| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, North Carolina 27710
Address all correspondence and requests for reprints to: Donald P. McDonnell, Ph.D., Box 3813, Duke University Medical Center, Durham, North Carolina 27710. E-mail: donald.mcdonnell{at}duke.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
One of the most important advances in our understanding of ER pharmacology has been the discovery that different ER ligands induce different conformational changes in the receptor, and that this is a key determinant of the interaction between ER and specific comodulator proteins (1, 2, 3). Thus, the ability of ligand-bound ER to regulate target gene transcription is determined by the cell- and tissue-specific expression of both coactivator and corepressor proteins that impact the ER signaling pathway (for reviews, see Refs. 4, 5). Adding to this complexity was the discovery of a second ER, ERß (6). It is likely, therefore, that tissue-specific expression of comodulators and ER subtypes will together play an important role in determining the tissue-specific actions of ER ligands. Clearly, identification of the ER comodulators in different target tissues will enable a more complete understanding of the pharmacology of the receptor and is likely to aid in the development of the next generation of SERMs. In most cases, however, the specific cell types, particularly outside of the reproductive tract, that permit tissues to respond to estrogen have not yet been identified.
To address globally the issues of tissue specificity and sensitivity to
both endogenous and xenobiotic estrogen, we have developed the ER
action indicator (ERIN) transgenic mouse that functions as a reporter
of ER activity. ERIN provides a model system that can be used to
identify tissues and cells that contain functionally active ER, both
ER
and ERß, and to define their ability to respond to different ER
ligands. This model system integrates the upstream requirements in ER
action, including the receptor, ligand, and accessory comodulators.
Activation of ER results in expression of the enzyme ß-galactosidase
(ß-gal), which allows for enzymatic amplification of the signal and
histological localization of its activity. This model system can be
used to identify novel estrogen target tissues and to define the
elements that influence and regulate ligand specificity and sensitivity
in the mouse. Importantly, by assessing the regulation of the same gene
across many different tissues, the contribution of cell context (not
target gene promoter) to the activity of a ligand can be evaluated. In
this study we validated this model system by identifying ER activity in
a number of classical and nonclassical estrogen target tissues, and we
used the system to study the tissue-specific activity of a select
estrogen (diethylstilbestrol, DES), SERM (tamoxifen), and
xenoestrogen (bisphenol A).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
cells were purchased from Life Technologies, Inc.
(Grand Island, NY), and luciferin was obtained from Promega Corp. (Madison, WI).
Plasmids
The thymidine kinase (TK)-luciferase reporter was a gift
from Ligand Pharmaceuticals, Inc. (San Diego, CA). The 1x
estrogen response element (ERE)-TK-luciferase and
3xERE-TATA-luciferase reporters were generated in the McDonnell
laboratory by J. D. Norris and M. Huacani-Hamilton. The
actin-luciferase, pW1Xb-simian virus 40 (SV40), and pXT-ß-gal3
plasmids were gifts from E. Linney (Duke University, Durham, NC).
Generation of transgene
For subcloning, all DNA fragments were separated on agarose
gels, excised, and purified using the Gene Clean II kit (no. 1001–400,
BIO 101, Vista, CA). lacZ was excised from pXT-ß-gal3 by
BglII digestion and ligated into pW1Xb-SV40, which contains
SV40 polyadenylase and intron sequences, digested with BglII
and BamHI to generate pW1-lacZ. 3xERE (three
copies of the vitellogenin ERE, GATCCCGCAGGTCACAGTGACCTG) was excised
from 3xERE-tata-luciferase by BglII digestion and ligated
into TK-luciferase digested with BamHI. 3xERE-TK was
excised from 3xERE-TK-luciferase with BglII and
HindIII and ligated into pW1-lacZ digested
with BglII and HindIII. The final transgene,
3xERE-TK-lacZ-SV40 polyadenylase and intron, was excised
with NotI and SfiI for microinjections.
Cotransfection assays
NIH-3T3 cells were maintained in DMEM. MCF-7 and HepG2 cells
were maintained in MEM. All media were supplemented with 8% FCS
(HyClone Laboratories, Inc., Logan, UT), 1 mM
sodium pyruvate, and 0.1 mM nonessential amino acids. Cells
were plated in 24-well plates (coated with gelatin for HepG2 cells)
24–48 h before transfection. DNA was introduced into cells by
transfection using lipofectin. Triplicate transfections were performed
using 3 µg total DNA. For standard transfections, 300 ng
actin-luciferase (normalization vector), 2200 ng reporter, and 500 ng
ER expression vector (pRST7-hER) (7) were used for each
triplicate. Cells were transfected for 5 h, at which time medium
was removed and induced with hormone diluted in phenol red-free medium
supplemented with 8% charcoal-stripped FCS (Sigma).
Incubation with hormone continued for 24 or 48 h, after which
cells were lysed and assayed for luciferase and ß-gal activities.
Generation and identification of transgenics
Transgenic mice were produced by the Duke University Transgenic
Mouse Facility by microinjection of male pronuclei of zygotes produced
from hybrid C57BL/6-SJL mice. Genomic DNA was isolated (DNeasy Tissue
Kit, no. 69506, QIAGEN, Valencia, CA) from tail clips from
10-d-old pups, and the transgene was detected by PCR amplification of a
200-bp fragment using transgene-specific primers (CCGACTGCATCTGCGTGT
and TAATACGACTCACTATAGGG) and control primers that amplified a 500-bp
fragment of the TSH gene (TCCTCAAAGATGCTCATTAG and
GTAACTCACTCATGCAAAGT).
Housing and mating
All housing and procedures were approved by the Duke University
animal care and use committee and were performed in accordance with
federal, state, and local rules for the humane treatment of laboratory
animals. Mice were housed in polystyrene cages with a 14-h light, 10-h
dark cycle, with food (Purina Mouse Chow 5001, or for pregnant and
nursing mice 5015, Ralston-Purina, St. Louis, MO) and
water ad libitum. Transgenic founders were bred with C57BL/6
mice (The Jackson Laboratory, Bar Harbor, ME), and
transgenic offspring were identified by PCR. Pups were weaned at
21 d and housed three to five per cage. All experimental animals
for these studies were generated from the Founder 6 line. Founder 6
(C57BL/6-SJL hybrid) was bred with C57BL/6 mice,
F1 offspring were crossed, and
F2 transgenics were mated with C57BL/6 mice to
generate experimental animals.
Ovariectomies and dosing
Adult mice were ovariectomized after anesthetization with a
ketamine and medetomidine cocktail. Ovariectomies were performed on
females by an incision directly over the ovary through the skin and
body wall. Ovaries were severed between the oviduct and uterus with
cauterizing scissors. Incisions were closed with surgical stainless
steel clips. Domitor was administered to reverse anesthesia. Mice were
kept under heat lamps until sternal recumbency was regained. One week
later, mice were given a single (unless otherwise noted) sc injection
of test compound in tocopherol-stripped corn oil (ICN Biomedicals, Inc., Aurora, OH) as indicated in the text. Twenty
to 24 h later (unless otherwise noted) mice were killed with
CO2 asphyxiation, and organs were immediately
removed, weighed, and either frozen on dry ice or placed in 1x lysis
buffer for immediate homogenization. We chose to use the estrogen DES
for these studies to assure continuity with future studies in which
compounds will be administered orally. DES is an orally active
estrogen, whereas E2 is not.
ß-Gal enzyme immunoassay (EIA)
Immulon 4 flat-bottom microtiter plates (no. 3855, Dynex
Technologies, Chantilly, VA) were used to capture 1.5 µg/well rabbit
anti Escherichia coli ß-gal antibody (AB1211, Chemicon
International, Inc., Temecula, CA) in PBS with 0.05%
NaN3 overnight at 4 C or for 2 h at 37 C.
Plates were washed with water twice. Nonspecific binding was blocked
with 200 µl/well blocking buffer (borate-buffered saline, 0.05%
Tween, 0.25% BSA, 1 mM EDTA, and 0.05%
NaN3) for 1 h or more at room temperature,
and the plates were washed twice with water immediately before assay.
Animals were killed by CO2 asphyxiation, tissues
were removed immediately, approximately 50 mg tissue were placed in 500
µl 1x lysis buffer [25 mM Tris-phosphate (pH
7.8), 2 mM dithiothreitol, 2
mM
trans-1-2-diaminocyclohexane-N,N,N,N'-tetraacetic
acid, 10% glycerol, and 0.5% Triton X-100], minced with
scissors, and kept on ice. All tissues were homogenized (PT1200,
Brinkmann Instruments, Inc., Westbury, NY) for 10 sec at
maximum speed. Insoluble material was pelleted by centrifugation at 4 C
at 15,000 x g for 10 min. ß-Gal capture was
performed by incubating 140 µl homogenate overnight at 4 C in
antibody-coated plates. For ß-gal assays, plates were washed four
times by submersion in water, then incubated with 200 µl 0.67 mg/ml
chlorophenol red-ß-D-galactopyranoside, and the
absorbance at 575 nm was measured at intervals (10 min and 3, 6, and
18 h). Wild-type mice were routinely included in the EIA analysis,
and it was found that nontransgenic mice do not express any proteins
that cross-react with the anti-ß-gal antibody. Thus, absorbance
readings from wild-type mice were the same as background. For protein
assays, tissue homogenates were diluted and performed in microplates
using the Coomassie Plus Protein Assay Reagent Kit (no. 23236,
Pierce Chemical Co., Rockford, IL).
Statistics
Data were log-transformed to reduce the variance heterogeneity,
and ANOVA was conducted on log-transformed data using StatView
(SAS Institute, Inc., Cary, NC). Planned comparisons were
conducted using Fisher’s planned least significant difference test
when the overall ANOVA was statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). In the course of
the analysis we observed that all of the ERE-TK reporters had a much
higher absolute level of induction than the 3xERE-tata promoter (data
not shown). After systematic evaluation of these
estrogen-responsive promoters in MCF-7 cells, HepG2 human
hepatocarcinoma cells, and NIH-3T3 mouse fibroblast cells with
transfected ER (data not shown), we selected the
3xERE-TK-lacZ for transgenic production (Fig. 1B).
This promoter has the highest absolute level of estrogen-induced
expression in cell-based transfection assays, a selection criteria that
had been used successfully in the creation of the retinoic acid
receptor response element-lacZ transgenic mouse
(8).
|
Characterization of the 3XERE-TK-lacZ-containing mice
Previous studies in animals and in vitro have shown
that it is difficult to select a single time point for estrogen
exposure that is suitable for all target organs. Thus, a preliminary
time-course study was performed. Adult female ERIN mice were
ovariectomized, and 1 wk later they were given a single sc injection of
corn oil or 5 µg/kg DES (a synthetic estrogen) 20, 46, or 70 h
before collection. We developed an EIA specific for the bacterial
ß-gal protein (coded for by the lacZ gene used for
transgene production) that was required to avoid the confounding
influence of endogenous enzymes that also hydrolyze the ß-gal
substrate. Using this assay, tissues were collected, homogenized, and
assayed for ß-gal activity. Robust estrogen-induced expression of the
transgene (ERIN activity) was detected in the uterus, pituitary,
hypothalamus, and kidney (Fig. 2). The
pituitary and uterus showed significant induction of ERIN activity at
all three time points tested, whereas the ß-gal signal was
significantly reduced in the kidney and hypothalamus after 46 and
20 h, respectively. The optimal expression of ERIN activity in the
four organs occurred at 20 h postinjection (Fig. 2), and
consequently, this time point was used for all of the experiments
presented in this study. To verify that the increased ERIN activity was
due to estrogen induction and not to an estrogen-stimulated increase in
cell number, ß-gal activity was normalized to both protein and DNA
content in a representative experiment. Interestingly, the fold
induction in the pituitary was not changed when normalized to DNA
content whereas the fold induction in the uterus was slightly
increased. As the two types of normalization yielded similar results,
the data were normalized to protein content for all of the experiments
in this study.
|
.
Evaluation of ERIN activity in DES-treated female mice revealed that
tissues could be classified into five groups based on ER activity. ERIN
activity was strongly induced (
4-fold) in the pituitary, uterus, and
kidney; however, the absolute levels of expression varied greatly
(pituitary > uterus >> kidney; compare scale in Fig. 2). A
moderate level of estrogen-induced ER activity (2-fold) with a high
level of basal ER activity was detected in the liver, hypothalamus (and
other areas of the brain), and adrenal. A moderate level of
estrogen-induced ER activity (2-fold) with a low level of basal
ER activity was detected in the thyroid, fat, mammary gland, and
muscle. Several tissues displayed a significant basal level of ERIN
activity that was not enhanced further with estrogen treatment,
including the heart, thymus, and intestine (data not shown). Finally,
there was no detectable activity in the spleen or lung.
|
). In addition, there was a trend toward
inhibition of the basal level of activity present in the heart, kidney,
adrenal, pituitary, and hypothalamus, but basal ER activity in thymus
and mammary gland was not affected (data not shown). As these
experiments were conducted in mice lacking the primary source of
estrogen (ovary), the variable level of basal ER activity may be due to
local aromatization of adrenal androgens, as the adrenal is a source of
estrogen precursors that can be used as substrates to synthesize
estrogen in other tissues, or to phytoestrogens in the feed. This
suggests that the ERIN mouse may be sensitive enough to detect very low
levels of estrogen exposure.
|
). The
EC50 of DES stimulation of ER activation in the
pituitary (20 ng/kg) was 25-fold lower than that required for ER
activation in the uterus and kidney (EC50 500
ng/kg). It will be important in the future to microdissect these
tissues and determine the relative sensitivities of different cell
types to estrogen exposure. However, these data suggest that cellular
context is a principle determinant of differential estrogen
responsiveness in different tissues.
|
BPA has previously been reported to have very weak uterotropic activity
(9, 10, 11, 12, 13), lower than would be predicted from its affinity
for ER, the dominant ER expressed in the uterus. However, when BPA
was administered to ERIN mice, it induced ER transcriptional activity
in the uterus at 25 mg/kg (P < 0.01) and 0.8 mg/kg
(P < 0.01), and there was a trend toward stimulation
at only 25 µg/kg (P = 0.052). At 25 mg/kg (the
maximum dose given), BPA stimulated ER transcriptional activity to 60%
of the maximum activity stimulated by 5 µg/kg DES. Contrary to the
strong response in ER transcriptional activity, when uterine wet weight
was measured in the same ERIN females, BPA showed very weak uterotropic
activity, stimulating uterine weight gain to only 18% of that induced
by DES (Fig. 6). In fact, BPA has
previously been demonstrated to be a partial agonist for this end
point, stimulating uterine weight gain to only 20% of that induced by
E2 (10).
|
). Surprisingly, however, tamoxifen was
found to stimulate very little ERIN activity in the same mice. It
appears that BPA and tamoxifen stimulate estrogenic responses
selectively in the uterus (Fig. 7). BPA is a relatively potent
agonist for ER transcriptional activation in the uterus, but is a weak
agonist in stimulating uterine wet weight gain. In contrast to BPA,
tamoxifen is a weak agonist for ER activation, but a potent agonist for
uterine wet weight gain. Thus, although BPA would probably be scored as
a compound with insignificant estrogenic activity based on its
performance in the uterotropic assay, it is, in fact, a relatively
potent activator of ER transcription activity in this tissue. These
data have important implications for environmental estrogen assessment
and for the evaluation of SERMs, where lack of uterotropic activity has
been taken to indicate inactivity for all end points.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We have used the ERIN mouse to examine the sensitivity of the same end
point in different tissues to DES administration. In ovariectomized
female mice, we found the pituitary to have 25-fold greater sensitivity
to estrogen than the uterus in the same mouse at the identical time.
These studies revealed that cell context is a major determinant of
end-point responsiveness to estrogen. Definition of the molecular
mechanisms that enable the pituitary to respond to low concentrations
of estrogen is a primary goal of our continued research, although
several potential mechanisms for differential responsiveness are
already apparent. For instance, in transient transfection assays, both
the PR A isoform and ERß have been shown to transrepress the
transcriptional activity of ER (16, 17), and this may
contribute to the decreased sensitivity of the uterus relative to the
pituitary that we observed in ERIN mice. In addition, thyroid
hormone-activated TR has been shown to potentiate estrogen activity in
some tissues (18, 19), whereas in other tissues, TR1
inhibits ER activity (20). Thus, isolation of the specific
pituitary cells that display a heightened response to estrogen and an
evaluation of the relative expression levels of the receptors will be
important. Finally, it is likely that tissue-specific expression of ER
comodulatory proteins will significantly impact ER signaling (21, 22). The ERIN mouse will clearly be a useful model that can be
used to define the mechanisms in the mouse responsible for the
differential tissue sensitivity of the pituitary and uterus and other
targets not considered in our study.
In addition to well characterized estrogen target tissues, we observed
ER transcriptional activity in a number of nonclassical tissues,
including liver, kidney, thyroid, adipose tissue, and adrenal glands.
The level of transgene expression varied greatly between tissues and
may reflect in part the expression level of ER and/or the number of
ER-containing cells in different tissues. For example, the pituitary,
uterus, and hypothalamus express ER in a large number of cells and, not
surprisingly, have a much higher level of estrogen-induced activity
in ERIN mice. The kidney has been shown to express both ER and ERß
(23), although the number of cells expressing ER is lower
than that in the more classic estrogen target tissues. Importantly,
however, all of the tissues we found to have ER activity have
previously been shown to express ER, albeit often at low levels. ERIN
can be used in future studies to specifically isolate the ER-containing
cells and determine the role of ER in these tissues.
An important new aspect in estrogen physiology is the potential ER-selective actions of xenoestrogens, a research area that has been complicated by contradictory reports of estrogenicity of several of these xenobiotics. For example, BPA, a widely used synthetic compound with demonstrated estrogenic activity, is used as a component of epoxy resins found in the lining of metal food cans (24), as a monomer in the manufacture of polycarbonate plastics (25), and in dental sealants (26). BPA has a relatively weak affinity for ER (27, 28) and exhibits low activity in the classic uterine weight gain assay (9, 10, 11, 12, 13). However, this xenoestrogen can display significant estrogenic activity, as evidenced 1) in mice where prenatal exposure results in increased prostate weight in adult males and earlier puberty in female mice (27, 29, 30, 31), and 2) in Fischer 344 rats where its administration leads to the development of hyperprolactinemia (32). The differential, and seemingly paradoxical, actions of BPA may be due to selective ER modulatory activities of this ligand, which result in species-, life stage-, and tissue-selective ER activity (33, 34). In addition, BPA is a full ER agonist in many cell-based assays and a partial agonist in others (25, 34), and Diel et al. (35) recently reported that BPA can induce estrogen-responsive endogenous genes in the uterus at lower concentrations than stimulation of uterine weight gain. It is likely that the ER conformation induced by BPA results in recruitment of cell- and tissue-specific factors responsible for the differential responses to this ligand (36). By definition, therefore, BPA can be classified as a SERM.
Our results have important implications for the screening of environmental estrogen. Currently, there are several in vitro assays that adequately measure the ability of xenoestrogens to interact with and/or activate ER, including binding, transcriptional activation, and proliferation assays (37). Clearly, however, species- and tissue-selective ER-mediated responses will occur in the animal. In this study the potency and efficacy of BPA in stimulating uterotropic activity were very low; however, the potency and efficacy of BPA in stimulating ER transcriptional activity in the uterus are equal to or greater than its potency in vitro. Specifically, BPA stimulated ER activity in the uterus at 0.8 mg/kg (efficacy, 40% of DES maximum; P < 0.05) and tended to stimulate at 25 µg/kg (20% of DES maximum; P = 0.052). This is the lowest reported estrogenic response of BPA in adult animals. The estrogen-stimulated uterine wet weight assay has been the gold standard for determining estrogenicity in vivo. However, based on our results and others (12), this assay appears to be a relatively insensitive end point, and is likely to underestimate the number of compounds with estrogenic potential in vivo. For example, based on results of uterotropic assays in mice, BPA would be considered an extremely weak partial ER agonist, whereas SERMs such as tamoxifen would be rather potent agonists; conclusions that are not supported by the results of this study.
Although the Founder 6 used in these studies showed expression in all
tissues reported to be estrogen responsive, it showed relatively
limited expression in two organs, the mammary gland and ovary. However,
we have recently identified a new founder that in preliminary
experiments showed strong expression of the transgene in both the
mammary gland and ovary and broadly in other tissues. Due to the
insertion site of the transgene into areas of chromatin that are
variably inactive in different tissues, it is possible that there will
not be a single founder line that possesses the ability to respond
strongly to ER ligands in all tissues. However, we have demonstrated
estrogen-dependent ER activity in a number of classic estrogen target
tissues in ERIN mice in addition to tissues with less
characterized estrogenic responses. ERIN will provide an excellent
in vivo model system 1) to characterize the pharmacology of
ER- and ERß-selective ligands, 2) to detect local sources of
estrogen production, 3) to identify cell types within nonclassical
estrogen target tissues containing active ER, and 4) to aid in the
characterization of environmental estrogen, which, like BPA, will
undoubtedly manifest tissue-specific estrogenic responses. We believe
that ERIN is an important model system and anticipate that it will gain
widespread use in the field to study different aspects of estrogen
signaling.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Abbreviations: BPA, Bisphenol A; DES, diethylstilbestrol; E2, estradiol; EIA, enzyme immunoassay; ER, estrogen receptor; ERE, estrogen response element; ERIN, ER action indicator; ß-gal, ß-galactosidase; ICI, ICI 182,780; SERM, selective ER modulator; SV40, simian virus 40; TK, thymidine kinase.
Received May 22, 2001.
Accepted for publication July 16, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ERß. Proc Natl Acad Sci USA 96:3999–4004 and ERß at AP1 sites. Science 277:1508–1510
transcriptional activity and is a key regulator of the cellular
response to estrogens and antiestrogens. Endocrinology 140:5566–5578 in a distinct manner from
estradiol. Mol Cell Endocrinol 142:203–214[CrossRef][Medline]
and ERß. J Biol Chem 275:35986–35993This article has been cited by other articles:
 |
|
 |
|
  D. Di Lorenzo, G. Rando, P. Ciana, and A. Maggi Molecular Imaging, an Innovative Methodology for Whole-Body Profiling of Endocrine Disrupter Action Toxicol. Sci., December 1, 2008; 106(2): 304 - 311. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Varayoud, J. G. Ramos, V. L. Bosquiazzo, M. Munoz-de-Toro, and E. H. Luque Developmental Exposure to Bisphenol A Impairs the Uterine Response to Ovarian Steroids in the Adult Endocrinology, November 1, 2008; 149(11): 5848 - 5860. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. E Burdette In vivo imaging of molecular targets and their function in endocrinology J. Mol. Endocrinol., June 1, 2008; 40(6): 253 - 261. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. D. DuSell, M. Umetani, P. W. Shaul, D. J. Mangelsdorf, and D. P. McDonnell 27-Hydroxycholesterol Is an Endogenous Selective Estrogen Receptor Modulator Mol. Endocrinol., January 1, 2008; 22(1): 65 - 77. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. Windahl, M. K. Lagerquist, N. Andersson, C. Jochems, A. Kallkopf, C. Hakansson, J. Inzunza, J.-A. Gustafsson, P. T. van der Saag, H. Carlsten, et al. Identification of Target Cells for the Genomic Effects of Estrogens in Bone Endocrinology, December 1, 2007; 148(12): 5688 - 5695. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. M. Wittmann, A. Sherk, and D. P. McDonnell Definition of Functionally Important Mechanistic Differences among Selective Estrogen Receptor Down-regulators Cancer Res., October 1, 2007; 67(19): 9549 - 9560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. V. Welshons, S. C. Nagel, and F. S. vom Saal Large Effects from Small Exposures. III. Endocrine Mechanisms Mediating Effects of Bisphenol A at Levels of Human Exposure Endocrinology, June 1, 2006; 147(6): s56 - s69. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Larson, D. L. Osburn, K. Schmitz, L. Giampa, S.-M. Mong, K. Marschke, H. M. Seidel, J. Rosen, and A. Negro-Vilar Peptide Binding Identifies an ER{alpha} Conformation That Generates Selective Activity in Multiple In Vitro Assays J Biomol Screen, September 1, 2005; 10(6): 590 - 598. [Abstract] [PDF]
|
|
|
|
 |
|
 D. R. Boverhof, K. C. Fertuck, L. D. Burgoon, J. E. Eckel, C. Gennings, and T. R. Zacharewski Temporal- and dose-dependent hepatic gene expression changes in immature ovariectomized mice following exposure to ethynyl estradiol Carcinogenesis, July 1, 2004; 25(7): 1277 - 1291. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Toda, Y. Okada, M. Zubair, K.-i. Morohashi, T. Saibara, and T. Okada Aromatase-Knockout Mouse Carrying an Estrogen-Inducible Enhanced Green Fluorescent Protein Gene Facilitates Detection of Estrogen Actions in Vivo Endocrinology, April 1, 2004; 145(4): 1880 - 1888. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Jelinsky, H. A. Harris, E. L. Brown, K. Flanagan, X. Zhang, C. Tunkey, K. Lai, M. V. Lane, D. K. Simcoe, and M. J. Evans Global Transcription Profiling of Estrogen Activity: Estrogen Receptor {alpha} Regulates Gene Expression in the Kidney Endocrinology, February 1, 2003; 144(2): 701 - 710. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Di Lorenzo, R. Villa, G. Biasiotto, S. Belloli, G. Ruggeri, A. Albertini, P. Apostoli, M. Raviscioni, P. Ciana, and A. Maggi Isomer-Specific Activity of Dichlorodyphenyl-trichloroethane with Estrogen Receptor in Adult and Suckling Estrogen Reporter Mice Endocrinology, December 1, 2002; 143(12): 4544 - 4551. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. M. Ismail, J. Li, F. J. DeMayo, B. W. O'Malley, and J. P. Lydon A Novel LacZ Reporter Mouse Reveals Complex Regulation of the Progesterone Receptor Promoter During Mammary Gland Development Mol. Endocrinol., November 1, 2002; 16(11): 2475 - 2489. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
) was given 20 h
before collection or a singe dose of 5 µg/kg DES (
) was given 70,
46, or 20 h before collection. Tissues were harvested and
homogenized for EIA (see Materials and Methods). ß-Gal
activity was normalized to protein content. n 
3/treatment
group. Error bars represent the SEM. *,
P < 0.05 relative to corn oil control.
