help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haupt, K.
Right arrow Articles by Saller, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haupt, K.
Right arrow Articles by Saller, B.
Endocrinology Vol. 142, No. 3 1017-1023
Copyright © 2001 by The Endocrine Society


ARTICLES

Induction of a Cellular and Humoral Immune Response against Preprocalcitonin by Genetic Immunization: A Potential New Treatment for Medullary Thyroid Carcinoma1

K. Haupt, F. Siegel, M. Lu, D. Yang, G. Hilken, K. Mann, M. Roggendorf and B. Saller

Institute for Virology, Division of Endocrinology, Department of Internal Medicine (K.M., B.S.), and Central Animal Laboratory (G.H.), University of Essen, 45122 Essen, Germany

Address all correspondence and requests for reprints to: Katharina Haupt, M.D., Institute for Virology, University of Essen, Hufelandstrasse 55, 45122 Essen, Germany.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Currently, no effective therapy exists for patients suffering from progressive medullary thyroid carcinoma (MTC), a calcitonin (CT)-secreting C cell tumor. As CT, which arises from the precursor protein preprocalcitonin (PPCT), is expressed by almost all MTC cases, these molecules may represent target antigens for immunotherapy against MTC. In our study we investigated whether DNA immunization is able to induce cellular and humoral immune responses against human PPCT (hPPCT) in mice. Antigen-encoding expression plasmids were delivered intradermally by gene gun. One group of mice received DNA encoding hPPCT only. Two groups were coinjected with mouse cytokine genes. We observed in lymphocyte proliferative assays substantial proliferation against hPPCT in mice coinjected with the granulocyte-macrophage colony-stimulating factor (GM-CSF) gene, in contrast to mice vaccinated with hPPCT expression plasmid only. In addition, codelivery of the GM-CSF gene augmented the frequency of anti-hPPCT antibody seroconversions in sera of immunized animals, as shown by enzyme-linked immunosorbent assay. These results illustrate that cellular and humoral immune responses against hPPCT can be generated by DNA immunization and increased by coinjection of the GM-CSF gene. Our findings may have implications for the use of DNA immunization as a potential novel immunotherapeutic treatment for patients suffering from progressive MTC.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MEDULLARY THYROID carcinoma (MTC) is a malignant tumor that arises from thyroid parafollicular C cells secreting calcitonin (CT). This tumor is responsible for 5–10% of all thyroid carcinoma. It may occur sporadically, as a familial form without associated endocrinopathies, or combined with other endocrinopathies in multiple endocrine neoplasia type 2 (1, 2). The primary treatment modality for both the inherited and sporadic forms of MTC is surgery (3). As nonsurgical treatment approaches such as chemotherapy and radiation have only a palliative role, no effective therapy is currently available for patients who have failed complete surgical tumor removal and suffer from progressive metastatic disease. For that reason, alternative therapies to treat disseminated MTC are currently under investigation (4, 5, 6, 7, 8, 9).

Many attempts have been made during the past years to develop immunostimulating approaches to cancer treatment (10). In these approaches, regression of tumor growth is achieved by the induction of T cell- or antibody-mediated cytotoxicity against tumor-specific antigens. In MTC, CT may represent a target antigen for immunotherapy, because it is expressed in almost all MTC cases, is specific for this tumor, and is not essential for health and survival. Protein synthesis of CT starts with the translation of the 141-amino acid precursor protein preprocalcitonin (PPCT) after transcription of the preprocalcitonin gene on chromosome 11p and processing of the primary transcript (11). The 32-amino acid protein CT is liberated intracellularly from PPCT by tissue-specific proteolysis (12).

A novel approach to elicit both cellular and humoral antitumor immune responses involves the use of antigen-encoding plasmid DNA vaccines (13). DNA vaccines with immunostimulatory properties can be easily produced and purified in large quantities. Once in cell nuclei, the plasmids persist as circular nonreplicating episomes; they are not integrated into the host’s genome (14), resulting in long-term expression of the encoded proteins by the host’s cells (14, 15). The major advantage of DNA vaccination is that the in vivo-synthesized protein can enter both the MHC class I and class II processing pathways to favor effective antigen-specific cellular and humoral immunity. DNA vaccination has been shown to elicit in vivo immune responses against a broad range of infectious agents (16) and against certain tumor antigens, including B cell lymphoma idiotype (17), an epitope derived from mutated p53 (18), free hCG {beta}-subunit (19), prostate-specific antigen (20), and melanoma-associated antigens such as gp100 (21) and gp75 (22).

DNA immunization against the CT precursor PPCT may therefore result in targeted immune ablation of C cells that express PPCT and secrete mature CT, not only at the primary tumor, but also at metastatic tumor sites of MTC. To prove the basic principle of this approach, we investigated in the present study whether DNA immunization is able to induce a cellular and humoral immune response against the human CT precursor PPCT in a mouse model.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice
Female mice (BALB/c0laHsd) were kept under specific pathogen-free conditions in the Central Animal Facilities of the University of Essen and were used at 12–20 weeks of age. The appropriateness of the experimental procedure, the required number of animals used, and the method of acquisition comply with federal, state, and local laws and institutional regulations.

Construction and purification of expression vectors
A human PPCT (hPPCT) complementary DNA (cDNA) fragment of 724 bp was amplified by RT-PCR using RNA prepared from human MTC tissue (23). The following primers were used: 5'-GGTGAGCCCCGAGATTCTGG-3' (nucleotides 1–20) and 5'-GCACATTCAGAAAGCAGGACAGA-3' (nucleotides 724–702). The PCR product was cloned into pCRII (Invitrogen, San Diego, CA) according to the manufacturer’s instructions. The sequenced PCR fragment was isolated by digestion with HindIII and XbaI and integrated into the corresponding sites of the pcDNA3 expression vector (Invitrogen) containing the cytomegalovirus (CMV) immediate-early promoter. This construct was designated pcDNA3/hPPCT. The integrity of the clones was verified by sequencing.

For the construction of a bacterial expression plasmid yielding hPPCT containing an N-terminal His-tag for easier purification, the cDNA of hPPCT was amplified by PCR with overhang primers attaching two additional restriction sites. A BamHI site was attached to the 5'-end of the cDNA using the sense primer (CTCGGATCCGGCTTCCAAAAGTTCTCC), and a HindIII site was attached to the 3'-end using the antisense primer (GCCAAGCTTTTAGTTGGCATTCTGGGGCA). The obtained fragment was cloned into PQE30 (QIAGEN, Hilden, Germany) in the same reading frame as the His tag, yielding a plasmid called PQE30/hPPCT.

The plasmids pCMV/interferon-{gamma} (IFN-{gamma}) and pCMV/granulocyte-macrophage colony-stimulating factor (GM-CSF) contain the genes encoding mouse IFN-{gamma} and GM-CSF, respectively, under the control of the CMV immediate early promoter and were provided by Jörg Reimann (University of Ulm, Ulm, Germany). As a control, the plasmid pcDNA3/HDAg encoding hepatitis D virus p24 antigen was used (24). Plasmid DNA for vaccination was prepared using the Giga plasmid purification kit (QIAGEN) and was dissolved in PBS at 1 mg/ml.

The precipitation of DNA onto 1-µm gold particles (Bio-Rad Laboratories, Inc., Hercules, CA) for use with the gene gun was performed according to the manufacturer’s instructions at room temperature. In a 1.5-ml microfuge tube 25-mg gold beads were weighed out. One hundred microliters of 0.05 M spermidine (Sigma, St. Louis, MO) were added, and the mixture was vortexed for 20 sec and sonicated for 5 sec. Fifty micrograms of pcDNA3/hPPCT (for coprecipitations, additionally 50 µg pCMV/IFN-{gamma} or pCMV/GM-CSF) or 50 µg pcDNA3/HDAg were added, and the mixture was vortexed again for 20 sec. While vortexing, 100 µl 1 M CaCl2 were added dropwise. The DNA was allowed to precipitate at room temperature for 10 min. The supernatant was removed, and the gold microcarriers were washed three times with fresh 100% ethanol. After the last wash, 3 ml ethanol containing 0.05 mg/ml polyvinylpyrrolidone (Bio-Rad Laboratories, Inc.) were added to the mixture. The gold microcarriers were then coated onto the inner wall of Tefzel tubing (Bio-Rad Laboratories, Inc.) according to the manufacturer’s protocol.

Cell transfection in vitro
The expression construct pcDNA3/hPPCT and, as control, the empty pcDNA3 vector were transfected into BHK cells using Lipofectamine (Life Technologies, Inc., Eggenstein-Leopoldshafen, Germany) as specified by the manufacturer. Briefly, 4 µg plasmid DNA were incubated with 20 µg Lipofectamine in 200 µl OptiMEM medium (Life Technologies, Inc.) for 45 min at room temperature. The DNA liposome complexes were added to the cells in 1 ml OptiMEM for 6 h at 37 C in 5% CO2. Transfected cells were maintained for another 48 h, and the supernatants were collected at different time points (24 and 48 h). Supernatants were analyzed for the presence of secreted human calcitonin (hCT) by a commercial two-site immunoradiometric assay (Scantibodies Laboratory, Inc., Santee, CA). This assay uses two different goat polyclonal antibodies against hCT and has no significant cross-reaction with hCT gene-related peptide (<0.1%). The lower limit of detection was 0.7 pg/ml. Interassay coefficient of variation was 7.0% at 20.2 pg/ml (n = 63) and 12.7% at 203 pg/ml (n = 63).

Expression and purification of recombinant hPPCT protein
To obtain large amounts of recombinant hPPCT protein that can be easily purified and used for antibody detection in enzyme-linked immunosorbent assay (ELISA) and for stimulating T cells in proliferation assay, the QIAexpress system (QIAGEN) was used. Escherichia coli strain M15(pREP4) (QIAGEN) was transformed with the expression construct PQE30/hPPCT. The right transformants were selected on plates containing both ampicillin (PQE30/hPPCT) and kanamycin (pREP4). For production of recombinant hPPCT, 1 liter expression medium (25 g bacto-tryptone, 15 g bacto-yeast extract, and 5 g NaCl) was inoculated with 50 ml of an overnight culture. Induction was performed at OD600 1.2 with isopropyl-{beta}-D-thiogalactoside (IPTG; BIOMOL Research Laboratories, Inc., Hamburg, Germany) added to a final concentration of 2 mM. The expression of recombinant hPPCT was controlled by Western blotting. Cells were pelleted 3.5 h after induction, resuspended in sonication buffer (50 mM sodium phosphate, pH 7.8, and 300 mM NaCl), and lysed by sonification. DNA and RNA were digested by deoxyribonuclease I and ribonuclease H (Roche, Mannheim, Germany). After centrifugation, the supernatant was discarded, and the protein was solubilized by the addition of 8 M urea to the pellet. After filtering through a 45-nm pore size filter, the His-tagged protein was bound to nickel-nitrilotriacetic acid (Ni-NTA)-Superose fast protein liquid chromatography column. The column was washed with 10 and 60 mM imidazole. The protein was eluted with 500 mM imidazole, and the eluate was collected in fractions (basic purification). The fractions were tested for the presence of the protein in SDS-PAGE. In a second purification step, fractions containing the protein were diluted to an imidazole concentration of 60 mM and then again bound to Ni-NTA column. hPPCT was eluted using a linear gradient of imidazole ranging from 60–500 mM (optimized purification). The fractions were again controlled by SDS-PAGE, and those containing the protein were combined and desalted via dialysis. The protein concentration was determined using the Bradford microassay procedure (Bio-Rad Laboratories, Inc.).

Protein was separated by 17% SDS-PAGE and colored with Coomassie blue or for Western blot analysis was transferred to a nitrocellulose membrane (Schleicher & Schuell, Inc., Dassel, Germany). Nonspecific binding sites were blocked with 3% BSA in Tris-buffered saline at room temperature for 1 h. The membrane was incubated for an additional 1 h with Ni-NTA horseradish peroxidase conjugate diluted 1:1000 (QIAGEN), which detects His-tagged proteins. Bands were visualized with (3,3',4,4'-tetraaminobiphenyl) tetrahydrochloride (Sigma) according to the manufacturer’s instructions.

The specificity of the purified protein was controlled by Western blot using a mouse monoclonal anti-hCT antibody (donated by Brahms Diagnostica, Berlin, Germany) diluted 1:500. This antibody recognizes the native and denatured forms of hCT as well as pro-CT (25). Detection was performed with horseradish peroxidase-labeled antimouse antibody (DAKO Corp., Copenhagen, Denmark) diluted 1:1000.

Immunization protocol
There were four groups of mice. Group 1 was immunized with pcDNA3/hPPCT, group 2 was coinjected with pCMV/IFN-{gamma}, and group 3 was coinjected with pCMV/GM-CSF. As controls, mice from group 4 received pcDNA3/HDAg. Groups 1–3 consisted of five animals each. In group 4 one animal had to be killed because of a bad general condition before the end of the immunization period, so that in this group only four animals could be kept within the study. DNA vaccination was performed using the hand-held helium-pulsed Helios gene gun (Bio-Rad Laboratories, Inc.). Cartridges were loaded into the gene gun and shot at 200 psi into freshly shaven abdominal skin of anesthetized mice. Two cartridges were discharged per animal, delivering a total of 2 µg pcDNA3/hPPCT or pcDNA3/HDAg/immunization (for cotransfections, additionally 2 µg pCMV/IFN-{gamma} or pCMV/GM-CSF). Mice were gunned six times at 2-week intervals. Blood (300 µl) was drawn from the retroorbital plexus 0, 6, 8, 10, and 13 weeks after the first immunization. Three weeks after the last immunization mice were killed, and spleens were removed.

T cell proliferation assay
Single cell suspensions of spleen cells from immunized mice were depleted of erythrocytes by ammonium chloride lysis. Spleen cells were cultured in triplicate using round-bottom 96-well microtiter plates (Falcon, Becton Dickinson and Co., Franklin Lakes, NJ) at 2.5 x 104 cells/well in 225 µl complete RPMI 1640 medium containing 10% FBS (Life Technologies, Inc.). Stimulated wells received purified hPPCT at two different concentrations (1 or 0.5 µg/ml) or hCT (Sigma; 5 or 1 µg/ml). Con A (Sigma; 2.5 µg/ml) served as a positive mitogenic control. Negative control wells received cells only. After a 4-day incubation, spleen cells were labeled with 1 µCi/well [3H]thymidine (Amersham Pharmacia Biotech, Braunschweig, Germany; 37 MBq/ml) for 20 h. [3H]Thymidine incorporation into DNA was measured after harvesting. The stimulation index (SI) was calculated as the mean counts per min of the stimulated wells divided by the mean counts per min of the control wells. Positive assay was defined as a SI of 2.0 or more.

Detection of anti-hPPCT and anti-hCT antibodies
The following ELISAs were developed and employed to measure anti-hPPCT and anti-hCT antibodies in serum of immunized mice. In brief, microtiter plates were coated with either purified hPPCT protein (0.15 µg/well) or hCT protein (Sigma; 0.2 µg/well). After blocking with 10% FBS in PBS for 1 h at 37 C, a 1:100 dilution of mouse serum was added to the plates and incubated at 37 C for an additional 1 h. As a positive control, a monoclonal anti-hCT antibody of mice (Brahms) was used at a concentration of 0.34 µg/well. After washing with PBS containing 0.05% Tween, a horseradish peroxidase-labeled antimouse antibody (DAKO Corp.) was added at a dilution of 1:1000. After 1-h incubation at 37 C, plates were washed, and substrate was added for color development. The OD at 492 nm was determined after 10 min. A positive assay has been defined as exceeding 3 SD above the mean value of control mouse sera. The precision relating to within-assay variability is 5.8% (n = 20). All relevant comparisons were made within the same assay.

Statistical analysis
Proliferation assay values are presented as the mean of triplicate measurements ± SEM.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmid gene expression in vitro
For DNA immunization of mice we constructed the expression vector pcDNA3/hPPCT containing the full-length cDNA for hPPCT driven by the CMV immediate early promoter as described in Materials and Methods. To evaluate the plasmid gene expression in vitro, the mammalian BHK cell line was transiently transfected with this construct. As a control, the cell line was transfected with the empty pcDNA3 vector. All cell clones transfected with the hPPCT expression vector produced high levels of protein (>37 pg/ml) after 24 h. The concentration of hCT secreted into the cell culture supernatant of one clone exceeded 811 pg/ml after 24 h (Fig. 1Go), designated pcDNA3/hPPCT-5. HCT was not produced by BHK cells transfected with the empty pcDNA3 vector.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 1. Plasmid gene expression in vitro. Secretion of hCT protein into the cell culture supernatant 24 h after transfection of BHK cells with the hPPCT-encoding expression construct (pcDNA3/hPPCT-5) or control vector (empty pcDNA3), as determined by a specific immunoradiometric assay.

 
T cell proliferative responses to hPPCT and hCT induced by DNA immunization
For stimulating T cells in proliferative assay recombinant hPPCT was expressed in Escherichia coli and purified in two steps, as shown in Materials and Methods. The expression of this protein was controlled by Western blot analysis of bacterial cell lysates before and after 3.5 h of IPTG induction (Fig. 2AGo). The calculated Mr of the His-tagged hPPCT protein was approximately 16 kDa. This protein has an apparent Mr of 25 kDa on the SDS gel, presumably due to the His tag, as reported for His-tagged proteins (26). As shown in Fig. 2BGo (lane 1), many unspecific bands were additionally visible on the SDS gel after the first purification step. After the second step (lane 2) hPPCT had a high purity, as no contaminants were detectable on SDS-PAGE. The specificity of the purified protein was confirmed by Western blotting using a monoclonal anti-hCT antibody (Fig. 2CGo).



View larger version (71K):
[in this window]
[in a new window]
 
Figure 2. Bacterial expression and purification of recombinant His-tagged hPPCT. A, hPPCT expression determined by Western blotting. Lane 1, Before IPTG induction. Lane 2, After 3.5 h IPTG induction. B, SDS-PAGE monitoring the two-step purification by binding to Ni-NTA-Superose fast protein liquid chromatography column. Lane 1, Protein after elution with 500 mM imidazole (basic purification). Lane 2, Protein after elution with a linear gradient (60–500 mM) of imidazole (optimized purification). C, Confirmation of specificity of the purified protein by Western blotting using a monoclonal anti-hCT antibody of mice (Brahms Diagnostica, Berlin, Germany).

 
Vaccine-induced T cell-mediated immune responses were investigated, and the enhancing effect of codelivery of cytokine genes on T cells was examined for proliferation in response to stimulation with different concentrations of purified hPPCT or hCT. As illustrated in Fig. 3AGo, no proliferative response was observed after stimulation of splenocytes with hPPCT in mice exclusively immunized with hPPCT expression plasmid (group 1). Two of five mice coinjected with IFN-{gamma} expression plasmid (group 2) displayed a weak proliferative response after stimulation of splenocytes with 1 µg/ml hPPCT. Moreover, we observed an improved T cell proliferative response to hPPCT after codelivery of the GM-CSF gene. Two of five mice coinjected with this cytokine gene (group 3) elicited substantial proliferative responses after stimulation of splenocytes with 1 µg/ml hPPCT. T cell proliferative activity after in vitro stimulation with purified hPPCT was dose dependent, because stimulation of splenocytes with a lower concentration of hPPCT (0.5 µg/ml) decreased the observed proliferative responses to 1 µg/ml hPPCT in mice coinjected with IFN-{gamma} or GM-CSF expression plasmids (Fig. 3AGo).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 3. Lymphocyte proliferative immune responses to hPPCT (A) and hCT (B) induced by DNA immunization. Mice were immunized with pcDNA3/hPPCT expression plasmid alone (group 1) or in the presence of plasmids encoding mouse IFN-{gamma} (group 2) or mouse GM-CSF (group 3). Control mice (group 4) received pcDNA3/HDAg. Spleen cells of immunized animals were stimulated in vitro with 0.5 µg/ml ({square}) and 1 µg/ml ({blacksquare}) purified hPPCT (A) or with 1 µg/ml ({square}) and 5 µg/ml ({blacksquare}) hCT (B). Proliferation was determined by measuring [3H]thymidine incorporation into DNA. Values are presented as the mean + SEM SI of each mouse tested in triplicate. A positive assay was defined as an SI of 2.0 or more.

 
The T cell responses against hCT induced by DNA immunization (Fig. 3BGo) were weaker than the responses generated against hPPCT. Neither immunization with hPPCT expression plasmid alone (group 1) nor codelivery of IFN-{gamma} expression plasmid (group 2) generated proliferative activity of splenocytes against hCT, although a higher concentration of hCT (5 µg/ml) compared with hPPCT (1 µg/ml) was used for in vitro stimulation of splenocytes. However, consistent with our results demonstrating an augmentation of the T cell response against hPPCT by coinjection of the GM-CSF gene, we found an enhancement of the T cell proliferative activity against hCT after codelivery of this cytokine gene (group 3). Two of five mice coimmunized with GM-CSF-encoding plasmid displayed a proliferative response after stimulation of splenocytes with 5 µg/ml hCT.

As expected, lymphocytes, derived from mice vaccinated with HDAg expression plasmid (group 4), did not respond to hPPCT or hCT.

All mice that failed to respond to hPPCT or hCT in proliferative assays showed stimulation indexes ranging from 55–225 after in vitro stimulation of splenocytes with the positive mitogenic control Con A, indicating that the T cells of these mice were not generally impaired.

Humoral immune responses against hPPCT and hCT induced by DNA immunization
Immunization with hPPCT expression plasmid alone (group 1) induced hPPCT-specific antibodies in two of five mice, as shown in Fig. 4Go. After coinjection of the IFN-{gamma} gene (group 2) two of five mice demonstrated an anti-hPPCT antibody response weaker than that of mice immunized with hPPCT expression plasmid alone. In contrast, coinjection of the GM-CSF gene (group 3) resulted in much stronger anti-hPPCT antibody responses compared with those in mice receiving hPPCT expression plasmid alone. Four of five mice coinjected with the GM-CSF gene developed significant levels of antibodies against hPPCT. After coinjection of the GM-CSF gene anti-hPPCT antibodies were initially detected as early as 6 weeks after the first immunization compared with 8 weeks after immunization with hPPCT expression plasmid alone or coinjection of the IFN-{gamma} gene. Thus, codelivery of the GM-CSF gene not only augmented the frequency of anti-hPPCT seroconversions, but also resulted in an earlier time point of seroconversions.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. Humoral immune responses against hPPCT induced by DNA immunization. Mice were immunized with pcDNA3/hPPCT expression plasmid alone (group 1) or in the presence of plasmids encoding mouse IFN-{gamma} (group 2) or mouse GM-CSF (group 3). Control mice (group 4) received pcDNA3/HDAg. Sera were collected at the indicated weeks after the first DNA immunization and analyzed by ELISA. Samples with absorbance below the lines were scored as not having detectable anti-hPPCT antibodies.

 
All animals immunized with hPPCT expression plasmid alone or coinjected with IFN-{gamma} or GM-CSF genes failed to generate detectable anti-hCT antibodies at any time point (data not shown).

Sera derived from control mice immunized with HDAg expression plasmid (group 4) were negative for anti-hPPCT and anti-hCT antibodies.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DNA vaccination may offer a new approach to induce immune-mediated tumor reductions in MTC. As a first step to establish such a treatment, the present study demonstrates that antigen-specific cellular and humoral immune responses against hPPCT can be induced by DNA immunization in a mouse model.

For immunization, an expression plasmid encoding the hCT precursor hPPCT was used instead of hCT, because this larger molecule, comprising 141 amino acid residues, has a greater probability of containing suitable epitopes than mature hCT, a 32-residue peptide. According to this assumption, the T cell proliferation observed after in vitro stimulation of splenocytes of immunized animals was weaker when hCT was used as an antigen instead of hPPCT. Similarly, only antibodies against hPPCT, not those against hCT were detectable in sera of immunized animals. These results indicate that hPPCT indeed contains more relevant T and B cell epitopes than the small mature molecule hCT.

In the present study particle gun-mediated gene transfer was used for introducing DNA constructs into the animals. This method is highly effective, atraumatic (27, 28, 29, 30), and offers the advantage that much smaller amounts of DNA are required for immunization than with direct im injection. Gene gun administration works by direct transfection of host cells in the dermis, including dendritic cells (31). In pilot experiments performed with gene gun immunization with hPPCT expression plasmid, we found that application of 1 µg DNA three times did not elicit notable antigen-specific cellular or humoral immune responses in the presence or absence of cytokine genes (data not shown). The paucity of immunostimulatory motifs in these low amounts of DNA applied may be the reason for the failure of effective immune responses to be induced. We therefore increased the number of vaccinations as well as the amount of DNA applied per immunization to six times and 2 µg, respectively, in the experiments reported here.

Inasmuch as it is known that the immunization schedule (32) as well as the route of application of plasmid DNA (33, 34, 35) manipulate the quality of the immune response generated, there exists the potential to further influence the response via cytokine gene codelivery. Several reports have shown that the codelivery of vectors encoding cytokines such as interleukin-2, interleukin-12, IFN-{gamma}, or GM-CSF can direct the nature of the resulting immune response and augment the efficacy of DNA vaccines (36, 37, 38). GM-CSF especially seems to be potent in enhancing cellular and humoral immune responses (39, 40, 41), possibly due to inducing the differentiation of primitive hematopoietic precursors into dendritic cells (42), activating antigen-presenting cells (43), or increasing the expression of MHC class II molecules in antigen-presenting cells (44), thus augmenting their antigen-presenting ability. In the present study we evaluated the efficacy of coadministration of expression plasmids encoding IFN-{gamma} and GM-CSF. In accordance with the finding cited above, our results indicate that both proliferative cellular and antibody responses are enhanced when the hPPCT DNA vaccine is delivered in the presence of the GM-CSF gene. In addition, the group of animals immunized with hPPCT and GM-CSF expression plasmids not only developed higher levels of anti-hPPCT antibodies, but also showed an earlier time point of seroconversions compared with the group immunized with hPPCT DNA alone. In contrast to the results obtained with GM-CSF, codelivery of IFN-{gamma} expression plasmid resulted in a decreased magnitude of antibody response against hPPCT compared with immunization with hPPCT expression plasmid alone. A similar finding on the regulation of the antibody response by IFN-{gamma} gene to a DNA vaccine has been reported previously (38). One explanation for this observation could be that IFN-{gamma} is a cytokine that tends to enhance Th1-like (45) and suppress Th2-like responses, leading to a decreased B cell response.

Our results demonstrate that DNA immunization can induce proliferative cellular and humoral immune responses against hPPCT and that these responses might be modulated by cytokines such as GM-CSF; it remains unclear whether this kind of immune response is effective at preventing tumor growth. There is, however, increasing evidence for an effective antitumor activity of proliferative T cell responses that are mediated by CD4+ T cells (39, 46). These cells seem to be important components of a successful antitumor immune response. Tumor-specific CD4+ cells not only provide help for the induction of specific CD8+ cytotoxic T lymphocytes, but are also critical in activating macrophages and eosinophils to produce nitric oxide and superoxides. Independently of CD8+ cells, these cells then collaborate in the destruction of tumor cells (46, 47).

In addition to the analysis of the immune responses described above, histological and immunocytochemical examinations of thyroid sections of our DNA-vaccinated mice were performed to control potential infiltration of immune cells. However, there was no evidence for lymphocyte or other cell infiltration into the thyroids of mice that were DNA-immunized with hPPCT in the presence or absence of cytokine genes (data not shown). This could result from the failure of mouse lymphocytes to cross-react between human PPCT (used for DNA immunization) and mouse PPCT (expressed in the thyroids), which are 77% identical (26), indicating the absence of conserved epitopes.

A beneficial use of DNA immunization as immunotherapy for patients suffering from MTC clearly requires the precondition to break immunological self-tolerance and to induce a potent response against self-antigens expressed by normal C cells and MTC tumor cells in vivo. Recently, it has been shown that tolerance to mouse tumor antigens can be broken by DNA immunization of the animals (22, 48). Breaking such self-tolerance may be aided by codelivery of genes encoding immunostimulatory cytokines such as GM-CSF to boost response.

In summary, our results provide evidence that DNA immunization with hPPCT expression plasmid by gene gun enables induction of antigen-specific cellular and humoral immune responses in mice. Codelivery of a plasmid encoding GM-CSF increases the efficacy of this DNA vaccine. These findings provide the basis for the generation of an efficient antitumor immune response against MTC by DNA vaccination. Future studies are necessary to establish such a response in humans. If successful, it would provide a novel treatment option for patients suffering from progressive MTC. In addition, family members genetically at risk of developing MTC may benefit from DNA vaccination against PPCT by eliminating or at least postponing disease manifestation.


    Acknowledgments
 
We thank Drs. Reinhold Schirmbeck and Jörg Reimann for kindly providing the cytokine plasmids, Priv.-Doz. Dr. Klaus Metz, Department of Pathology, for generously performing the histological examinations, and Dr. Beate Lohrengel for many helpful discussions.


    Footnotes
 
1 Presented in part at the Annual Meeting of the European Thyroid Association, August 1999, Milan, Italy. This work was supported by the IFORES program of the University Hospital Essen (Essen, Germany). Back

Received August 21, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Eng C, Smith DP, Mulligan LM, Nagai MA, Healey CS, Ponder MA, Gardner E, Scheumann GF, Jackson CE, Tunnacliffe A 1994 Point mutation within the tyrosine kinase domain of the RET proto-oncogene in multiple endocrine neoplasia type 2B and related sporadic tumours [published erratum appears in Hum Mol Genet 1994 Apr; 3(4):686]. Hum Mol Genet 3:237–241[Abstract/Free Full Text]
  2. Giuffrida D, Gharib H 1998 Current diagnosis and management of medullary thyroid carcinoma. Ann Oncol 9:695–701[Abstract/Free Full Text]
  3. Evans DB, Burgess MA, Goepfert H, Gagel RF 1997 Medullary thyroid carcinoma. Curr Ther Endocrinol Metab 6:127–132[Medline]
  4. Cressent M, Pidoux E, Cohen R, Modigliani E, Roth C 1995 Interleukin-2 and interleukin-4 display potent antitumour activity on rat medullary thyroid carcinoma cells. Eur J Cancer 31A:2379–2384
  5. Lausson S, Fournes B, Borrel C, Milhaud G, Treilhou-Lahille F 1996 Immune response against medullary thyroid carcinoma (MTC) induced by parental and/or interleukin-2-secreting MTC cells in a rat model of human familial medullary thyroid carcinoma. Cancer Immunol Immunother 43:116–123[CrossRef][Medline]
  6. Zhang R, Straus FH, DeGroot LJ 1999 Effective genetic therapy of established medullary thyroid carcinomas with murine interleukin-2: dissemination and cytotoxicity studies in a rat tumor model. Endocrinology 140:2152–2158[Abstract/Free Full Text]
  7. Soler MN, Milhaud G, Lekmine F, Treilhou-Lahille F, Klatzmann D, Lausson S 1999 Treatment of medullary thyroid carcinoma by combined expression of suicide and interleukin-2 genes. Cancer Immunol Immunother 48:91–99[CrossRef][Medline]
  8. Parthasarathy R, Cote GJ, Gagel RF 1999 Hammerhead ribozyme-mediated inactivation of mutant RET in medullary thyroid carcinoma. Cancer Res 59:3911–3914[Abstract/Free Full Text]
  9. Minemura K, Takeda T, Minemura K, Nagasawa T, Zhang R, Leopardi S, DeGroot LJ 2000 Cell-specific induction of sensitivity to ganciclovir in medullary thyroid carcinoma cells by adenovirus-mediated gene transfer of herpes simplex virus thymidine kinase. Endocrinology 141:1814–1822[Abstract/Free Full Text]
  10. Sinkovics JG, Horvath JC 2000 Vaccination against human cancers (review). Int J Oncol 16:81–96[Medline]
  11. Steenbergh PH, Hoppener JW, Zandberg J, Visser A, Lips CJ, Jansz HS 1986 Structure and expression of the human calcitonin/CGRP genes. FEBS Lett 209:97–103[CrossRef][Medline]
  12. Bovenberg RA, Adema GJ, Jansz HS, Baas PD 1988 Model for tissue specific Calcitonin/CGRP-I RNA processing from in vitro experiments. Nucleic Acids Res 16:7867–7883[Abstract/Free Full Text]
  13. Weiner DB, Kennedy RC 1999 Genetic vaccines. N Engl J Med 341:277–278[Free Full Text]
  14. Wolff JA, Malone RW, Williams P, Chong W, Acsadi G, Jani A, Felgner PL 1990 Direct gene transfer into mouse muscle in vivo. Science 247:1465–1468[Abstract/Free Full Text]
  15. Wolff JA, Ludtke JJ, Acsadi G, Williams P, Jani A 1992 Long-term persistence of plasmid DNA and foreign gene expression in mouse muscle. Hum Mol Genet 1:363–369[Abstract/Free Full Text]
  16. Seder RA, Gurunathan S 1999 DNA vaccines–designer vaccines for the 21st century. Nat Biotechnol 17:821[CrossRef][Medline]
  17. Stevenson FK, Link Jr CJ, Traynor A, Yu H, Corr M 1999 DNA vaccination against multiple myeloma. Semin Hematol 36:38–42
  18. Ciernik IF, Berzofsky JA, Carbone DP 1996 Induction of cytotoxic T lymphocytes and antitumor immunity with DNA vaccines expressing single T cell epitopes. J Immunol 156:2369–2375[Abstract]
  19. Geissler M, Wands G, Gesien A, de la Monte S, Bellet D, Wands JR 1997 Genetic immunization with the free human chorionic gonadotropin beta subunit elicits cytotoxic T lymphocyte responses and protects against tumor formation in mice. Lab Invest 76:859–871[Medline]
  20. Kim JJ, Trivedi NN, Wilson DM, Mahalingam S, Morrison L, Tsai A, Chattergoon MA, Dang K, Patel M, Ahn L, Boyer JD, Chalian AA, Shoemaker H, Kieber-Emmons T, Agadjanyan MA, Weiner DB 1998 Molecular and immunological analysis of genetic prostate specific antigen (PSA) vaccine. Oncogene 17:3125–3135[CrossRef][Medline]
  21. Schreurs MW, de Boer AJ, Figdor CG, Adema GJ 1998 Genetic vaccination against the melanocyte lineage-specific antigen gp100 induces cytotoxic T lymphocyte-mediated tumor protection. Cancer Res 58:2509–2514[Abstract/Free Full Text]
  22. Weber LW, Bowne WB, Wolchok JD, Srinivasan R, Qin J, Moroi Y, Clynes R, Song P, Lewis JJ, Houghton AN 1998 Tumor immunity and autoimmunity induced by immunization with homologous DNA. J Clin Invest 102:1258–1264[Medline]
  23. Craig RK, Riley JH, Edbrooke MR, Broad PM, Foord SM, Al-Kazwini SJ, Holman JJ, Manshall I 1986 Expression and function of the human calcitonin/{alpha}-CGRP gene in health and disease. Biochem Soc Symp 52:91–105[Medline]
  24. Fiedler M, Roggendorf M Vaccination against hepatitis delta virus infection: studies in the woodchuck (Marmota monax) model. Intervirology, in press
  25. Muller CA, Uhl W, Printzen G, Gloor B, Bischofberger H, Tcholakov O, Buchler MW 2000 Role of procalcitonin and granulocyte colony stimulating factor in the early predicition of infected necrosis in severe acute pancreatitis. Gut 46:233–238[Abstract/Free Full Text]
  26. Rehli M, Luger K, Beier W, Falk W 1996 Molecular cloning and expression of mouse calcitonin. Biochem Biophys Res Commun 226:420–425[CrossRef][Medline]
  27. Degano P, Sarphie DF, Bangham CR 1998 Intradermal DNA immunization of mice against influenza A virus using the novel PowderJect system. Vaccine 16:394–398[CrossRef][Medline]
  28. Cheng L, Ziegelhoffer PR, Yang NS 1993 In vivo promoter activity and transgene expression in mammalian somatic tissues evaluated by using particle bombardment. Proc Natl Acad Sci USA 90:4455–4459[Abstract/Free Full Text]
  29. Yang NS, Burkholder J, Roberts B, Martinell B, McCabe D 1990 In vivo and in vitro gene transfer to mammalian somatic cells by particle bombardment. Proc Natl Acad Sci USA 87:9568–9572[Abstract/Free Full Text]
  30. Williams RS, Johnston SA, Riedy M, DeVit MJ, McElligott SG, Sanford JC 1991 Introduction of foreign genes into tissues of living mice by DNA-coated microprojectiles. Proc Natl Acad Sci USA 88:2726–2730[Abstract/Free Full Text]
  31. Condon C, Watkins SC, Celluzzi CM, Thompson K, Falo Jr LD 1996 DNA-based immunization by in vivo transfection of dendritic cells. Nat Med 2:1122–1128[CrossRef][Medline]
  32. Hanke T, Neumann VC, Blanchard TJ, Sweeney P, Hill AV, Smith GL, McMichael A 1999 Effective induction of HIV-specific CTL by multi-epitope using gene gun in a combined vaccination regime. Vaccine 17:589–596[CrossRef][Medline]
  33. Fynan EF, Webster RG, Fuller DH, Haynes JR, Santoro JC, Robinson HL 1993 DNA vaccines: protective immunizations by parenteral, mucosal, and gene-gun inoculations. Proc Natl Acad Sci USA 90:11478–11482[Abstract/Free Full Text]
  34. Pertmer TM, Roberts TR, Haynes JR 1996 Influenza virus nucleoprotein-specific immunoglobulin G subclass and cytokine responses elicited by DNA vaccination are dependent on the route of vector DNA delivery. J Virol 70:6119–6125[Abstract]
  35. Feltquate DM, Heaney S, Webster RG, Robinson HL 1997 Different T helper cell types and antibody isotypes generated by saline and gene gun DNA immunization. J Immunol 158:2278–2284[Abstract]
  36. Chen Y, Hu D, Eling DJ, Robbins J, Kipps TJ 1998 DNA vaccines encoding full-length or truncated Neu induce protective immunity against Neu-expressing mammary tumors. Cancer Res 58:1965–1971[Abstract/Free Full Text]
  37. Chow YH, Huang WL, Chi WK, Chu YD, Tao MH 1997 Improvement of hepatitis B virus DNA vaccines by plasmids coexpressing hepatitis B surface antigen and interleukin-2. J Virol 71:169–178[Abstract]
  38. Chow YH, Chiang BL, Lee YL, Chi WK, Lin WC, Chen YT, Tao MH 1998 Development of Th1 and Th2 populations and the nature of immune responses to hepatitis B virus DNA vaccines can be modulated by codelivery of various cytokine genes. J Immunol 160:1320–1329[Abstract/Free Full Text]
  39. Geissler M, Gesien A, Tokushige K, Wands JR 1997 Enhancement of cellular and humoral immune responses to hepatitis C virus core protein using DNA-based vaccines augmented with cytokine-expressing plasmids. J Immunol 158:1231–1237[Abstract]
  40. Gerloni M, Lo D, Ballou WR, Zanetti M 1998 Immunological memory after somatic transgene immunization is positively affected by priming with GM-CSF and does not require bone marrow-derived dendritic cells. Eur J Immunol 28:1832–1838[CrossRef][Medline]
  41. Geissler M, Schirmbeck R, Reimann J, Blum HE, Wands JR 1998 Cytokine and hepatitis B virus DNA co-immunizations enhance cellular and humoral immune responses to the middle but not to the large hepatitis B virus surface antigen in mice. Hepatology 28:202–210[CrossRef][Medline]
  42. Caux C, Dezutter-Dambuyant C, Schmitt D, Banchereau J 1992 GM-CSF and TNF-alpha cooperate in the generation of dendritic Langerhans cells. Nature 360:258–261[CrossRef][Medline]
  43. Tazi A, Bouchonnet F, Grandsaigne M, Boumsell L, Hance AJ, Soler P 1993 Evidence that granulocyte macrophage-colony-stimulating factor regulates the distribution and differentiated state of dendritic cells/Langerhans cells in human lung and lung cancers. J Clin Invest 91:566–576
  44. Fischer HG, Frosch S, Reske K, Reske-Kunz AB 1988 Granulocyte-macrophage colony-stimulating factor activates macrophages derived from bone marrow cultures to synthesis of MHC class II molecules and to augmented antigen presentation function. J Immunol 141:3882–3888[Abstract]
  45. Macatonia SE, Hsieh CS, Murphy KM, O’Garra A 1993 Dendritic cells and macrophages are required for Th1 development of CD4+ T cells from {alpha}{beta} TCR transgenic mice: IL-12 substitution for macrophages to stimulate IFN-{gamma} production is IFN-{gamma}-dependent. Int Immunol 5:1119–1128[Abstract/Free Full Text]
  46. Pardoll DM, Topalian SL 1998 The role of CD4+ T cell responses in antitumor immunity. Curr Opin Immunol 10:588–59447[CrossRef][Medline]
  47. Hung K, Hayashi R, Lafond-Walker A, Lowenstein C, Pardoll D, Levitsky H 1998 The central role of CD4(+) T cells in the antitumor immune response. J Exp Med 188:2357–2368[Abstract/Free Full Text]
  48. Tuting T, Gambotto A, DeLeo A, Lotze MT, Robbins PD, Storkus WJ 1999 Induction of tumor antigen-specific immunity using plasmid DNA immunization in mice. Cancer Gene Ther 6:73–80[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
M. Wuttke, C. Papewalis, Y. Meyer, C. Kessler, B. Jacobs, H. S. Willenberg, S. Schinner, C. Kouatchoua, T. Baehring, W. A. Scherbaum, et al.
Amino Acid-Modified Calcitonin Immunization Induces Tumor Epitope-Specific Immunity in a Transgenic Mouse Model for Medullary Thyroid Carcinoma
Endocrinology, November 1, 2008; 149(11): 5627 - 5634.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Papewalis, M. Wuttke, J. Seissler, Y. Meyer, C. Kessler, B. Jacobs, E. Ullrich, H. S. Willenberg, S. Schinner, T. Baehring, et al.
Dendritic Cell Vaccination with Xenogenic Polypeptide Hormone Induces Tumor Rejection in Neuroendocrine Cancer
Clin. Cancer Res., July 1, 2008; 14(13): 4298 - 4305.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
M. Schott
Immunesurveillance by dendritic cells: potential implication for immunotherapy of endocrine cancers.
Endocr. Relat. Cancer, September 1, 2006; 13(3): 779 - 795.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
K. Haupt, M. Roggendorf, and K. Mann
The Potential of DNA Vaccination against Tumor-Associated Antigens for Antitumor Therapy
Experimental Biology and Medicine, April 1, 2002; 227(4): 227 - 237.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Schott, J. Seissler, M. Lettmann, V. Fouxon, W. A. Scherbaum, and J. Feldkamp
Immunotherapy for Medullary Thyroid Carcinoma by Dendritic Cell Vaccination
J. Clin. Endocrinol. Metab., October 1, 2001; 86(10): 4965 - 4969.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haupt, K.
Right arrow Articles by Saller, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haupt, K.
Right arrow Articles by Saller, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals