| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Gene Expression in MCF-7 Cells by 17
-Estradiol1
Department of Veterinary Physiology and Pharmacology (I.S., C.V., F.W., M.S., I.C., S.S.), Department of Biochemistry and Biophysics (I.S., C.V., M.K.), Department of Veterinary Anatomy and Public Health (R.Ba., R.Bu.), Texas A&M University, College Station, Texas 77843
Address all correspondence and requests for reprints to: Stephen H. Safe, Department of Veterinary Physiology and Pharmacology, Texas A&M University, College Station, Texas 77843-4466. E-mail: ssafe{at}cvm.tamu.edu
| Abstract |
|---|
|
|
|---|
-estradiol
(E2) results in increased DNA synthesis and cell
proliferation and enhanced enzyme activities associated with
purine/pyrimidine biosynthesis. The mechanism of enhanced DNA
polymerase
activity was investigated by analysis of the promoter
region of this gene. E2 induced luciferase (reporter gene)
activity in MCF-7 cells transfected with pDNAP1, pDNAP2, and pDNAP3
containing -1515 to +45, -248 to +45 and -116 to +45 inserts from
the DNA polymerase
gene promoter, whereas no induction was observed
with pDNAP4 (-65 to +45 insert). The induction response was dependent
on cotransfection with estrogen receptor
(ER
), and
transactivation was also observed with a mutant ER
that
did not express the DNA-binding domain. Subsequent functional, DNA
binding, and DNA footprinting studies showed that a GC-rich region at
-106 to -100 was required for E2-mediated
transactivation, and Sp1 protein, but not ER
, bound this
sequence. Transcriptional activation of DNA polymerase
by
E2 is associated with ER
/Sp1 action at a
proximal GC-rich promoter sequence, and this gene is among a growing
list of E2-responsive genes that are induced via
ER
/Sp1 protein interactions that do not require direct
binding of the hormone receptor to DNA. | Introduction |
|---|
|
|
|---|
, contains four
subunits and plays an important role in DNA replication
(1, 2, 3). Not surprisingly, stimulation of cell growth by
mitogens, induces a diverse spectrum of genes involved in the cell
cycle and DNA synthesis and this includes DNA polymerase
(4, 5, 6, 7). DNA polymerase
messenger RNA (mRNA) and
protein levels are constitutively expressed during the cell cycle,
whereas in serum-deprived cells levels are low but significantly
increased after serum is added (4). Analysis of the DNA
polymerase
gene promoter in cycling HeLa cells showed that the
region from -248 to the start site was required for maximal activity
of deletion constructs in transfection assays (6). The
region of the promoter downstream from -248 contains multiple
transcription factor binding sites including AP-2, AP-1, GC-rich,
E2F, ATF, and CCAAT motifs; however, a TATA box
is not present (6). Regulation of DNA polymerase
is
complex and may be dependent on phosphorylation of the expressed
protein or interactions of nuclear transcription factors with specific
promoter elements (4, 5, 6, 7, 8, 9, 10). For example, in some cell lines
infected with human cytomegalovirus an immediate early gene product
(IE1) interacts with CTF1, a transcription factor that binds the CCAAT
box, and synergistically enhances transactivation of DNA polymerase
in transient transfection assays (10).
Estrogens, growth factors, and other mitogens induce proliferation of
MCF-7 human breast cancer cells (11, 12, 13, 14), and the
estrogen-induced response is accompanied by activation of the cell
cycle and related enzymes/genes (15, 16, 17, 18, 19), enhanced
progression of cells from
G0/G1 to S and
G2/M phase, and increased DNA synthesis
(20, 21, 22, 23, 24, 25, 26). For example, in MCF-7 cells treated with
E2, there is increased activity and/or gene
expression of enzymes involved in nucleotide biosynthesis, and these
include thymidine kinase, dihydrofolate reductase, thymidylate
synthase, adenosine deaminase, carbamoyl phosphate synthetase, and
orotate pyrophosphorylase. Moreover, hormone treatment also induces DNA
synthesis as determined by increased incorporation of labeled
nucleotides into cellular DNA extracts (20, 21, 22, 23, 24, 25, 26). The
effects of E2 on DNA polymerase
have not
previously been reported, and this study shows that there is
time-dependent transcriptional activation of this gene after treatment
of MCF-7 cells with E2. Deletion analysis of the
DNA polymerase
gene promoter identified a GC-rich site at -106 to
-100 that bound Sp1 protein, and hormone-induced transactivation was
associated with ER
/Sp1 action at this proximal
Sp1-binding site. Thus, DNA polymerase
is one of an increasing
number of genes regulated by ER
/Sp1 in breast
cancer cells, and these include adenosine deaminase, insulin-like
growth factor binding protein 4, retinoic acid receptor
1,
c-fos, E2F1, thymidylate synthase,
bcl-2, and cathepsin D (27, 28, 29, 30, 31, 32, 33, 34).
| Materials and Methods |
|---|
|
|
|---|
-32P]ATP (3000 Ci/mmol) was purchased
from NEN Life Science Products (Boston, MA).
Poly[d(I-C)], restriction enzymes (HindIII,
SphI, EagI, SacII), and
T4-polynucleotide kinase were purchased from Roche Molecular Biochemicals (Indianapolis, IN). ICI 182,780 was kindly provided
by Dr. A. Wakeling, AstraZeneca (Macclesfield, UK).
Recombinant human Sp1 protein was purchased from Promega Corp. (Madison, WI) and human ER
protein was purchased from
Panvera (Madison, WI). DNA polymerase
oligonucleotides were
synthesized by Genosys (The Woodlands, TX). Human Sp1 and human Sp3
antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The DNA polymerase
monoclonal
antibody was obtained from MBL International Corp. (Watertown, MA) and
was prepared using the bovine protein as the immunogen. This antibody
recognizes both human and bovine DNA polymerase
but does not
cross-react with the rat, mouse, or rabbit protein. All other chemicals
and biochemicals were the highest quality available from commercial
sources. The synthetic DNA polymerase
oligonucleotides used in this
study are shown below: Oligo Sequence (sense)
DNAP5 5'AGCTTCCGGGGGCGGAGCGCGGCGCGGCGCGGC-ACGTCAGTGG 3'
DNAP5m1 5'AGCTTCCGGA*A*T*T*C*GAGCGCGGCG-CGGCGCGGCACGTCAGTGG 3'
DNAP5m2 5'AGCTTCCGGGGGCGGAGCGCGGCGCGGCGCGGC- C*T*C*G*A*G*GTGG 3'
DNA5Pm1m2 5'AGCTTCCGGA*A*T*T*C*GAGCGCGGCG-CGGCGCGGCC*T*C*G*A*G*GTCG 3'
Concensus Sp1 5'CGATCGGGGCGGAGCTTATTAGGCGAGC 3'
Concensus CRE 5'AGAGATTGCCTGACGTCAGAGAGCTAG 3'
Gel mobility shift assays
The oligonucleotides were annealed and end-labeled using
T4-polynucleotide kinase and [
-32P]ATP.
Nuclear extracts from MCF-7 cells were prepared as described previously
(35). Gel shift reactions with nuclear proteins were
carried out in 25 mM HEPES, 1.5 mM EDTA, 10%
glycerol, 1.0 mM dithiothreitol, and 150 mM KCl
in a final volume of 25 µl. Four micrograms of nuclear extracts from
cells treated with 10 nM E2 for
2 h were incubated with 1 µg polydeoxyinosinic-deoxycytidylic
acid for 15 min at 25 C to bind nonspecific DNA-binding proteins. After
addition of [32P]-labeled DNA, the mixture was
incubated for 15 min at 25 C. For competition assays, excess specific
or nonspecific competitor oligonucleotide was added (100-fold) 5 min
before addition of [32P]-labeled DNA. Reaction
mixtures were loaded onto a 5% polyacrylamide gel and run at 110 V in
0.9 M Tris, 0.9 M borate, 2 mM EDTA
(pH 8.0). Gels were dried and protein-DNA complexes were visualized by
exposure to a phosphor screen for 16 h and subsequent scanning of
the screen on a Molecular Dynamics, Inc. 860 Storm
(Molecular Dynamics, Inc., Sunnyvale, CA). For supershift
assays, before electrophoresis, gel shift reactions were incubated with
1.5 µg of either Sp1 or Sp3 antibodies, normal goat IgG, or normal
rabbit IgG for 30 min on ice. Extracts were then subjected to
electrophoresis and detected as described above.
Schneider cell maintenance and transfection
Drosophila Schneider cells (SL-2) were obtained from ATCC and
maintained at room temperature in Schneiders Drosophila Medium 1x
(Life Technologies, Inc., Grand Island, NY) supplemented
with heat-inactivated 5% FBS. Cells were subcultured every 23 days
and seeded in 6- or 12-well plates at a 1:2 to 1:5 dilution of
resuspended confluent cells from maintenance flasks. A pPac-Sp1
expression plasmid containing the complementary DNA (cDNA) of the human
Sp1 protein (beginning at amino acid 83) was kindly provided by Dr.
Robert Tijan (University of California-Berkeley). Empty pPac vector,
used to normalize the amount of DNA transfected in each well, was
obtained by excising the XhoI restriction fragment of Sp1
from pPac-Sp1, and re-ligating the vector. Plasmid pPac-hER
was
constructed by digesting an hER
expression plasmid (courtesy of Dr.
Ming-Jer Tsai, Baylor College of Medicine, Houston, TX) with
EcoRI and ligating the 1.8-kb fragment into
XhoI-linearized pPac using appropriate XhoI
linkers to keep codons in-frame. The SL-2 expression plasmid containing
only the DNA binding domain (DBD) of Sp1 was derived from pPacSp1 which
was digested with BamHI to remove the activation domain of
Sp1. The reaction was treated with mung bean nuclease in 1x mung bean
nuclease buffer to remove the 5'-sticky ends. After gel purification,
the blunt-ended, linear plasmid containing the DBD of Sp1 was
recircularized by ligation to become a vector that contains an in-frame
DBD of Sp1 cDNA (pPacDBD); the correct direction and sequence of this
construct was confirmed by restriction mapping and DNA sequencing. For
SL-2 cell transfection studies, 2 ml of cells per well were pipetted
into six-well plates, and after incubation for 24 h at 20 C, cells
in each well were transfected with 0.5 ml of transfection cocktail
containing 1 µg of reporter plasmid, different amount of pPachER,
pPacSp1, or pPacDBD, 250 ml of 2x HBS, and 15 µl of 2.5
M CaCl2. The empty vector,
pPac, was used to make total amount of plasmid to be 3 µg. After
incubation for 20 h at room temperature, cells were treated with
10-8
M E2 or solvent carrier
[dimethylsulfoxide (DMSO)] for about 48 h and harvested by
manual scraping, in 1x lysis buffer (Promega Corp.).
Luciferase activity in cell lysates was determined using the
Promega Corp. luciferase assay buffer and
-galactosidase activity was determined using the Tropix
Galacto-Light Plus assay system (Tropix, Bedford, MA) in a Lumicount
microwell plate reader (Packard Instruments Co.). Relative luciferase
activity was normalized to
-galactosidase units for each
transfection and protein levels were determined by the method of
Bradford (36).
Plasmids
pDPAL
5' (pDNAP1) was kindly provided by Dr. Teresa Wang from
the Department of Pathology, Stanford University School of Medicine
(6, 8). Deletion constructs were prepared in this
laboratory by digestion of pDPAL
5' with HindIII and
SphI (pDNAP2), HindIII and SacII
(pDNAP3), HindIII and EagI (pDNAP4), gel
purification and re-ligation of the parental plasmids. A synthetic
oligonucleotide (-109 to -73) fragment was inserted into the
pXP1-luciferase vector into which a TATA promoter was previously cloned
(pXP1-TATA-luc) resulting in pDNAP5. pDNAP5 mutants were constructed by
cloning synthetic oligonucleotide fragments (-109 to -73) in which
the Sp1 (pDNAP5m1), ATF (pDNAP5m2), and both (pDNAP5m1m2) sites were
mutated into pXP1-TATA-luc. The hE11 construct expressing a DNA binding
domain deficient human ER
was obtained from Dr. Pierre Chambon
(INSERM, Strasbourg, France). The construct expressing the dominant
negative Sp1 protein, and its corresponding empty vector (pBGNSp1 and
pBGEN0) were provided courtesy of Dr. Gerald Thiel (Saarland,
Germany).
Cell culture and transfection assays
MCF-7 cells were maintained in DME (Life Technologies, Inc.) supplemented with 5% FBS, 2.2 g/liter sodium bicarbonate,
and 10 ml/liter antibiotic/antimycotic solution (Sigma).
Cells for transient transfection assays were seeded in DME-F12 without
phenol red (Sigma) supplemented with 5% dextran-charcoal
stripped FBS, 2.2 g/liter sodium bicarbonate, and 10 ml/liter
antibiotic/antimycotic solution (Sigma). Two days after
seeding in DME-F12 without phenol red with 5% stripped FBS, 1 µg
pDNAP plasmid, 2 µg hER expression plasmid, and 0.75 µg pCMV-lacZ
were cotransfected into cells by calcium phosphate precipitation.
Eighteen hours after transfection, the media were removed and fresh
media containing the appropriate chemicals was added. Cells were grown
for an additional 2 days before harvesting for luciferase assays.
Luciferase assays were performed using the Luciferase Assay System with
Reporter Lysis Buffer from Promega Corp.
-Galactosidase
activity was determined using the luminescent Galacton-plus assay
system from Tropix (Bedford, MA). The intensity of light emission from
assays of cell extracts containing constant protein was determined
using a Packard LumiCount luminometer.
In vitro SssI footprinting with nuclear extracts (37, 38)
Fifty micrograms of plasmid pDPAL
5' (which contains a 1515-bp
portion of the DNA polymerase
promoter) was restricted with
HindIII and diluted to a concentration of 10 ng/µl. One
microliter of the diluted plasmid was incubated with varying
concentrations of E2-treated MCF-7 cell nuclear
extract in 1x MS buffer (5% glycerol, 17.65 mM
MgCl2, 0.18 mM
S-adenosylmethionine, 5 mM DTT). The binding
reactions were incubated on ice for 5 min and then equilibrated to room
temperature for 20 min. Two microliters of 1:4 dilution of purified
SssI (New England Biolabs, Inc., Beverly, MA) was added to
the equilibrated reactions which were then incubated at 30 C for 45
min. After 15 min at 75 C, 10 µl of freshly made deamination
denaturation buffer (0.9 N NaOH, 25
mM EDTA, 0.2 mg of sheared salmon sperm DNA) was
added. Following incubation for 5 min at 98 C, the samples were
processed as described by Kladde et al. (37, 38). The primers used to amplify from the purified deaminated
plasmid DNA were Pol
a1 (5'-AAACACCAACCTAAAAACCAATC-3') and Pol
a2
(5'-TATTATATTAGGAGGTATATG AGA-3'). PCR products were processed using
the Wizard PCR Prep Kit (Promega Corp., Madison, WI) and
sequenced with radiolabeled Pol
a1 primer in the presence of a 5
µM solution of dATP, dCTP, and dTTP using 50
µM ddGTP as the stop nucleotide. Sequitherm
10x buffer and Sequitherm Thermostable DNA Polymerase (Epicentre
Technologies, Madison, WI) were used in the reactions; 2 µl of each
sequencing reaction was run on a 6% polyacrylamide-urea sequencing
gel. The dried gels were exposed to a phosphor screen for 12 h and
analyzed on a Molecular Dynamics, Inc. Storm 860
instrument.
In vitro SssI footprinting with recombinant proteins
Fifty micrograms of plasmid pDPAL
5' (which contains a 1515-bp
portion of the DNA polymerase
promoter) was restricted with
HindIII and diluted to a concentration of 10 ng/µl. One
microliter of the diluted plasmid was incubated with increasing
concentrations of pure Sp1 protein (Promega Corp. Madison
WI), increasing concentrations of pure ER protein (Panvera, Madison,
WI), and both Sp1 and ER proteins. Binding reactions were carried out
in 1x NS binding buffer (0.02 M HEPES, 0.1
M KCl, 0.005 M
MgCl2, 0.004 mM EDTA, 5%
Glycerol, 50 mM SAM) in a volume of 25 µl. The
binding reactions were incubated on ice for 5 min and then equilibrated
to room temperature for 10 min; 2 µl of 1:2 dilution of purified SssI
(New England Biolabs, Inc.) were added to the equilibrated
reactions which were then incubated at 30 C for 5 min. After 15 min at
75 C, 10 µl of freshly made deamination denaturation buffer (0.9 N
NaOH, 25 mM EDTA, 0.2 mg/ml of sheared salmon
sperm DNA) were added. Samples were then processed as described above
for the nuclear extract SssI footprinting.
Ribonuclease protection assay
Cells were plated into 100 mm Petri dishes and cultured in 5%
stripped serum for 24 h, then synchronized for 2 days, and treated
with DMSO (control) and 1 nM E2 for
various times. A solution of RNAzol B (Tel-Test, Inc.,
Friendswood, TX) was added, cells were scraped from the plates, and
total RNA was extracted. Using a T7 promoter sequence appended to 5' of
the reverse PCR primers, the PCR products of DNA polymerase
and
-actin cDNAs were in vitro transcribed to
[
-32P]UTP-labeled complementary RNAs
(cRNAs) by a T7 RNA polymerase using the standard protocol as described
in the assay kit (Ambion, Inc., Austin, TX). The 324
nucleotide (nt) and 306 nt riboprobes were complementary to the coding
region of DNA polymerase
(from 579 to 903) and
-actin (144 to
450) mRNAs. The ribonuclease protection assay was also carried out
using the assay kit procedures (Ambion, Inc., Austin, TX).
Briefly, total RNA (30 µg) was incubated for 15 min at 68 C with
80,000 cpm of gel purified [
-32P]UTP-labeled
cRNAs in 10 µl hybridization buffer. After hybridization, samples
were digested with ribonuclease A/T1 in 100 µl RNase digestion buffer
for 30 min at 37 C and terminated by the addition of 150 µl
Inactivation/Precipitation mix. The mixture was precipitated,
denatured, and electrophoresed on a 5% polyacrylamide gel containing 8
M urea. The gel was dried and exposed to x-ray
film for 24 h. Levels of protected cRNA probe were standardized
relative to protected
-actin cRNA probe in the same sample, and band
intensities were determined on Betagen Betascope 603 blot analyzer
(Intelligenetics, Inc., Mountain View, CA) or
autoradiography using X-Omat film (Eastman Kodak Co.,
Rochester, NY). Quantitation of band intensities used a Zero-D software
package (Molecular Dynamics, Inc., Sunnyvale, CA) and a
JX-330 scanner (Sharp Electronics, Mahwah, NJ).
Immunocytochemistry
MCF-7 cells were seeded in Lab-Tek Chamber Slides (Nalge Nunc International, Naperville, IL) at 50,000 cells/well in
DME-F12 supplemented with 5% serum. After 12 h, cells were grown
in serum free conditions for 48 h and treated with 100
nM E2 or vehicle (DMSO) in 0.5%
serum for 10 h. The media chamber was detached according to
the manufacturers instructions and the remaining glass slides were
washed in Dulbeccos PBS supplemented with calcium chloride and
magnesium chloride. After washing, the glass slides were fixed in 0.2%
paraformaldehyde (EMS, Fort Washington, PA) in 0.02 M PBS
for 10 min. The slides were then washed in 0.02 M PGS for 5
min (2x), and subsequently permeabilized with 1% Triton X-100
(Sigma) in 0.02 M PBS for 10 min. The cells
were washed for 5 min (3x) with 0.3% Tween 20 (Sigma) in
0.02 M PBS before blocking with 5% mouse serum in antibody
dilution buffer (1% BSA, 0.3% Tween 20, 0.02 M PBS) for
30 min at room temperature. After removal of blocking cocktail,
antibovine DNA polymerase
monoclonal antibody IgG1-FITC (MBL
International Corp.) was added 1:15 in antibody dilution buffer and
incubated overnight at 4 C. Slides were washed for 10 min (3x) with
0.3% Tween 20 in 0.02 M PBS and rinsed in doubly deionized
water before mounting. Glass slides were processed as recommended in
the manufacturers instructions. Slides were mounted in ProLong
antifading medium (Molecular Probes, Inc., Eugene, OR) and
coverslips were sealed using Nailslicks nail polish (Noxell Corp., Hunt
Valley, MD). Fluorescence imaging was performed using Carl Zeiss Axiophot 2 (Carl Zeiss, Inc., Thornwood, NY)
microscope with a Hamamatsu C5810 camera (Hamamatsu Photonics,
Bridgewater, NJ). Images were captured using Adobe Photoshop 5.5 using
identical camera settings. Nuclei from at least 500 cells per treatment
were compared using NIH Image following adjustment of images to
background. Values determined represent mean nuclear fluorescence
intensity ± SEM.
Statistics
Results are expressed as means ± SE for at
least three independent (replicate) experiments for each treatment
group. Statistical significance was determined by ANOVA and Students
t test.
| Results |
|---|
|
|
|---|
-dependent induction of DNA polymerase 
mRNA levels at the 6 h time point (Fig. 1A
gene promoter insert linked
to a luciferase reporter gene. Activity in three cell lines was
relatively high (HEC1A > MCF-7 > T47D), and these cell
lines all express ER
. Basal luciferase
activity in the four remaining cell lines was <5% of the
response observed in HEC1A cells (MDA-MB-231
MDA-MB-453
> CV1 > HeLa). In cells cotransfected with pDNAP1 plus
ER
expression plasmid,
E2 significantly induced luciferase activity only
in T47D (5.2-fold), MCF-7 (2.8-fold) and MDA-MB-453 (2.5-fold) cells.
An elevated response (1.8-fold) was also observed in CV-1 cells;
however, due to the low basal activity, this induction was not
significant. Cotransfection with ER
expression plasmid alone (2
µg) did not markedly affect basal activity in these cells. Due to
overexpression of the pDNAP constructs and limiting levels of ER
in
these cells, E2-responsiveness was observed only
after cotransfection with ER
. Similar results have been observed in
other studies in ER-positive MCF-7/T47D breast cancer cells using
constructs containing promoter inserts from other
E2-responsive genes including pS2, progesterone
receptor, c-fos, cathepsin D, and constructs from gene
promoters regulated through ER
/AP1 with AP1 elements and ER
/Sp1
interactions with GC-rich sites (27, 28, 29, 30, 31, 32, 33, 34, 39, 40, 41, 42, 43, 44, 45) Deletion
analysis of the DNA polymerase
gene promoter (Fig. 1C
,
E2 induced luciferase activity with pDNAP1,
pDNAP2, and pDNAP3, but not pDNAP4, suggesting that elements associated
with the -116 to -65 region of the promoter are required for
hormone-mediated responses and for basal activity of these constructs.
The results obtained with pDNAP4 showed some induction by
E2 but this was not significant; however, some
downstream sequences may contribute to transcriptional activation by
E2.
|
promoter
gene
promoter was used in gel mobility shift assays to determine binding of
proteins from MCF-7 cell nuclear extracts (Fig. 2
gene promoter. ER
did not bind [32P]DNAP5, and it has previously
been reported for other GC-rich oligonucleotides from
E2-responsive genes that ER
enhances Sp1-DNA
binding but does not form a ternary complex (27, 28, 29, 30, 31, 32, 33, 34, 46).
The failure to form an ER
/Sp1-DNA supershifted complex has been
observed for other interacting proteins, including human T cell
leukemia virus, type I Tax, sterol regulatory element-binding protein,
and cyclin D1, enhanced binding of bZIP, Sp1, and ER to their cognate
enhancer elements (47, 48, 49). Tax also enhances AP1 and
cAMP-responsive element binding protein-DNA interactions without
forming supershifted bands (50, 51). Additional insight on
ER
/Sp1 interactions with the DNA polymerase
gene promoter are
illustrated below in the footprinting assays.
|
gene promoter
/Sp1 as a hormone-induced transcription
factor that interacts with GC-rich elements and does not require direct
DNA binding by ER
(27, 28, 29, 30, 31, 32, 33, 34). The
results in Fig. 3A
and pDNAP5 (wild-type) or pDNAP5m2 (CRE
mutant), but no induction was observed with pDNAP5m1 (GC-rich mutant)
or pDNAP5m3 (GC-rich and CRE mutant). These results confirm that the
GC-rich site is required for E2-responsiveness
and for basal activity of these constructs. The role of
ER
/Sp1 was also investigated in cells
cotransfected with ER
and pBGEN0 and pBGENSp1
expression plasmids that contain a control empty vector and a dominant
negative Sp1 construct that expresses a protein that binds DNA but does
not transactivate (Fig. 3B
/Sp1 action. Moreover,
E2 also induces luciferase activity in MCF-7
cells cotransfected with a DNA-binding domain-deficient mutant of
ER
(HE11) plus pDNAP1 or pDNAP3, and the
antiestrogen ICI 182,780 inhibited the induced response (Fig. 3C
is not
required for transactivation, and this is consistent with
ER
/Sp1 action through GC-rich sites.
|
promoter contains a CpG
site () and incubation of pDNAP1 with increasing amounts of nuclear
extracts from MCF-7 showed some protection at the Sp1 binding site
(Fig. 4A
and Sp1 protein (Fig. 4B
alone did
not protect from CpG methylation by SssI, whereas significant
protection was observed for Sp1 at the two highest concentrations (20
and 40 ng), but not using 10 ng. Sp1 protein alone also inhibited
methylation at other sites with this region of the promoter.
Interactions of ER
and Sp1 proteins using the
low amount Sp1 protein (10 ng) and increasing amounts of
ER
(100400 fmol) (lanes 810) showed that
both proteins synergistically decreased methylation at the GC-rich site
as well as other CpG sequences in the promoter. These studies were
carried out in the absence of E2 because ER
and Sp1
physical interactions are ligand-independent (46). The
extensive protection of multiple sites surrounding the GC-rich element
after incubation with proteins demonstrates that binding of
ER
/Sp1 at one site significantly influences
protein accessibility both upstream and downstream from the
E2-responsive GC-rich enhancer sequence, and this
has previously been observed using other estrogen responsive elements
(33, 34, 37, 38).
|
/Sp1 interactions with pDNAP5 in SL-2 cells
or Sp1 proteins, and
this cell line was used to further investigate interactions of
ER
/Sp1 with the DNA polymerase
gene promoter by transfection of
pDNAP5. The results (Fig. 5
did not affect activity. However, luciferase activity observed in
cells after transfection with Sp1 expression plasmid was enhanced by
cotransfection with ER
demonstrating that ER
/Sp1 functionally
interacts with the DNA polymerase
gene promoter.
|
antibody (C). Relatively high background staining
was observed in untreated cells (A); however, after treatment with
E2, there was a >40% significant increase
in staining, and this increase was observed in at least four
experiments. In a separate experiment, antibody staining units (in
parentheses) were obtained in MCF-7 cells treated with DMSO
(323 ± 9.2), 100 nM E2
(359 ± 6.3), 1 µM ICI 182,780 (298 ± 4.6),
and E2 plus ICI 182,780 (282 ± 3.5).
E2 significantly (P < 0.05)
induced immunostaining with DNA polymerase
antibodies, and this
response was significantly decreased (P < 0.05) in
cells cotreated with E2 plus ICI 182,780. Thus,
hormone-induced expression of DNA polymerase
mRNA is accompanied by
increased immunoreactive protein expression in MCF-7 cells.
|
| Discussion |
|---|
|
|
|---|
-positive breast cancer cell lines, and this
response is coupled to up-regulation of genes and/or activities
important for cell growth. This study focused on the effects of
estrogens on DNA polymerase
gene expression because cell growth is
most often paralleled by increased uptake of nucleotides incorporated
into cellular DNA, and this has previously been observed after
treatment of MCF-7 cells with E2. In preliminary
screening studies, we observed that E2
significantly induced DNA polymerase
mRNA levels (Fig. 1A
protein (Fig. 6
mRNA levels
by E2 was observed after 6 h, and this
delayed response was in contrast to maximal induction of early
intermediate genes such as c-fos 12 h after
treatment with E2 (28, 43).
Analysis of the DNA polymerase
gene promoter showed that basal
activity was comparable using constructs containing gene promoter
inserts from the -1515 to -248 region; however, a 40 to 50% decrease
was observed after deletion of the -248 to -116 region, and any
subsequent deletions gave constructs with minimal basal activity (Fig. 1B
). These deletion studies were comparable to results obtained with
similar constructs in cycling HeLa cells showing the importance of the
region downstream from-248 for maintaining basal expression of DNA
polymerase
(4, 8).
Hormone responsiveness of DNA polymerase
was determined by deletion
and mutational analysis (Figs. 1
and 3
), and a GC-rich region (-106 to
-100) that bound Sp1 and Sp3 (Fig. 2
), but not
ER
, proteins was required for activation by
E2. Results obtained with DNA polymerase
gene
promoter constructs also showed that transactivation in breast cancer
cells could be observed with wild-type ER
and
a DNA binding domain mutant (HE11) (Fig. 3C
), and
ER
/Sp1 action was inhibited by a dominant
negative expression plasmid for Sp1 (Fig. 3B
). Moreover, ER
/Sp1
interactions were also observed in Schneider SL-2 cells transfected
with a construct (pDNAP5) containing the GC-rich site (Fig. 5
). These
results are consistent with a mechanism of DNA polymerase
activation by E2 that requires either wild-type
ER
(or HE11) binding Sp1 protein which in turn binds GC-rich
promoter elements. Ligand-activated ER
action that does not require
direct receptor binding to estrogen-responsive elements has previously
been observed with ER
-AP1 and ER
-Sp1 activation of genes/gene
promoters (27, 28, 29, 30, 31, 32, 33, 34, 45, 46, 52, 53, 54). ER
-AP1 activates
gene expression through interactions of ER
(or ER
) with the AP1
transcription factor complex in which ER
physically interacts with
c-jun but not fos proteins (45). Research in
this laboratory has identified functional GC-rich sites in promoters of
several E2-responsive genes that bind ER
/Sp1
(27, 28, 29, 30, 31, 32, 33, 34, 46) and both proteins also physically interact in
a ligand-independent manner (46, 55). Interestingly, there
are many differences in ligand-activated ER
interactions with Sp1
and AP1 proteins. For example, ER agonists/antagonists such as
E2, tamoxifen and ICI 182,780 differentially
activate both complexes; activation function 1 (AF1) is required for
ER
/Sp1 (55), whereas both AF1 and AF2 are important for
ER
/AP1 action (54).
The yeast SssI DNA methyltransferase has recently been developed as a
sensitive bioassay for investigating protein-DNA interactions. This
enzyme catalyzes methylation of CpG sites and can be used in both
in vivo and in vitro DNA footprinting studies to
determine protein interactions at these specific methylation sites
(37, 38). Nuclear extracts from MCF-7 cells only weakly
footprinted the GC-rich site (Fig. 4A
) in the DNA polymerase
gene
promoter; however, incubation with Sp1 protein alone footprinted this
site, whereas incubation with ER
alone
(100400 fmol) had minimal effects on the footprint. Coincubation of
ER
with an amount of Sp1 protein (10 ng) that minimally affected the
footprint at the GC-rich region (e.g. lane 5) resulted in
increased binding (lane 8) indicating that ER
enhanced the Sp1
protein footprint. We have observed similar interactions of
ER
/Sp1 at functional GC-rich sites in the
c-fos proto-oncogene and bcl-2 gene promoters
using this in vitro footprint procedure and gel mobility
shift assays (33, 34). ER
and Sp1 protein interactions
with GC-rich sites are ligand independent, and the model proposed for
hormone-induced transcriptional activation suggests that the ligand is
important for recruiting other nuclear factors (55), and
we are currently determining the identities and roles of ER
/Sp1
interacting proteins.
In summary, this study demonstrates that transcriptional activation of
DNA polymerase
by E2 in MCF-7 breast cancer
cells is dependent on ER
/Sp1 interaction with
a GC-rich site at -106 to -100 in the promoter region of this gene.
This activation pathway does not require direct interaction of
ER
with promoter DNA. DNA polymerase
is
one of an expanding number of genes regulated by the
ER
/Sp1 complex in breast cancer cells
(27, 28, 29, 30, 31, 32, 33, 34, 56, 57) and confirms the important role of Sp1 in
mediating transcriptional activation by ligand-activated nuclear
receptors, such as ER
, progesterone receptor
and retinoic acid receptor, and ligand-independent orphan receptors
such as COUP-TF (58, 59, 60, 61).
| Footnotes |
|---|
Received May 31, 2000.
| References |
|---|
|
|
|---|
during cell
proliferation and the cell cycle. Mol Cell Biol 8:50165025
gene expression is cell proliferation dependent and its primary
structure is similar to both prokaryotic and eukaryotic replicative DNA
polymerases. EMBO J 7:3747[Medline]
gene: sequences controlling expression in cycling and
serum-stimulated cells. Mol Cell Biol 11:20812095
-primase activity
by phosphorylation. Mol Cell Biol 19:646656
. J
Biol Chem 266:78937903
-primase B subunit. Mol Cell Biol 15:883891[Abstract]
promoter by the human cytomegalovirus 72-kilodalton
major immediate-early protein. J Virol 69:182188[Abstract]
-Estradiol induces cyclin D1 gene
transcription,
p36D1-p34cdk4 complex
activation and p105Rb phosphorylation during
mitogenic stimulation of G1-arrested human breast
cancer cells. Oncogene 12:23152324[Medline]
-estradiol in MCF-7 cells: role of estrogen receptor-Sp1
complexes. Endocrinology 140:25012508
1 gene expression: role of estrogen
receptor-Sp1 complex. Mol Endocrinol 12:882890
-estradiol in MCF-7 cells is regulated by
NF-Y-Sp1/estrogen receptor interactions. Mol Endocrinol 13:13731387
-estradiol in
breast cancer cells. J Biol Chem 174:3209932107
-estradiol: mechanism of aryl hydrocarbon receptor-mediated
inhibition. Mol Endocrinol 13:15111521
-estradiol-induced pS2 expression. Cancer Res 54:27072713
and ER
at AP1 sites. Science 277:15081510
/
)-dependent activation at GC-rich (Sp1)
promoter elements. J Biol Chem 275:53795387This article has been cited by other articles:
![]() |
S. Safe and K. Kim Non-classical genomic estrogen receptor (ER)/specificity protein and ER/activating protein-1 signaling pathways J. Mol. Endocrinol., November 1, 2008; 41(5): 263 - 275. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Hawse, M. Subramaniam, D. G. Monroe, A. H. Hemmingsen, J. N. Ingle, S. Khosla, M. J. Oursler, and T. C. Spelsberg Estrogen Receptor {beta} Isoform-Specific Induction of Transforming Growth Factor {beta}-Inducible Early Gene-1 in Human Osteoblast Cells: An Essential Role for the Activation Function 1 Domain Mol. Endocrinol., July 1, 2008; 22(7): 1579 - 1595. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Khan, F. Wu, S. Liu, Q. Wu, and S. Safe Role of specificity protein transcription factors in estrogen-induced gene expression in MCF-7 breast cancer cells J. Mol. Endocrinol., October 1, 2007; 39(4): 289 - 304. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Monroe, F. J. Secreto, J. R. Hawse, M. Subramaniam, S. Khosla, and T. C. Spelsberg Estrogen Receptor Isoform-specific Regulation of the Retinoblastoma-binding Protein 1 (RBBP1) Gene: ROLES OF AF1 AND ENHANCER ELEMENTS J. Biol. Chem., September 29, 2006; 281(39): 28596 - 28604. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Higgins, S. Liu, M. Abdelrahim, K. Yoon, K. Vanderlaag, W. Porter, R. P. Metz, and S. Safe Vascular Endothelial Growth Factor Receptor-2 Expression Is Induced by 17{beta}-Estradiol in ZR-75 Breast Cancer Cells by Estrogen Receptor {alpha}/Sp Proteins Endocrinology, July 1, 2006; 147(7): 3285 - 3295. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kim, R. Barhoumi, R. Burghardt, and S. Safe Analysis of Estrogen Receptor {alpha}-Sp1 Interactions in Breast Cancer Cells by Fluorescence Resonance Energy Transfer Mol. Endocrinol., April 1, 2005; 19(4): 843 - 854. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y-L Zhao, W-D Han, Q Li, Y-M Mu, X-C Lu, L Yu, H-J Song, X Li, J-M Lu, and C-Y Pan Mechanism of transcriptional regulation of LRP16 gene expression by 17-{beta} estradiol in MCF-7 human breast cancer cells J. Mol. Endocrinol., February 1, 2005; 34(1): 77 - 89. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Khan, M. Abdelrahim, I. Samudio, and S. Safe Estrogen Receptor/Sp1 Complexes Are Required for Induction of cad Gene Expression by 17{beta}-Estradiol in Breast Cancer Cells Endocrinology, June 1, 2003; 144(6): 2325 - 2335. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kim, N. Thu, B. Saville, and S. Safe Domains of Estrogen Receptor {alpha} (ER{alpha}) Required for ER{alpha}/Sp1-Mediated Activation of GC-Rich Promoters by Estrogens and Antiestrogens in Breast Cancer Cells Mol. Endocrinol., May 1, 2003; 17(5): 804 - 817. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Abdelrahim, I. Samudio, R. Smith III, R. Burghardt, and S. Safe Small Inhibitory RNA Duplexes for Sp1 mRNA Block Basal and Estrogen-induced Gene Expression and Cell Cycle Progression in MCF-7 Breast Cancer Cells J. Biol. Chem., August 2, 2002; 277(32): 28815 - 28822. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Lobenhofer, L. Bennett, P. L. Cable, L. Li, P. R. Bushel, and C. A. Afshari Regulation of DNA Replication Fork Genes by 17{beta}-Estradiol Mol. Endocrinol., June 1, 2002; 16(6): 1215 - 1229. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Castro-Rivera, I. Samudio, and S. Safe Estrogen Regulation of Cyclin D1 Gene Expression in ZR-75 Breast Cancer Cells Involves Multiple Enhancer Elements J. Biol. Chem., August 10, 2001; 276(33): 30853 - 30861. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Sun, H. Y. Chen, and J. R. Davie Effect of Estradiol on Histone Acetylation Dynamics in Human Breast Cancer Cells J. Biol. Chem., December 21, 2001; 276(52): 49435 - 49442. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Saville, H. Poukka, M. Wormke, O. A. Janne, J. J. Palvimo, M. Stoner, I. Samudio, and S. Safe Cooperative Coactivation of Estrogen Receptor alpha in ZR-75 Human Breast Cancer Cells by SNURF and TATA-binding Protein J. Biol. Chem., January 18, 2002; 277(4): 2485 - 2497. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |