help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krishnan, V.
Right arrow Articles by Frolik, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krishnan, V.
Right arrow Articles by Frolik, C. A.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Endocrinology Vol. 142, No. 2 940-947
Copyright © 2001 by The Endocrine Society


ARTICLES

Bone Anabolic Effects of Sonic/Indian Hedgehog Are Mediated By BMP-2/4-Dependent Pathways in the Neonatal Rat Metatarsal Model

Venkatesh Krishnan, Yanfei L. Ma, Jane M. Moseley, Andrew G. Geiser, Sylvie Friant and Charles A. Frolik

Endocrinology Division (V.K., Y.M., S.F., C.A.F.), Eli Lilly & Co., Lilly Corporate Center, Indianapolis, Indiana 46285; St. Vincent’s Institute of Medical Research (J.M.M.), Victoria 3065, Australia

Address all correspondence and requests for reprints to: Venkatesh Krishnan, Endocrinology Division, Eli Lilly & Co., Lilly Corporate Center, Indianapolis, Indiana 46285. E-mail: Krishnan_Gary{at}lilly.com


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A neonatal rat metatarsal organ culture model has been employed to study the anabolic effects of Sonic/Indian hedgehog and BMP-4. In this culture system, a significant increase in endochondral ossification is measured by an increase in length of mineralized bone, after daily treatment for 7 days with Sonic hedgehog protein (Shh-N). Previous evidence indicated that PTH related protein (PTHrP) is a critical target of hedgehog function in endochondral ossification. Using a PTHrP blocking antibody, it is shown that hedgehog mediates this activity via pathways other than through PTHrP. A dose-related increase in endochondral ossification is observed when metatarsals are treated with 25 ng/ml recombinant human bone morphogenetic protein 4 (BMP-4). However, this activity is not evident at higher doses of BMP-4 (200 ng/ml). High doses of BMP-4 resulted in increased expression of noggin messenger RNA and cotreatment of noggin and Shh-N resulted in reversal of the anabolic action of Shh-N. This observation suggests that BMP-4 signaling can influence the Shh-N mediated increase in endochondral ossification. Finally, we show that the Shh-N and BMP-4 mediated increase in endochondral ossification is reversed by treatment with antisense oligonucleotides targeted against Cbfa1. Thus, this report identifies Shh-N as an inducer of endochondral ossification that mediates its effect via BMP-4 and Cbfa1-dependent pathways.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
WE HAVE employed a previously reported (1) neonatal rat metatarsal organ culture model, which allows us to study endochondral ossification in the context of a developing long bone. We believe that this organ culture targets all the cell types that are potentially involved in endochondral ossification and thereby provides a more natural microenvironment to study complex biomolecules. The mineralized area in the putative diaphysis region is imaged and quantified. This region includes mineralized bone along with mineralized hypertrophic chondrocytes. Hence, this model is truly representative of endochondral ossification. We have defined anabolic activity in this model as one that increases endochondral ossification.

Indian hedgehog (Ihh) is a member of the vertebrate family of Hedgehog genes that include Sonic hedgehog (Shh) and Desert hedgehog (Dhh) (2). Indian hedgehog is expressed in a discrete portion of the developing growth cartilage at the border of maturing and hypertrophic chondrocytes (3). It is believed that Ihh’s effect on chondrocyte growth and differentiation is primarily mediated by PTH-related protein (PTHrP) and its cognate receptor (4). A recent report by Pathi and co-workers has revealed yet another BMP-2/4 related pathway that may be downstream of Ihh (5). Prior use of bone explants to study the role of Ihh and PTHrP have revealed an inhibitory effect of PTHrP and Ihh on cartilage differentiation as measured by collagen X expression (6). However, recent studies in mice null for the Ihh gene reveal that these factors may also have a growth and differentiation promoting role during endochondral ossification (7). Ihh and Shh are highly homologous and bind the receptor ptc with similar affinity and are capable of being used interchangeably in experimental systems (3). In this report, we use a neonatal rat metatarsal culture model (8, 9) to study the effect of the N-terminal 19-kDa Shh protein fragment (Shh-N) on longitudinal growth. We observe an anabolic effect for both Shh-N and BMP-4 and these two pathways were found to work in concert in the model. Noggin is a secreted protein that antagonizes the BMP-2/4 signaling by tethering the ligand and preventing it from binding to its cognate receptor (10). We provide evidence that noggin is up-regulated by treatment with 200 ng/ml BMP-4, and is capable of blocking the anabolic effect of both Shh-N and BMP-4. Furthermore, we show an increase in osteocalcin expression after treatment of metatarsals with 1 nM Shh-N, 25 ng/ml BMP-4 and BMP-4 + Shh-N. Finally, with the use of antisense Cbfa1/Osf-2 oligonucleotides, we show that both Shh-N and BMP-4 cannot mediate their effect in the absence of Cbfa1 expression. Collectively, this report points to a BMP-2/4 and Cbfa1-dependent pathway of endochondral ossification that is induced by Shh-N, and presumably Ihh, in cultured neonatal rat metatarsals.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents
All chemicals were obtained from Sigma-Aldrich Corp. unless otherwise indicated. Recombinant hBMP-4, recombinant mouse noggin and mShh-N were purchased from R&D Systems (Minneapolis, MN). Rat PTHrP (1–34) was purchased from Bachem Bioscience, Inc. (King of Prussia, PA). Genosys Corp. (Houston, TX) synthesized the scrambled and antisense Cbfa1 phosphorothiate substituted oligonucleotides. The real time taqman primers were purchased from Perkin-Elmer Corp. (Foster City, CA).

Human Ihh protein
Human Ihh was cloned from human liver messenger RNA (mRNA) using RT-PCR with a specific set of primers and its sequence was subsequently verified (2). A construct containing the nucleotides to generate an N-terminal fragment (amino acid residues 28–202) was synthesized using a pBluescript KSII vector (Stratagene, La Jolla, CA). This construct was used to generate in vitro translated radiolabeled N-terminal human Ihh that was immunoprecipitated (IP’d) using the mShh-N antibody from R&D Systems. In vitro translation was performed using the Promega Corp. (Madison, WI) T3/T7 reticulocyte lysate kit. Immunoprecipitation was performed using protein A Sepharose beads conjugated with 100 µl of 1:10 diluted Shh-N antibody ± Shh-N 2 µg/ml, or control IgG, for 2 h. Fifty microliters of the reticulocyte lysate was incubated at 30 C along with the conjugate for 2 h. Five or 10 µl of the supernatant was boiled in the presence of SDS loading buffer, run onto a 10% SDS-PAGE and visualized by autoradiography. The Shh-N (2 µg/µl) precleared antibody was used to ascertain specificity of the protein product.

Rat neonate metatarsal culture
Metatarsals were cultured as previously described (1). Newborn Sprague Dawley rats (Harlan Sprague Dawley, Inc., Indianapolis, IN) were killed at day 0, and the metatarsals were surgically isolated and placed in BGJ media (Life Technologies, Inc., Rockville, MD), without serum containing 100 µg/ml antibiotic/antimycotic solution (Life Technologies, Inc.). Metatarsals were cultured for 7 days in this media in a 96-well round bottom Petri dish (Nunclon, Nunc Products, Denmark) under 5% CO2 at 37 C. Wells were replaced with fresh media containing appropriate treatments every 24 h for 7 days. The metatarsals were imaged under a light microscope on day 0 and day 7 and changes in mineralization were quantified using Image Pro analysis software.

Calcein staining and histopathological analysis
At the end of the culture, metatarsals were fixed in 10% buffered formalin for 24 h at 4 C. Half of the metatarsals were routinely processed (11) and embedded in plastic. The other half of the metatarsals were subsequently decalcified in Decalcifier II (Surgipath Medical Industries Inc., Richmond, IL) for 4 h at 4 C and then processed for paraffin embedding. Longitudinal 5-µm sections were stained with either toluidine blue or hematoxylin and eosin. One set of metatarsals were stained for 2 h, before embedding in plastic, with Calcein (500 ng/ml) and were subsequently sectioned and imaged under a fluorescent microscope.

cAMP assay
This assay was performed as described earlier (12). PTHrP ± 3F5 was incubated overnight at 4 C and 100 µl of this mix was added to 900 µl of assay reaction buffer.

mRNA analysis
Metatarsals were pulverized after culture in a guanidinium thiocyanate solution as previously described (13). The lysate was placed onto a sucrose density gradient and total RNA was pelleted after ultracentrifugation at 25 C for 20 h at 32,000 rpm in a SW41Ti (Beckman Coulter, Inc.) rotor. RNA pellets were precipitated using isopropanol and subsequently washed with 70% ethanol 30% water. Total RNA was dissolved in water and 250 ng was used in a RT reaction using the Superscript II kit (Life Technologies, Inc.) and random hexamer primers. Subsequently, an aliquot of the RT reaction was subjected to 30 cycles of PCR using Platinum Taq polymerase and specific primers for noggin, osteocalcin (rat and mouse) and GAPDH. PCR were annealed at 60 C, 54 C and 54 C, respectively, in a 25 µl reaction. Ten microliters were loaded onto a 1.5% TAE gel and the products were analyzed after ethidium bromide staining.

Primer information
All custom primers were obtained from Life Technologies, Inc.

Rat noggin primers. 241 GGAGGCATGGAGCGCTGCCC (forward) 990 GGATCCATCAAGTGTCTGG (reverse)

Human Ihh primers. 1 CCGGCGCCTCATGACCCAGCGCTGCAAGGA (forward) 1211 GGAGTCGCCGTGCCAGCCTCAAGGTCTC (reverse)

Rat GAPDH primers. 301 TCGTGGAGTCTACTGGCGTCTT (forward) 1075 CCTCTCTCTTGCTCTCAGTATC (reverse)

Rat osteocalcin primers. 474 AGTCACCAACCACAGCATCC (forward) 801 TTTGTCCCTTCCCTTCTGCC (reverse)

Quantitative PCR analysis
Poly A mRNA was isolated from rat neonate metatarsals treated with 25 ng/ml BMP-4, 1 nM Shh-N, and Shh-N+ BMP-4 for 72 h by using RNA isolation kit from Promega Corp. Osteocalcin and GAPDH was measured by real time PCR that allows a quantitative evaluation of the steady-state mRNA levels.

Mouse and rat GAPDH. 200 GGCAAATTCAACGGCACAGT (sense) 269 AGATGGTGATGGGCTTCCC (antisense) 221 AAGGCCGAGAATGGGAAGCTTGTCATC (taqman probe)

Rat osteocalcin. 1131 ATGAGGACCCTCTCTCTG (sense) 1193 TGCCAGGTCAGAGAGGC (antisense) 1151 CACTCTGCTGGCCCTGACTGCA (taqman probe)

The taqman probe consists of an oligonucleotide with a 5'-reporter dye and a 3-quencher dye. The fluorescent reporter dye FAM (6carboxyfluorescein) was covalently linked to the 5' end of the oligonucleotide, and the reporter was quenched by TAMRA (6-carboxytetramethylrhodamine) that is located in the 3' end. The quencher suppressed fluorescence until the PCR when the probe was cleaved which released the fluorescent radicals. The resulting increase in fluorescence was measured and reflects the amount of specific mRNA present in each tube. The results are shown as fold or percent changes over vehicle controls.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The neonatal rat metatarsal culture model
Saggital sections obtained from the cultured metatarsals embedded in plastic clearly indicate the mineralized portion of the bone (Fig. 1AGo). Furthermore, at higher magnification (Fig. 1BGo) plump cuboidal osteoblasts (OB) and multinucleated osteoclasts (OC) can be seen which suggests, that after 7 days of culture the organ is viable and is capable of responding to bone modeling or anabolic agents. To identify the mineralized region within the metatarsal that is being quantified we visualized the mineralization after calcein staining of the metatarsal. Figure 2Go (brightfield) shows the presence of a calcified matrix and the measured value (shown in brackets) can be overlaid onto the calcein stained (Fig. 2Go; darkfield) area of the metatarsal section. Anabolic activity of a particular treatment is the increase in endochondral ossification which was defined by longitudinal extensions within this calcified region comparing the day 0 and day 7 images of the same metatarsal.



View larger version (99K):
[in this window]
[in a new window]
 
Figure 1. A, Hematoxylin and eosin stained histologic section of neonate rat metatarsal rudiment after the 7-day culture in BGJ media. The endochondral ossification through the zones of hypertrophic, calcified cartilage and primary center of ossification is clearly shown. B, High power view of the toluidine blue stained histologic section of the neonate rat metatarsal rudiment. OB, Osteoblast; OC, osteoclast.

 


View larger version (116K):
[in this window]
[in a new window]
 
Figure 2. Fluorescent microscopic section (bottom) showing the mineralized cartilage and primary bone labeled with calcein. Calcein fluorochrome 0.5 mg/ml was given on the first day of culture for 2 h following several rinses. The mineralized zone correlated to the area between the two ends of lower growth plates on toluidine blue stained section (top) from the same metatarsal rudiment.

 
Human Ihh is recognized by mShh-N antibody
Reticulocyte lysates from in vitro translated human Ihh complementary DNA (partial fragment; 28–202 aa) can be immunoprecipitated with a mShh-N antibody (Fig. 3Go). There are two bands which correspond to full-length (~19 kDa) and a lower molecular weight band as a result of aberrant 3' translation using the in vitro system. The antibody was raised against a N termini peptide and can detect full length and 3' truncated proteins. In contrast, neither the Shh-N precleared antibody nor the IgG could immunoprecipitate these bands (Fig. 3Go). Twenty-five microliters of this reticulocyte lysate was found to increase secreted alkaline phosphatase activity by 3-fold in C3H10T1/2 cells after 3 days of treatment (data not shown). Earlier reports have used both Ihh and Shh-N interchangeably (3) and since recombinant mShh-N protein gave us consistent results and could block the detection of the in vitro translated Ihh protein, subsequent experiments were performed using the recombinant Shh-N protein.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 3. Immunoprecipitation (IP) of the N-terminal fragment (28–202 aa) of human Ihh using mShh antibody. Ten microliters of control (1) in vitro translated vector, 5 (2) and 10 µl (3) of in vitro-translated Ihh N-terminal fragment IP’d using Shh antibody, 10 µl of same lysate as in lane 3, IP’d with Shh antibody preincubated with mouse Shh-N (4), and finally lysate from lane 3 IP’d with control rabbit IgG.

 
Shh-N is anabolic in the rat metatarsal culture model
Metatarsals treated with a range of Shh-N concentrations (10 -12 to 10 -7 M) showed a dose-dependent increase in anabolic activity, with maximal activation at 10 nM Shh-N (Fig. 4AGo). It has been reported that PTHrP is a target gene for Ihh signaling and that PTHrP acts as a feedback inhibitor of Ihh signaling. To study the role of PTHrP in mediating this effect we used the 3F5 PTHrP-blocking antibody (5 µg/ml) together with PTHrP and Shh-N. Cotreatment with 10 µg/ml of 3F5 decreases the PTHrP induced dose-dependent increase in cAMP levels, observed in UMR 106.01 cells (Table 1Go). The actual dose for the antibody seems to be slightly different for the two assays. As shown in Fig. 4BGo, 1Go nM rPTHrP (1–34) cotreatment with 5 µg/ml 3F5 antibody results in complete reversal of PTHrP-mediated anabolic activity. However, cotreatment of metatarsals with 1 or 0.1 nM Shh-N and the 3F5 antibody does not result in a significant change in Shh-N-mediated anabolic activity. In contrast, IgG cotreated with 1 nM rPTHrP and 1 nM or 0.1 nM Shh-N does not block the anabolic activity of both PTHrP and Shh-N. This result suggests that Shh-N- induced anabolic activity in these metatarsals is not mediated by PTHrP.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 4. A, Anabolic activity of Shh-N shown at concentrations ranging from 1 pM to 100 nM, compared with vehicle control. *, Statistically significant over vehicle control (P < 0.05; t test). B, Anabolic activity of Shh-N (1, 0.1 nM) is measured in the presence of IgG or 3F5, (5 µg/ml, PTHrP blocking antibody). One nanomolar concentration rat PTHrP (1–34) was used as a positive control. *, Statistically significant over vehicle control (P < 0.05; t test).

 

View this table:
[in this window]
[in a new window]
 
Table 1. Activation of adenylate cyclase in UMR 106.01 cells

 
BMP-4 exhibits dose-dependent anabolic activity
Metatarsals were treated with recombinant human BMP-4 at concentrations ranging from 25 ng/ml to 200 ng/ml. An anabolic effect was observed at a concentration of 25 ng/ml but this effect was less evident at higher concentrations of 100 ng/ml and 200 ng/ml (Fig. 5Go). To investigate the reason why this anabolic effect was lost at higher doses, mRNA from these metatarsals were subjected to a RT-PCR using two sets of primers for GAPDH and noggin. It has been reported that noggin expression is under the control of BMP-2/4 signaling and noggin can inhibit the BMP-2/4 pathway, which provides a negative feedback loop for BMP-2/4 signaling (10). Accordingly, we found an increase in noggin mRNA as the concentration of BMP-4 was increased from the anabolic 25 ng/ml to the restrictive 200 ng/ml amount (Fig. 6Go; compare lanes 2 through 8). Hence, we hypothesize that the lack of anabolic activity at higher doses of BMP-4 may result from a negative feedback control mechanism which is mediated by noggin.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 5. BMP-4 has a varied effect that is anabolic at lower concentrations of 100 ng/ml and 25 ng/ml. The high dose of BMP-4 (200 ng/ml) is not anabolic and this dose abolished the anabolic activity of 1 nM Shh-N in cotreated samples. *, Statistically significant over vehicle control (P < 0.05; t test).

 


View larger version (32K):
[in this window]
[in a new window]
 
Figure 6. RT-PCR analysis of rat noggin and rat GAPDH transcripts in the presence of increasing amounts of BMP-4 (25 to 200 ng/ml), 1 nM Shh-N, a combination of the high dose of BMP-4 and Shh-N, and a 100 bp DNA marker (M). The 600-bp fragment within the ladder is overloaded for convenience. Lanes from products run without reverse transcriptase have been denoted as -RT.

 
Role of BMP-4 in Shh-N mediated anabolic activity
To study any interactions between BMP-4 and Shh-N mediated anabolic activity we cotreated metatarsals with the high dose of BMP-4 (200 ng/ml) and 1 nM Shh-N. To our surprise, 200 ng/ml of BMP-4 was capable of blocking Shh-N mediated anabolic activity (Fig. 5Go). Furthermore, an increased expression of noggin was observed in these metatarsals (Fig. 6Go, compare lanes 2 and 12). Cotreatment of 25 ng/ml hBMP-4 and 1 nM Shh-N did not result in an additional increase in endochondral ossification than either treatment alone (Fig. 5Go). Cotreatment of metatarsals with 1 nM Shh-N and 25 ng/ml BMP-4 or 200 ng/ml of BMP-4, completely reversed the anabolic activity of Shh-N at the higher dose (200 ng/ml) of BMP-4, but it did not further increase the anabolic activity at the lower dose (25 ng/ml) of BMP-4 (Fig. 5Go). Finally, addition of exogenous amounts of recombinant noggin (20 µg/ml) to 1 nM Shh-N or 25 ng/ml BMP-4, reversed the anabolic activity of both agents (Fig. 7Go). In contrast the anabolic activity of 1 nM PTHrP is not significantly altered in the presence of 20 µg/ml of recombinant noggin (Fig. 7Go).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 7. Neonatal rat metatarsals were treated with vehicle control, 20 µg/ml noggin, 1 nM Shh-N, 1 nM PTHrP, 25 ng/ml BMP-4, noggin + Shh-N, noggin + BMP-4, and noggin + PTHrP for 7 days. Noggin cotreatment results in statistically significant decrease in Shh-N mediated anabolic activity (P < 0.05).

 
Role of Cbfa1 in mediating anabolic activity of BMP-4
Cbfa1/Osf-2 is an osteoblast specific transcription factor that has been shown to be essential for bone formation (14). Previous reports have shown that BMP-4 treatment of C2C12 cells results in an increase in Cbfa1/Osf-2 mRNA, which is consistent with our observations (data not shown) (15, 16).

To determine the role of Cbfa1 in mediating the anabolic activity of BMP-4, we used a previously characterized antisense oligonucleotide (17) that attenuates Cbfa1 expression, along with a control scrambled sense oligonucleotide that does not affect Cbfa1 levels. These antisense oligonucleotides have been directed against the nucleotides immediately 5' of the runt domain and have been shown to decrease alkaline phosphatase activity in primary rat osteoblasts (17). These oligonucleotides were added to the culture 1 h before treatment of metatarsals with BMP-4 (25 ng/ml). To confirm the effect of this antisense oligonucleotide approach, we measured the mRNA levels of osteocalcin, an osteoblast specific marker, in both scrambled and antisense oligonucleotide-treated metatarsals. We saw a significant decrease (~ 85%) in osteocalcin mRNA compared with minimal change in GAPDH mRNA (~5%) as measured by real time PCR after day 3 of treatment with 10 µM of antisense oligonucleotide (Fig. 9AGo). In contrast, the scrambled sense oligonucleotide did not have an effect on osteocalcin mRNA (Fig. 8AGo). Furthermore, only the antisense oligonucleotide and not the scrambled sense oligonucleotide, resulted in complete blockade of BMP-4 and Shh-N mediated anabolic activity (Fig. 8BGo). Finally, we measured osteocalcin mRNA, a downstream target of Cbfa1, using real time PCR in metatarsals treated with BMP-4 (25 ng/ml), Shh-N 10 nM, and Shh-N+ BMP-4. An approximately 3-fold increase in osteocalcin mRNA was observed with BMP-4 treatment and an approximately 2-fold increase was observed with 10 nM Shh-N. As seen earlier cotreatment with both agents did not increase the osteocalcin mRNA levels over and above that of BMP-4 alone (Fig. 9Go). Collectively, these results suggest a mechanistic link between Shh-N/Ihh-N, BMP-2/4, and Cbfa1/Osf-2 in mediating the anabolic affects of Shh-N/Ihh-N.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 9. Real-time PCR results showing fold increase over vehicle control in osteocalcin mRNA after 3 days of treatment with 1 nM Shh-N, 25 ng/ml BMP-4, and Shh-N + BMP-4. Results are presented as a mean ± SD, from four separate studies.

 


View larger version (20K):
[in this window]
[in a new window]
 
Figure 8. Real-time PCR analysis of rat osteocalcin and rat GAPDH transcripts from RNA obtained from rat metatarsals treated with 10 µM of antisense (AS) or scrambled sense (Scr) oligos. Results are expressed as percent inhibition compared with vehicle control. 8B. Anabolic activity of 1 nM Shh-N and 25 ng/ml of BMP-4 is reversed by a 1-h pretreatment with 10 µM Cbfa1 antisense oligo (AS) but is not affected by pretreatment with 10 µM scrambled sense (Scr). *, Statistically significant over vehicle control (P < 0.05; t test).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, an ex vivo organ culture of rat neonate metatarsals has been used to model endochondral ossification. Histopathological analysis of a cross-section of the rat neonatal metatarsals after 7 days of culture in BGJ serum-free media, revealed a viable organ with the presence of plump cuboidal osteoblasts and multinucleated osteoclasts. In addition, hypertrophic chondrocytes, packed in a columnar fashion were present, juxtaposed with the calcein-stained mineral found in the mid-diaphysis region. This model would accordingly measure mineralization of both hypertrophic chondrocytes and bone and would reflect changes in the process of endochondral ossification. The observed increase in this mineralized area after 7 days of treatment with known anabolic agents such as BMP-4 and PTHrP lend credence to this model as a method of studying bone anabolic activity.

Earlier reports have shown that treatment of chick bone explants with PTHrP (retroviral overexpression) leads to decreased collagen X expression, a marker for hypertrophic cartilage, suggesting an inhibitory role for PTHrP and Ihh in cartilage differentiation (18). However, in the same study it was suggested that Ihh is also important for chondrocyte differentiation, as exemplified by the short-limb dwarfism phenotype in the Ihh knockout mouse (19). Osteoblasts are primarily responsible for laying down the collagen Ienriched matrix that accounts for most of the mineral present in the mid-diaphysis region (20). It is noteworthy that treatment of these metatarsals with 1 to 100 nM calcitonin did not affect their mineralization (data not shown), in spite of the presence of multinucleated osteoclasts (refer to Fig. 1BGo). The ability of recombinant BMP-4 to elicit an anabolic response provided initial validation that this model is responsive to a known anabolic agent. Interestingly, the appearance of noggin mRNA at higher doses of BMP-4 suggests that this anabolic activity can be controlled by a negative feedback loop mediated by noggin (21). This observation may have important implications when targeting modulators of BMP-2/4 activity for the treatment of osteoporosis.

The process of fracture healing is shown to result in the formation of a pseudo growth plate, which provides for the recapitulation of the endochondral ossification within the microenvironment of the fracture (22). Correspondingly, it has been reported that BMP-2/4 transcripts along with that of Ihh have been identified in such microenvironments (18). Hence, there is precedence for these two signaling molecules to be coexpressed in areas undergoing new bone formation. In Ihh null mice, a specific effect on osteoblast development is observed, such that the bone collar which is derived from diaphyseal osteoblasts is lacking in these mice. This observation points to chondrocyte maturation-independent effects of Ihh and is consistent with the loss of Cbfa1/Osf-2 expression in these mice (19). Because PTHrP blocking antibody fails to inhibit this Shh-N–induced anabolic activity, it can be inferred that Shh-N/Ihh targets areas other than the PTHrP-responsive tissues, in this model. In support of this hypothesis it has been reported that the ROS17/2.8 cell line model with some features of a mature rat osteoblast, expresses Ihh and its cognate receptor patched. However, it remains to be seen whether this can effectively explain all of Shh-N's anabolic activity (23). In addition, the inability of a constitutively active PTHrP receptor (PTHRI) to rescue the short-limbed phenotype of Ihh null mice, when expressed as a transgene, is indicative of nonPTHrP pathways mediating Ihh action (7). Based on our results using Cbfa1 antisense oligonucleotides it can be inferred that Shh-N/Ihh anabolic action is mediated by osteoblasts and chondrocytes that express Cbfa1 (20, 24, 25). The precise details of mechanism will become more apparent with the availability of more sensitive techniques to detect Ihh protein as it is found to migrate across the critical cell layers during endochondral ossification.

Our results indicate that BMP-4 signaling pathways mediate bone anabolic activity of Shh-N/Ihh, in this organ culture model. This observation provides additional evidence that these two signaling molecules are intricately intertwined during embryonic and postnatal limb development (26, 27, 28). This observation that Shh/Ihh, BMP-2/4 and noggin signaling are intertwined has been previously implicated in somitogenesis (29, 30). However, the relationship between Shh-N and BMP-4 has been antagonistic unlike our current report, which seems to indicate that BMP-2/4 signaling may mediate the anabolic action of Shh/Ihh during endochondral ossification. The recent evidence that BMP-4 has a role in cartilage differentiation may shed some light (5) on the mechanism of this anabolic activity in the metatarsal model. An increase in chondrocyte differentiation caused by Shh-N/Ihh or BMP-4 could lead to increase in the presence of chondro-osteoblast precursors or to an increased scaffold laid down by the maturing chondrocytes. This would eventually result in increased mineralization. However, treatment of these metatarsals with 1, 10 nM Shh-N did not alter the level of collagen X mRNA as detected by RT-PCR (data not shown). This result would suggest that the anabolic activity for Shh-N/Ihh is not solely mediated by increase in the number of hypertrophic chondrocytes. Finally the observation that Cbfa1 antisense oligonucleotides block the anabolic activity of Shh-N and BMP-4 indicates that compromising the ability of an osteoblast to deposit bone matrix will interfere with endochondral ossification. Evidence for this role is provided by the finding that expression of a dominant negative Cbfa1 in mature osteoblasts severely affects bone volume without affecting osteoblast number (31).

In conclusion, this report has identified a mechanistic link between Shh-N/Ihh, BMP-2/4, and Cbfa1 signaling in mediating bone anabolic activity in an organ culture model. This activity of Shh-N/Ihh is independent of PTHrP but is dependent on BMP-2/4 and Cbfa1/Osf-2 signaling. Future studies on the mechanism of this anabolic action and the role of the individual cell types in mediating this anabolic action will shed light on the complex pathway of endochondral ossification.


    Acknowledgments
 
The authors acknowledge the critical review of this manuscript by Drs. Jude E. Onyia and John T. Martin. The authors acknowledge the technical assistance of Zeng, Q.-Q., and R. L. Cain, in isolating rat neonate metatarsals.

Received April 27, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Haaijman A, D’Souza RN, Bronckers AL, Goei SW, Burger EH 1997 OP-1 (BMP-7) affects mRNA expression of type I, II, X collagen, and matrix Gla protein in ossifying long bones in vitro. J Bone Miner Res 12:1815–1823[CrossRef][Medline]
  2. Marigo V, Roberts DJ, Lee SMK, Tsukurov O, Levi T, Gastier JM, Epstein DJ, Gilbert DJ, Copeland NG, Seidman CE, Jenkins NA, Seidman JG, McMahon AP, Tabin CJ 1995 Cloning, expression and chromosomal localization of Shh and Ihh, two human homologues of the Drosophila segment polarity gene hedgehog. Genomics 28:44–51[CrossRef][Medline]
  3. Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM, Tabin CJ 1996 Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science 273:613–622
  4. Chung U, Lanske B, Lee K, Li E, Kronenberg H 1998 The parathyroid hormone/parathyroid hormone-related peptide receptor coordinates endochondral bone development by directly controlling chondrocyte differentiation. Proc Natl Acad Sci USA 95:13030–13035[Abstract/Free Full Text]
  5. Pathi S, Rutenberg JB, Johnson RL, Vortkamp A 1999 Interaction of Ihh and BMP Noggin signaling during cartilage differentiation. Dev Biol 209:239–253[CrossRef][Medline]
  6. Kronenberg HM, Lee K, Lanske B, Segre GV 1997 PTHrP and Ihh control the pace of cartilage differentiation. J Endocrinol 154:S39–S45
  7. Karp SJ, Schipani E, Jacques BS, Hunzelman J, Kronenberg H, McMahon A 2000 Indian hedgehog coordinates endochondral bone growth and morphogenesis via parathyroid hormone related protein-dependent and -independent pathways. Development 127:543–548[Abstract]
  8. Yasoda A, Ogawa Y, Suda M, Tamura N, Mori K, Sakuma Y, Chusho H, Shiota K, Tanaka K, Nakao K 1998 Natriuretic peptide regulation of endochondral ossification. J Biol Chem 273:11695–11700[Abstract/Free Full Text]
  9. Sahni M, Ambrosetti DC, Mansukhani A, Gertner R, Levy D, Basilico C 1999 FGF signaling inhibits chondrocyte proliferation and regulates bone development through the STAT-1 pathway. Genes Dev 13:1361–1366[Abstract/Free Full Text]
  10. Zimmerman L, Jesus-Escobar LD, Harland R 1996 The Spemann organizer signal noggin binds and inactivates bone morphogenetic protein-4. Cell 86:599–606[CrossRef][Medline]
  11. Ma YF, Pen Z, Jee WS, Lin CH, Liang HH, Chen H, Pun S, Li XJ 1997 Intermittent on/off prostaglandin E2 and risedronate are equally anabolic as daily PGE2 alone treatment in cortical bone of ovariectomized rats. J Bone Miner Res 12:2108–2112[CrossRef][Medline]
  12. Forrest SM, Ng KW, Finday DM, Michelangeli VP, Livesey SA, Partridge NC, Zajac JD, Martin TJ 1985 Characterisation of an osteoblast-like clonal cell line which responds to bone parathyroid hormone and calcitonin. Calcif Tissue Int 37:51–56[Medline]
  13. Maniatis T, Fritsch EF, Sambrook J 1982 Molecular Cloning. A Laboratory Manual, ed 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  14. Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson RT, Gao YH, Inada M, Sato M, Okamoto R, Kitamura Y, Yoshiki S, Kishimoto T 1997 Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts [see comments]. Cell 89:755–764[CrossRef][Medline]
  15. Lee MH, Javed A, Kim HJ, Shin HI, Gutierrez S, Choi JY, Rosen V, Stein JL, van Wijnen AJ, Stein GS, Lian JB, Ryoo HM 1999 Transient upregulation of CBFA1 in response to bone morphogenetic protein-2 and transforming growth factor beta1 in C2C12 myogenic cells coincides with suppression of the myogenic phenotype but is not sufficient for osteoblast differentiation. J Cell Biochem 73:114–125[CrossRef][Medline]
  16. Tsuji K, Ito Y, Noda M 1998 Expression of the PEBP2alphaA/AML3/CBFA1 gene is regulated by BMP4/7 heterodimer and its overexpression suppresses type I collagen and osteocalcin gene expression in osteoblastic and nonosteoblastic mesenchymal cells. Bone 22:87–92[Medline]
  17. Banerjee C, McCabe LR, Choi JY, Hebert SW, Stein JL, Stein GS, Lian JB 1997 Runt homology domain proteins in osteoblast differentiation: AML3/Cbfa1 is a major component of a bone specific complex. J Cell Biochem 66:1–8[CrossRef][Medline]
  18. Vortkamp A, Pathi S, Perelti G, Caruso E, Zaleske D, Tabin C 1998 Recapitulation of signals regulating embryonic bone formation during postnatal growth and in fracture repair. Mech Dev 71:65–76[CrossRef][Medline]
  19. St-Jacques B, Hammerschmidt M, McMahon AP 1999 Indian hedgehog signaling regulates proliferation and differentiation of chondrocytes and is essential for bone formation. Genes Dev 13:2072–2086[Abstract/Free Full Text]
  20. Ducy P, Karsenty G 1998 Genetic control of cell differentiation in the skeleton. Curr Opin Cell Biol 10:614–619[CrossRef][Medline]
  21. Kameda T, Koike C, Saitoh K, Kuroiwa A, Iba H 1999 Developmental patterning in chondrocytic cultures by morphogenic gradients: BMP induces expression of Indian hedgehog and noggin. Genes Cells 4:175–184[Abstract]
  22. Ferguson C, Miclau T, Hu D, Alpern E, Helms J 1998 Common molecular pathways in skeletal morphogenesis and repair. Ann NY Acad Sci 857:33–42[CrossRef][Medline]
  23. Murakami S, Nifuji A, Noda M 1997 Expression of Indian hedgehog in osteoblasts and its posttranscriptional regulation by transforming growth factor-ß. Endocrinology 138:1972–1978[Abstract/Free Full Text]
  24. Inada M, Yasui T, Nomura S, Miyake S, Deguchi K, Himeno M, Sato M, Yamagiwa H, Kimura T, Yasui N, Ochi T, Endo N, Kitamura Y, Kishimoto T, Komori T 1999 Maturational disturbance of chondrocytes in Cbfa1-deficient mice. Dev Dyn 214:279–290[CrossRef][Medline]
  25. Komori T, Kishimoto T 1998 Cbfa1 in bone development. Curr Opin Genet Dev 114:494–499
  26. Kim IS, Otto F, Zabel B, Mundlos S 1999 Regulation of chondrocyte differentiation by Cbfa1. Mech Dev 80:159–170[CrossRef][Medline]
  27. Riddle R, Johnson RL, Iaufer E, Tabin C 1993 Sonic hedgehog mediates the polarizing activity of the ZPA. Cell 75:1401–1416[CrossRef][Medline]
  28. Johnson RL, Tabin C 1995 The long and short of hedgehog signaling. Cell 81:313–316[CrossRef][Medline]
  29. Hirsinger E, Duprez D, Joove C, Malapert P, Cooke J, Pourquie O 1997 Noggin acts downstream of Wnt and sonic hedgehog to antagonize BMP4 in avian somite patterning. Development 124:4605–4614[Abstract]
  30. Marcelle C, Stark MR, Bronner-Fraser M 1997 Coordinate actions of BMPs, Wnts, Shh and noggin mediate patterning of the dorsal somite. Development 124:3955–3963[Abstract]
  31. Ducy P, Starbuck M, Priemel M, Shen J, Pinero G, Geoffroy V, Amling M, Karsenty G 1999 A Cbfa1-dependent genetic pathway controls bone formation beyond embryonic development. Genes Dev 13:1025–1036[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Cell Sci.Home page
A. Mukherjee and P. Rotwein
Akt promotes BMP2-mediated osteoblast differentiation and bone development
J. Cell Sci., March 1, 2009; 122(5): 716 - 726.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Mukherjee and P. Rotwein
Insulin-Like Growth Factor-Binding Protein-5 Inhibits Osteoblast Differentiation and Skeletal Growth by Blocking Insulin-Like Growth Factor Actions
Mol. Endocrinol., May 1, 2008; 22(5): 1238 - 1250.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. R. Dwyer, N. Sever, M. Carlson, S. F. Nelson, P. A. Beachy, and F. Parhami
Oxysterols Are Novel Activators of the Hedgehog Signaling Pathway in Pluripotent Mesenchymal Cells
J. Biol. Chem., March 23, 2007; 282(12): 8959 - 8968.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Yaar, C. Wu, H.-Y. Park, I. Panova, G. Schutz, and B. A. Gilchrest
Bone Morphogenetic Protein-4, a Novel Modulator of Melanogenesis
J. Biol. Chem., September 1, 2006; 281(35): 25307 - 25314.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. K. Chan, D. Miao, R. Deckelbaum, I. Bolivar, A. Karaplis, and D. Goltzman
Parathyroid Hormone-Related Peptide Interacts with Bone Morphogenetic Protein 2 to Increase Osteoblastogenesis and Decrease Adipogenesis in Pluripotent C3H10T1/2 Mesenchymal Cells
Endocrinology, December 1, 2003; 144(12): 5511 - 5520.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
E. Canalis, A. N. Economides, and E. Gazzerro
Bone Morphogenetic Proteins, Their Antagonists, and the Skeleton
Endocr. Rev., April 1, 2003; 24(2): 218 - 235.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
V. Krishnan, T. L. Moore, Y. L. Ma, L. M. Helvering, C. A. Frolik, K. M. Valasek, P. Ducy, and A. G. Geiser
Parathyroid Hormone Bone Anabolic Action Requires Cbfa1/Runx2-Dependent Signaling
Mol. Endocrinol., March 1, 2003; 17(3): 423 - 435.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krishnan, V.
Right arrow Articles by Frolik, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krishnan, V.
Right arrow Articles by Frolik, C. A.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals