help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Samudio, I.
Right arrow Articles by Safe, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Samudio, I.
Right arrow Articles by Safe, S.
Endocrinology Vol. 142, No. 3 1000-1008
Copyright © 2001 by The Endocrine Society


ARTICLES

Transcriptional Activation of Deoxyribonucleic Acid Polymerase {alpha} Gene Expression in MCF-7 Cells by 17{beta}-Estradiol1

Ismael Samudio, Carrie Vyhlidal, Fan Wang, Matthew Stoner, Ichen Chen, Michael Kladde, Rola Barhoumi, Robert Burghardt and Stephen Safe

Department of Veterinary Physiology and Pharmacology (I.S., C.V., F.W., M.S., I.C., S.S.), Department of Biochemistry and Biophysics (I.S., C.V., M.K.), Department of Veterinary Anatomy and Public Health (R.Ba., R.Bu.), Texas A&M University, College Station, Texas 77843

Address all correspondence and requests for reprints to: Stephen H. Safe, Department of Veterinary Physiology and Pharmacology, Texas A&M University, College Station, Texas 77843-4466. E-mail: ssafe{at}cvm.tamu.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Treatment of MCF-7 human breast cancer cells with 17{beta}-estradiol (E2) results in increased DNA synthesis and cell proliferation and enhanced enzyme activities associated with purine/pyrimidine biosynthesis. The mechanism of enhanced DNA polymerase {alpha} activity was investigated by analysis of the promoter region of this gene. E2 induced luciferase (reporter gene) activity in MCF-7 cells transfected with pDNAP1, pDNAP2, and pDNAP3 containing -1515 to +45, -248 to +45 and -116 to +45 inserts from the DNA polymerase {alpha} gene promoter, whereas no induction was observed with pDNAP4 (-65 to +45 insert). The induction response was dependent on cotransfection with estrogen receptor {alpha} (ER{alpha}), and transactivation was also observed with a mutant ER{alpha} that did not express the DNA-binding domain. Subsequent functional, DNA binding, and DNA footprinting studies showed that a GC-rich region at -106 to -100 was required for E2-mediated transactivation, and Sp1 protein, but not ER{alpha}, bound this sequence. Transcriptional activation of DNA polymerase {alpha} by E2 is associated with ER{alpha}/Sp1 action at a proximal GC-rich promoter sequence, and this gene is among a growing list of E2-responsive genes that are induced via ER{alpha}/Sp1 protein interactions that do not require direct binding of the hormone receptor to DNA.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DNA REPLICATION, recombination, and repair in eukaryotes is dependent on members of one or more DNA polymerases that exhibit both unique and overlapping catalytic activities. One member of this group of enzymes, DNA polymerase {alpha}, contains four subunits and plays an important role in DNA replication (1, 2, 3). Not surprisingly, stimulation of cell growth by mitogens, induces a diverse spectrum of genes involved in the cell cycle and DNA synthesis and this includes DNA polymerase {alpha} (4, 5, 6, 7). DNA polymerase {alpha} messenger RNA (mRNA) and protein levels are constitutively expressed during the cell cycle, whereas in serum-deprived cells levels are low but significantly increased after serum is added (4). Analysis of the DNA polymerase {alpha} gene promoter in cycling HeLa cells showed that the region from -248 to the start site was required for maximal activity of deletion constructs in transfection assays (6). The region of the promoter downstream from -248 contains multiple transcription factor binding sites including AP-2, AP-1, GC-rich, E2F, ATF, and CCAAT motifs; however, a TATA box is not present (6). Regulation of DNA polymerase {alpha} is complex and may be dependent on phosphorylation of the expressed protein or interactions of nuclear transcription factors with specific promoter elements (4, 5, 6, 7, 8, 9, 10). For example, in some cell lines infected with human cytomegalovirus an immediate early gene product (IE1) interacts with CTF1, a transcription factor that binds the CCAAT box, and synergistically enhances transactivation of DNA polymerase {alpha} in transient transfection assays (10).

Estrogens, growth factors, and other mitogens induce proliferation of MCF-7 human breast cancer cells (11, 12, 13, 14), and the estrogen-induced response is accompanied by activation of the cell cycle and related enzymes/genes (15, 16, 17, 18, 19), enhanced progression of cells from G0/G1 to S and G2/M phase, and increased DNA synthesis (20, 21, 22, 23, 24, 25, 26). For example, in MCF-7 cells treated with E2, there is increased activity and/or gene expression of enzymes involved in nucleotide biosynthesis, and these include thymidine kinase, dihydrofolate reductase, thymidylate synthase, adenosine deaminase, carbamoyl phosphate synthetase, and orotate pyrophosphorylase. Moreover, hormone treatment also induces DNA synthesis as determined by increased incorporation of labeled nucleotides into cellular DNA extracts (20, 21, 22, 23, 24, 25, 26). The effects of E2 on DNA polymerase {alpha} have not previously been reported, and this study shows that there is time-dependent transcriptional activation of this gene after treatment of MCF-7 cells with E2. Deletion analysis of the DNA polymerase {alpha} gene promoter identified a GC-rich site at -106 to -100 that bound Sp1 protein, and hormone-induced transactivation was associated with ER{alpha}/Sp1 action at this proximal Sp1-binding site. Thus, DNA polymerase {alpha} is one of an increasing number of genes regulated by ER{alpha}/Sp1 in breast cancer cells, and these include adenosine deaminase, insulin-like growth factor binding protein 4, retinoic acid receptor {alpha}1, c-fos, E2F1, thymidylate synthase, bcl-2, and cathepsin D (27, 28, 29, 30, 31, 32, 33, 34).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells, chemicals, and biochemicals
MCF-7 cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA). DME/F12 with and without phenol red, 100x antibiotic/antimycotic solution, and E2 were purchased from Sigma (St. Louis, MO). FCS was purchased from Intergen (Purchase, NY). [{gamma}-32P]ATP (3000 Ci/mmol) was purchased from NEN Life Science Products (Boston, MA). Poly[d(I-C)], restriction enzymes (HindIII, SphI, EagI, SacII), and T4-polynucleotide kinase were purchased from Roche Molecular Biochemicals (Indianapolis, IN). ICI 182,780 was kindly provided by Dr. A. Wakeling, AstraZeneca (Macclesfield, UK). Recombinant human Sp1 protein was purchased from Promega Corp. (Madison, WI) and human ER{alpha} protein was purchased from Panvera (Madison, WI). DNA polymerase {alpha} oligonucleotides were synthesized by Genosys (The Woodlands, TX). Human Sp1 and human Sp3 antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The DNA polymerase {alpha} monoclonal antibody was obtained from MBL International Corp. (Watertown, MA) and was prepared using the bovine protein as the immunogen. This antibody recognizes both human and bovine DNA polymerase {alpha} but does not cross-react with the rat, mouse, or rabbit protein. All other chemicals and biochemicals were the highest quality available from commercial sources. The synthetic DNA polymerase {alpha} oligonucleotides used in this study are shown below:

Oligo Sequence (sense)

DNAP5 5'AGCTTCCGGGGGCGGAGCGCGGCGCGGCGCGGC-ACGTCAGTGG 3'

DNAP5m1 5'AGCTTCCGGA*A*T*T*C*GAGCGCGGCG-CGGCGCGGCACGTCAGTGG 3'

DNAP5m2 5'AGCTTCCGGGGGCGGAGCGCGGCGCGGCGCGGC- C*T*C*G*A*G*GTGG 3'

DNA5Pm1m2 5'AGCTTCCGGA*A*T*T*C*GAGCGCGGCG-CGGCGCGGCC*T*C*G*A*G*GTCG 3'

Concensus Sp1 5'CGATCGGGGCGGAGCTTATTAGGCGAGC 3'

Concensus CRE 5'AGAGATTGCCTGACGTCAGAGAGCTAG 3'

Gel mobility shift assays
The oligonucleotides were annealed and end-labeled using T4-polynucleotide kinase and [{gamma}-32P]ATP. Nuclear extracts from MCF-7 cells were prepared as described previously (35). Gel shift reactions with nuclear proteins were carried out in 25 mM HEPES, 1.5 mM EDTA, 10% glycerol, 1.0 mM dithiothreitol, and 150 mM KCl in a final volume of 25 µl. Four micrograms of nuclear extracts from cells treated with 10 nM E2 for 2 h were incubated with 1 µg polydeoxyinosinic-deoxycytidylic acid for 15 min at 25 C to bind nonspecific DNA-binding proteins. After addition of [32P]-labeled DNA, the mixture was incubated for 15 min at 25 C. For competition assays, excess specific or nonspecific competitor oligonucleotide was added (100-fold) 5 min before addition of [32P]-labeled DNA. Reaction mixtures were loaded onto a 5% polyacrylamide gel and run at 110 V in 0.9 M Tris, 0.9 M borate, 2 mM EDTA (pH 8.0). Gels were dried and protein-DNA complexes were visualized by exposure to a phosphor screen for 16 h and subsequent scanning of the screen on a Molecular Dynamics, Inc. 860 Storm (Molecular Dynamics, Inc., Sunnyvale, CA). For supershift assays, before electrophoresis, gel shift reactions were incubated with 1.5 µg of either Sp1 or Sp3 antibodies, normal goat IgG, or normal rabbit IgG for 30 min on ice. Extracts were then subjected to electrophoresis and detected as described above.

Schneider cell maintenance and transfection
Drosophila Schneider cells (SL-2) were obtained from ATCC and maintained at room temperature in Schneider’s Drosophila Medium 1x (Life Technologies, Inc., Grand Island, NY) supplemented with heat-inactivated 5% FBS. Cells were subcultured every 2–3 days and seeded in 6- or 12-well plates at a 1:2 to 1:5 dilution of resuspended confluent cells from maintenance flasks. A pPac-Sp1 expression plasmid containing the complementary DNA (cDNA) of the human Sp1 protein (beginning at amino acid 83) was kindly provided by Dr. Robert Tijan (University of California-Berkeley). Empty pPac vector, used to normalize the amount of DNA transfected in each well, was obtained by excising the XhoI restriction fragment of Sp1 from pPac-Sp1, and re-ligating the vector. Plasmid pPac-hER{alpha} was constructed by digesting an hER{alpha} expression plasmid (courtesy of Dr. Ming-Jer Tsai, Baylor College of Medicine, Houston, TX) with EcoRI and ligating the 1.8-kb fragment into XhoI-linearized pPac using appropriate XhoI linkers to keep codons in-frame. The SL-2 expression plasmid containing only the DNA binding domain (DBD) of Sp1 was derived from pPacSp1 which was digested with BamHI to remove the activation domain of Sp1. The reaction was treated with mung bean nuclease in 1x mung bean nuclease buffer to remove the 5'-sticky ends. After gel purification, the blunt-ended, linear plasmid containing the DBD of Sp1 was recircularized by ligation to become a vector that contains an in-frame DBD of Sp1 cDNA (pPacDBD); the correct direction and sequence of this construct was confirmed by restriction mapping and DNA sequencing. For SL-2 cell transfection studies, 2 ml of cells per well were pipetted into six-well plates, and after incubation for 24 h at 20 C, cells in each well were transfected with 0.5 ml of transfection cocktail containing 1 µg of reporter plasmid, different amount of pPachER, pPacSp1, or pPacDBD, 250 ml of 2x HBS, and 15 µl of 2.5 M CaCl2. The empty vector, pPac, was used to make total amount of plasmid to be 3 µg. After incubation for 20 h at room temperature, cells were treated with 10-8 M E2 or solvent carrier [dimethylsulfoxide (DMSO)] for about 48 h and harvested by manual scraping, in 1x lysis buffer (Promega Corp.). Luciferase activity in cell lysates was determined using the Promega Corp. luciferase assay buffer and {beta}-galactosidase activity was determined using the Tropix Galacto-Light Plus assay system (Tropix, Bedford, MA) in a Lumicount microwell plate reader (Packard Instruments Co.). Relative luciferase activity was normalized to {beta}-galactosidase units for each transfection and protein levels were determined by the method of Bradford (36).

Plasmids
pDPAL{Delta}5' (pDNAP1) was kindly provided by Dr. Teresa Wang from the Department of Pathology, Stanford University School of Medicine (6, 8). Deletion constructs were prepared in this laboratory by digestion of pDPAL{Delta}5' with HindIII and SphI (pDNAP2), HindIII and SacII (pDNAP3), HindIII and EagI (pDNAP4), gel purification and re-ligation of the parental plasmids. A synthetic oligonucleotide (-109 to -73) fragment was inserted into the pXP1-luciferase vector into which a TATA promoter was previously cloned (pXP1-TATA-luc) resulting in pDNAP5. pDNAP5 mutants were constructed by cloning synthetic oligonucleotide fragments (-109 to -73) in which the Sp1 (pDNAP5m1), ATF (pDNAP5m2), and both (pDNAP5m1m2) sites were mutated into pXP1-TATA-luc. The hE11 construct expressing a DNA binding domain deficient human ER{alpha} was obtained from Dr. Pierre Chambon (INSERM, Strasbourg, France). The construct expressing the dominant negative Sp1 protein, and its corresponding empty vector (pBGNSp1 and pBGEN0) were provided courtesy of Dr. Gerald Thiel (Saarland, Germany).

Cell culture and transfection assays
MCF-7 cells were maintained in DME (Life Technologies, Inc.) supplemented with 5% FBS, 2.2 g/liter sodium bicarbonate, and 10 ml/liter antibiotic/antimycotic solution (Sigma). Cells for transient transfection assays were seeded in DME-F12 without phenol red (Sigma) supplemented with 5% dextran-charcoal stripped FBS, 2.2 g/liter sodium bicarbonate, and 10 ml/liter antibiotic/antimycotic solution (Sigma). Two days after seeding in DME-F12 without phenol red with 5% stripped FBS, 1 µg pDNAP plasmid, 2 µg hER expression plasmid, and 0.75 µg pCMV-lacZ were cotransfected into cells by calcium phosphate precipitation. Eighteen hours after transfection, the media were removed and fresh media containing the appropriate chemicals was added. Cells were grown for an additional 2 days before harvesting for luciferase assays. Luciferase assays were performed using the Luciferase Assay System with Reporter Lysis Buffer from Promega Corp. {beta}-Galactosidase activity was determined using the luminescent Galacton-plus assay system from Tropix (Bedford, MA). The intensity of light emission from assays of cell extracts containing constant protein was determined using a Packard LumiCount luminometer.

In vitro SssI footprinting with nuclear extracts (37, 38)
Fifty micrograms of plasmid pDPAL{Delta}5' (which contains a 1515-bp portion of the DNA polymerase {alpha} promoter) was restricted with HindIII and diluted to a concentration of 10 ng/µl. One microliter of the diluted plasmid was incubated with varying concentrations of E2-treated MCF-7 cell nuclear extract in 1x MS buffer (5% glycerol, 17.65 mM MgCl2, 0.18 mM S-adenosylmethionine, 5 mM DTT). The binding reactions were incubated on ice for 5 min and then equilibrated to room temperature for 20 min. Two microliters of 1:4 dilution of purified SssI (New England Biolabs, Inc., Beverly, MA) was added to the equilibrated reactions which were then incubated at 30 C for 45 min. After 15 min at 75 C, 10 µl of freshly made deamination denaturation buffer (0.9 N NaOH, 25 mM EDTA, 0.2 mg of sheared salmon sperm DNA) was added. Following incubation for 5 min at 98 C, the samples were processed as described by Kladde et al. (37, 38). The primers used to amplify from the purified deaminated plasmid DNA were Pol{alpha}a1 (5'-AAACACCAACCTAAAAACCAATC-3') and Pol{alpha}a2 (5'-TATTATATTAGGAGGTATATG AGA-3'). PCR products were processed using the Wizard PCR Prep Kit (Promega Corp., Madison, WI) and sequenced with radiolabeled Pol{alpha}a1 primer in the presence of a 5 µM solution of dATP, dCTP, and dTTP using 50 µM ddGTP as the stop nucleotide. Sequitherm 10x buffer and Sequitherm Thermostable DNA Polymerase (Epicentre Technologies, Madison, WI) were used in the reactions; 2 µl of each sequencing reaction was run on a 6% polyacrylamide-urea sequencing gel. The dried gels were exposed to a phosphor screen for 12 h and analyzed on a Molecular Dynamics, Inc. Storm 860 instrument.

In vitro SssI footprinting with recombinant proteins
Fifty micrograms of plasmid pDPAL{Delta}5' (which contains a 1515-bp portion of the DNA polymerase {alpha} promoter) was restricted with HindIII and diluted to a concentration of 10 ng/µl. One microliter of the diluted plasmid was incubated with increasing concentrations of pure Sp1 protein (Promega Corp. Madison WI), increasing concentrations of pure ER protein (Panvera, Madison, WI), and both Sp1 and ER proteins. Binding reactions were carried out in 1x NS binding buffer (0.02 M HEPES, 0.1 M KCl, 0.005 M MgCl2, 0.004 mM EDTA, 5% Glycerol, 50 mM SAM) in a volume of 25 µl. The binding reactions were incubated on ice for 5 min and then equilibrated to room temperature for 10 min; 2 µl of 1:2 dilution of purified SssI (New England Biolabs, Inc.) were added to the equilibrated reactions which were then incubated at 30 C for 5 min. After 15 min at 75 C, 10 µl of freshly made deamination denaturation buffer (0.9 N NaOH, 25 mM EDTA, 0.2 mg/ml of sheared salmon sperm DNA) were added. Samples were then processed as described above for the nuclear extract SssI footprinting.

Ribonuclease protection assay
Cells were plated into 100 mm Petri dishes and cultured in 5% stripped serum for 24 h, then synchronized for 2 days, and treated with DMSO (control) and 1 nM E2 for various times. A solution of RNAzol B (Tel-Test, Inc., Friendswood, TX) was added, cells were scraped from the plates, and total RNA was extracted. Using a T7 promoter sequence appended to 5' of the reverse PCR primers, the PCR products of DNA polymerase {alpha} and {beta}-actin cDNAs were in vitro transcribed to [{alpha}-32P]UTP-labeled complementary RNAs (cRNAs) by a T7 RNA polymerase using the standard protocol as described in the assay kit (Ambion, Inc., Austin, TX). The 324 nucleotide (nt) and 306 nt riboprobes were complementary to the coding region of DNA polymerase {alpha} (from 579 to 903) and {beta}-actin (144 to 450) mRNAs. The ribonuclease protection assay was also carried out using the assay kit procedures (Ambion, Inc., Austin, TX). Briefly, total RNA (30 µg) was incubated for 15 min at 68 C with 80,000 cpm of gel purified [{alpha}-32P]UTP-labeled cRNAs in 10 µl hybridization buffer. After hybridization, samples were digested with ribonuclease A/T1 in 100 µl RNase digestion buffer for 30 min at 37 C and terminated by the addition of 150 µl Inactivation/Precipitation mix. The mixture was precipitated, denatured, and electrophoresed on a 5% polyacrylamide gel containing 8 M urea. The gel was dried and exposed to x-ray film for 24 h. Levels of protected cRNA probe were standardized relative to protected {beta}-actin cRNA probe in the same sample, and band intensities were determined on Betagen Betascope 603 blot analyzer (Intelligenetics, Inc., Mountain View, CA) or autoradiography using X-Omat film (Eastman Kodak Co., Rochester, NY). Quantitation of band intensities used a Zero-D software package (Molecular Dynamics, Inc., Sunnyvale, CA) and a JX-330 scanner (Sharp Electronics, Mahwah, NJ).

Immunocytochemistry
MCF-7 cells were seeded in Lab-Tek Chamber Slides (Nalge Nunc International, Naperville, IL) at 50,000 cells/well in DME-F12 supplemented with 5% serum. After 12 h, cells were grown in serum free conditions for 48 h and treated with 100 nM E2 or vehicle (DMSO) in 0.5% serum for 10 h. The media chamber was detached according to the manufacturer’s instructions and the remaining glass slides were washed in Dulbecco’s PBS supplemented with calcium chloride and magnesium chloride. After washing, the glass slides were fixed in 0.2% paraformaldehyde (EMS, Fort Washington, PA) in 0.02 M PBS for 10 min. The slides were then washed in 0.02 M PGS for 5 min (2x), and subsequently permeabilized with 1% Triton X-100 (Sigma) in 0.02 M PBS for 10 min. The cells were washed for 5 min (3x) with 0.3% Tween 20 (Sigma) in 0.02 M PBS before blocking with 5% mouse serum in antibody dilution buffer (1% BSA, 0.3% Tween 20, 0.02 M PBS) for 30 min at room temperature. After removal of blocking cocktail, antibovine DNA polymerase {alpha} monoclonal antibody IgG1-FITC (MBL International Corp.) was added 1:15 in antibody dilution buffer and incubated overnight at 4 C. Slides were washed for 10 min (3x) with 0.3% Tween 20 in 0.02 M PBS and rinsed in doubly deionized water before mounting. Glass slides were processed as recommended in the manufacturer’s instructions. Slides were mounted in ProLong antifading medium (Molecular Probes, Inc., Eugene, OR) and coverslips were sealed using Nailslicks nail polish (Noxell Corp., Hunt Valley, MD). Fluorescence imaging was performed using Carl Zeiss Axiophot 2 (Carl Zeiss, Inc., Thornwood, NY) microscope with a Hamamatsu C5810 camera (Hamamatsu Photonics, Bridgewater, NJ). Images were captured using Adobe Photoshop 5.5 using identical camera settings. Nuclei from at least 500 cells per treatment were compared using NIH Image following adjustment of images to background. Values determined represent mean nuclear fluorescence intensity ± SEM.

Statistics
Results are expressed as means ± SE for at least three independent (replicate) experiments for each treatment group. Statistical significance was determined by ANOVA and Student’s t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ER{alpha}-dependent induction of DNA polymerase {alpha}
Treatment of MCF-7 cells with E2 for 1, 6, 12, and 24 h resulted in a >4-fold increase of DNA polymerase {alpha} mRNA levels at the 6 h time point (Fig. 1AGo). Results in Fig. 1BGo illustrate cell-type dependent basal luciferase activity in seven different cell lines transiently transfected with pDNAP1, which contains a -1515 to +45 DNA polymerase {alpha} gene promoter insert linked to a luciferase reporter gene. Activity in three cell lines was relatively high (HEC1A > MCF-7 > T47D), and these cell lines all express ER{alpha}. Basal luciferase activity in the four remaining cell lines was <5% of the response observed in HEC1A cells (MDA-MB-231 ~ MDA-MB-453 > CV1 > HeLa). In cells cotransfected with pDNAP1 plus ER{alpha} expression plasmid, E2 significantly induced luciferase activity only in T47D (5.2-fold), MCF-7 (2.8-fold) and MDA-MB-453 (2.5-fold) cells. An elevated response (1.8-fold) was also observed in CV-1 cells; however, due to the low basal activity, this induction was not significant. Cotransfection with ER{alpha} expression plasmid alone (2 µg) did not markedly affect basal activity in these cells. Due to overexpression of the pDNAP constructs and limiting levels of ER{alpha} in these cells, E2-responsiveness was observed only after cotransfection with ER{alpha}. Similar results have been observed in other studies in ER-positive MCF-7/T47D breast cancer cells using constructs containing promoter inserts from other E2-responsive genes including pS2, progesterone receptor, c-fos, cathepsin D, and constructs from gene promoters regulated through ER{alpha}/AP1 with AP1 elements and ER{alpha}/Sp1 interactions with GC-rich sites (27, 28, 29, 30, 31, 32, 33, 34, 39, 40, 41, 42, 43, 44, 45) Deletion analysis of the DNA polymerase {alpha} gene promoter (Fig. 1CGo) showed that basal luciferase activity varied by <2-fold using the pDNAP1 (-1515 to +45), pDNAP2 (-248 to +45) and pDNAP3 (-116 to +45) constructs, whereas activity was significantly decreased using pDNAP4 (-65 to +45). In cells cotransfected with ER{alpha}, E2 induced luciferase activity with pDNAP1, pDNAP2, and pDNAP3, but not pDNAP4, suggesting that elements associated with the -116 to -65 region of the promoter are required for hormone-mediated responses and for basal activity of these constructs. The results obtained with pDNAP4 showed some induction by E2 but this was not significant; however, some downstream sequences may contribute to transcriptional activation by E2.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. E2 responsiveness of DNA polymerase {alpha}. A, Ribonuclease protection assay. Total RNA (30 µg) prepared from DMSO and 1 nM E2-treated MCF-7 cells at various time points was hybridized with radiolabeled DNA polymerase {alpha} and {beta}-actin cRNA probes. Undigested DNA polymerase {alpha} (324 nt, lane 3) and {beta}-actin (306 nt, lane 1) probes, ribonuclease-digested probes (negative control, lane 2), and protected DNA polymerase {alpha} and {beta}-actin cRNA probes (lanes 4–11) were electrophoresed on a 5% polyacrylamide gel contain 8 M urea. After autoradiography, percent expression levels of the 324 nt protected DNA polymerase {alpha} cRNA was standardized relative to protected {beta}-actin cRNA probe as described in Materials and Methods. B, Cell context dependence. pDNAP1 was cotransfected with hER in 7 different cell lines. Cells were then dosed with DMSO (C) or 10 nm E2 and luciferase activity was determined as described in Materials and Methods. C, Deletion analysis. pDNAP1 and three deletion constructs pDNAP2, pDNAP3, and pDNAP4 were cotransfected with hER into MCF-7 breast cancer cells and luciferase activity was determined as described in Materials and Methods. *, Significant (P < 0.05) E2-induced responses. Results are expressed as means ± SE for three separate determinations.

 
Protein interactions with the DNA polymerase {alpha} promoter
The hormone responsive region of the DNA polymerase {alpha} gene promoter was used in gel mobility shift assays to determine binding of proteins from MCF-7 cell nuclear extracts (Fig. 2Go). The two major binding motifs include a GC-rich element that may bind Sp1 and Sp1-like proteins and a CRE. Binding of [32P]DNAP5 (-109 to -73) gave a broad intense band and a lower molecular weight band (labeled Sp1 and Sp3) (lane 4) that was not affected by coincubation with 100-fold excess unlabeled CRE oligonucleotide (lane 2), nonspecific goat IgG (lane 5), or rabbit IgG (lane 7). In contrast, a consensus Sp1 oligonucleotide decreased intensity of the retarded bands (lane 3), Sp1 antibodies supershifted a major part of the broad retarded band (lane 6, Sp1-ss) and Sp3 antibodies immunodepleted two Sp3-related bands (lane 8), but the supershifted complex could not be detected. Retarded bands associated with binding of nuclear extracts with a radiolabeled consensus Sp1 oligonucleotide (lane 9) and Sp1 antibodies (lane 10) gave a banding pattern similar to that observed for [32P]DNAP5 (lanes 3 and 6). Incubation of nuclear extracts with [32P]DNAP5m1 containing mutations in the GC-rich sequence formed only diffuse bands (lanes 11 and 12), whereas [32P]DNAP5m2 (mutation of the CRE site) formed complexes (lanes 13 and 14) similar to that observed for the wild-type oligonucleotide. The results suggest that Sp1 and Sp3 proteins from nuclear extracts preferentially bind to the hormone-responsive region of the DNA polymerase {alpha} gene promoter. ER did not bind [32P]DNAP5, and it has previously been reported for other GC-rich oligonucleotides from E2-responsive genes that ER{alpha} enhances Sp1-DNA binding but does not form a ternary complex (27, 28, 29, 30, 31, 32, 33, 34, 46). The failure to form an ER{alpha}/Sp1-DNA supershifted complex has been observed for other interacting proteins, including human T cell leukemia virus, type I Tax, sterol regulatory element-binding protein, and cyclin D1, enhanced binding of bZIP, Sp1, and ER to their cognate enhancer elements (47, 48, 49). Tax also enhances AP1 and cAMP-responsive element binding protein-DNA interactions without forming supershifted bands (50, 51). Additional insight on ER{alpha}/Sp1 interactions with the DNA polymerase {alpha} gene promoter are illustrated below in the footprinting assays.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 2. Sp1 and Sp3 binding to the DNA Polymerase {alpha} region from -106 to -73. Consensus Sp1 (lanes 9 and 10), DNAP5 (lanes 1 and 8), DNAP5m1 (lanes 11 and 12), and DNAP5m2 (lanes 13 and 14) oligonucleotides were incubated with nuclear extracts from E2-treated MCF-7 breast cancer cells. Retarded band formation was observed with DNAP5, DNAP5m2, and consensus Sp1, but not with DNAP5m1; 100-fold excess of unlabeled CRE oligonucleotide did not decrease the complex formation with DNAP5 (lane 4), whereas 100-fold excess of unlabeled Sp1 oligonucleotide decreased intensities of retarded bands formed by radiolabeled DNAP5 and DNAP5m2 (lanes 3 and 14, respectively). Sp1 antibody supershifted a large portion of the major complex formed by [32P]DNAP5 (lane 6) and consensus Sp1 (lane 10) oligonucleotides. Sp3 antibody immunodepleted a portion of the major complex and a faster migrating band formed by DNAP5 (lane 8). The pattern of retarded bands formed by DNAP5, DNAP5m2, and consensus Sp1 oligonucleotides were identical.

 
Analysis of the DNA polymerase {alpha} gene promoter
Previous studies have demonstrated the role of ER{alpha}/Sp1 as a hormone-induced transcription factor that interacts with GC-rich elements and does not require direct DNA binding by ER{alpha} (27, 28, 29, 30, 31, 32, 33, 34). The results in Fig. 3AGo summarize E2-responsiveness of wild-type and mutant constructs containing mutations in the GC-rich and CRE sites in the -109 to -73 region of the promoter. E2 induces luciferase activity in MCF-7 cells transfected with ER{alpha} and pDNAP5 (wild-type) or pDNAP5m2 (CRE mutant), but no induction was observed with pDNAP5m1 (GC-rich mutant) or pDNAP5m3 (GC-rich and CRE mutant). These results confirm that the GC-rich site is required for E2-responsiveness and for basal activity of these constructs. The role of ER{alpha}/Sp1 was also investigated in cells cotransfected with ER{alpha} and pBGEN0 and pBGENSp1 expression plasmids that contain a control empty vector and a dominant negative Sp1 construct that expresses a protein that binds DNA but does not transactivate (Fig. 3BGo). Expression of the dominant form of Sp1 completely inhibited ER{alpha}/Sp1 action. Moreover, E2 also induces luciferase activity in MCF-7 cells cotransfected with a DNA-binding domain-deficient mutant of ER{alpha} (HE11) plus pDNAP1 or pDNAP3, and the antiestrogen ICI 182,780 inhibited the induced response (Fig. 3CGo). Previous studies using E2-responsive GC-rich promoter for other genes gave similar responses (27, 28, 29, 30, 31, 32) confirming that DNA binding by ER{alpha} is not required for transactivation, and this is consistent with ER{alpha}/Sp1 action through GC-rich sites.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 3. The GC box in -106 to -100 is necessary and sufficient for E2-responsiveness of pDNAP5. A, Mutational analysis. Synthetic oligonucleotides containing mutations in either the GC-rich, CRE, or both sites were cloned into pXP1-TATA-luc, transfected into MCF-7 cells, and dosed with either DMSO or 10 nm E2 and luciferase activity was determined as described in Materials and Methods. E2 significantly (P < 0.05) induced constructs containing intact GC-rich sites. B, Effect of a dominant mutant of Sp1. pDNAP1 was cotransfected with hER, and either empty vector (pBGEN0) or the vector expressing a dominant negative mutant of Sp1 (pBGNSp1) and luciferase activity was determined as described in Materials and Methods. Dominant negative Sp1 expression significantly (P < 0.05) decreased hormone-responsiveness. C, Effect of cotransfecting a DNA binding deficient hER. pDNAP1 or pDNAP3 were cotransfected with HE11, a DNA binding deficient ER{alpha} and luciferase activity was determined as described in Materials and Methods. Significant induction (*, P < 0.05) was observed with HE11, and ICI 182,780 inhibited these responses.

 
DNA footprinting assays
SssI is a CpG viral methylase that converts a 5'-cytosine to a 5-methylcytosine and can be used as a highly sensitive probe for footprinting weak protein-DNA interactions (37, 38). The proximal GC-rich site in the DNA polymerase {alpha} promoter contains a CpG site (•) and incubation of pDNAP1 with increasing amounts of nuclear extracts from MCF-7 showed some protection at the Sp1 binding site (Fig. 4AGo) as well as the upstream DRE and AP2 sites. Incubation with different amounts of recombinant human ER{alpha} and Sp1 protein (Fig. 4BGo, lanes 2–4 and 5–7, respectively) showed that ER{alpha} alone did not protect from CpG methylation by SssI, whereas significant protection was observed for Sp1 at the two highest concentrations (20 and 40 ng), but not using 10 ng. Sp1 protein alone also inhibited methylation at other sites with this region of the promoter. Interactions of ER{alpha} and Sp1 proteins using the low amount Sp1 protein (10 ng) and increasing amounts of ER{alpha} (100–400 fmol) (lanes 8–10) showed that both proteins synergistically decreased methylation at the GC-rich site as well as other CpG sequences in the promoter. These studies were carried out in the absence of E2 because ER{alpha} and Sp1 physical interactions are ligand-independent (46). The extensive protection of multiple sites surrounding the GC-rich element after incubation with proteins demonstrates that binding of ER{alpha}/Sp1 at one site significantly influences protein accessibility both upstream and downstream from the E2-responsive GC-rich enhancer sequence, and this has previously been observed using other estrogen responsive elements (33, 34, 37, 38).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. In vitro SssI footprinting of the DNA polymerase {alpha} gene promoter. A, Nuclear extract footprints. pDNAP1 was incubated with increasing concentrations of E2-treated MCF-7 nuclear extracts (lanes 2 and 3) or no protein (lane 1) in the presence of SssI methylase. B, Pure protein footprints and ER-enhancement of Sp1 binding. pDNAP1 was incubated with SssI and increasing concentrations of pure ER protein (lanes 2–4), pure Sp1 protein (lanes 5–7), or increasing concentrations of pure ER protein in the presence of a subsaturating amount of pure Sp1 protein (lanes 8–10). Lane 1 is a control in which protein was not added. In the presence of 400 fmoles of pure ER{alpha} protein, 10 ng of pure Sp1 protein (lane 10) significantly protected the GC rich box and surrounding CpG sites compared with 10 ng of pure Sp1 protein alone (lane 5).

 
ER{alpha}/Sp1 interactions with pDNAP5 in SL-2 cells
Schneider SL-2 cells do not express ER{alpha} or Sp1 proteins, and this cell line was used to further investigate interactions of ER{alpha}/Sp1 with the DNA polymerase {alpha} gene promoter by transfection of pDNAP5. The results (Fig. 5Go) show that cotransfection with Sp1 expression plasmid and pDNAP5 resulted in a >13-fold increase in luciferase activity, whereas different amounts of ER{alpha} did not affect activity. However, luciferase activity observed in cells after transfection with Sp1 expression plasmid was enhanced by cotransfection with ER{alpha} demonstrating that ER{alpha}/Sp1 functionally interacts with the DNA polymerase {alpha} gene promoter.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 5. Interactions of Sp1 and ER{alpha} in Schneider SL-2 cells. A, Effects of Sp1 in cells transfected with pDNAP5. SL-2 cells were transfected with pPacSp1, pPacER{alpha}, or pPacDBD expression plasmid and pDNAP5 as described in Materials and Methods, and significant (P < 0.05) induction was only observed using 50, 200, and 1000 ng of Sp1 expression plasmid. B, Cotreatment with pPacSp1, pPacER{alpha}, or pPacDBD expression plasmids. Using the same protocol as described above, SL-2 cells were transfected with pDNAP5 plus pPacSp1 or pPacDBD alone (100 ng) or in combination with different amounts of pPacER{alpha} (0–2000 ng). Significant (P < 0.05) enhancement of luciferase activity was observed in SL-2 cells cotransfected with pPacSp1 (100 ng) plus pPacER{alpha} (20, 200, or 2000 ng) compared with cells transfected with pPacSp1 (100 ng) alone. Interactions between pPacDBD and pPacER{alpha} were not observed. All transfections using pPacER{alpha} used 10 nM E2.

 
Immunostaining of MCF-7 cells with DNA polymerase antibodies
The results in Fig. 6Go illustrate immunostaining of MCF-7 cells grown in the absence (A) or presence of 100 nM E2 (B) and in the absence of DNA polymerase {alpha} antibody (C). Relatively high background staining was observed in untreated cells (A); however, after treatment with E2, there was a >40% significant increase in staining, and this increase was observed in at least four experiments. In a separate experiment, antibody staining units (in parentheses) were obtained in MCF-7 cells treated with DMSO (323 ± 9.2), 100 nM E2 (359 ± 6.3), 1 µM ICI 182,780 (298 ± 4.6), and E2 plus ICI 182,780 (282 ± 3.5). E2 significantly (P < 0.05) induced immunostaining with DNA polymerase {alpha} antibodies, and this response was significantly decreased (P < 0.05) in cells cotreated with E2 plus ICI 182,780. Thus, hormone-induced expression of DNA polymerase {alpha} mRNA is accompanied by increased immunoreactive protein expression in MCF-7 cells.



View larger version (80K):
[in this window]
[in a new window]
 
Figure 6. Serum-deprived MCF-7 cells were dosed with either DMSO (A) or 100 nM E2 (B) in 0.5% serum for 10 h. Cells were then fixed and stained with DNA polymerase {alpha} antibody conjugated with fluorescein as described in Materials and Methods. As a control, antibody was deleted and antibody dilution buffer was used by itself (C). The antibody staining intensity units were 790 ± 153 (A) and 1125 ±; 196 (B) (means ± SE), and there was a significant (P < 0.05) increase in staining after treatment with E2.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
E2 induces proliferation of ER{alpha}-positive breast cancer cell lines, and this response is coupled to up-regulation of genes and/or activities important for cell growth. This study focused on the effects of estrogens on DNA polymerase {alpha} gene expression because cell growth is most often paralleled by increased uptake of nucleotides incorporated into cellular DNA, and this has previously been observed after treatment of MCF-7 cells with E2. In preliminary screening studies, we observed that E2 significantly induced DNA polymerase {alpha} mRNA levels (Fig. 1AGo), and a small but significant (>40%) increase in immunostained DNA polymerase {alpha} protein (Fig. 6Go), which was inhibited in cells cotreated with E2 plus ICI 812,780. These results are consistent with previous studies showing that, in MCF-7 cells, E2 also increased activities of enzymes associated with the biosynthesis of nucleotide precursors (20). Maximal induction of DNA polymerase {alpha} mRNA levels by E2 was observed after 6 h, and this delayed response was in contrast to maximal induction of early intermediate genes such as c-fos 1–2 h after treatment with E2 (28, 43).

Analysis of the DNA polymerase {alpha} gene promoter showed that basal activity was comparable using constructs containing gene promoter inserts from the -1515 to -248 region; however, a 40 to 50% decrease was observed after deletion of the -248 to -116 region, and any subsequent deletions gave constructs with minimal basal activity (Fig. 1BGo). These deletion studies were comparable to results obtained with similar constructs in cycling HeLa cells showing the importance of the region downstream from-248 for maintaining basal expression of DNA polymerase {alpha} (4, 8).

Hormone responsiveness of DNA polymerase {alpha} was determined by deletion and mutational analysis (Figs. 1Go and 3Go), and a GC-rich region (-106 to -100) that bound Sp1 and Sp3 (Fig. 2Go), but not ER{alpha}, proteins was required for activation by E2. Results obtained with DNA polymerase {alpha} gene promoter constructs also showed that transactivation in breast cancer cells could be observed with wild-type ER{alpha} and a DNA binding domain mutant (HE11) (Fig. 3CGo), and ER{alpha}/Sp1 action was inhibited by a dominant negative expression plasmid for Sp1 (Fig. 3BGo). Moreover, ER{alpha}/Sp1 interactions were also observed in Schneider SL-2 cells transfected with a construct (pDNAP5) containing the GC-rich site (Fig. 5Go). These results are consistent with a mechanism of DNA polymerase {alpha} activation by E2 that requires either wild-type ER{alpha} (or HE11) binding Sp1 protein which in turn binds GC-rich promoter elements. Ligand-activated ER{alpha} action that does not require direct receptor binding to estrogen-responsive elements has previously been observed with ER{alpha}-AP1 and ER{alpha}-Sp1 activation of genes/gene promoters (27, 28, 29, 30, 31, 32, 33, 34, 45, 46, 52, 53, 54). ER{alpha}-AP1 activates gene expression through interactions of ER{alpha} (or ER{beta}) with the AP1 transcription factor complex in which ER{alpha} physically interacts with c-jun but not fos proteins (45). Research in this laboratory has identified functional GC-rich sites in promoters of several E2-responsive genes that bind ER{alpha}/Sp1 (27, 28, 29, 30, 31, 32, 33, 34, 46) and both proteins also physically interact in a ligand-independent manner (46, 55). Interestingly, there are many differences in ligand-activated ER{alpha} interactions with Sp1 and AP1 proteins. For example, ER agonists/antagonists such as E2, tamoxifen and ICI 182,780 differentially activate both complexes; activation function 1 (AF1) is required for ER{alpha}/Sp1 (55), whereas both AF1 and AF2 are important for ER{alpha}/AP1 action (54).

The yeast SssI DNA methyltransferase has recently been developed as a sensitive bioassay for investigating protein-DNA interactions. This enzyme catalyzes methylation of CpG sites and can be used in both in vivo and in vitro DNA footprinting studies to determine protein interactions at these specific methylation sites (37, 38). Nuclear extracts from MCF-7 cells only weakly footprinted the GC-rich site (Fig. 4AGo) in the DNA polymerase {alpha} gene promoter; however, incubation with Sp1 protein alone footprinted this site, whereas incubation with ER{alpha} alone (100–400 fmol) had minimal effects on the footprint. Coincubation of ER{alpha} with an amount of Sp1 protein (10 ng) that minimally affected the footprint at the GC-rich region (e.g. lane 5) resulted in increased binding (lane 8) indicating that ER{alpha} enhanced the Sp1 protein footprint. We have observed similar interactions of ER{alpha}/Sp1 at functional GC-rich sites in the c-fos proto-oncogene and bcl-2 gene promoters using this in vitro footprint procedure and gel mobility shift assays (33, 34). ER{alpha} and Sp1 protein interactions with GC-rich sites are ligand independent, and the model proposed for hormone-induced transcriptional activation suggests that the ligand is important for recruiting other nuclear factors (55), and we are currently determining the identities and roles of ER{alpha}/Sp1 interacting proteins.

In summary, this study demonstrates that transcriptional activation of DNA polymerase {alpha} by E2 in MCF-7 breast cancer cells is dependent on ER{alpha}/Sp1 interaction with a GC-rich site at -106 to -100 in the promoter region of this gene. This activation pathway does not require direct interaction of ER{alpha} with promoter DNA. DNA polymerase {alpha} is one of an expanding number of genes regulated by the ER{alpha}/Sp1 complex in breast cancer cells (27, 28, 29, 30, 31, 32, 33, 34, 56, 57) and confirms the important role of Sp1 in mediating transcriptional activation by ligand-activated nuclear receptors, such as ER{alpha}, progesterone receptor and retinoic acid receptor, and ligand-independent orphan receptors such as COUP-TF (58, 59, 60, 61).


    Footnotes
 
1 This work was supported by the NIH (CA-76636 and ES-09106) and the Texas Agricultural Experiment Station. Back

Received May 31, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Burgers PMJ 1998 Eukaryotic DNA polymerases in DNA replication and DNA repair. Chromosoma 107:218–227[CrossRef][Medline]
  2. Wang TSF 1996 Cellular DNA polymerases. In: DePamphilis ML (ed) DNA Replication in Eukaryotic Cells. Cold Spring Harbor Laboratory Press, Plainview, NY, pp 461–493
  3. Dutta A, Bell S 1997 Initiation of DNA replication in eukaryotic cells. Annu Rev Cell Dev Biol 13:293–352[CrossRef][Medline]
  4. Wahl AF, Geis AM, Spain BH, Wong SW, Korn D, Wang TS 1988 Gene expression of human DNA polymerase {alpha} during cell proliferation and the cell cycle. Mol Cell Biol 8:5016–5025[Abstract/Free Full Text]
  5. Wong SW, Wahl AF, Yuan PM, Arai N, Pearson BE, Arai K, Korn D, Hunkapiller MW, Wang TS 1988 Human DNA polymerase {alpha} gene expression is cell proliferation dependent and its primary structure is similar to both prokaryotic and eukaryotic replicative DNA polymerases. EMBO J 7:37–47[Medline]
  6. Pearson BE, Nasheuer HP, Wang TS 1991 Human DNA polymerase {alpha} gene: sequences controlling expression in cycling and serum-stimulated cells. Mol Cell Biol 11:2081–2095[Abstract/Free Full Text]
  7. Voitenleitner C, Rehfuess C, Hilmes M, O’Rear L, Liao PC, Gage DA, Ott R, Nasheuer HP, Fanning E 1999 Cell cycle-dependent regulation of human DNA polymerase {alpha}-primase activity by phosphorylation. Mol Cell Biol 19:646–656[Abstract/Free Full Text]
  8. Nasheuer HP, Moore A, Wahl AF, Wang TS 1991 Cell cycle-dependent phosphorylation of human DNA polymerase {alpha}. J Biol Chem 266:7893–7903[Abstract/Free Full Text]
  9. Foiani M, Liberi G, Lucchini G, Plevani P 1995 Cell cycle-dependent phosphorylation and dephosphorylation of the yeast DNA polymerase {alpha}-primase B subunit. Mol Cell Biol 15:883–891[Abstract]
  10. Hayhurst GP, Bryant LA, Caswell RC, Walker SM, Sinclair JH 1995 CCAAT box-dependent activation of the TATA-less human DNA polymerase {alpha} promoter by the human cytomegalovirus 72-kilodalton major immediate-early protein. J Virol 69:182–188[Abstract]
  11. Dickson RB, Lippman ME 1988 Control of human breast cancer by estrogen, growth factors, and oncogenes. In: Lippman ME, Dickson RB (eds) Breast Cancer: Cellular and Molecular Biology. Kluwer Press, Boston, pp 119–166
  12. Dickson RB, Lippman ME 1991 Growth regulation of normal and malignant breast epithelium. In: Bland KI, Copeland EM (eds) The Breast. WB Saunders, Philadelphia, pp 363–394
  13. Dickson RB, Lippman ME 1995 Growth factors in breast cancer. Endocr Rev 16:559–589[Abstract/Free Full Text]
  14. Ethier SP 1995 Growth factor synthesis and human breast cancer progression. J Natl Cancer Inst 87:964–973[Abstract/Free Full Text]
  15. Foster JS, Wimalasena J 1996 Estrogen regulates activity of cyclin-dependent kinases and retinoblastoma protein phosphorylation in breast cancer cells. Mol Endocrinol 10:488–498[Abstract/Free Full Text]
  16. Planas-Silva MD, Weinberg RA 1997 Estrogen-dependent cyclin E-cdk2 activation through p21 redistribution. Mol Cell Biol 17:4059–4069[Abstract]
  17. Altucci L, Addeo R, Cicatiello L, Dauvois S, Parker MG, Truss M, Beato M, Sica V, Bresciani F, Weisz A 1996 17{beta}-Estradiol induces cyclin D1 gene transcription, p36D1-p34cdk4 complex activation and p105Rb phosphorylation during mitogenic stimulation of G1-arrested human breast cancer cells. Oncogene 12:2315–2324[Medline]
  18. Prall OWJ, Sarcevic B, Musgrove EA, Watts CKW, Sutherland RL 1997 Estrogen-induced activation of Cdk4 and Cdk2 during G1-S phase progression is accompanied by increased cyclin D1 expression and decreased cyclin-dependent kinase inhibitor association with cyclin E-Cdk2. J Biol Chem 272:10882–10894[Abstract/Free Full Text]
  19. Wang W, Smith R, Safe S 1998 Aryl hydrocarbon receptor-mediated antiestrogenicity in MCF-7 cells: modulation of hormone-induced cell cycle enzymes. Arch Biochem Biophys 356:239–248[CrossRef][Medline]
  20. Aitken SC, Lippman ME 1982 Hormonal regulation of net DNA synthesis in MCF-7 human breast cancer cells in tissue culture. Cancer Res 42:1727–1735[Abstract/Free Full Text]
  21. Aitken SC, Lippman ME 1983 Hormonal regulation of de novo pyrimidine synthesis and utilization in human breast cancer cells in tissue culture. Cancer Res 43:4681–4690[Abstract/Free Full Text]
  22. Aitken SC, Lippman ME 1985 Effect of estrogens and antiestrogens on growth-regulatory enzymes in human breast cancer cells in tissue culture. Cancer Res 45:1611–1620[Abstract/Free Full Text]
  23. Bronzert DA, Monaco ME, Pinkus L, Aitken S, Lippman ME 1981 Purification and properties of estrogen-responsive cytoplasmic thymidine kinase from human breast cancer. Cancer Res 41:604–610[Abstract/Free Full Text]
  24. Aitken SC, Lippman ME, Kasid A, Schoenberg DR 1985 Relationship between the expression of estrogen-regulated genes and estrogen-stimulated proliferation of MCF-7 mammary tumor cells. Cancer Res 45:2608–2615[Abstract/Free Full Text]
  25. Lippman ME, Dickson RB 1989 Mechanisms of growth control in normal and malignant breast epithelium. Recent Prog Horm Res 45:383–440
  26. Kasid A, Davidson NE, Gelmann EP, Lippman ME 1986 Transcriptional control of thymidine kinase gene expression by estrogens and antiestrogens in MCF-7 human breast cancer cells. J Biol Chem 261:5562–5567[Abstract/Free Full Text]
  27. Xie W, Duan R, Safe S 1999 Estrogen induces adenosine deaminase gene expression in MCF-7 human breast cancer cells: role of estrogen receptor-Sp1 interactions. Endocrinology 140:219–227[Abstract/Free Full Text]
  28. Duan R, Porter W, Safe S 1998 Estrogen-induced c-fos protooncogene expression in MCF-7 human breast cancer cells: role of estrogen receptor Sp1 complex formation. Endocrinology 139:1981–1990[Abstract/Free Full Text]
  29. Wang F, Hoivik D, Pollenz R, Safe S 1998 Functional and physical interactions between the estrogen receptor-Sp1 and the nuclear aryl hydrocarbon receptor complexes. Nucleic Acids Res 26:3044–3052[Abstract/Free Full Text]
  30. Qin C, Singh P, Safe S 1999 Transcriptional activation of insulin-like growth factor binding protein 4 by 17{beta}-estradiol in MCF-7 cells: role of estrogen receptor-Sp1 complexes. Endocrinology 140:2501–2508[Abstract/Free Full Text]
  31. Sun G, Porter W, Safe S 1998 Estrogen-induced retinoic acid receptor {alpha}1 gene expression: role of estrogen receptor-Sp1 complex. Mol Endocrinol 12:882–890[Abstract/Free Full Text]
  32. Wang W, Dong L, Saville B, Safe S 1999 Transcriptional activation of E2F1 gene expression by 17{beta}-estradiol in MCF-7 cells is regulated by NF-Y-Sp1/estrogen receptor interactions. Mol Endocrinol 13:1373–1387[Abstract/Free Full Text]
  33. Dong L, Wang W, Wang F, Stoner M, Reed JC, Harigai M, Kladde M, Vyhlidal C, Safe S 1999 Mechanisms of transcriptional activation of bcl-2 gene expression by 17{beta}-estradiol in breast cancer cells. J Biol Chem 174:32099–32107
  34. Duan R, Porter W, Samudio I, Vyhlidal C, Kladde M, Safe S 1999 Transcriptional activation of c-fos protooncogene by 17{beta}-estradiol: mechanism of aryl hydrocarbon receptor-mediated inhibition. Mol Endocrinol 13:1511–1521[Abstract/Free Full Text]
  35. Hoivik D, Willett K, Wilson C, Safe S 1997 Estrogen does not inhibit 2,3,7,8-tetraclorodibenzo-p-dioxin-mediated effects in MCF-7 and Hepa 1c1c7 cells. J Biol Chem 272:30270–30274[Abstract/Free Full Text]
  36. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  37. Kladde MP, Simpson RT 1996 Chromatin structure mapping in vivo using methyltransferases. Methods Enzymol 274:214–233[Medline]
  38. Kladde MP, Xu M, Simpson RT 1996 Direct study of DNA-protein interactions in repressed and active chromatin in living cells. EMBO J 15:6290–6300[Medline]
  39. Savouret JF, Bailly A, Misrahi M, Rarch C, Redeuilh G, Chauchereau A, Milgrom E 1991 Characterization of the hormone responsive element involved in the regulation of the progesterone receptor gene. EMBO J 10:1875–1883[Medline]
  40. Cavailles V, Augereau P, Rochefort H 1993 Cathepsin D gene is controlled by a mixed promoter, and estrogens stimulate only TATA-dependent transcription. Proc Natl Acad Sci USA 90:203–207[Abstract/Free Full Text]
  41. Cavailles V, Garcia M, Rochefort H 1989 Regulation of cathepsin D and pS2 gene expression by growth factors in MCF-7 human breast cancer cells. Mol Endocrinol 3:552–558[Abstract/Free Full Text]
  42. Zacharewski TR, Bondy KL, McDonell P, Wu ZF 1994 Antiestrogenic effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin on 17{beta}-estradiol-induced pS2 expression. Cancer Res 54:2707–2713[Abstract/Free Full Text]
  43. Weisz A, Rosales R 1990 Identification of an estrogen response element upstream of the human c-fos gene that binds the estrogen receptor and the AP-1 transcription factor. Nucleic Acids Res 18:5097–5106[Abstract/Free Full Text]
  44. Gillesby B, Santostefano M, Porter W, Wu ZF, Safe S, Zacharewski T 1997 Identification of a motif within the 5'-regulatory region on pS2 which is responsible for Ap1 binding and TCDD-mediated suppression. Biochemistry 36:6080–6089[CrossRef][Medline]
  45. Webb P, Lopez GN, Uht RM, Kushner PJ 1995 Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol Endocrinol 9:443–456[Abstract/Free Full Text]
  46. Porter W, Saville B, Hoivik D, Safe S 1997 Functional synergy between the transcription factor Sp1 and the estrogen receptor. Mol Endocrinol 11:1569–1580[Abstract/Free Full Text]
  47. Wagner SA, Green MR 1993 HTLV-1 Tax protein stimulation of DNA binding of bZIP proteins by enhancing dimerization. Science 266:395–399
  48. Sanchez HB, Yieh L, Osborne TF 1995 Cooperation by sterol regulatory element-binding protein and Sp1 in sterol regulation of low density lipoprotein receptor gene. J Biol Chem 270:1161–1169[Abstract/Free Full Text]
  49. Zwijsen RM, Wientjens E, Klompmaker R, van der Sman J, Bernards R, Michalides RJ 1997 CDK-independent activation of estrogen receptor by cyclin D1. Cell 88:405–415[CrossRef][Medline]
  50. Yamagata T, Mitani K, Ueno H, Kanda Y, Yazaki Y, Hirai H 1997 Triple synergism of human T-lymphotropic virus type 1-encoded tax, GATA-binding protein, and AP-1 is required for constitutive expression of the interleukin-5 gene in adult T-cell leukemia cells. Mol Cell Biol 17:4272–4281[Abstract]
  51. Lundblad JR, Kwok RPS, Laurance ME, Huang MS, Richards JP, Brennan RG, Goodman RH 1998 The human T-cell leukemia virus-1 transcriptional activator Tax enhances c-AMP-responsive element-binding protein (CREB) binding activity through interactions with the DNA minor groove. J Biol Chem 273:19251–19259[Abstract/Free Full Text]
  52. Uht RM, Anderson CM, Webb P, Kushner PJ 1997 Transcriptional activities of estrogen and glucocorticoid receptors are functionally integrated at the AP-1 response element. Endocrinology 138:2900–2908[Abstract/Free Full Text]
  53. Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ, Scanlan TS 1997 Differential ligand activation of estrogen receptors ER{alpha} and ER{beta} at AP1 sites. Science 277:1508–1510[Abstract/Free Full Text]
  54. Webb P, Nguyen P, Valentine C, Lopez GN, Kwok GR, McInerney E, Katzenellenbogen BS, Enmark E, Gustafsson J-Å, Nilsson S, Kushner PJ 1999 The estrogen receptor enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions. Mol Endocrinol 13:1672–1685[Abstract/Free Full Text]
  55. Saville B, Wormke M, Wang F, Nguyen T, Enmark E, Kuiper G, Gustafsson J-A, Safe S 2000 Ligand-, cell- and estrogen receptor subtype ({alpha}/{beta})-dependent activation at GC-rich (Sp1) promoter elements. J Biol Chem 275:5379–5387[Abstract/Free Full Text]
  56. Salvatori L, Ravenna L, Felli MP, Cardillo MR, Russo MA, Frati L, Gulino A, Petrangeli E 2000 Identification of an estrogen-mediated deoxyribonucleic acid-binding independent transactivation pathway on the epidermal growth factor receptor gene promoter. Endocrinology 141:2266–2274[Abstract/Free Full Text]
  57. Petz LN, Nardulli AM 2000 Sp1 binding sites and an estrogen response element half-site are involved in regulation of the human progesterone receptor A promoter. Mol Endocrinol 14:972–985[Abstract/Free Full Text]
  58. Rohr O, Aunis D, Schaeffer E 1997 COUP-TF and Sp1 interact and cooperate in the transcriptional activation of the human immunodeficiency virus type 1 long terminal repeat in human microglial cells. J Biol Chem 272:31149–31155[Abstract/Free Full Text]
  59. Pipaón C, Tsai SY, Tsai MJ 1999 COUP-TF upregulates NGFI-A gene expression through an Sp1 binding site. Mol Cell Biol 19:2734–2745[Abstract/Free Full Text]
  60. Suzuki Y, Shimada J, Shudo K, Matsumura M, Crippa MP, Kojima S 1999 Physical interactions between retinoic acid receptor and Sp1: mechanism for induction of urokinase by retinoic acid. Blood 93:4264–4276[Abstract/Free Full Text]
  61. Owen GI, Richer JK, Tung L, Takimoto G, Horwitz KB 1998 Progesterone regulates transcription of the p21WAF1 cyclin-dependent kinase inhibitor gene through Sp1 and CBP/p300. J Biol Chem 273:10696–10701[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
S. Safe and K. Kim
Non-classical genomic estrogen receptor (ER)/specificity protein and ER/activating protein-1 signaling pathways
J. Mol. Endocrinol., November 1, 2008; 41(5): 263 - 275.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. R. Hawse, M. Subramaniam, D. G. Monroe, A. H. Hemmingsen, J. N. Ingle, S. Khosla, M. J. Oursler, and T. C. Spelsberg
Estrogen Receptor {beta} Isoform-Specific Induction of Transforming Growth Factor {beta}-Inducible Early Gene-1 in Human Osteoblast Cells: An Essential Role for the Activation Function 1 Domain
Mol. Endocrinol., July 1, 2008; 22(7): 1579 - 1595.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
S. Khan, F. Wu, S. Liu, Q. Wu, and S. Safe
Role of specificity protein transcription factors in estrogen-induced gene expression in MCF-7 breast cancer cells
J. Mol. Endocrinol., October 1, 2007; 39(4): 289 - 304.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. G. Monroe, F. J. Secreto, J. R. Hawse, M. Subramaniam, S. Khosla, and T. C. Spelsberg
Estrogen Receptor Isoform-specific Regulation of the Retinoblastoma-binding Protein 1 (RBBP1) Gene: ROLES OF AF1 AND ENHANCER ELEMENTS
J. Biol. Chem., September 29, 2006; 281(39): 28596 - 28604.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. J. Higgins, S. Liu, M. Abdelrahim, K. Yoon, K. Vanderlaag, W. Porter, R. P. Metz, and S. Safe
Vascular Endothelial Growth Factor Receptor-2 Expression Is Induced by 17{beta}-Estradiol in ZR-75 Breast Cancer Cells by Estrogen Receptor {alpha}/Sp Proteins
Endocrinology, July 1, 2006; 147(7): 3285 - 3295.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. Kim, R. Barhoumi, R. Burghardt, and S. Safe
Analysis of Estrogen Receptor {alpha}-Sp1 Interactions in Breast Cancer Cells by Fluorescence Resonance Energy Transfer
Mol. Endocrinol., April 1, 2005; 19(4): 843 - 854.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
Y-L Zhao, W-D Han, Q Li, Y-M Mu, X-C Lu, L Yu, H-J Song, X Li, J-M Lu, and C-Y Pan
Mechanism of transcriptional regulation of LRP16 gene expression by 17-{beta} estradiol in MCF-7 human breast cancer cells
J. Mol. Endocrinol., February 1, 2005; 34(1): 77 - 89.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Khan, M. Abdelrahim, I. Samudio, and S. Safe
Estrogen Receptor/Sp1 Complexes Are Required for Induction of cad Gene Expression by 17{beta}-Estradiol in Breast Cancer Cells
Endocrinology, June 1, 2003; 144(6): 2325 - 2335.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. Kim, N. Thu, B. Saville, and S. Safe
Domains of Estrogen Receptor {alpha} (ER{alpha}) Required for ER{alpha}/Sp1-Mediated Activation of GC-Rich Promoters by Estrogens and Antiestrogens in Breast Cancer Cells
Mol. Endocrinol., May 1, 2003; 17(5): 804 - 817.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Abdelrahim, I. Samudio, R. Smith III, R. Burghardt, and S. Safe
Small Inhibitory RNA Duplexes for Sp1 mRNA Block Basal and Estrogen-induced Gene Expression and Cell Cycle Progression in MCF-7 Breast Cancer Cells
J. Biol. Chem., August 2, 2002; 277(32): 28815 - 28822.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. K. Lobenhofer, L. Bennett, P. L. Cable, L. Li, P. R. Bushel, and C. A. Afshari
Regulation of DNA Replication Fork Genes by 17{beta}-Estradiol
Mol. Endocrinol., June 1, 2002; 16(6): 1215 - 1229.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Castro-Rivera, I. Samudio, and S. Safe
Estrogen Regulation of Cyclin D1 Gene Expression in ZR-75 Breast Cancer Cells Involves Multiple Enhancer Elements
J. Biol. Chem., August 10, 2001; 276(33): 30853 - 30861.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-M. Sun, H. Y. Chen, and J. R. Davie
Effect of Estradiol on Histone Acetylation Dynamics in Human Breast Cancer Cells
J. Biol. Chem., December 21, 2001; 276(52): 49435 - 49442.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Saville, H. Poukka, M. Wormke, O. A. Janne, J. J. Palvimo, M. Stoner, I. Samudio, and S. Safe
Cooperative Coactivation of Estrogen Receptor alpha in ZR-75 Human Breast Cancer Cells by SNURF and TATA-binding Protein
J. Biol. Chem., January 18, 2002; 277(4): 2485 - 2497.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Samudio, I.
Right arrow Articles by Safe, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Samudio, I.
Right arrow Articles by Safe, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals