help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bernard, C.
Right arrow Articles by Cordier-Bussat, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bernard, C.
Right arrow Articles by Cordier-Bussat, M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Endocrinology Vol. 142, No. 2 721-729
Copyright © 2001 by The Endocrine Society


ARTICLES

Peptones Stimulate Intestinal Cholecystokinin Gene Transcription via Cyclic Adenosine Monophosphate Response Element-Binding Factors

Christine Bernard1, Anne Sutter1, Charles Vinson, Christelle Ratineau, Jean-Alain Chayvialle and Martine Cordier-Bussat

Institut National de la Santé et de la Recherche Médicale U45 (C.B., A.S., C.R., J.-A.C., M.C-B.), Hôpital Edouard Herriot, 69437 Lyon, France; Elève de l’Ecole Pratique des Hautes Etudes (A.S.); and Laboratory of Metabolism (C.V.), National Cancer Institute, National Institutes of Health, Bethesda, Maryland, 20892

Address all correspondence and requests for reprints to: Dr. Martine Cordier-Bussat, INSERM U45, Hôpital Edouard Herriot, Pavillon Hbis, 69437 Lyon Cedex 03, France. E-mail: cordier{at}lyon151.inserm.fr


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cholecystokinin (CCK) is a potent intestinal hormone that regulates several digestive functions. Despite the physiological importance of CCK, the cellular and molecular mechanisms that govern its synthesis and secretion are not completely identified. Peptones, which are fair counterparts of the protein fraction in the intestinal lumen, are good stimulants of CCK secretion. We have previously shown that peptones activate CCK gene transcription in STC-1 enteroendocrine cells. The DNA element(s) necessary to induce the transcriptional stimulation was preliminary, localized in the first 800 bp of the CCK gene promoter. In the present study, we identify a DNA element [peptone-response element (PepRE)] essential to confer peptone-responsiveness to the CCK promoter, and we characterize the transcription factors implicated. Localization of the PepRE between -93 and -70 bp of the promoter was established using serial 5'-3'deletions. Systematic site-directed mutagenesis demonstrated that the core PepRE sequence, spanning from nucleotide -72 to -83, overlapped with the putative AP-1/CRE site. Mutations in the core sequence dramatically decreased peptone-responsiveness of CCK promoter fragments. The PepRE functioned as a low-affinity CRE consensus site, binding only transcription factors of the CREB family. Overexpression, in STC-1 cells, of a dominant-negative protein (A-CREB), that prevented the binding of CREB factors to DNA, completely abolished the peptone-induced transcriptional stimulation. Peptone treatment did not modify the nature and the abundance of proteins bound to the PepRE but led to increased phosphorylation of the CREB factors. In conclusion, the present study first demonstrates that CCK gene expression is under the control of protein-derived nutrients in the STC-1 enteroendocrine cell line.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CHOLECYSTOKININ (CCK) is a neuroendocrine peptide produced by the endocrine I cells of the small intestine and by neurons of the central and peripheral nervous systems (1, 2). Intestinal CCK displays a broad spectrum of biological effects, especially with regard to postprandial pancreatic secretion and gall-bladder contraction, whereas brain CCK has been proposed to regulate a variety of central nervous system functions, including feeding behavior, anxiety, analgesia, and memory functions.

The CCK complementary DNA has been cloned in several species, including human (3) and rat (4). The same gene transcript of approximately 750 bp is expressed in the intestine and in the nervous system. Despite the physiological relevance of the peptide, the factors involved in the regulation of CCK gene transcription are little known. Previous studies concerned the transcriptional expression in nervous tissue, especially in neuroblastoma cell lines (5, 6, 7, 8, 9). The proximal upstream regulatory region of the CCK gene exhibits functional elements highly conserved in evolution: an SP1 site located close to the putative TATA box; and an AP-1/TRE/CRE element located approximately 80 bp upstream of the transcription initiation site and flanked by two E-box (E1 and E2) motifs (7, 10). Recent studies have shown that both the basic fibroblast growth factor (bFGF) and forskolin stimulate CCK gene promoter via the CRE/TRE site in the human SK-N-MC neuroblastoma cell line (9) and that factors associated with the most 5' E1 motif exhibit a negative cooperative effect on the activation via the CRE/TRE element (8).

Nothing has been reported yet on the regulation of CCK gene in the intestine. That the functional elements identified in nervous tissue are operating as well in the enteroendocrine cells is likely but not proven. In addition, agents stimulating CCK-storing sites clearly differ in the central nervous system and in the gut. Indeed, intestinal endocrine cells are polarized epithelial cells, with their apical pole in direct contact with the intestinal lumen and with the alimentary chyme. Although it is well established that nutrients stimulate CCK secretion in vivo, the contribution of each class of nutrients to CCK secretion is still not well defined, nor are the cellular and molecular mechanisms implicated in this hormonal res-ponse. Digestion of proteins mainly yields amino acids and oligopeptides. Peptones are fair counterparts of the protein fraction in the intestinal lumen. We have demonstrated previously that peptones not only stimulate CCK secretion in vivo but also ex vivo in the model of isolated vascularly perfused rat intestine (11) and in vitro in the intestinal enteroendocrine cell line STC-1 (12), suggesting a direct effect of peptones on endocrine cells. Recently, we have shown that peptones stimulate CCK gene transcription in STC-1 cells (12). The cis-acting DNA element(s) conferring peptone inducibility to the CCK promoter [peptone-response element (PepRE)] was preliminary located within the first 800 bp upstream of the transcription initiation site (12). In the present study, we report the identification of the PepRE and the characterization of transcription factors implicated in the peptone-induced activation of CCK gene transcription.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids
Cloning of CCK promoter subfragments from -765 bp to -144 bp into pGL3 basic vector. A BamHI restriction fragment, containing approximately 800 bp of the rat CCK gene 5' flanking region [position +40 to -765 of the CCK promoter (10)], was subcloned into pBluescript (Stratagene/Ozyme, Montigny le Bretonneux, France) to generate plasmid BS/CCK800. CCK promoter fragments from -765 bp to -144 bp were subcloned into pGL3basic (Promega Corp., Charbonnières, France), which contains a firefly luciferase reporter gene downstream of a multicloning site (MCS). A KpnI/SacI fragment, containing 800 bp of the CCK promoter, was excised from BS/CCK800 and introduced into the KpnI/SacI sites of pGL3basic MCS to generate the plasmid pGL3/CCK-765. The -654, -420, -250, and -144 fragments were obtained after digestion of the 800-bp KpnI/SacI CCK promoter fragment with Nru1, Ava2, RsaI, and SmaI restriction enzymes, respectively. These subfragments were blunt-ended at their 5' extremity and introduced into the EcoRV/SacI restriction sites of pGL3/CCK-765 MCS. The other subfragments (-311, -282, -271, -194, and -160) were obtained from pGL3/CCK-654, linearized upstream of the CCK promoter fragment using KpnI and EcoRI and then treated with exonuclease III, Mung Bean Nuclease, and ligase to induce serial deletions in the 5' extremity of the CCK fragment.

Cloning of the CCK promoter subfragments -105, -93, -71,-50, and -28 into pGL3basic. An oligonucleotide with a Bgl2 restriction site in its 3' extremity, containing the CCK promoter sequence from +40 to -28 bp, was coligated with a series of oligonucleotides possessing KpnI sites in their 5' extremities and containing the CCK promoter sequences from -28 to -51 bp, from -28 to -71 bp, from -28 to -93 bp, or from -28 to -105 bp, into the KpnI and Bgl2 restriction sites of pGL3basic.

Site-directed mutagenesis. Systematic site-directed mutagenesis between -93 and -70 bp was performed as previously described (13). Briefly, single-stranded plasmid DNA was obtained from pGL3/CCK-93 in CJ236 bacteria (Invitrogen, Groningen, The Netherlands) using the M13K07 helper bacteriophage (Promega Corp.). Overlapping 25- to 30-bp oligonucleotides complementary to the CCK promoter sequence between -93 and -70 bp, except over 6 bp, corresponding to transversions described in Fig. 2Go, were hybridized to the single-stranded pGL3/CCK-93 template, before complementary strand synthesis using T4 DNA polymerase and T4 DNA ligase (Promega Corp.). The AP1cons pGL3/CCK144 mutant was obtained, following the instructions of the manufacturer, using the Tfu Direct site-directed mutagenesis kit (Appligene, Q-Biogene, Illkirch, France). Mutant plasmids were selected by specific hybridization with labeled mutated oligonucleotides and were controlled by DNA sequencing using the sequenase version 2.0 DNA kit (USB, Amersham Pharmacia Biotech/Pharmacia Biotech Europe, Orsay, France).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. Effect of mutations on the peptone-induced activation of CCK promoter fragments. STC-1 cells were cotransfected with the plasmid pRLTK used as an internal control and (a) with the series of the pGL3basic/CCK-93 wild type (wt) and mutant (m1-m8) constructs or (b) with the pGL3basic/CCK-144 wt and the mutant APlcons constructs. The luciferase and renilla activities were measured after a 16-h incubation period without ({square}) or with peptones ({blacksquare}). These results are presented as in Fig. 1bGo.

 
Expression vectors for dominant-negative inhibitors of CREB and CGN4 proteins. Dominant-negative inhibitors of CREB (A-CREB) and CGN4 (N4H-CGN4) were previously described (14, 15). The coding sequences for A-CREB and N4H-CGN4 were inserted into a pRc/CMV vector (Invitrogen), modified to contain an N-terminal FLAG epitope (pRc/CMV500/A-CREB) or a hemagglutinin epitope (pRc/CMV566/N4H-CGN4).

Oligonucleotides
Oligonucleotides for site-directed mutagenesis and electrophoretic motility shift assay (EMSA) were purchased and were purified using reverse-phase chromatography (Eurogentec, Seraing, Belgium). Sequences of the CCK promoter-related oligonucleotides were as follows. PepRE: 5' CGGACTGCGTCAGCACTGGGG 3'; PepRE mut: 5' GCCGGACTGTACACTCACTGGG 3'; E1: 5' CTCTGAGCACGTGTCCTGCC 3'; SP1: 5' GCGTACCGGGCGGGGCTACGTAC 3'.

AP1 and CRE consensus oligonucleotides were purchased from Promega Corp. and their sequences were as follows. AP1 consensus: 5'CGCTTGATGAGTCAGCCGGAA3'; CREB consensus: 5' AGAGATTGCCTGACGTCAGAGAGCTAG3'.

CDX oligonucleotide corresponds to cdx-2 binding site in the sucrase isomaltase gene promoter. It was purchased from Isoprim (Toulouse, France) and its sequence was as follows. CDX: 5' GTGCAATAAAACTTTATGAGTA 3'.

Cell culture and transfections
The STC-1 plurihormonal cell-line was derived by Rindi et al. (16) from an endocrine tumor that developed in the small intestine of a double transgenic mouse expressing viral oncogenes under the control of the insulin promoter. It was provided by Dr. A. B. Leiter (Department of Medicine, New England Medical Center, Boston, MA). STC-1 cells were cultured in RPMI 1640 medium (Life Technologies, Inc., Cergy-Pontoise, France) containing 5% FCS, and supplemented with penicillin (100 IU/ml) and streptomycin (50 µM). Transfection experiments were performed using the Escort lipofection protocol (Sigma, Saint-Quentin-Fallavier, France). Briefly, 48 h before transfection, STC-1 cells were seeded in 24-well culture plates (8 x 104 cells per well). For each well, 250 ng plasmid DNA was mixed with 0.5 µl escort reagent in 100 µl RMPI 1640 medium without FCS. In all transfection experiments, a plasmid with a renilla reporter gene under the control of a thymidine kinase promoter (pRL-TK, Promega Corp.) was used as an internal control (25 ng pRL-TK per well). The DNA/escort mixture was incubated 15–30 min at room temperature before addition of 400 µl RPMI 1640 with 5% FCS. This mixture was incubated 5–6 h with the cells at 37 C. The escort/plasmid DNA mixture was then removed and replaced by fresh RPMI complete medium. Cells were incubated for 24 h at 37 C before peptone treatment. RPMI complete medium was replaced with RPMI without FCS but containing 0.2% BSA in the presence or absence of peptones (2% meat hydrolysate, Sigma), as previously described (12), or with forskolin (10-5 M) or/and 3-isobutyl-1-methylxanthine (IBMX) (2.10-4 M). After a 16-h incubation at 37 C, cells were harvested in lysis buffer. Luciferase and renilla activities were measured using the Dual Luciferase kit (Promega Corp.), according to the manufacturer’s instructions.

Cotransfections with A-CREB and N4H-CGN4 expression vectors. Two hundred fifty nanograms of pGL3basic/CCK-144 plasmid DNA were mixed with various concentrations (250 ng, 50 ng, 10 ng, or 5 ng) of pRc/CMV500/A-CREB, pRc/CMV566/N4H-CGN4, pRc/CMV500, or pRc/CMV566 expression vectors, in the presence of 1 µl escort reagent. Transfection was then performed as described above.

EMSA
Nuclear extracts from STC-1 cells were prepared as previously described (17). EMSA was performed essentially as described elsewhere (Pollack, R. M., 17A ). Briefly, oligonucleotides were labeled using T4 polynucleotide kinase (Promega Corp.) and [{gamma}-P32]-ATP (Amersham Pharmacia Biotech) and then purified using Spin 10 columns (Sigma). The standard binding reaction contained the following components in a final vol of 20 µl (4% glycerol; 1 mM MgCl2; 0.5 mM EDTA; 50 mM NaCl; 10 mM Tris, pH 7.5; 1 µg polydI.dC; and 5–20 µg nuclear extract). After a 20-min incubation at room temperature, 4 x 104 cpm of probe were added, and the mixture was incubated for 20 min at room temperature before migration on a 4% polyacrylamide/0.5 x TBE gel. The gel was then dried and subjected to autoradiography. In supershift experiments, 3 µl antibody were added to the standard reaction and incubated for 90 min on ice and for 20 min at room temperature before the probe was added.

Antibodies
Antibodies used in EMSA were purchased from Santa Cruz Biotechnology, Inc. (Tebu, Le Perray-en-Yvelines, France): polyclonal anti-FOS (no. sc-253x) broadly reacts with the FOS family of proteins; polyclonal anti-JUN (no. sc-44x) is broadly reactive with the JUN family of proteins; polyclonal anti-CREB-1 (no. sc-186x) reacts with CREB-1, ATF-1, and CREM-1 but not with other ATF/CREB factors; polyclonal anti-CREM-1 (no. sc-440x) has a partial cross-reactivity with the ATF/CREB proteins and other CREM isoforms; polyclonal anti-CREB-2 (no. sc-200x) reacts with ATF-4 but not with other ATF/CREB proteins; polyclonal anti-ATF3 (no. sc-188x) is noncross-reactive with other ATF/CREB transcription factors; monoclonal anti-ATF-1 (no. sc-243x) is specific for the ATF-1 p35; and polyclonal anti-USF-2 (no. sc-862x) reacts with USF-2 p44 but not with USF-1 p43.

The polyclonal anti-phospho-CREB antibody (no. 9191S, New England Biolabs, Inc., OZYME, Saint Quentin Yvelines, France) detects Ser133-phosphorylated CREB, but also the phosphorylated form of the CREB related proteins ATF-1 and CREM.

Western blot
Forty-eight hours before the experiments, STC-1 cells were seeded in 12-well culture plates (2.5 x 105 cells per well) in complete RPMI medium. After 24 h at 37 C, RPMI complete medium was replaced by RPMI medium containing only 0.5% FCS, and cells were then incubated for 24 h at 37 C before treatment. The treatments were performed in RPMI medium without FCS but contained 0.2% BSA and peptones or 10-5 M forskolin and 2 x 10-4 M IBMX. The cells were harvested after 30 min of treatment and washed in PBS, and cellular pellets were lysed by the addition of 80 µl solubilization buffer (50 mM HEPES, pH 7.5; 150 mM NaCl; 100 mM NaF; 10 nM EDTA); 10 mM Na4P2O7; 2 mM sodium vanadate; 0.2 mg/ml phenylmethylsulfonylfluoride; 20 mM leupeptin; 100 IU/ml aprotinin; and 1% Triton X-100. Twenty-five micrograms of protein extracts were boiled for 5 min in the presence of the loading buffer (15 mM Tris, 2% SDS, 10% glycerol, 5% ß-mercaptoethanol, and 0.16% bromophenol blue) before being separated on a 10% SDS/polyacrylamide gel and transferred to Protran nitrocellulose membrane (Schleicher & Schuell, Inc./Céra-Labo, Ecquevilly, France). After blocking with 5% nonfat dry milk in washing buffer (10 mM Tris, pH 7.5; 100 mM NaCl; 0.1% Tween 20) for 1–2 h at 4 C, membranes were incubated with anti-CREB-1 antibody (sc-186x, dilution 1/5000) or with anti-phospho-CREB/ATF-1 antibody (no. 9191S, dilution 1/1000), in blocking solution overnight at 4 C. After three washes, the membranes were incubated for 3 h at 4 C with conjugated antirabbit IgG-horseradish peroxidase antibody (Jackson ImmunoResearch Laboratories, Inc./Interchim, Montluçon, France, dilution 1/3000), in blocking solution. The membranes were then washed three times, and detection was performed using the enhanced chemiluminescent method (ECL, Pierce Chemical Co., Rockford, IL) according to the manufacturer’s instructions.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Localization of the PepRE in the first 144 bp of the CCK promoter
To localize the DNA sequence(s) essential to confer peptone-responsiveness to the 800-bp CCK promoter fragment, a series of 5'-3'-deleted CCK fragments (from -795 bp to -144 bp) were fused to the firefly luciferase reporter gene in the pGL3 basic vector (constructs pGL3basic/CCK-765 to -144), before being transiently transfected in the STC-1 cells then treated or not with peptones. All the CCK promoter fragments tested did possess a transcriptional activity above the pGL3 basic control vector. Peptones exhibited a small basal transcriptional effect upon the pGL3 basic vector that was reflected by a basal increase of the luciferase/renilla activity (Fig. 1aGo). However, peptone treatment clearly induced a specific transcriptional stimulation of the CCK promoter fragments. This stimulation was reflected by an increase of the luciferase/renilla activity in peptone-treated cells, up to 300–400% of the activity obtained in nontreated cells (about 3- to 4-fold increase). This peptone-induced activation was observed with all the promoter fragments tested and did not decrease as the promoter was deleted in 5' down to -144 bp, indicating that the putative PepRE was localized in these first -144 bp of the promoter.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Effect of 5' deletions on the peptone-induced activation of CCK promoter. STC-1 cells were transiently cotransfected with the plasmid pRLTK used as an internal control and with the pGL3basic promoterless vector (pGL3 b) or with the series of CCK deletion constructs from -765 to -144 bp (Fig. 1aGo) and -144 to -28 bp (Fig. 1bGo). The luciferase and renilla activities were measured after a 16-h incubation period without ({square}) or with peptones ({blacksquare}). The results are presented as the percentage of the ratio R = luciferase activity/renilla activity obtained when the construct pGL3basic/CCK-765 was transfected in unstimulated STC-1 cells, and represent the mean ± SEM of at least six experiments using two different stocks of plasmids. In Fig. 1bGo, the ratio R was normalized to the values obtained after transfection of the pGL3basic promoterless vector in STC-1 cells. Statistical significance symbolized with an asterisk was assessed using two-ways ANOVA followed by t test, using Statview Windows software. Differences were considered significant when P < 0.05.

 
Identification of the PepRE spanning from -93 to -70
To identify the PepRE in the first -144 bp of the CCK promoter, serial 5'-3'-deleted promoter fragments [from -144 bp to -28 bp, excluding each time a consensus site for a transcription factor, were fused to the luciferase reporter gene in the pGL3 basic vector (constructs pGL3basic/CCK-105, -93, -70, -50 and -28)] and then transiently transfected in STC-1 cells, subsequently treated or not with peptones. The transcriptional activity of the promoter fragments was maintained over the pGL3basic control vector, even using only the first 28 bp of the promoter (Fig. 1aGo). Peptones induced a specific and significant transcriptional stimulation of the CCK promoter constructs pGL3basic/CCK-765, -144, -105, and -93 (about 3.0- to 3.8-fold increase). Interestingly, deletion of the CCK promoter region between -93 bp and -70 bp resulted in the complete loss of the CCK-specific peptone-induced transcriptional activation that returned to its basal level. These results indicated that a DNA element essential to confer peptone responsiveness to the CCK promoter was located between -93 bp and -70 bp. Because the CCK AP1/CRE consensus binding site was deleted to give the -70-bp fragment, we inferred that the PepRE could overlap this site.

Systematic site-directed mutagenesis shows that the core PepRE sequence overlaps the putative AP1/CRE site
Systematic site-directed mutagenesis (6-bp overlapping mutations) between -90 and -63 bp was performed to identify precisely the cis-acting sequence(s) that conferred peptone inducibility to CCK promoter fragments. The CCK promoter construct pGL3basic/CCK-93, (containing the wild-type -93 promoter fragment) or constructs pGL3basic/CCK-93 m1 to m8 (containing mutated -93 derived fragments, see Fig. 3Go) were transiently transfected in the STC-1 cells then treated or not with peptones. When the construct pGL3basic/CCK-93-m4 (containing a -75/-82-bp mutated sequence) was transfected, the peptone-induced stimulation was abolished and returned to the basal stimulation observed with pGL3basic control vector (Fig. 2aGo). The transcriptional stimulation induced by the peptones was also largely decreased with the mutations m3 and m5, although remaining significant. As mutations moved from these sites to the positions -90 or -63 bp, progressively the peptone-induced activation of CCK promoter fragments was completely restored. These observations indicated that the core of the PepRE was located between nucleotides -72 and -83. This 12-bp sequence overlaps the previously described AP1/CRE site in the CCK promoter. Interestingly, when the AP1cons construct, which was designed to have a wild-type AP1 consensus site, was transfected, peptone-induced stimulation was abolished (Fig. 2bGo).



View larger version (64K):
[in this window]
[in a new window]
 
Figure 3. Characterization of the protein complexes binding to the CCK PepRE element. a, Sequence of the CCK PepRE is compared with those of AP1 and CRE consensus sites. b, An EMSA was performed using a labeled oligonucleotide containing the CCK PepRE sequence and 20 µg STC-1 cell nuclear extracts. Competition experiments were performed in absence (-) or in presence of 100x and 500x molar excesses of the following cold oligonucleotides: CCK PepRE (PepRE), AP1 consensus binding site (AP1), PepRE oligonucleotide with a 6-bp mutation located in the PepRE sequence (Pepmut), a CREB consensus binding site (CRE), CCK promoter E1 and SP1 site (SP), and sucrase isomaltase cdx-2 site (cdx). The labeled oligonucleotide/protein complex detected (C1) and the nonbound probe (free PepRE) are indicated.

 
Characterization of the transcription factors binding to the CCK PepRE
The CCK PepRE core sequence (Fig. 3aGo) can be considered: first, as an AP1 consensus site in which a C has been substituted to the A in the third position; second, as a CRE consensus site in which the A in the third position has been deleted. Using EMSA, we compared the protein complexes binding to the PepRE with those binding to AP1 or CRE consensus sites. Using 20 µg of STC-1 nuclear extracts, we first observed that an oligonucleotide containing the PepRE bound only one specific complex (C1), which did not disappear in competition experiments with a 500x excess of cold nonrelated oligonucleotides, e.g. E1, SP1, or cdx (Fig. 3bGo). The C1 complex was also not competed in the presence of a 500x excess of cold PepREmut oligonucleotide, indicating that a 6-bp mutation overlapping the putative AP1/CRE site abolished the binding of the factors present in this complex. The C1 complex disappeared entirely in the presence of a 100x excess of cold CRE consensus oligonucleotide but only partially in the presence of a 100x excess of cold AP1 consensus oligonucleotide, demonstrating that factors in the C1 complex had a greater affinity to the CRE consensus sequence than to the AP1 consensus sequence.

We then characterized the factors in the C1 complex, with the use in the EMSA binding reactions of a series of antibodies directed against known families of transcription factors (FOS, JUN, CREB/ATF, USF). First, when the AP1 consensus oligonucleotide was used as probe in the binding reactions, with 20 µg STC-1 nuclear extracts, one major and specific complex (C2) was detected (Fig. 4Go). The binding of this C2 complex was dramatically decreased when antibodies directed against proteins of the FOS or JUN families were added to the binding reactions but not with the other antibodies tested. Second, when the CRE consensus oligonucleotide was used as probe in the binding reactions, with only 5 µg STC-1 nuclear extracts, we detected a major C3 complex and a minor (C4) one, (Fig. 4Go). When the polyclonal anti-CREB-1 antibody directed against the proteins of the CREB family was added, the binding of the C3 complex was dramatically impaired. C3 or C4 complexes were not affected by incubation with the other antibodies tested. Finally, the binding of the C1 complex was affected only by the incubation with the anti-CREB-1 antibody, but not with the other one tested (Fig. 4Go), although the experimental conditions were strictly identical, indicating, thus, that the PepRE only bound transcription factors of the CREB family and not those of the FOS and JUN families.



View larger version (68K):
[in this window]
[in a new window]
 
Figure 4. Identification of the transcription factors in the C1 complex. An EMSA was performed using, as probes, oligonucleotides corresponding (respectively) to the AP1 consensus binding site, the PepRE sequence, and the CREB consensus binding site, with (respectively) 20 µg, 20 µg, and 5 µg STC-1 cell nuclear extracts. Antibodies directed against the transcription factors ATF-3, FOS, JUN, CREB-1, and USF-2 were incubated with the nuclear extracts before the probe was added. The labeled oligonucleotide/protein complexes detected with each probe (respectively, C2, C1, and C3/C4) and the nonbound probes (free) are indicated.

 
A CREB dominant negative protein (A-CREB) inhibits peptone-induced stimulation of CCK promoter transcription
To test the functional relevance of the CREB family of transcription factors in the peptone-induced trancriptional effect, we transiently overexpressed in STC-1 cells a dominant negative inhibitor of the CREB protein (A-CREB), and we evaluated the impact of its ectopic expression on the peptone-induced transcriptional activation of the CCK promoter. Overexpression of the A-CREB protein dose-dependently abolished the peptone-induced transcriptional activation of the pGL3basic/CCK-144 promoter construct (Fig. 5Go). The A-CREB effect disappeared as the quantity of transfected A-CREB expression vector decreased from 250 ng to 2 ng. Moreover, a dominant negative inhibitor of the yeast factor CGN4 had no effect on the transcriptional response of pGL3basic/CCK-144 to the peptone treatment. We concluded that transcription factors of the CREB family play a major role in the transcriptional response of CCK promoter to peptones.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 5. Inhibition of peptone-induced activation of CCK promoter after overexpression of a dominant negative inhibitor of CREB protein (A-CREB). STC-1 cells were cotransfected with 250 ng of the CCK promoter construct pGL3basic/CCK-144 and with 250 ng, 50 ng, 10 ng, or 2 ng pRc/CMV (pCMV), c/CMV/A-CREB (pA-CREB), or pRc/CMV/N4H-CGN4 (pcGN4) expression vectors. Luciferase activity was measured after a 16-h incubation period without ({square}) or with peptones ({blacksquare}). The results are presented as percentage of the basal luciferase activity obtained when the pGL3basic/CCK-144 construct was cotransfected with the pRc/CMV control vector in unstimulated STC-1 cells and represent the mean ± SEM of at least six experiments using two different stocks of plasmids.

 
What is the link between peptones and the CREB family of transcription factors?
Because the CREB family of transcription factors was implicated in the transcriptional response of the CCK promoter to peptones, we tested whether peptones could modify the nature, or the quantity, of proteins bound to the PepRE. In a first set of EMSA, we ana1yzed the nature of the complexes bound to the PepRE in nuclear extracts from STC-1 cells treated with peptones, in comparison with nuclear extracts from nontreated cells. Apparently, the same complex (C1) was detected with the two types of extracts and competed identically in the presence of cold PepRE and CRE oligonucleotides (Fig. 6aGo). Because the anti-CREB-1 antibody used in the previous experiments was broadly reactive with CREB-1, ATF-1, and CREM-1 proteins, we tested here the effect of more specific polyclonal antibodies directed individually against the proteins CREM-1, CREB-2, ATF-3 and of a monoclonal antibody directed against ATF-1. The anti-CREM-1 antibody partially shifted the C1 complex, whereas anti-ATF-1, -CREB-2, and -ATF-3 antibodies had no effect (Fig. 6bGo), indicating that the C1 complex contained CREB-1 and CREM-1 (but not ATF-1, ATF-3, or CREB-2) proteins. Moreover, we were unable to detect any modification of the proteins contained in the C1 complex using the nuclear extracts of STC-1, either treated or nontreated with peptones. We concluded that peptones apparently did not modify the nature and the abundance of the transcription factors bound to the PepRE, suggesting a posttranslational modification of these factors.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 6. Comparison of the complexes binding to the PepRE in nuclear extracts of STC-1 cells treated or not with peptones. An EMSA was performed using the labeled PepRE oligonucleotide as probe and 20 µg of nuclear extracts from STC-1 cells treated or nontreated with peptones. a, Competition experiments were performed in absence (-) or in presence of 100x and 500x molar excesses of the cold PepRE and CREB consensus oligonucleotides. b, Polyclonal antibodies directed against the transcription factors CREB-1, CREM-1, CREB-2, ATF-3, and monoclonal anti-ATF-1 antibody were added to the binding reaction before the probe itself. The labeled oligonucleotide/protein complex detected (C1) is indicated.

 
We thus examined whether cellular exposure to peptones could be associated with a phosphorylation of CREB/CREM factors. The hypothesis was tested using Western blot analysis and an antibody specific for the serine-133-phosphorylated form of CREB and the serine-63-phosphorylated form of ATF-1. The results indicated that treatment of STC-1 cells with peptones did increase the phosphorylation of the two proteins p43-CREB and p35-ATF-1, to a level equivalent to that obtained on forskolin/IBMX treatment (Fig. 7aGo). As a control, using the same protein samples, the quantity of CREB proteins detected in parallel with the polyclonal anti-CREB antibody was not modified after those treatments.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 7. a, Western Blot analysis of CREB/ATF-1 and phosphoCREB/phosphoATF-1 proteins present in peptone-treated STC-1 cells. Western blot analysis was performed on 25 µg of cellular extracts from STC-1 cells either nontreated (-), treated with peptones (Pep), or treated with forskolin (FK), using for detection either anti-phospho-CREB/ATF-1 or anti-CREB-1 antibodies. b, Transcriptional effect of forskolin and IBMX on the CCK promoter: STC-1 cells were cotransfected with the plasmid pRLTK used as an internal control and with the CCK construct pGL3basic/CCK-144. The luciferase and renilla activities were measured after an 8-h ({square}) or 16-h ({blacksquare}) incubation period in absence (nontreated) or in presence of FK, or of IBMX, or of forskolin and IBMX (FK/IBMX). The results are presented in Fig. 1Go.

 
Interestingly, we observed, in parallel, that treatment of STC-1 cells with forskolin/IBMX mimicked the transcriptional activation induced after peptone-treatment (Fig. 7bGo). In the presence of forskolin/IBMX, CCK promoter activity was stimulated up to 300–400% of the activity observed in nontreated cells, as in the presence of peptones (see Figs. 1Go, 2Go, and 3).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We previously reported that exposure of the enteroendocrine cell line STC-1 to peptones induced the transcriptional stimulation of the two major intestinal hormone genes, namely those of CCK and proglucagon (12, 18). The work presented in this report focuses on the identification of the cis- and trans-acting elements, which are involved in the transcriptional regulation of CCK gene expression by peptones in this intestinal endocrine cell line.

Although nutrients are major regulators of intestinal hormone secretion in vivo, peptones are the first transcriptional stimulus to be described that acts in situ at the apical pole of the cell. Transcriptional stimulation of CCK gene transcription by peptones was quite reproducible in our experiments although moderate. Forskolin and bFGF were previously described to increase CCK gene transcription in a neuroblastoma cell line with a similar efficiency (9). The cis-acting DNA element, which is essential to confer peptone-responsiveness to the CCK promoter (designated PepRE), maps to nucleotides -93 to -70 upstream of the transcription initiation site. The location of the PepRE was first determined using serial 5'-3' deletions. Because all the deletions down to -93 bp did not modify the level of the transcriptional response to peptones, we inferred that the sequences between -765 and -93 bp did not directly contribute to the activation. Deletion of the region between -93 and -70 bp completely abolished the sensitivity to peptone treatment, demonstrating that a major cis-acting DNA element was present in this region. Mutations affecting the core 12-bp sequence between nucleotides -72 and -83, overlapping the putative AP1/CRE site, resulted in low and unregulated activity of CCK promoter. Moreover, mutation in this core region completely abolished transcription factor binding. We cannot exclude, nevertheless, that sequences flanking the core PepRE sequence could also play a role in the transcriptional response to peptones, because mutations in these sequences little affected the peptone responsiveness of the promoter fragments tested.

The CCK PepRE mimics a CRE consensus site. Its core sequence corresponds to an imperfect palindrome and functions as a low-affinity CREB binding site, as already described in the promoter of other genes such as tyrosine aminotransferase, urokinase plasminogen activator, or proenkephalin (19). Our results fit those previous observations. The C1 complex binding to the PepRE was competed with the best efficiency by a high-affinity CRE consensus site oligonucleotide corresponding to a perfect palindrome found in the promoter of several genes, e.g. somatostatin, {alpha}-CG, or fibronectin. Moreover, 20 µg STC-1 nuclear extracts were necessary to detect the C1 complex bound to the PepRE, whereas only 5 µg were sufficient to easily detect the C3 and C4 complexes bound to the CRE consensus site. Finally, the CCK PepRE sequence binds only factors of the CREB family in STC-1 cell nuclear extracts, but no factor of the FOS or JUN families, emphasizing that it cannot be considered as an AP1 binding site, although its sequence is very similar. Moreover, the expression construct designed to have a wild-type AP1 site lost the ability to be stimulated by peptones. Overexpression of FOS and JUN proteins in SK-N-MC cells was previously reported to stimulate CCK promoter transcription (7, 8, 9), but binding of these factors to the putative CCK AP1/CRE site, using SK-N-MC nuclear extracts, has not been demonstrated yet. Hence, the hypothesis that indirect mechanisms were implicated remains.

The functional relevance of the CREB family of transcription factors is clearly demonstrated. Overexpression of the dominant-negative protein A-CREB in STC-1 cells completely abolished the transcriptional response of the CCK promoter to peptones. A-CREB protein has been previously shown to function by preventing DNA binding of CREB proteins in a dimerization domain-dependent fashion (14, 15). A-CREB effect on the peptone-induced transcriptional response was very specific because: 1) it disappeared as the quantity of transfected A-CREB expression vector decreased from 250 ng to 2ng; and 2) a dominant negative inhibitor of the yeast bZIP factor GCN4 had no effect on the transcriptional response of pGL3basic/-144 to peptone treatment. The results emphasize that direct binding of CREB factors to the PepRE is a major requirement for the peptone-induced transcriptional activation. The nature and quantity of the factors bound to the PepRE apparently remain unchanged after peptone treatment, suggesting a posttranslational modification. We indeed detected an increased phosphorylation of p35-ATF-1and p43-CREB-1 proteins after the peptone treatment, like that detected after forskolin treatment. ATF-1 does not bind to the PepRE using STC-1 nuclear extracts; hence, the phosphorylation of CREB-1 (or CREM-1) is the only event that can be related to the transcriptional stimulation induced by the peptones. Phosphorylation of CREB at Ser-133 has been reported to induce complex formation with CREB-binding protein (CBP/p300) (20). Recruitment of such a coactivator could explain the transcriptional activation observed after peptone treatment, but this hypothesis remains to be demonstrated.

Peptones used in this study are fair counterparts of the protein fraction in the intestinal lumen, because initial digestion of proteins yields a mixture of amino acids and oligopeptides. We previously demonstrated that single amino acids or a mixture of them had no effect on transcription, suggesting that oligopeptides must be responsible for the transcriptional effect of peptones. To our knowledge, stimulation of gene transcription by the oligopeptide class of nutrients was not previously described. Glucose- and lipid-response elements have already been identified in gene promoters (21, 22, 23, 24). This is the first description of a protein hydrolysate-DNA response element, in particular in the promoter of an intestinal hormone gene. Further investigations will be necessary to establish whether the CCK PepRE could confer peptone-inducibility to a heterologous promoter. In particular, identification of the PepRE-like sequence in the proglucagon gene promoter, which we also demonstrated to be very sensitive to peptone stimulation (18), will indicate whether the same type of DNA sequence can be used in two different hormone genes for activation by peptones.

The transduction mechanisms responsible for the effects of peptones on STC-1 cells are actually largely unknown. Previous work in our laboratory (25) suggests that peptones, at least in part, must passively enter the endocrine cells, but the existence of a presently unknown specific oligopeptide receptor cannot be definitively excluded. Many kinases have been described to phosphorylate the CREB family of transcription factors, and further experiments will be necessary to identify those implicated in the peptone response. Recently, the p38 mitogen-activated protein kinase, the ERK mitogen-activated protein kinase, and the protein kinase A-signaling pathways were implicated in the phosphorylation of CREB factors and activation of the CCK promoter in SK-N-MC cells in response to bFGF and forskolin stimulation (9). It will be interesting to know whether peptone effects are mediated through one of these pathways or another specific one. We have observed that forskolin/IBMX treatment can mimic the effect of peptones on CCK promoter, but whether the same transduction pathways are set in action in these two situations remains also to be determined.

In conclusion, the present study demonstrates that CCK gene expression is under the control of protein-derived nutrients in the STC-1 enteroendocrine cell line. In vivo correlation between dietary stimulation of CCK secretion and transcription has been reported in rat (26) and human (27). We confirmed previously this correlation in vitro using peptones and the STC-1 cell line (12, 18). Moreover, we demonstrated that peptones act on hormone gene transcription in STC-1 and Glutag cell lines but not in the other lines tested. The transcriptional effect of peptones on CCK appears thus as a specific intestinal phenomenon. Although they remain to be definitively proven in vivo, the reported data fit with a physiological regulation, strengthened by several studies indicating that peptones are strong in vivo and ex vivo stimulants of the CCK release in some species, including rat, man, and pig (11, 28). The transcriptional stimulation of CCK promoter after peptone exposure is mediated via a specific DNA element that overlaps a CRE site and binds transcription factors of the CREB family. Moreover, peptone treatment stimulates the phosphorylation of CREB factors. Such a nutrient response DNA element located in a gene encoding an intestinal hormone has not been described previously. Hence, this work makes an original contribution in the understanding of the molecular mechanisms underlying the effects of nutrient derivatives on the regulation of intestinal hormone genes expression. The identification of the factor in peptones that acts to stimulate hormone secretion and transcription of promoter reporter genes remains an exciting challenge.


    Acknowledgments
 
We thank Beate Laser-Ritz, Jacques Philippe, Jacques Abello, Colette Roche, and Jean-Claude Cuber for critical reading of the manuscript and helpful suggestions.


    Footnotes
 
1 Contributed equally in the realization of the work. Back

Received July 24, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Liddle RA 1997 Cholecystokinin cells. Annu Rev Physiol 59:221–242[CrossRef][Medline]
  2. Walsh JH 1994 Cholecystokinin. In: Johnson LR (ed) Physiology of the Gastrointestinal Tract. Raven Press, New York, vol 3:49–67
  3. Takahashi Y, Fukushige S, Murotsu T, Matsubara K 1986 Structure of human cholecystokinin gene and its chromosomal location. Gene 50:353–360[CrossRef][Medline]
  4. Deschenes RJ, Haun RS, Funckes CL, Dixon JE 1985 A gene encoding rat cholecystokinin. Isolation, nucleotide sequence, and promoter activity. J Biol Chem 260:1280–1286[Abstract/Free Full Text]
  5. Monstein HJ, Folkesson R 1991 Phorbol 12-myristate-13-acetate (PMA) stimulates a differential expression of cholecystokinin (CCK) and c-fos mRNA in a human neuroblastoma cell line. FEBS Lett 293:145–148[CrossRef][Medline]
  6. Monstein HJ 1993 Identification of an AP-1 transcription factor binding site within the human cholecystokinin (CCK) promoter. Neuroreport 4:195–197[Medline]
  7. Nielsen FC, Pedersen K, Hansen TV, Rourke IJ, Rehfeld JF 1996 Transcriptional regulation of the human cholecystokinin gene: composite action of upstream stimulatory factor, Sp1, and members of the CREB/ATF- AP-1 family of transcription factors DNA. Cell Biol 15:53–63
  8. Rourke IJ, Hansen TV, Nerlov C, Rehfeld JF, Nielsen FC 1999 Negative cooperativity between juxtaposed E-box and cAMP/TPA responsive elements in the cholecystokinin gene promoter. FEBS Lett 448:15–18[CrossRef][Medline]
  9. Hansen TV, Rehfeld JF, Nielsen FC 1999 Mitogen-activated protein kinase and protein kinase A signaling pathways stimulate cholecystokinin transcription via activation of cyclic adenosine 3',5'-monophosphate response element-binding protein. Mol Endocrinol 13:466–475[Abstract/Free Full Text]
  10. Haun RS, Dixon JE 1990 A transcriptional enhancer essential for the expression of the rat cholecystokinin gene contains a sequence identical to the -296 element of the human c-fos gene. J Biol Chem 265:15455–15463[Abstract/Free Full Text]
  11. Cuber JC, Bernard G, Fushiki T, Bernard C, Yamanishi R, Sugimoto E, Chayvialle JA 1990 Luminal CCK-releasing factors in the isolated vascularly perfused rat duodenojejunum. Am J Physiol 259:G191–197
  12. Cordier-Bussat M, Bernard C, Haouche S, Roche C, Abello J, Chayvialle JA, Cuber JC 1997 Peptones stimulate cholecystokinin secretion and gene transcription in the intestinal cell line STC-1. Endocrinology 138:1137–1144[Abstract/Free Full Text]
  13. Kunkel TA 1985 Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc Natl Acad Sci U S A 82:488–492[Abstract/Free Full Text]
  14. Olive M, Krylov D, Echlin DR, Gardner K, Taparowsky E, Vinson C 1997 A dominant negative to activation protein-1 (AP1) that abolishes DNA binding and inhibits oncogenesis. J Biol Chem 272:18586–18594[Abstract/Free Full Text]
  15. Ahn S, Olive M, Aggarwal S, Krylov D, Ginty DD, Vinson C 1998 A dominant-negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos. Mol Cell Biol 18:967–977[Abstract/Free Full Text]
  16. Rindi G, Grant SG, Yiangou Y, Ghatei MA, Bloom SR, Bautch VL, Solcia E, Polak JM 1990 Development of neuroendocrine tumors in the gastrointestinal tract of transgenic mice. Heterogeneity of hormone expression. Am J Pathol 136:1349–1363[Abstract]
  17. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  18. Pollock RM 1998 DNA-protein interactions. In: Ausubel FA, Brent R (eds) Current Protocols in Molecular Biology. John Wiley & Sons, New York, pp 12.2.1–12.2.7
  19. Cordier-Bussat M, Bernard C, Levenez F, Klages N, Laser-Ritz B, Philippe J, Chayvialle JA, Cuber JC 1998 Peptones stimulate both the secretion of the incretin hormone glucagon- like peptide 1 and the transcription of the proglucagon gene. Diabetes 47:1038–1045[Abstract]
  20. Nichols M, Weih F, Schmid W, DeVack C, Kowenz-Leutz E, Luckow B, Boshart M, Schutz G 1992 Phosphorylation of CREB affects its binding to high and low affinity sites: implications for cAMP induced gene transcription. EMBO J 11:3337–3346[Medline]
  21. Parker D, Ferreri K, Nakajima T, LaMorte VJ, Evans R, Koerber SC, Hoeger C, Montminy MR 1996 Phosphorylation of CREB at Ser-133 induces complex formation with CREB-binding protein via a direct mechanism. Mol Cell Biol 16:694–703[Abstract]
  22. Clarke SD, Abraham S 1992 Gene expression: nutrient control of pre- and posttranscriptional events. FASEB J 6:3146–3152[Abstract]
  23. Mitanchez D, Doiron B, Chen R, Kahn A 1997 Glucose-stimulated genes and prospects of gene therapy for type I diabetes. Endocr Rev 18:520–540[Abstract/Free Full Text]
  24. Schoonjans K, Staels B, Auwerx J 1996 Role of the peroxisome proliferator-activated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression. J Lipid Res 37:907–925[Abstract]
  25. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM 1994 mPpar gamma 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8:1224–1234[Abstract/Free Full Text]
  26. Nemoz-Gaillard E, Bernard C, Abello J, Cordier-Bussat M, Chayvialle JA, Cuber JC 1998 Regulation of cholecystokinin secretion by peptones and peptidomimetic antibiotics in STC-1 cells. Endocrinology 139:932–938[Abstract/Free Full Text]
  27. Liddle RA, Carter JD, McDonald AR 1988 Dietary regulation of rat intestinal cholecystokinin gene expression. J Clin Invest 81:2015–2019
  28. Bentouimou N, Leray V, Zerbib F, Blottiere HM, Galmiche JP, Bruley des Varannes S 1995 Expression of the gene of cholecystokinin. Demonstration from duodenal biopsies in man. Gastroenterol Clin Biol 19:659–663[Medline]
  29. Li Y, Owyang C 1996 Peptone stimulates CCK-releasing peptide secretion by activating intestinal submucosal cholinergic neurons. J Clin Invest 97:1463–1470[Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. Choi, M. Lee, A. L. Shiu, S. J. Yo, G. Hallden, and G. W. Aponte
GPR93 activation by protein hydrolysate induces CCK transcription and secretion in STC-1 cells
Am J Physiol Gastrointest Liver Physiol, May 1, 2007; 292(5): G1366 - G1375.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. C. Chen, S. V. Wu, J. R. Reeve Jr., and E. Rozengurt
Bitter stimuli induce Ca2+ signaling and CCK release in enteroendocrine STC-1 cells: role of L-type voltage-sensitive Ca2+ channels
Am J Physiol Cell Physiol, October 1, 2006; 291(4): C726 - C739.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
N. P. Darcel, A. P. Liou, D. Tome, and H. E. Raybould
Activation of Vagal Afferents in the Rat Duodenum by Protein Digests Requires PepT1
J. Nutr., June 1, 2005; 135(6): 1491 - 1495.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. M. Lay, G. Bane, C. S. Brunkan, J. Davis, L. Lopez-Diaz, and L. C. Samuelson
Enteroendocrine cell expression of a cholecystokinin gene construct in transgenic mice and cultured cells
Am J Physiol Gastrointest Liver Physiol, February 1, 2005; 288(2): G354 - G361.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-C. Gevrey, M. Cordier-Bussat, E. Nemoz-Gaillard, J.-A. Chayvialle, and J. Abello
Co-requirement of Cyclic AMP- and Calcium-dependent Protein Kinases for Transcriptional Activation of Cholecystokinin Gene by Protein Hydrolysates
J. Biol. Chem., June 14, 2002; 277(25): 22407 - 22413.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Nian, J. Gu, D. M. Irwin, and D. J. Drucker
Human glucagon gene promoter sequences regulating tissue-specific versus nutrient-regulated gene expression
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2002; 282(1): R173 - R183.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bernard, C.
Right arrow Articles by Cordier-Bussat, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bernard, C.
Right arrow Articles by Cordier-Bussat, M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals