristic of a family that includes breast cancer estrogen-inducible gene (TFF1), stomach spasmolytic polypeptide (TFF2), and intestinal trefoil factor (TFF3) (for review, see Wong et al. [25 ]). Trefoil proteins are induced in ulceration and carcinoma and are involved in the cell migration and differentiation in damage repair and in cancer (44). TFFs are abundant in the gastrointestinal tract in association with mucins, where they modulate cell adhesion and migration in mucosal defense and repair. The types of injury to the epididymis in which ESC42 might function include damage to the epithelium by invading pathogens. Interaction of the TFF1 trefoil motif with a von Willebrand motif in mucins was recently reported (45), suggesting that the TFF may cross-link mucins, potentially affecting viscosity and sperm mobility.
A related trefoil-like motif is found in the
carbohydrate-degrading enzymes sucrase-isomaltase and lysosomal
-glucosidase, in which the motif is suggested to bind
carbohydrate, raising the possibility of a role in the degradation of
extracellular glycoprotein matrix (25). Large trefoil-like
motifs appear in pig and rabbit zona pellucida protein 3
(46), heavily glycosylated extracellular matrix proteins
surrounding oocytes, as well as in uromodulin, a protein thought to
protect against urinary tract infections by certain microorganisms
(47). Interaction of the trefoil motifs in frog mucin
FIM-A.1 with surface carbohydrates of oral microorganisms was
suggested to protect against pathological invasion
(48).
The motif most closely matching the cysteine-rich region of ESC42 is the 50% identical N terminus of another epididymis-specific protein, ESP13.2 (49) (GenBank accession number AJ236910). The function of this protein is not known, but the authors compare the cysteine-rich region to similar domains in defensins, molecules of innate immunity. Recent reports describe the antimicrobial functions in the epididymis of human cationic antimicrobial protein (50) and the rat Bin1b (51). Bin1b prevents the growth of Escherichia coli in epididymal cultures and exhibits structural similarity to HE2ß1 (18), a human sperm-binding protein. The cysteine-rich domain in Bin1b is also similar to the six-cysteine array in ESC42. Antimicrobial peptides bound to the sperm surface may promote fertility by protecting sperm against attack by bacteria or viruses in the male and female reproductive tracts.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
1 Present address: State Key Laboratory of Molecular Biology, Shanghai
Institute for Biological Science, Institute of Biochemistry and Cell
Biology, Sinica Academia, Shanghai 200031, China. 
2 Present address: Department of Biochemistry, Indian Institute of
Science, Bangalore, India 560012.
Abbreviations: DAPI, 4',6-Diamidino-2-phenylindole; pfu, plaque-forming units; TFF, trefoil factor.
Received March 21, 2001.
Accepted for publication June 5, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-mannosidase. Mol Reprod Dev 42:141–148[CrossRef][Medline]
, new members of an epididymis-specific family of
androgen-regulated proteins in the human. Endocrinology 141:1245–1253This article has been cited by other articles:
 |
|
 |
|
  A. Chandra, K. R. Srinivasan, F. Jamal, P. K. Mehrotra, R. L. Singh, and A. Srivastav Post-translational modifications in glycosylation status during epididymal passage and significance in fertility of a 33 kDa glycoprotein (MEF3) of rhesus monkey (Macaca mulatta) Reproduction, June 1, 2008; 135(6): 761 - 770. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-Y. Li, H.-Y. Wang, J. Liu, Q. Liu, J.-S. Zhang, F.-C. Wan, F.-J. Liu, S.-H. Jin, and Y.-L. Zhang Transcriptome Analysis of a cDNA Library from Adult Human Epididymis DNA Res, April 4, 2008; (2008) dsn005v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Radhakrishnan, M. A. Fares, F. S. French, and S. H. Hall Comparative genomic analysis of a mammalian {beta}-defensin gene cluster Physiol Genomics, August 20, 2007; 30(3): 213 - 222. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-F. Zhu, Q. Liu, L. Zhang, H.-X. Yuan, W. Zhen, J.-S. Zhang, Z.-J. Chen, S. H. Hall, F. S. French, and Y.-L. Zhang RNase9, an Androgen-Dependent Member of the RNase A Family, Is Specifically Expressed in the Rat Epididymis Biol Reprod, January 1, 2007; 76(1): 63 - 73. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yamazaki, T. Adachi, K. Sato, Y. Yanagisawa, H. Fukata, N. Seki, C. Mori, and M. Komiyama Identification and Characterization of Novel and Unknown Mouse Epididymis-Specific Genes by Complementary DNA Microarray Technology Biol Reprod, September 1, 2006; 75(3): 462 - 468. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Zhang, R. Gao, H. Zhang, X. Cai, C. Shen, C. Wu, S. Zhao, and L. Yu Molecular Cloning and Characterization of Three Novel Lysozyme-Like Genes, Predominantly Expressed in the Male Reproductive System of Humans, Belonging to the C-Type Lysozyme/Alpha-Lactalbumin Family Biol Reprod, November 1, 2005; 73(5): 1064 - 1071. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Patil, Y. Cai, Y. Sang, F. Blecha, and G. Zhang Cross-species analysis of the mammalian {beta}-defensin gene family: presence of syntenic gene clusters and preferential expression in the male reproductive tract Physiol Genomics, September 21, 2005; 23(1): 5 - 17. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yenugu, R. T. Richardson, P. Sivashanmugam, Z. Wang, M. G. O'Rand, F. S. French, and S. H. Hall Antimicrobial Activity of Human EPPIN, an Androgen-Regulated, Sperm-Bound Protein with a Whey Acidic Protein Motif Biol Reprod, November 1, 2004; 71(5): 1484 - 1490. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Yenugu, K. G. Hamil, Y. Radhakrishnan, F. S. French, and S. H. Hall The Androgen-Regulated Epididymal Sperm-Binding Protein, Human {beta}-Defensin 118 (DEFB118) (Formerly ESC42), Is an Antimicrobial {beta}-Defensin Endocrinology, July 1, 2004; 145(7): 3165 - 3173. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Zanich, J. C. Pascall, and R. Jones Secreted Epididymal Glycoprotein 2D6 That Binds to the Sperm's Plasma Membrane Is a Member of the {beta}-Defensin Superfamily of Pore-Forming Glycopeptides Biol Reprod, December 1, 2003; 69(6): 1831 - 1842. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. I. Yudin, T. L. Tollner, M.-W. Li, C. A. Treece, J. W. Overstreet, and G. N. Cherr ESP13.2, a Member of the {beta}-Defensin Family, Is a Macaque Sperm Surface-Coating Protein Involved in the Capacitation Process Biol Reprod, October 1, 2003; 69(4): 1118 - 1128. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Rao, J. C. Herr, P. P. Reddi, M. J. Wolkowicz, L. A. Bush, N. E. Sherman, M. Black, and C. J. Flickinger Cloning and Characterization of a Novel Sperm-Associated Isoantigen (E-3) with Defensin- and Lectin-Like Motifs Expressed in Rat Epididymis Biol Reprod, January 1, 2003; 68(1): 290 - 301. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. H. Hall, K. G. Hamil, and F. S. French Host Defense Proteins of the Male Reproductive Tract J Androl, September 1, 2002; 23(5): 585 - 597. [Full Text] [PDF] |
, Indicates predicted signal peptide cleavage site.
