| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Institute for Virology, Division of Endocrinology, Department of Internal Medicine (K.M., B.S.), and Central Animal Laboratory (G.H.), University of Essen, 45122 Essen, Germany
Address all correspondence and requests for reprints to: Katharina Haupt, M.D., Institute for Virology, University of Essen, Hufelandstrasse 55, 45122 Essen, Germany.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Many attempts have been made during the past years to develop immunostimulating approaches to cancer treatment (10). In these approaches, regression of tumor growth is achieved by the induction of T cell- or antibody-mediated cytotoxicity against tumor-specific antigens. In MTC, CT may represent a target antigen for immunotherapy, because it is expressed in almost all MTC cases, is specific for this tumor, and is not essential for health and survival. Protein synthesis of CT starts with the translation of the 141-amino acid precursor protein preprocalcitonin (PPCT) after transcription of the preprocalcitonin gene on chromosome 11p and processing of the primary transcript (11). The 32-amino acid protein CT is liberated intracellularly from PPCT by tissue-specific proteolysis (12).
A novel approach to elicit both cellular and humoral antitumor immune
responses involves the use of antigen-encoding plasmid DNA vaccines
(13). DNA vaccines with immunostimulatory properties can
be easily produced and purified in large quantities. Once in cell
nuclei, the plasmids persist as circular nonreplicating episomes; they
are not integrated into the host’s genome (14), resulting
in long-term expression of the encoded proteins by the host’s cells
(14, 15). The major advantage of DNA vaccination is that
the in vivo-synthesized protein can enter both the MHC class
I and class II processing pathways to favor effective antigen-specific
cellular and humoral immunity. DNA vaccination has been shown to elicit
in vivo immune responses against a broad range of infectious
agents (16) and against certain tumor antigens, including
B cell lymphoma idiotype (17), an epitope derived from
mutated p53 (18), free hCG 
-subunit (19),
prostate-specific antigen (20), and melanoma-associated
antigens such as gp100 (21) and gp75
(22).
DNA immunization against the CT precursor PPCT may therefore result in targeted immune ablation of C cells that express PPCT and secrete mature CT, not only at the primary tumor, but also at metastatic tumor sites of MTC. To prove the basic principle of this approach, we investigated in the present study whether DNA immunization is able to induce a cellular and humoral immune response against the human CT precursor PPCT in a mouse model.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Construction and purification of expression vectors
A human PPCT (hPPCT) complementary DNA (cDNA) fragment of 724 bp
was amplified by RT-PCR using RNA prepared from human MTC tissue
(23). The following primers were used:
5'-GGTGAGCCCCGAGATTCTGG-3' (nucleotides 1–20) and
5'-GCACATTCAGAAAGCAGGACAGA-3' (nucleotides 724–702). The PCR product
was cloned into pCRII (Invitrogen, San Diego, CA)
according to the manufacturer’s instructions. The sequenced PCR
fragment was isolated by digestion with HindIII and
XbaI and integrated into the corresponding sites of the
pcDNA3 expression vector (Invitrogen) containing the
cytomegalovirus (CMV) immediate-early promoter. This construct was
designated pcDNA3/hPPCT. The integrity of the clones was verified by
sequencing.
For the construction of a bacterial expression plasmid yielding hPPCT containing an N-terminal His-tag for easier purification, the cDNA of hPPCT was amplified by PCR with overhang primers attaching two additional restriction sites. A BamHI site was attached to the 5'-end of the cDNA using the sense primer (CTCGGATCCGGCTTCCAAAAGTTCTCC), and a HindIII site was attached to the 3'-end using the antisense primer (GCCAAGCTTTTAGTTGGCATTCTGGGGCA). The obtained fragment was cloned into PQE30 (QIAGEN, Hilden, Germany) in the same reading frame as the His tag, yielding a plasmid called PQE30/hPPCT.
The plasmids pCMV/interferon-
(IFN-) and
pCMV/granulocyte-macrophage colony-stimulating factor (GM-CSF) contain
the genes encoding mouse IFN- and GM-CSF, respectively, under the
control of the CMV immediate early promoter and were provided by
Jörg Reimann (University of Ulm, Ulm, Germany). As a control, the
plasmid pcDNA3/HDAg encoding hepatitis D virus p24 antigen was
used (24). Plasmid DNA for vaccination was prepared using
the Giga plasmid purification kit (QIAGEN) and was
dissolved in PBS at 1 mg/ml.
The precipitation of DNA onto 1-µm gold particles (Bio-Rad Laboratories, Inc., Hercules, CA) for use with the gene gun was
performed according to the manufacturer’s instructions at room
temperature. In a 1.5-ml microfuge tube 25-mg gold beads were weighed
out. One hundred microliters of 0.05 M spermidine
(Sigma, St. Louis, MO) were added, and the mixture was
vortexed for 20 sec and sonicated for 5 sec. Fifty micrograms of
pcDNA3/hPPCT (for coprecipitations, additionally 50 µg pCMV/IFN-
or pCMV/GM-CSF) or 50 µg pcDNA3/HDAg were added, and the mixture was
vortexed again for 20 sec. While vortexing, 100 µl 1 M
CaCl2 were added dropwise. The DNA was allowed to
precipitate at room temperature for 10 min. The supernatant was
removed, and the gold microcarriers were washed three times with fresh
100% ethanol. After the last wash, 3 ml ethanol containing 0.05 mg/ml
polyvinylpyrrolidone (Bio-Rad Laboratories, Inc.)
were added to the mixture. The gold microcarriers were then coated onto
the inner wall of Tefzel tubing (Bio-Rad Laboratories, Inc.) according to the manufacturer’s protocol.
Cell transfection in vitro
The expression construct pcDNA3/hPPCT and, as control, the empty
pcDNA3 vector were transfected into BHK cells using Lipofectamine
(Life Technologies, Inc., Eggenstein-Leopoldshafen,
Germany) as specified by the manufacturer. Briefly, 4 µg plasmid DNA
were incubated with 20 µg Lipofectamine in 200 µl OptiMEM medium
(Life Technologies, Inc.) for 45 min at room temperature.
The DNA liposome complexes were added to the cells in 1 ml OptiMEM for
6 h at 37 C in 5% CO2. Transfected
cells were maintained for another 48 h, and the supernatants were
collected at different time points (24 and 48 h). Supernatants
were analyzed for the presence of secreted human calcitonin (hCT) by a
commercial two-site immunoradiometric assay (Scantibodies Laboratory,
Inc., Santee, CA). This assay uses two different goat polyclonal
antibodies against hCT and has no significant cross-reaction with hCT
gene-related peptide (<0.1%). The lower limit of detection was 0.7
pg/ml. Interassay coefficient of variation was 7.0% at 20.2 pg/ml
(n = 63) and 12.7% at 203 pg/ml (n = 63).
Expression and purification of recombinant hPPCT protein
To obtain large amounts of recombinant hPPCT protein that can be
easily purified and used for antibody detection in enzyme-linked
immunosorbent assay (ELISA) and for stimulating T cells in
proliferation assay, the QIAexpress system (QIAGEN) was
used. Escherichia coli strain M15(pREP4) (QIAGEN) was
transformed with the expression construct PQE30/hPPCT. The right
transformants were selected on plates containing both ampicillin
(PQE30/hPPCT) and kanamycin (pREP4). For production of recombinant
hPPCT, 1 liter expression medium (25 g bacto-tryptone, 15 g
bacto-yeast extract, and 5 g NaCl) was inoculated with 50 ml of an
overnight culture. Induction was performed at
OD600 1.2 with
isopropyl--D-thiogalactoside (IPTG;
BIOMOL Research Laboratories, Inc., Hamburg, Germany)
added to a final concentration of 2 mM. The
expression of recombinant hPPCT was controlled by Western blotting.
Cells were pelleted 3.5 h after induction, resuspended in
sonication buffer (50 mM sodium phosphate, pH
7.8, and 300 mM NaCl), and lysed by sonification.
DNA and RNA were digested by deoxyribonuclease I and ribonuclease H
(Roche, Mannheim, Germany). After centrifugation, the
supernatant was discarded, and the protein was solubilized by the
addition of 8 M urea to the pellet. After
filtering through a 45-nm pore size filter, the His-tagged protein was
bound to nickel-nitrilotriacetic acid (Ni-NTA)-Superose fast protein
liquid chromatography column. The column was washed with 10 and 60
mM imidazole. The protein was eluted with 500
mM imidazole, and the eluate was collected in
fractions (basic purification). The fractions were tested for the
presence of the protein in SDS-PAGE. In a second purification step,
fractions containing the protein were diluted to an imidazole
concentration of 60 mM and then again bound to
Ni-NTA column. hPPCT was eluted using a linear gradient of imidazole
ranging from 60–500 mM (optimized purification).
The fractions were again controlled by SDS-PAGE, and those containing
the protein were combined and desalted via dialysis. The protein
concentration was determined using the Bradford microassay procedure
(Bio-Rad Laboratories, Inc.).
Protein was separated by 17% SDS-PAGE and colored with Coomassie blue or for Western blot analysis was transferred to a nitrocellulose membrane (Schleicher & Schuell, Inc., Dassel, Germany). Nonspecific binding sites were blocked with 3% BSA in Tris-buffered saline at room temperature for 1 h. The membrane was incubated for an additional 1 h with Ni-NTA horseradish peroxidase conjugate diluted 1:1000 (QIAGEN), which detects His-tagged proteins. Bands were visualized with (3,3',4,4'-tetraaminobiphenyl) tetrahydrochloride (Sigma) according to the manufacturer’s instructions.
The specificity of the purified protein was controlled by Western blot using a mouse monoclonal anti-hCT antibody (donated by Brahms Diagnostica, Berlin, Germany) diluted 1:500. This antibody recognizes the native and denatured forms of hCT as well as pro-CT (25). Detection was performed with horseradish peroxidase-labeled antimouse antibody (DAKO Corp., Copenhagen, Denmark) diluted 1:1000.
Immunization protocol
There were four groups of mice. Group 1 was immunized with
pcDNA3/hPPCT, group 2 was coinjected with pCMV/IFN-, and group 3 was
coinjected with pCMV/GM-CSF. As controls, mice from group 4 received
pcDNA3/HDAg. Groups 1–3 consisted of five animals each. In group 4 one
animal had to be killed because of a bad general condition before the
end of the immunization period, so that in this group only four animals
could be kept within the study. DNA vaccination was performed using the
hand-held helium-pulsed Helios gene gun (Bio-Rad Laboratories, Inc.). Cartridges were loaded into the gene gun and shot at 200
psi into freshly shaven abdominal skin of anesthetized mice. Two
cartridges were discharged per animal, delivering a total of 2 µg
pcDNA3/hPPCT or pcDNA3/HDAg/immunization (for cotransfections,
additionally 2 µg pCMV/IFN- or pCMV/GM-CSF). Mice were gunned six
times at 2-week intervals. Blood (300 µl) was drawn from the
retroorbital plexus 0, 6, 8, 10, and 13 weeks after the first
immunization. Three weeks after the last immunization mice were killed,
and spleens were removed.
T cell proliferation assay
Single cell suspensions of spleen cells from immunized mice were
depleted of erythrocytes by ammonium chloride lysis. Spleen cells were
cultured in triplicate using round-bottom 96-well microtiter plates
(Falcon, Becton Dickinson and Co., Franklin Lakes, NJ) at
2.5 x 104 cells/well in 225 µl complete
RPMI 1640 medium containing 10% FBS (Life Technologies, Inc.). Stimulated wells received purified hPPCT at two different
concentrations (1 or 0.5 µg/ml) or hCT (Sigma; 5 or 1
µg/ml). Con A (Sigma; 2.5 µg/ml) served as a positive
mitogenic control. Negative control wells received cells only. After a
4-day incubation, spleen cells were labeled with 1 µCi/well
[3H]thymidine (Amersham Pharmacia Biotech, Braunschweig, Germany; 37 MBq/ml) for 20 h.
[3H]Thymidine incorporation into DNA was
measured after harvesting. The stimulation index (SI) was calculated as
the mean counts per min of the stimulated wells divided by the mean
counts per min of the control wells. Positive assay was defined as a SI
of 2.0 or more.
Detection of anti-hPPCT and anti-hCT antibodies
The following ELISAs were developed and employed to measure
anti-hPPCT and anti-hCT antibodies in serum of immunized mice. In
brief, microtiter plates were coated with either purified hPPCT protein
(0.15 µg/well) or hCT protein (Sigma; 0.2 µg/well).
After blocking with 10% FBS in PBS for 1 h at 37 C, a 1:100
dilution of mouse serum was added to the plates and incubated at 37 C
for an additional 1 h. As a positive control, a monoclonal
anti-hCT antibody of mice (Brahms) was used at a concentration of 0.34
µg/well. After washing with PBS containing 0.05% Tween, a
horseradish peroxidase-labeled antimouse antibody (DAKO Corp.) was added at a dilution of 1:1000. After 1-h incubation
at 37 C, plates were washed, and substrate was added for color
development. The OD at 492 nm was determined after 10 min. A positive
assay has been defined as exceeding 3 SD above the mean
value of control mouse sera. The precision relating to within-assay
variability is 5.8% (n = 20). All relevant comparisons were made
within the same assay.
Statistical analysis
Proliferation assay values are presented as the mean of
triplicate measurements ± SEM.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
), designated pcDNA3/hPPCT-5. HCT was
not produced by BHK cells transfected with the empty pcDNA3 vector.
|
). The calculated
Mr of the His-tagged hPPCT protein was
approximately 16 kDa. This protein has an apparent
Mr of 25 kDa on the SDS gel, presumably due to
the His tag, as reported for His-tagged proteins (26). As
shown in Fig. 2B (lane 1), many unspecific bands were additionally
visible on the SDS gel after the first purification step. After the
second step (lane 2) hPPCT had a high purity, as no contaminants were
detectable on SDS-PAGE. The specificity of the purified protein was
confirmed by Western blotting using a monoclonal anti-hCT antibody
(Fig. 2C).
|
, no proliferative response was
observed after stimulation of splenocytes with hPPCT in mice
exclusively immunized with hPPCT expression plasmid (group 1). Two of
five mice coinjected with IFN- expression plasmid (group 2)
displayed a weak proliferative response after stimulation of
splenocytes with 1 µg/ml hPPCT. Moreover, we observed an improved T
cell proliferative response to hPPCT after codelivery of the GM-CSF
gene. Two of five mice coinjected with this cytokine gene (group 3)
elicited substantial proliferative responses after stimulation of
splenocytes with 1 µg/ml hPPCT. T cell proliferative activity after
in vitro stimulation with purified hPPCT was dose
dependent, because stimulation of splenocytes with a lower
concentration of hPPCT (0.5 µg/ml) decreased the observed
proliferative responses to 1 µg/ml hPPCT in mice coinjected with
IFN- or GM-CSF expression plasmids (Fig. 3A).
|
)
were weaker than the responses generated against hPPCT. Neither
immunization with hPPCT expression plasmid alone (group 1) nor
codelivery of IFN- expression plasmid (group 2) generated
proliferative activity of splenocytes against hCT, although a higher
concentration of hCT (5 µg/ml) compared with hPPCT (1 µg/ml) was
used for in vitro stimulation of splenocytes. However,
consistent with our results demonstrating an augmentation of the T cell
response against hPPCT by coinjection of the GM-CSF gene, we found an
enhancement of the T cell proliferative activity against hCT after
codelivery of this cytokine gene (group 3). Two of five mice
coimmunized with GM-CSF-encoding plasmid displayed a proliferative
response after stimulation of splenocytes with 5 µg/ml hCT. As expected, lymphocytes, derived from mice vaccinated with HDAg expression plasmid (group 4), did not respond to hPPCT or hCT.
All mice that failed to respond to hPPCT or hCT in proliferative assays showed stimulation indexes ranging from 55–225 after in vitro stimulation of splenocytes with the positive mitogenic control Con A, indicating that the T cells of these mice were not generally impaired.
Humoral immune responses against hPPCT and hCT induced by DNA
immunization
Immunization with hPPCT expression plasmid alone (group 1) induced
hPPCT-specific antibodies in two of five mice, as shown in Fig. 4. After coinjection of the IFN- gene
(group 2) two of five mice demonstrated an anti-hPPCT antibody response
weaker than that of mice immunized with hPPCT expression plasmid
alone. In contrast, coinjection of the GM-CSF gene (group 3) resulted
in much stronger anti-hPPCT antibody responses compared with those in
mice receiving hPPCT expression plasmid alone. Four of five mice
coinjected with the GM-CSF gene developed significant levels of
antibodies against hPPCT. After coinjection of the GM-CSF gene
anti-hPPCT antibodies were initially detected as early as 6 weeks after
the first immunization compared with 8 weeks after immunization with
hPPCT expression plasmid alone or coinjection of the IFN- gene.
Thus, codelivery of the GM-CSF gene not only augmented the frequency of
anti-hPPCT seroconversions, but also resulted in an earlier time point
of seroconversions.
|
or GM-CSF genes failed to generate detectable anti-hCT
antibodies at any time point (data not shown). Sera derived from control mice immunized with HDAg expression plasmid (group 4) were negative for anti-hPPCT and anti-hCT antibodies.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
For immunization, an expression plasmid encoding the hCT precursor hPPCT was used instead of hCT, because this larger molecule, comprising 141 amino acid residues, has a greater probability of containing suitable epitopes than mature hCT, a 32-residue peptide. According to this assumption, the T cell proliferation observed after in vitro stimulation of splenocytes of immunized animals was weaker when hCT was used as an antigen instead of hPPCT. Similarly, only antibodies against hPPCT, not those against hCT were detectable in sera of immunized animals. These results indicate that hPPCT indeed contains more relevant T and B cell epitopes than the small mature molecule hCT.
In the present study particle gun-mediated gene transfer was used for introducing DNA constructs into the animals. This method is highly effective, atraumatic (27, 28, 29, 30), and offers the advantage that much smaller amounts of DNA are required for immunization than with direct im injection. Gene gun administration works by direct transfection of host cells in the dermis, including dendritic cells (31). In pilot experiments performed with gene gun immunization with hPPCT expression plasmid, we found that application of 1 µg DNA three times did not elicit notable antigen-specific cellular or humoral immune responses in the presence or absence of cytokine genes (data not shown). The paucity of immunostimulatory motifs in these low amounts of DNA applied may be the reason for the failure of effective immune responses to be induced. We therefore increased the number of vaccinations as well as the amount of DNA applied per immunization to six times and 2 µg, respectively, in the experiments reported here.
Inasmuch as it is known that the immunization schedule
(32) as well as the route of application of plasmid DNA
(33, 34, 35) manipulate the quality of the immune response
generated, there exists the potential to further influence the response
via cytokine gene codelivery. Several reports have shown that the
codelivery of vectors encoding cytokines such as interleukin-2,
interleukin-12, IFN-, or GM-CSF can direct the nature of the
resulting immune response and augment the efficacy of DNA vaccines
(36, 37, 38). GM-CSF especially seems to be potent in
enhancing cellular and humoral immune responses (39, 40, 41),
possibly due to inducing the differentiation of primitive hematopoietic
precursors into dendritic cells (42), activating
antigen-presenting cells (43), or increasing the
expression of MHC class II molecules in antigen-presenting cells
(44), thus augmenting their antigen-presenting ability. In
the present study we evaluated the efficacy of coadministration of
expression plasmids encoding IFN- and GM-CSF. In accordance with the
finding cited above, our results indicate that both proliferative
cellular and antibody responses are enhanced when the hPPCT DNA vaccine
is delivered in the presence of the GM-CSF gene. In addition, the group
of animals immunized with hPPCT and GM-CSF expression plasmids not only
developed higher levels of anti-hPPCT antibodies, but also showed an
earlier time point of seroconversions compared with the group immunized
with hPPCT DNA alone. In contrast to the results obtained with GM-CSF,
codelivery of IFN- expression plasmid resulted in a decreased
magnitude of antibody response against hPPCT compared with immunization
with hPPCT expression plasmid alone. A similar finding on the
regulation of the antibody response by IFN- gene to a DNA vaccine
has been reported previously (38). One explanation for
this observation could be that IFN- is a cytokine that tends to
enhance Th1-like (45) and suppress Th2-like responses,
leading to a decreased B cell response.
Our results demonstrate that DNA immunization can induce proliferative cellular and humoral immune responses against hPPCT and that these responses might be modulated by cytokines such as GM-CSF; it remains unclear whether this kind of immune response is effective at preventing tumor growth. There is, however, increasing evidence for an effective antitumor activity of proliferative T cell responses that are mediated by CD4+ T cells (39, 46). These cells seem to be important components of a successful antitumor immune response. Tumor-specific CD4+ cells not only provide help for the induction of specific CD8+ cytotoxic T lymphocytes, but are also critical in activating macrophages and eosinophils to produce nitric oxide and superoxides. Independently of CD8+ cells, these cells then collaborate in the destruction of tumor cells (46, 47).
In addition to the analysis of the immune responses described above, histological and immunocytochemical examinations of thyroid sections of our DNA-vaccinated mice were performed to control potential infiltration of immune cells. However, there was no evidence for lymphocyte or other cell infiltration into the thyroids of mice that were DNA-immunized with hPPCT in the presence or absence of cytokine genes (data not shown). This could result from the failure of mouse lymphocytes to cross-react between human PPCT (used for DNA immunization) and mouse PPCT (expressed in the thyroids), which are 77% identical (26), indicating the absence of conserved epitopes.
A beneficial use of DNA immunization as immunotherapy for patients suffering from MTC clearly requires the precondition to break immunological self-tolerance and to induce a potent response against self-antigens expressed by normal C cells and MTC tumor cells in vivo. Recently, it has been shown that tolerance to mouse tumor antigens can be broken by DNA immunization of the animals (22, 48). Breaking such self-tolerance may be aided by codelivery of genes encoding immunostimulatory cytokines such as GM-CSF to boost response.
In summary, our results provide evidence that DNA immunization with hPPCT expression plasmid by gene gun enables induction of antigen-specific cellular and humoral immune responses in mice. Codelivery of a plasmid encoding GM-CSF increases the efficacy of this DNA vaccine. These findings provide the basis for the generation of an efficient antitumor immune response against MTC by DNA vaccination. Future studies are necessary to establish such a response in humans. If successful, it would provide a novel treatment option for patients suffering from progressive MTC. In addition, family members genetically at risk of developing MTC may benefit from DNA vaccination against PPCT by eliminating or at least postponing disease manifestation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received August 21, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-CGRP gene in health and disease. Biochem
Soc Symp 52:91–105[Medline]
TCR transgenic mice:
IL-12 substitution for macrophages to stimulate IFN- production is
IFN--dependent. Int Immunol 5:1119–1128This article has been cited by other articles:
 |
|
 |
|
  M. Wuttke, C. Papewalis, Y. Meyer, C. Kessler, B. Jacobs, H. S. Willenberg, S. Schinner, C. Kouatchoua, T. Baehring, W. A. Scherbaum, et al. Amino Acid-Modified Calcitonin Immunization Induces Tumor Epitope-Specific Immunity in a Transgenic Mouse Model for Medullary Thyroid Carcinoma Endocrinology, November 1, 2008; 149(11): 5627 - 5634. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Papewalis, M. Wuttke, J. Seissler, Y. Meyer, C. Kessler, B. Jacobs, E. Ullrich, H. S. Willenberg, S. Schinner, T. Baehring, et al. Dendritic Cell Vaccination with Xenogenic Polypeptide Hormone Induces Tumor Rejection in Neuroendocrine Cancer Clin. Cancer Res., July 1, 2008; 14(13): 4298 - 4305. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Schott Immunesurveillance by dendritic cells: potential implication for immunotherapy of endocrine cancers. Endocr. Relat. Cancer, September 1, 2006; 13(3): 779 - 795. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Haupt, M. Roggendorf, and K. Mann The Potential of DNA Vaccination against Tumor-Associated Antigens for Antitumor Therapy Experimental Biology and Medicine, April 1, 2002; 227(4): 227 - 237. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Schott, J. Seissler, M. Lettmann, V. Fouxon, W. A. Scherbaum, and J. Feldkamp Immunotherapy for Medullary Thyroid Carcinoma by Dendritic Cell Vaccination J. Clin. Endocrinol. Metab., October 1, 2001; 86(10): 4965 - 4969. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
)
and 1 µg/ml (
) purified hPPCT (A) or with 1 µg/ml (