| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Institut National de la Santé et de la Recherche Médicale U45 (C.B., A.S., C.R., J.-A.C., M.C-B.), Hôpital Edouard Herriot, 69437 Lyon, France; Elève de lEcole Pratique des Hautes Etudes (A.S.); and Laboratory of Metabolism (C.V.), National Cancer Institute, National Institutes of Health, Bethesda, Maryland, 20892
Address all correspondence and requests for reprints to: Dr. Martine Cordier-Bussat, INSERM U45, Hôpital Edouard Herriot, Pavillon Hbis, 69437 Lyon Cedex 03, France. E-mail: cordier{at}lyon151.inserm.fr
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The CCK complementary DNA has been cloned in several species, including human (3) and rat (4). The same gene transcript of approximately 750 bp is expressed in the intestine and in the nervous system. Despite the physiological relevance of the peptide, the factors involved in the regulation of CCK gene transcription are little known. Previous studies concerned the transcriptional expression in nervous tissue, especially in neuroblastoma cell lines (5, 6, 7, 8, 9). The proximal upstream regulatory region of the CCK gene exhibits functional elements highly conserved in evolution: an SP1 site located close to the putative TATA box; and an AP-1/TRE/CRE element located approximately 80 bp upstream of the transcription initiation site and flanked by two E-box (E1 and E2) motifs (7, 10). Recent studies have shown that both the basic fibroblast growth factor (bFGF) and forskolin stimulate CCK gene promoter via the CRE/TRE site in the human SK-N-MC neuroblastoma cell line (9) and that factors associated with the most 5' E1 motif exhibit a negative cooperative effect on the activation via the CRE/TRE element (8).
Nothing has been reported yet on the regulation of CCK gene in the intestine. That the functional elements identified in nervous tissue are operating as well in the enteroendocrine cells is likely but not proven. In addition, agents stimulating CCK-storing sites clearly differ in the central nervous system and in the gut. Indeed, intestinal endocrine cells are polarized epithelial cells, with their apical pole in direct contact with the intestinal lumen and with the alimentary chyme. Although it is well established that nutrients stimulate CCK secretion in vivo, the contribution of each class of nutrients to CCK secretion is still not well defined, nor are the cellular and molecular mechanisms implicated in this hormonal res-ponse. Digestion of proteins mainly yields amino acids and oligopeptides. Peptones are fair counterparts of the protein fraction in the intestinal lumen. We have demonstrated previously that peptones not only stimulate CCK secretion in vivo but also ex vivo in the model of isolated vascularly perfused rat intestine (11) and in vitro in the intestinal enteroendocrine cell line STC-1 (12), suggesting a direct effect of peptones on endocrine cells. Recently, we have shown that peptones stimulate CCK gene transcription in STC-1 cells (12). The cis-acting DNA element(s) conferring peptone inducibility to the CCK promoter [peptone-response element (PepRE)] was preliminary located within the first 800 bp upstream of the transcription initiation site (12). In the present study, we report the identification of the PepRE and the characterization of transcription factors implicated in the peptone-induced activation of CCK gene transcription.
| Materials and Methods |
|---|
|
|
|---|
Cloning of the CCK promoter subfragments -105, -93, -71,-50, and -28 into pGL3basic. An oligonucleotide with a Bgl2 restriction site in its 3' extremity, containing the CCK promoter sequence from +40 to -28 bp, was coligated with a series of oligonucleotides possessing KpnI sites in their 5' extremities and containing the CCK promoter sequences from -28 to -51 bp, from -28 to -71 bp, from -28 to -93 bp, or from -28 to -105 bp, into the KpnI and Bgl2 restriction sites of pGL3basic.
Site-directed mutagenesis. Systematic site-directed
mutagenesis between -93 and -70 bp was performed as previously
described (13). Briefly, single-stranded plasmid DNA was
obtained from pGL3/CCK-93 in CJ236 bacteria (Invitrogen,
Groningen, The Netherlands) using the M13K07 helper bacteriophage
(Promega Corp.). Overlapping 25- to 30-bp oligonucleotides
complementary to the CCK promoter sequence between -93 and -70 bp,
except over 6 bp, corresponding to transversions described in Fig. 2
, were hybridized to the single-stranded pGL3/CCK-93 template, before
complementary strand synthesis using T4 DNA polymerase and T4 DNA
ligase (Promega Corp.). The AP1cons pGL3/CCK144 mutant was
obtained, following the instructions of the manufacturer, using the Tfu
Direct site-directed mutagenesis kit (Appligene, Q-Biogene, Illkirch,
France). Mutant plasmids were selected by specific hybridization with
labeled mutated oligonucleotides and were controlled by DNA sequencing
using the sequenase version 2.0 DNA kit (USB, Amersham Pharmacia Biotech/Pharmacia Biotech Europe, Orsay,
France).
|
Oligonucleotides
Oligonucleotides for site-directed mutagenesis and
electrophoretic motility shift assay (EMSA) were purchased and
were purified using reverse-phase chromatography (Eurogentec,
Seraing, Belgium). Sequences of the CCK promoter-related
oligonucleotides were as follows. PepRE: 5'
CGGACTGCGTCAGCACTGGGG 3'; PepRE mut: 5'
GCCGGACTGTACACTCACTGGG 3'; E1: 5'
CTCTGAGCACGTGTCCTGCC 3'; SP1: 5'
GCGTACCGGGCGGGGCTACGTAC 3'.
AP1 and CRE consensus oligonucleotides were purchased from Promega Corp. and their sequences were as follows. AP1 consensus: 5'CGCTTGATGAGTCAGCCGGAA3'; CREB consensus: 5' AGAGATTGCCTGACGTCAGAGAGCTAG3'.
CDX oligonucleotide corresponds to cdx-2 binding site in the sucrase isomaltase gene promoter. It was purchased from Isoprim (Toulouse, France) and its sequence was as follows. CDX: 5' GTGCAATAAAACTTTATGAGTA 3'.
Cell culture and transfections
The STC-1 plurihormonal cell-line was derived by Rindi et
al. (16) from an endocrine tumor that developed in
the small intestine of a double transgenic mouse expressing viral
oncogenes under the control of the insulin promoter. It was provided by
Dr. A. B. Leiter (Department of Medicine, New England Medical
Center, Boston, MA). STC-1 cells were cultured in RPMI 1640 medium
(Life Technologies, Inc., Cergy-Pontoise, France)
containing 5% FCS, and supplemented with penicillin (100 IU/ml) and
streptomycin (50 µM). Transfection experiments
were performed using the Escort lipofection protocol
(Sigma, Saint-Quentin-Fallavier, France). Briefly, 48
h before transfection, STC-1 cells were seeded in 24-well culture
plates (8 x 104 cells per well). For each
well, 250 ng plasmid DNA was mixed with 0.5 µl escort reagent in 100
µl RMPI 1640 medium without FCS. In all transfection experiments, a
plasmid with a renilla reporter gene under the control of a thymidine
kinase promoter (pRL-TK, Promega Corp.) was used as an
internal control (25 ng pRL-TK per well). The DNA/escort mixture was
incubated 1530 min at room temperature before addition of 400 µl
RPMI 1640 with 5% FCS. This mixture was incubated 56 h with the
cells at 37 C. The escort/plasmid DNA mixture was then removed and
replaced by fresh RPMI complete medium. Cells were incubated for
24 h at 37 C before peptone treatment. RPMI complete medium was
replaced with RPMI without FCS but containing 0.2% BSA in the presence
or absence of peptones (2% meat hydrolysate, Sigma), as
previously described (12), or with forskolin
(10-5
M) or/and 3-isobutyl-1-methylxanthine (IBMX)
(2.10-4
M). After a 16-h incubation at 37 C, cells were
harvested in lysis buffer. Luciferase and renilla activities were
measured using the Dual Luciferase kit (Promega Corp.),
according to the manufacturers instructions.
Cotransfections with A-CREB and N4H-CGN4 expression vectors. Two hundred fifty nanograms of pGL3basic/CCK-144 plasmid DNA were mixed with various concentrations (250 ng, 50 ng, 10 ng, or 5 ng) of pRc/CMV500/A-CREB, pRc/CMV566/N4H-CGN4, pRc/CMV500, or pRc/CMV566 expression vectors, in the presence of 1 µl escort reagent. Transfection was then performed as described above.
EMSA
Nuclear extracts from STC-1 cells were prepared as previously
described (17). EMSA was performed essentially as
described elsewhere (Pollack, R. M., 17A ). Briefly,
oligonucleotides were labeled using T4 polynucleotide kinase
(Promega Corp.) and [
-P32]-ATP
(Amersham Pharmacia Biotech) and then purified using Spin
10 columns (Sigma). The standard binding reaction
contained the following components in a final vol of 20 µl (4%
glycerol; 1 mM MgCl2; 0.5
mM EDTA; 50 mM NaCl; 10
mM Tris, pH 7.5; 1 µg polydI.dC; and 520 µg
nuclear extract). After a 20-min incubation at room temperature, 4
x 104 cpm of probe were added, and the mixture
was incubated for 20 min at room temperature before migration on a 4%
polyacrylamide/0.5 x TBE gel. The gel was then dried and
subjected to autoradiography. In supershift experiments, 3 µl
antibody were added to the standard reaction and incubated for 90 min
on ice and for 20 min at room temperature before the probe was
added.
Antibodies
Antibodies used in EMSA were purchased from Santa Cruz Biotechnology, Inc. (Tebu, Le Perray-en-Yvelines,
France): polyclonal anti-FOS (no. sc-253x) broadly reacts with
the FOS family of proteins; polyclonal anti-JUN (no. sc-44x) is
broadly reactive with the JUN family of proteins; polyclonal
anti-CREB-1 (no. sc-186x) reacts with CREB-1, ATF-1, and CREM-1 but
not with other ATF/CREB factors; polyclonal anti-CREM-1 (no. sc-440x)
has a partial cross-reactivity with the ATF/CREB proteins and other
CREM isoforms; polyclonal anti-CREB-2 (no. sc-200x) reacts with ATF-4
but not with other ATF/CREB proteins; polyclonal anti-ATF3 (no.
sc-188x) is noncross-reactive with other ATF/CREB transcription
factors; monoclonal anti-ATF-1 (no. sc-243x) is specific for the ATF-1
p35; and polyclonal anti-USF-2 (no. sc-862x) reacts with USF-2 p44 but
not with USF-1 p43.
The polyclonal anti-phospho-CREB antibody (no. 9191S, New England Biolabs, Inc., OZYME, Saint Quentin Yvelines, France) detects Ser133-phosphorylated CREB, but also the phosphorylated form of the CREB related proteins ATF-1 and CREM.
Western blot
Forty-eight hours before the experiments, STC-1 cells were
seeded in 12-well culture plates (2.5 x 105
cells per well) in complete RPMI medium. After 24 h at 37 C, RPMI
complete medium was replaced by RPMI medium containing only 0.5% FCS,
and cells were then incubated for 24 h at 37 C before treatment.
The treatments were performed in RPMI medium without FCS but contained
0.2% BSA and peptones or
10-5 M
forskolin and 2 x
10-4 M IBMX.
The cells were harvested after 30 min of treatment and washed in PBS,
and cellular pellets were lysed by the addition of 80 µl
solubilization buffer (50 mM HEPES, pH 7.5; 150
mM NaCl; 100 mM NaF; 10 nM EDTA);
10 mM Na4P2O7; 2
mM sodium vanadate; 0.2 mg/ml phenylmethylsulfonylfluoride;
20 mM leupeptin; 100 IU/ml aprotinin; and 1% Triton X-100.
Twenty-five micrograms of protein extracts were boiled for 5 min in the
presence of the loading buffer (15 mM Tris, 2% SDS, 10%
glycerol, 5% ß-mercaptoethanol, and 0.16% bromophenol blue) before
being separated on a 10% SDS/polyacrylamide gel and transferred to
Protran nitrocellulose membrane (Schleicher & Schuell, Inc./Céra-Labo, Ecquevilly, France). After blocking with
5% nonfat dry milk in washing buffer (10 mM Tris, pH 7.5;
100 mM NaCl; 0.1% Tween 20) for 12 h at 4 C, membranes
were incubated with anti-CREB-1 antibody (sc-186x, dilution 1/5000) or
with anti-phospho-CREB/ATF-1 antibody (no. 9191S, dilution 1/1000), in
blocking solution overnight at 4 C. After three washes, the membranes
were incubated for 3 h at 4 C with conjugated antirabbit
IgG-horseradish peroxidase antibody (Jackson ImmunoResearch Laboratories, Inc./Interchim, Montluçon, France, dilution
1/3000), in blocking solution. The membranes were then washed three
times, and detection was performed using the enhanced chemiluminescent
method (ECL, Pierce Chemical Co., Rockford, IL) according
to the manufacturers instructions.
| Results |
|---|
|
|
|---|
|
Systematic site-directed mutagenesis shows that the core PepRE
sequence overlaps the putative AP1/CRE site
Systematic site-directed mutagenesis (6-bp overlapping mutations)
between -90 and -63 bp was performed to identify precisely the
cis-acting sequence(s) that conferred peptone inducibility to CCK
promoter fragments. The CCK promoter construct pGL3basic/CCK-93,
(containing the wild-type -93 promoter fragment) or constructs
pGL3basic/CCK-93 m1 to m8 (containing mutated -93 derived fragments,
see Fig. 3
) were transiently transfected in the STC-1 cells then
treated or not with peptones. When the construct pGL3basic/CCK-93-m4
(containing a -75/-82-bp mutated sequence) was transfected, the
peptone-induced stimulation was abolished and returned to the basal
stimulation observed with pGL3basic control vector (Fig. 2a
). The transcriptional stimulation
induced by the peptones was also largely decreased with the mutations
m3 and m5, although remaining significant. As mutations moved from
these sites to the positions -90 or -63 bp, progressively the
peptone-induced activation of CCK promoter fragments was
completely restored. These observations indicated that the core
of the PepRE was located between nucleotides -72 and -83. This 12-bp
sequence overlaps the previously described AP1/CRE site in the CCK
promoter. Interestingly, when the AP1cons construct, which was designed
to have a wild-type AP1 consensus site, was transfected,
peptone-induced stimulation was abolished (Fig. 2b
).
|
We then characterized the factors in the C1 complex, with the use in
the EMSA binding reactions of a series of antibodies directed against
known families of transcription factors (FOS, JUN, CREB/ATF, USF).
First, when the AP1 consensus oligonucleotide was used as probe in the
binding reactions, with 20 µg STC-1 nuclear extracts, one major and
specific complex (C2) was detected (Fig. 4
). The binding of this C2 complex was
dramatically decreased when antibodies directed against proteins of the
FOS or JUN families were added to the binding reactions but not with
the other antibodies tested. Second, when the CRE consensus
oligonucleotide was used as probe in the binding reactions, with only 5
µg STC-1 nuclear extracts, we detected a major C3 complex and a minor
(C4) one, (Fig. 4
). When the polyclonal anti-CREB-1 antibody directed
against the proteins of the CREB family was added, the binding of the
C3 complex was dramatically impaired. C3 or C4 complexes were not
affected by incubation with the other antibodies tested. Finally, the
binding of the C1 complex was affected only by the incubation with the
anti-CREB-1 antibody, but not with the other one tested (Fig. 4
),
although the experimental conditions were strictly identical,
indicating, thus, that the PepRE only bound transcription factors of
the CREB family and not those of the FOS and JUN families.
|
|
|
|
| Discussion |
|---|
|
|
|---|
Although nutrients are major regulators of intestinal hormone secretion in vivo, peptones are the first transcriptional stimulus to be described that acts in situ at the apical pole of the cell. Transcriptional stimulation of CCK gene transcription by peptones was quite reproducible in our experiments although moderate. Forskolin and bFGF were previously described to increase CCK gene transcription in a neuroblastoma cell line with a similar efficiency (9). The cis-acting DNA element, which is essential to confer peptone-responsiveness to the CCK promoter (designated PepRE), maps to nucleotides -93 to -70 upstream of the transcription initiation site. The location of the PepRE was first determined using serial 5'-3' deletions. Because all the deletions down to -93 bp did not modify the level of the transcriptional response to peptones, we inferred that the sequences between -765 and -93 bp did not directly contribute to the activation. Deletion of the region between -93 and -70 bp completely abolished the sensitivity to peptone treatment, demonstrating that a major cis-acting DNA element was present in this region. Mutations affecting the core 12-bp sequence between nucleotides -72 and -83, overlapping the putative AP1/CRE site, resulted in low and unregulated activity of CCK promoter. Moreover, mutation in this core region completely abolished transcription factor binding. We cannot exclude, nevertheless, that sequences flanking the core PepRE sequence could also play a role in the transcriptional response to peptones, because mutations in these sequences little affected the peptone responsiveness of the promoter fragments tested.
The CCK PepRE mimics a CRE consensus site. Its core sequence
corresponds to an imperfect palindrome and functions as a low-affinity
CREB binding site, as already described in the promoter of other genes
such as tyrosine aminotransferase, urokinase plasminogen activator, or
proenkephalin (19). Our results fit those previous
observations. The C1 complex binding to the PepRE was competed with the
best efficiency by a high-affinity CRE consensus site oligonucleotide
corresponding to a perfect palindrome found in the promoter of several
genes, e.g. somatostatin,
-CG, or fibronectin. Moreover,
20 µg STC-1 nuclear extracts were necessary to detect the C1 complex
bound to the PepRE, whereas only 5 µg were sufficient to easily
detect the C3 and C4 complexes bound to the CRE consensus site.
Finally, the CCK PepRE sequence binds only factors of the CREB family
in STC-1 cell nuclear extracts, but no factor of the FOS or JUN
families, emphasizing that it cannot be considered as an AP1 binding
site, although its sequence is very similar. Moreover, the expression
construct designed to have a wild-type AP1 site lost the ability to be
stimulated by peptones. Overexpression of FOS and
JUN proteins in SK-N-MC cells was previously reported to
stimulate CCK promoter transcription (7, 8, 9), but binding
of these factors to the putative CCK AP1/CRE site, using SK-N-MC
nuclear extracts, has not been demonstrated yet. Hence, the hypothesis
that indirect mechanisms were implicated remains.
The functional relevance of the CREB family of transcription factors is clearly demonstrated. Overexpression of the dominant-negative protein A-CREB in STC-1 cells completely abolished the transcriptional response of the CCK promoter to peptones. A-CREB protein has been previously shown to function by preventing DNA binding of CREB proteins in a dimerization domain-dependent fashion (14, 15). A-CREB effect on the peptone-induced transcriptional response was very specific because: 1) it disappeared as the quantity of transfected A-CREB expression vector decreased from 250 ng to 2ng; and 2) a dominant negative inhibitor of the yeast bZIP factor GCN4 had no effect on the transcriptional response of pGL3basic/-144 to peptone treatment. The results emphasize that direct binding of CREB factors to the PepRE is a major requirement for the peptone-induced transcriptional activation. The nature and quantity of the factors bound to the PepRE apparently remain unchanged after peptone treatment, suggesting a posttranslational modification. We indeed detected an increased phosphorylation of p35-ATF-1and p43-CREB-1 proteins after the peptone treatment, like that detected after forskolin treatment. ATF-1 does not bind to the PepRE using STC-1 nuclear extracts; hence, the phosphorylation of CREB-1 (or CREM-1) is the only event that can be related to the transcriptional stimulation induced by the peptones. Phosphorylation of CREB at Ser-133 has been reported to induce complex formation with CREB-binding protein (CBP/p300) (20). Recruitment of such a coactivator could explain the transcriptional activation observed after peptone treatment, but this hypothesis remains to be demonstrated.
Peptones used in this study are fair counterparts of the protein fraction in the intestinal lumen, because initial digestion of proteins yields a mixture of amino acids and oligopeptides. We previously demonstrated that single amino acids or a mixture of them had no effect on transcription, suggesting that oligopeptides must be responsible for the transcriptional effect of peptones. To our knowledge, stimulation of gene transcription by the oligopeptide class of nutrients was not previously described. Glucose- and lipid-response elements have already been identified in gene promoters (21, 22, 23, 24). This is the first description of a protein hydrolysate-DNA response element, in particular in the promoter of an intestinal hormone gene. Further investigations will be necessary to establish whether the CCK PepRE could confer peptone-inducibility to a heterologous promoter. In particular, identification of the PepRE-like sequence in the proglucagon gene promoter, which we also demonstrated to be very sensitive to peptone stimulation (18), will indicate whether the same type of DNA sequence can be used in two different hormone genes for activation by peptones.
The transduction mechanisms responsible for the effects of peptones on STC-1 cells are actually largely unknown. Previous work in our laboratory (25) suggests that peptones, at least in part, must passively enter the endocrine cells, but the existence of a presently unknown specific oligopeptide receptor cannot be definitively excluded. Many kinases have been described to phosphorylate the CREB family of transcription factors, and further experiments will be necessary to identify those implicated in the peptone response. Recently, the p38 mitogen-activated protein kinase, the ERK mitogen-activated protein kinase, and the protein kinase A-signaling pathways were implicated in the phosphorylation of CREB factors and activation of the CCK promoter in SK-N-MC cells in response to bFGF and forskolin stimulation (9). It will be interesting to know whether peptone effects are mediated through one of these pathways or another specific one. We have observed that forskolin/IBMX treatment can mimic the effect of peptones on CCK promoter, but whether the same transduction pathways are set in action in these two situations remains also to be determined.
In conclusion, the present study demonstrates that CCK gene expression is under the control of protein-derived nutrients in the STC-1 enteroendocrine cell line. In vivo correlation between dietary stimulation of CCK secretion and transcription has been reported in rat (26) and human (27). We confirmed previously this correlation in vitro using peptones and the STC-1 cell line (12, 18). Moreover, we demonstrated that peptones act on hormone gene transcription in STC-1 and Glutag cell lines but not in the other lines tested. The transcriptional effect of peptones on CCK appears thus as a specific intestinal phenomenon. Although they remain to be definitively proven in vivo, the reported data fit with a physiological regulation, strengthened by several studies indicating that peptones are strong in vivo and ex vivo stimulants of the CCK release in some species, including rat, man, and pig (11, 28). The transcriptional stimulation of CCK promoter after peptone exposure is mediated via a specific DNA element that overlaps a CRE site and binds transcription factors of the CREB family. Moreover, peptone treatment stimulates the phosphorylation of CREB factors. Such a nutrient response DNA element located in a gene encoding an intestinal hormone has not been described previously. Hence, this work makes an original contribution in the understanding of the molecular mechanisms underlying the effects of nutrient derivatives on the regulation of intestinal hormone genes expression. The identification of the factor in peptones that acts to stimulate hormone secretion and transcription of promoter reporter genes remains an exciting challenge.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received July 24, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Choi, M. Lee, A. L. Shiu, S. J. Yo, G. Hallden, and G. W. Aponte GPR93 activation by protein hydrolysate induces CCK transcription and secretion in STC-1 cells Am J Physiol Gastrointest Liver Physiol, May 1, 2007; 292(5): G1366 - G1375. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Chen, S. V. Wu, J. R. Reeve Jr., and E. Rozengurt Bitter stimuli induce Ca2+ signaling and CCK release in enteroendocrine STC-1 cells: role of L-type voltage-sensitive Ca2+ channels Am J Physiol Cell Physiol, October 1, 2006; 291(4): C726 - C739. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P. Darcel, A. P. Liou, D. Tome, and H. E. Raybould Activation of Vagal Afferents in the Rat Duodenum by Protein Digests Requires PepT1 J. Nutr., June 1, 2005; 135(6): 1491 - 1495. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Lay, G. Bane, C. S. Brunkan, J. Davis, L. Lopez-Diaz, and L. C. Samuelson Enteroendocrine cell expression of a cholecystokinin gene construct in transgenic mice and cultured cells Am J Physiol Gastrointest Liver Physiol, February 1, 2005; 288(2): G354 - G361. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Gevrey, M. Cordier-Bussat, E. Nemoz-Gaillard, J.-A. Chayvialle, and J. Abello Co-requirement of Cyclic AMP- and Calcium-dependent Protein Kinases for Transcriptional Activation of Cholecystokinin Gene by Protein Hydrolysates J. Biol. Chem., June 14, 2002; 277(25): 22407 - 22413. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nian, J. Gu, D. M. Irwin, and D. J. Drucker Human glucagon gene promoter sequences regulating tissue-specific versus nutrient-regulated gene expression Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2002; 282(1): R173 - R183. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |