help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Way, J. M.
Right arrow Articles by Kliewer, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Way, J. M.
Right arrow Articles by Kliewer, S. A.
Endocrinology Vol. 142, No. 3 1269-1277
Copyright © 2001 by The Endocrine Society


ARTICLES

Comprehensive Messenger Ribonucleic Acid Profiling Reveals That Peroxisome Proliferator-Activated Receptor {gamma} Activation Has Coordinate Effects on Gene Expression in Multiple Insulin-Sensitive Tissues

James M. Way, W. Wallace Harrington, Kathleen K. Brown, William K. Gottschalk, Scott S. Sundseth, Traci A. Mansfield, Ravi K. Ramachandran, Timothy M. Willson and Steven A. Kliewer

Departments of Molecular Endocrinology (J.M.W., S.A.K.), Metabolic Diseases (W.W.H., K.K.B., W.K.G.), Discovery Genetics (S.S.S.), and Medicinal Chemistry (T.M.W.), Glaxo Wellcome Inc., Research and Development, Research Triangle Park, North Carolina 27709; and CuraGen Corp. (T.A.M., R.K.R.), New Haven, Connecticut 06511

Address all correspondence and requests for reprints to: Dr. Steven A. Kliewer, Glaxo Wellcome Inc. Research and Development, Venture 118, 5 Moore Drive, Research Triangle Park, North Carolina 27709. E-mail: sak15922{at}glaxowellcome.com


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonists, including the glitazone class of drugs, are insulin sensitizers that reduce glucose and lipid levels in patients with type 2 diabetes mellitus. To more fully understand the molecular mechanisms underlying their therapeutic actions, we have characterized the effects of the potent, tyrosine-based PPAR{gamma} ligand GW1929 on serum glucose and lipid parameters and gene expression in Zucker diabetic fatty rats. In time-course studies, GW1929 treatment decreased circulating FFA levels before reducing glucose and triglyceride levels. We used a comprehensive and unbiased messenger RNA profiling technique to identify genes regulated either directly or indirectly by PPAR{gamma} in epididymal white adipose tissue, interscapular brown adipose tissue, liver, and soleus skeletal muscle. PPAR{gamma} activation stimulated the expression of a large number of genes involved in lipogenesis and fatty acid metabolism in both white adipose tissue and brown adipose tissue. In muscle, PPAR{gamma} agonist treatment decreased the expression of pyruvate dehydrogenase kinase 4, which represses oxidative glucose metabolism, and also decreased the expression of genes involved in fatty acid transport and oxidation. These changes suggest a molecular basis for PPAR{gamma}-mediated increases in glucose utilization in muscle. In liver, PPAR{gamma} activation coordinately decreased the expression of genes involved in gluconeogenesis. We conclude from these studies that the antidiabetic actions of PPAR{gamma} agonists are probably the consequence of 1) their effects on FFA levels, and 2), their coordinate effects on gene expression in multiple insulin-sensitive tissues.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ADULT-ONSET (TYPE 2) diabetes mellitus afflicts more than 100 million people worldwide, and its prevalence is soaring in Western countries with high fat diets and sedentary lifestyles. Insulin resistance, which is an inability of the body to respond efficiently to insulin, is an early step in the onset of type 2 diabetes. The thiazolidinedione-based glitazones, including Avandia (rosiglitazone) and Actos (pioglitazone), are a promising new class of drug used for the treatment of type 2 diabetes (1, 2, 3). These drugs increase insulin sensitivity and lower glucose levels in type 2 diabetics by enhancing glucose metabolism in muscle and decreasing glucose biosynthesis (gluconeogenesis) in liver (1, 4).

The glitazones mediate their therapeutic effects by binding and activating peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}), a member of the nuclear hormone receptor family of ligand-activated transcription factors (1, 2, 5). Recently, potent nonglitazone PPAR{gamma} ligands such as the tyrosine analogs GI262570 and GW1929 have also been shown to enhance insulin sensitivity in humans and rodent models of type 2 diabetes (6, 7, 8). PPAR{gamma} is highly expressed in adipose tissue and plays a pivotal role in fat cell differentiation (1, 9). PPAR{gamma} regulates gene expression by binding as a heterodimer with the 9-cis retinoic acid receptors (RXRs) to DNA response elements comprised of two copies of the consensus nuclear receptor half-site sequence AGGTCA organized as a direct repeat (DR) and separated by a single nucleotide spacer, a so-called DR-1 motif. PPAR{gamma} response elements have been identified in the regulatory regions of several genes involved in fatty acid and carbohydrate metabolism (10). In addition to the synthetic glitazones and tyrosine analogs, PPAR{gamma} is activated by various naturally occurring polyunsaturated fatty acids and polyunsaturated fatty acid metabolites (2, 5). Thus, PPAR{gamma} may represent a molecular link between fatty acids and insulin sensitivity.

Although the antidiabetic actions of PPAR{gamma} agonists are well established, the mechanism underlying the pharmacological activities of these drugs has remained obscure. How does activation of PPAR{gamma}, which is highly expressed in fat cells, result in therapeutic effects in muscle and liver? There are several plausible explanations involving either direct or indirect effects on muscle and liver (1, 2). To better understand the mechanism by which PPAR{gamma} activation improves insulin sensitivity, we have identified genes regulated by the selective, tyrosine-based PPAR{gamma} agonist GW1929 in major insulin-sensitive tissues, including epididymal white adipose tissue (WAT), interscapular brown adipose tissue (BAT), soleus skeletal muscle, and liver of Zucker diabetic fatty (ZDF) rats. PPAR{gamma}-regulated genes were identified using an unbiased and comprehensive messenger RNA (mRNA) profiling technique, called GeneCalling (11). In this technique, complementary DNA (cDNA) fragments representing differentially expressed genes are identified by comparing the length of each fragment against a sequence database. The identities of differentially expressed genes are confirmed by competitive PCR using gene-specific oligonucleotides. Our results demonstrate that PPAR{gamma} activation has coordinate effects on genes regulating important metabolic pathways in WAT, BAT, skeletal muscle, and liver.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
GW1929 was synthesized by the Medicinal Chemistry Department at Glaxo Wellcome Inc.

Experimental animals and protocols
All procedures performed were in compliance with the Animal Welfare Act and USDA regulations and were approved by the Glaxo Wellcome Inc., institutional animal care and use committee. Animals were housed at 72 F and 50% relative humidity with a 12-h light, 12-h dark cycle, and fed chow diet (Formulab Diet 5008, PMI Feeds, Inc., Richmond, IN). Age-matched (9 weeks) and glucose-matched male ZDF rats (Genetic Models, Inc., Indianapolis, IN) were gavaged twice daily for the indicated periods of time with either vehicle (0.05 M n-methylglucamine) or GW1929 (5.0 mg/kg). Glucose, triglycerides, and FFAs were measured as previously described (7).

Biochemical assays
Serum triglyceride and FFA levels were determined using a Technicon AXON automated chemistry analyzer (Bayer Corp., Tarrytown, NY) as previously described (7). Serum triglyceride concentrations were measured using Bayer Corp. reagents and Axon method SM4–2148K94. FFA concentrations were measured using Waco FFA C test kit 990–75401 (Waco, Neuss, Germany). Plasma glucose measurements were made with a glucose analyzer (model 2700, YSI, Inc., Yellow Springs, OH).

GeneCalling differential gene expression methodology
Genes that were differentially expressed in GW1929- vs. vehicle-treated ZDF rats were identified by GeneCalling technology essentially as previously described (11) using 96 different pairs of endonucleases and mRNA prepared from WAT, BAT, skeletal muscle, and liver. All genes that were determined to be regulated 1.5-fold or more by treatment were confirmed by competitive PCR using gene-specific oligonucleotides as previously described (11).

Real-time quantitative PCR (RTQ-PCR)
RTQ-PCR was performed using an ABI PRISM 7700 Sequence Detection System instrument and software (PE Applied Biosystems, Foster City, CA) as previously described (12, 13) with minor modifications. Briefly, the expression levels of selected genes were compared between tissues from either vehicle- or GW1929-treated animals using RNA pooled from each treatment group (three animals per group). Pooled RNA samples were normalized for comparison by determining 18S ribosomal RNA levels by RTQ-PCR. Expression levels of selected genes were determined by generating a seven-point serial standard curve (each point performed in triplicate) using vehicle-treated RNA for each gene, with the final assay concentration ranging from 1.6–100 ng total RNA/25 µl reaction. This curve was used to calculate the amount of target gene mRNA in vehicle and treated sample based on RTQ-PCR performed with 25 ng total RNA/25-µl reaction (reactions performed in quintuplicate). Primer/probe sequences used were as follows: glycerol-3-phosphate acyltransferase: forward, CGAAGGAGGCTGATCGCA; reverse, ATGATAGCGCAGGACTTGCTG; probe, ACCTGGCGGAGCACATTCTCTTC-ACC; ketoacyl-coenzyme A (ketoacyl-CoA) thiolase: forward, ACTCTGCCGACCGTCTGG; reverse, GAACGCAGTGCATATTTATCCTGT; probe, TGCTGCCTTTGCTGTTT-CTCGAATGG; heart fatty acid-binding protein (hFABP): forward, CAAGTCGGTCGTGACACTGG; reverse, CCTGCCCGTCCCACTTC; probe, CGGAGGCAAACTGGTCCATGTGC; peroxisomal enoyl-CoA isomerase: forward, CTTCTTGTGAGGAGTCTTGCCA; reverse, CGCAATCATGAGCTTTGTTACC; probe, TGTCGTGGACTTCACAGCTTTGGCTTT; carnitine/acylcarnitine carrier protein: forward, TTGGGATCCGTGGCTTCTAC; reverse, ATCCCACTGGCAGGAACATC; probe, AGGGACTGCGCTCACTCTCATGCG; long chain enoyl CoA hydratase: forward, CTCCAAGGACACCACAGCGT; reverse, TTGACCACAATGATGACC-TTCC; probe, TGCCGTGGCCGTGGGTCTC; and phosphoenolpyruvate carboxykinase (PEPCK): forward, TGAGGAAGTTTGTGGAAGGCA; reverse, GCCGTCGCAGATGTGAATATACT; probe, TGCCCAGCTGTGCCAGCCA. Results are expressed as the fold change by determining the ratio of calculated units of RNA in treated compared with vehicle groups. ANOVA was used to evaluate statistical significance.

Generation of cDNA probes
cDNA fragments encoding rat pyruvate dehydrogenase kinase 4 (PDK4; 423 bp) or hFABP (397 bp) were amplified by PCR from 250 ng rat heart cDNA (CLONTECH Laboratories, Inc., Palo Alto, CA) using the following PCR primer pairs: PDK4, 5'-CCAATCCACATCGTGTACGTTCC-3' (coding strand) and 5'-TGCGGAAACAAGAGTCCACACACATTC-3' (noncoding strand); and hFABP, 5'-ATGGCGGACGCCTTTGTCGGTAC-3' (coding strand) and 5'-TCACGTTCTCGTAAGTCCGAGTG-3' (noncoding strand). A 544-bp cDNA fragment encoding a portion of rat PEPCK was amplified by PCR from 250 ng rat liver cDNA (CLONTECH Laboratories, Inc., Palo Alto, CA) using the primer pair 5'-TCTACGAAGCTCTCAGCTGGCAG-3' (coding strand) and 5'-TTACATCTGGCTGATTCTCTGTTTC-3' (noncoding strand). Fragments were labeled with [32P]deoxy-CTP using the MegaPrime random primers labeling system according to the manufacturer’s protocol (Amersham Pharmacia Biotech, Aylesbury, UK).

RNA preparation and Northern blot analysis
Total RNA from liver, WAT, and soleus muscle was prepared from ZDF rats using TRIzol reagent according to the manufacturer’s protocol (Life Technologies, Inc., Gaithersburg, MD), resolved on a 1% agarose/formaldehyde gel, and transferred to a nylon membrane. After UV cross-linking, filters were prehybridized at 68 C in Express-Hyb (CLONTECH Laboratories, Inc.) for 60 min, followed by hybridization to specific 32P-labeled cDNA probes at a concentration of 1 x 106 cpm/ml for 2 h at 68 C. Filters were washed twice in 2 x SSC (standard saline citrate)/0.1% SDS for 20 min, followed by a single wash in 0.1 x SSC/0.1% SDS at 60 C and exposed to storage phosphor screens for several hours. Northern blots were stripped and reprobed with ß-actin for normalization. Image analysis and quantitation from the phosphor screen were performed on a Storm optical scanner using the ImageQuant software package (Molecular Dynamics, Inc., Sunnyvale, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Genes regulated by the PPAR{gamma} agonist GW1929 in insulin-sensitive tissues
To identify genes regulated by a PPAR{gamma} agonist, ZDF rats were treated for 7 days with either GW1929 or vehicle alone. GW1929 is a tyrosine-based, nonthiazolidinedione PPAR{gamma} agonist that activates PPAR{gamma} in vitro with a half-maximal effective concentration of about 10 nM. GW1929 is more than 1000-fold selective for PPAR{gamma} relative to either PPAR{alpha} or PPAR{delta} (6, 7). As expected, GW1929 treatment resulted in marked decreases in serum glucose, triglyceride, and FFA levels (Table 1Go). At the end of the treatment period, mRNA was prepared from epididymal WAT, interscapular BAT, liver, and soleus skeletal muscle. Genes whose expression was either increased or decreased in response to GW1929 were identified by GeneCalling mRNA profiling technology (11). Based on the fraction of GeneCalling cDNA fragments that were changed by treatment, we estimate that approximately 10% of all genes were regulated 1.5-fold or more in WAT and BAT, approximately 2% in liver, and approximately 1% in skeletal muscle. These data are consistent with the finding that PPAR{gamma} is much more highly expressed in WAT and BAT than in either liver or skeletal muscle. Genes with known function that were identified in this study as regulated 1.5-fold or more by GW1929 are listed in Table 2Go. As part of the standard GeneCalling analysis, the regulation of each of these genes was confirmed by a competitive PCR reaction using a gene-specific oligonucleotide as previously described (11). In addition, the changes in the expression of a number of these genes were confirmed by either Northern analysis or RTQ-PCR (Table 2Go). In all cases, the direction in which the gene was regulated (i.e. either stimulation or repression) agreed between GeneCalling and Northern or RTQ-PCR analysis. In most cases, we also observed a good quantitative correlation between the data obtained via the GeneCalling technology and either Northern or RTQ-PCR analysis (Table 2Go and Figs. 1Go and 2Go).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Effects of GW1929 on serum parameters in ZDF rats

 

View this table:
[in this window]
[in a new window]
 
TABLE 2. Genes differentially regulated by a PPAR{gamma} agonist in insulin-sensitive tissues

 

Figure 1
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 1. PPAR{gamma} activation differentially regulates gene expression in WAT and muscle. ZDF rats were treated with either GW1929 or vehicle alone for 7 days (n = 3/treatment group), and total RNA was prepared from WAT and soleus skeletal muscle. Levels of glycerol-3-phosphate acyltransferase (GPAT), ketoacyl CoA-thiolase (KACT), hFABP, peroxisomal enoyl-CoA isomerase (PECI), carnitine/acylcarnitine carrier protein (C/ACCP), and long-chain enoyl-CoA hydratase (LC-ECH) mRNA were determined by RTQ-PCR analysis in WAT ({square}) and muscle ({blacksquare}) and are plotted as fold regulation in GW1929 treatment vs. vehicle treatment. *, P < 0.01; **, P < 0.001 (compared with vehicle treatment). The change in expression (fold regulation) for each of the genes as determined by GeneCalling analysis (Table 2Go) is superimposed on each of the bars for comparison.

 

Figure 2
View larger version (48K):
[in this window]
[in a new window]
 
FIG. 2. Time-course study for effects of PPAR{gamma} agonist treatment on gene expression in WAT, liver, and muscle. ZDF rats were treated with either GW1929 or vehicle alone for 6 h, 24 h, or 7 days (n = 3/treatment group), and total RNA was prepared from WAT, liver, and soleus skeletal muscle at each of the time points. Northern blot analysis was performed with probes for hFABP (top), PEPCK (middle), or PDK4 (bottom) as indicated. Northern blot data were quantified with a PhosphorImager and normalized using ßactin, and are shown to the right of each blot. *, P < 0.05; **, P < 0.01 (compared with vehicle treatment).

 
WAT
GW1929 treatment resulted in a coordinate increase in the expression of a large number of genes involved in glucose and fatty acid homeostasis in WAT. Among these were many genes whose products are required for lipogenesis, including the dihydrolipoamide acyltransferase subunit of pyruvate dehydrogenase (PDH; Table 2Go, line 32), acetyl-CoA carboxylase (Table 2Go, line 1), which catalyzes the rate-limiting step in long-chain fatty acid biosynthesis, fatty acid synthase (Table 2Go, line 2), proteins of the pyruvate/malate cycle (citrate synthase, pyruvate carboxylase, tricarboxylate transport protein, ATP-citrate lyase, cytosolic malate dehydrogenase, and malic enzyme; Table 2Go, lines 3–7 and 31), and proteins involved in fatty acid desaturation (stearyl-CoA desaturase; Table 2Go, line 8) and triglyceride biosynthesis (PEPCK, long-chain acyl-CoA synthetase, and glycerol-3-phosphate acyltransferase; Table 2Go, lines 9, 11, 30). PEPCK and acyl-CoA synthetase were previously shown to be regulated by glitazones and PPAR{gamma} (14, 15). Glycogen synthase expression was also markedly increased by GW1929 treatment (Table 2Go, line 34). The increased expression of these genes is consistent with GW1929 stimulating the storage of glucose in white adipocytes as either triglyceride or glycogen.

GW1929 treatment stimulated the expression of genes involved in different aspects of fatty acid metabolism in WAT, including lipoprotein catabolism (lipoprotein lipase; Table 2Go, line 24), fatty acid transport (CD36, fatty acid transport protein, and hFABP; Table 2Go, lines 25–27), and fatty acid oxidation (e.g. carnitine palmitoyltransferase I, short-chain and long-chain acyl-CoA dehydrogenases, and monoglyceride lipase; Table 2Go, lines 12–18 and 20, 21, 23). Several of these genes, including CD36, lipoprotein lipase, and fatty acid transport protein, were previously shown to be regulated by glitazones (15, 16, 17). In agreement with a previous study (18), uncoupling protein 3 (UCP3) expression was also increased by PPAR{gamma} agonist treatment (Table 2Go, line 16). Although its precise function is unknown, UCP3 expression increases under physiological conditions that raise FFA levels (19). A recent report showed that overexpression of UCP3 in the skeletal muscle of mice resulted in the dissipation of energy (20). Taken together, these changes in gene expression suggest that increased uptake, storage, and oxidation of fatty acids in WAT contribute to the marked hypolipidemic actions of GW1929. We note that expression of the adipocyte fatty acid-binding protein (aP2), which is directly regulated by PPAR{gamma} during adipocyte differentiation and highly expressed in mature fat cells (21, 22), was only modestly (1.6-fold) increased in WAT by GW1929 treatment (Table 2Go, line 28), whereas expression of hFABP, which is expressed in a wide variety of tissues (23), was dramatically stimulated (Table 2Go, line 27). Interestingly, GW1929 treatment increased expression of the transcription factor adipocyte determination and differentiation factor-1/sterol regulatory element-binding protein-1c (ADD1/SREBP1c) 2.2-fold in WAT (Table 2Go, line 65). ADD1/SREBP1c is a transcription factor that cooperates with PPAR{gamma} in promoting adipocyte differentiation in vitro. Moreover, ADD1/SREBP1c regulates several genes involved in lipogenesis in mature adipocytes and may play a broad role in mediating the actions of insulin on genes involved in lipid and carbohydrate metabolism (24, 25). GW1929 treatment also induced expression of the rat ortholog of insulin-induced growth response protein (CL-6; Table 2Go, line 45). Although its function is not known, insulin-induced growth response protein is highly induced in the liver after insulin treatment and is also known to be expressed in cultured fibroblasts and adipocytes (26, 27). The induction of CL-6 suggests that PPAR{gamma} activation is potentiating the actions of insulin in WAT.

Expression of several genes was decreased by GW1929 in WAT, including phosphodiesterase I, {alpha}-crystalin, and the contrapsin-like and C1 protease inhibitors (Table 2Go, lines 46–49). We note that tumor necrosis factor-{alpha} and leptin, which were previously shown to be inhibited by glitazones (28, 29, 30), were not regulated 1.5-fold or more in WAT or other tissues in this study (data not shown). This may reflect differences in the animal model, the treatment regimen, or the PPAR{gamma} agonists employed.

BAT
Overall, the pattern of gene regulation by GW1929 in interscapular BAT was very similar to that seen in WAT, with changes occurring in the expression of genes involved in lipogenesis and fatty acid transport and oxidation (Table 2Go). These data demonstrate that PPAR{gamma} agonists regulate many common genes in BAT and WAT. Only a few genes were differentially regulated by GW1929 in BAT relative to WAT. For example, mitochondrial long chain enoyl-CoA hydratase (Table 2Go, line 20) and PDK4 (Table 2Go, line 33), which were modestly up-regulated by GW1929 in WAT, were down-regulated in BAT. The expression of several genes that were unaffected by treatment in WAT was decreased in BAT, including creatine kinase and myoglobin (Table 2Go, lines 50 and 51). The significance of these differences between adipose tissue depots is unclear. However, as BAT and WAT subserve distinct physiological roles, the finding that there are differences in their gene expression patterns is not surprising.

Liver
In contrast to WAT and BAT, roughly equal numbers of genes were up-regulated and down-regulated in liver by GW1929 (Table 2Go). Notably, GW1929 treatment resulted in decreases in the expression of PEPCK, pyruvate carboxylase, and glucose-6-phosphatase (Table 2Go, lines 29–31), which are required for hepatic gluconeogenesis. PEPCK expression was previously shown to be reduced by glitazones in cultured rat hepatocytes (31) and in streptozotocin-treated rats (32). These changes in gene expression suggest a molecular basis for the finding that PPAR{gamma} agonists reduce hepatic glucose production in vivo (33, 34). GW1929 treatment also decreased the expression of several genes involved in fatty acid oxidation (Table 2Go, lines 14 and 19–21) and HMG-CoA synthase (Table 2Go, line 42), which encodes the enzyme responsible for the rate-limiting step in ketogenesis. The formation of ketone bodies is decreased by PPAR{gamma} agonists in rodent models of insulin resistance (35). In contrast, GW1929 treatment increased the expression of several genes involved in lipogenesis (Table 2Go, lines 2, 5, 8, and 10) and increased hepatic expression of glucokinase (Table 2Go, line 38), which catalyzes a key step in glucose metabolism.

Skeletal muscle
In contrast to the other tissues, most of the genes regulated by GW1929 in skeletal muscle showed decreased expression (Table 2Go). Notably, expression of PDK4 was decreased about 8-fold by GW1929 treatment (Table 2Go, line 33). As PDK4 phosphorylates and inactivates the PDH complex, thus inhibiting oxidative glucose metabolism, this finding suggests a molecular basis for increased glucose utilization in muscle of PPAR{gamma} agonist-treated animals. In agreement with this observation, PDH activity was recently shown to be reduced in ZDF rats and to be restored by troglitazone treatment (36). GW1929 treatment also resulted in a coordinate repression of 10 genes involved in fatty acid transport and oxidation (Table 2Go, lines 13, 16–22, 26, and 27), suggesting a decrease in the utilization of fatty acids for energy in the muscle of treated animals. In agreement with a previous study performed with pioglitazone (37), UCP3 expression was decreased by PPAR{gamma} agonist treatment (Table 2Go, line 16). As expression of both PDK4 and UCP3 is stimulated by physiological conditions that increase FFA levels (19, 38), the data suggest that GW1929 treatment decreases fatty acid levels in muscle. Expression of aP2 was modestly increased (1.8-fold) in skeletal muscle (Table 2Go, line 28). It is not clear whether this reflects changes in aP2 expression in myocytes or in adipocytes present in the soleus muscle tissue. Expression of aP2 can be induced by PPAR{gamma} agonists in cultured muscle cells (39, 40), but it is not known whether this trans-differentiation occurs in vivo. Taken together, the gene expression data suggest an increase in glucose utilization and a decrease in fatty acid utilization in the muscle of PPAR{gamma} agonist-treated animals.

GW1929 has opposing effects on gene expression in WAT and muscle
The GeneCalling analysis revealed that many of the same genes involved in fatty acid transport and oxidation showed increased expression in WAT and BAT and decreased expression in skeletal muscle in response to GW1929 treatment (Table 2Go). We confirmed the differential regulation of several of these genes by RTQ-PCR analysis using RNA derived from WAT or skeletal muscle. As expected, the expression of glycerol-3-phosphate acyltransferase, ketoacyl-CoA-thiolase, hFABP, peroxisomal enoyl-CoA isomerase, carnitine/acylcarnitine carrier protein, and long-chain enoyl-CoA hydratase was significantly increased in WAT and decreased in muscle by GW1929 (Fig. 1Go). The magnitudes of these changes roughly paralleled those seen in the GeneCalling analysis (Fig. 1Go and Table 2Go). These data provide strong evidence that PPAR{gamma} activation differentially modulates fatty acid metabolism in WAT and muscle.

Time course for the tissue-specific effects of GW1929
We sought to determine the kinetics with which GW1929 affected serum glucose and lipid levels and gene expression in different insulin-sensitive tissues. ZDF rats were treated with either GW1929 or vehicle alone for 6 h, 24 h, or 7 days to distinguish early effects from secondary effects. Clinical parameters were measured, and total RNA was prepared from WAT, liver, and muscle at each time point. A statistically significant decrease in FFA levels was observed at 24 h, although a more modest decrease was seen at the 6 h point (Table 3Go). Changes in serum glucose and triglyceride levels were seen only at 7 days (Table 3Go). These data demonstrate that PPAR{gamma} agonist-induced decreases in FFA levels precede those in glucose and triglyceride levels, suggesting that decreases in FFA levels may be important for the insulin-sensitizing actions of PPAR{gamma} agonists.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Time course for effects of GW1929 on serum parameters in ZDF rats

 
To examine the temporal relationship between changes in serum parameters and gene expression, we performed Northern blot analysis of hFABP expression in WAT, PEPCK expression in liver, and PDK4 expression in skeletal muscle at the 6 h, 24 h, and 7 day points. These genes were chosen based on their high degree of regulation by GW1929 in their respective tissues (Table 2Go, lines 27, 30, and 33). An increase in hFABP mRNA in WAT was observed at 24 h after treatment (Fig. 2Go). hFABP expression levels were further increased after 7 days of treatment. Interestingly, we observed a statistically significant change in PDK4 expression as early as 6 h after treatment with GW1929 (Fig. 2Go). Surprisingly, PDK4 mRNA levels increased in GW1929-treated animals at the 6 h point. The reason for this initial increase in PDK4 expression is not known. However, after 24 h of treatment, PDK4 mRNA levels had fallen to approximately 50% of those in vehicle-treated animals. A further decrease in PDK4 mRNA levels was seen at the 7 day point (Fig. 2Go). By contrast, no change in liver PEPCK mRNA expression was observed in GW1929-treated rats until the 7 day point (Fig. 2Go). These data demonstrate that changes in FFA levels in serum, hFABP expression in WAT, and PDK4 expression in muscle are relatively early events after PPAR{gamma} activation and precede the decreases in serum triglyceride and glucose levels. However, the time lag between these early events and decreases in serum glucose levels suggests that other factors may be critical for the improvement in insulin sensitization. The time-course results raise the interesting possibility that the effects of GW1929 on PDK4 expression are due to direct activation of PPAR{gamma} in muscle rather than being a secondary effect of PPAR{gamma} activation in adipose tissue. However, as PDK4 is known to be regulated by fatty acids (38), we cannot rule out the possibility that regulation of its expression is secondary to effects on FFA levels. In this regard, the most dramatic regulation of PDK4, hFABP, and PEPCK was observed at the 7 day point (Fig. 2Go), indicating that at least some of the effect of GW1929 on their expression is likely to be indirect.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The therapeutic utility of PPAR{gamma} agonists in the treatment of insulin resistance and type 2 diabetes is now firmly established. However, the mechanism underlying the glucose- and lipid-lowering actions of PPAR{gamma} agonists has remained obscure. In this report we have used an unbiased and comprehensive mRNA profiling technique to systematically identify genes regulated by a potent PPAR{gamma} agonist in four insulin-responsive tissues. Most of the PPAR{gamma}-regulated genes that were identified in this study fall into key metabolic pathways involved in carbohydrate and/or lipid homeostasis. As might be expected based on its expression levels, we found that PPAR{gamma} regulates many more genes in adipose tissue than in either liver or muscle. Nevertheless, the gene expression data reveal that PPAR{gamma} activation has coordinate effects on fundamental metabolic pathways in each of these tissues, including glucose and fatty acid metabolism in skeletal muscle and gluconeogenesis in the liver (Fig. 3Go).


Figure 3
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3. Model for the physiological actions of PPAR{gamma}. PPAR{gamma} activation either stimulates (+) or represses (–) key metabolic pathways in adipose, muscle, and liver and promotes a flux of FFA from muscle and liver to adipose. The overall effect is to increase glucose utilization in muscle and to decrease glucose production in the liver. Key genes regulated by PPAR{gamma} are indicated. The effects of PPAR{gamma} activators are direct (solid arrow) on adipose and either direct or indirect (dashed arrows) on muscle and liver.

 
To date, no PPAR{gamma}-regulated genes have been identified in muscle that can readily account for the increase in glucose disposal effected by PPAR{gamma} ligands. In this report we show that GW1929 treatment results in a marked decrease in PDK4 expression in muscle. PDK4 phosphorylates and inactivates the PDH complex, which catalyzes the first irreversible step in oxidative glucose metabolism. Thus, decreases in PDK4 levels would be expected to result in increases in glucose oxidation. A recent study showed that PDH activity in soleus muscle was reduced in ZDF rats relative to that in their lean littermates and was restored to normal levels by troglitazone treatment (36). PDK activity is increased in response to fatty acids and has been proposed to play a primary role in the development of insulin resistance in obese individuals (41). Notably, PDK4 expression in skeletal muscle has been shown to positively correlate with plasma insulin concentrations and to negatively correlate with insulin-mediated glucose uptake in nondiabetic Pima Indians, a population with a high prevalence of type 2 diabetes associated with obesity (42). Thus, the inhibition of PDK4 expression may represent an important mechanism by which PPAR{gamma} agonists enhance glucose utilization in muscle.

In addition to its effects on PDK4 expression, GW1929 treatment resulted in a coordinate decrease in the expression of a number of genes involved in fatty acid transport and oxidation in muscle. These data are consistent with a decreased reliance on fatty acids and an increased reliance on glucose as an energy source in muscle. Strikingly, expression of these same genes was increased in adipose tissue in response to GW1929, suggesting that PPAR{gamma} activation promotes a flux of fatty acids into adipose tissue and away from muscle (Fig. 3Go). In this regard, two recent studies showed that glitazone treatment decreased triglyceride levels in the skeletal muscle of ZDF rats (36, 43). Repartitioning of fatty acids from muscle to adipose tissue might be expected to enhance insulin sensitivity based on the Randle cycle, in which fatty acids and glucose compete for use as energy substrate in muscle (41). FFAs are also known to stimulate glucose production in the liver (41, 44). Hence, a flux of fatty acids away from liver might also account for the decreases that we observed in the expression of PEPCK, pyruvate carboxylase, and glucose-6-phosphatase (Fig. 3Go).

Do PPAR{gamma} agonists regulate gene expression in muscle and liver by direct receptor activation or by more indirect means, such as altering metabolite levels? In time-course studies, we found that PPAR{gamma} agonist-induced decreases in FFA levels preceded drops in glucose and triglyceride levels (Table 3Go). These data suggest that decreases in FFA levels may be important for the insulin-sensitizing actions of PPAR{gamma} agonists. However, the time lag between the decreases in FFA and glucose levels suggests that other factors are likely to be important in insulin sensitization. Interestingly, the expression of PDK4, which we used as a marker of changes in gene expression in muscle, was decreased as early as 24 h posttreatment (Fig. 2Go). These changes preceded those in serum triglyceride and glucose levels but occurred at roughly the same time as the decreases in FFA levels. Thus, the effects of GW1929 on the expression of PDK4 and other genes in muscle may be secondary to changes in circulating FFA concentrations. It is important to note, however, that our studies do not rule out direct effects of PPAR{gamma} agonists on muscle. Several studies have shown that the PPAR{gamma} protein is present in human and rodent muscle (45, 46), and troglitazone has been reported to regulate gene expression and enhance glucose utilization in human muscle cultures (40, 47). Moreover, troglitazone was shown to improve insulin sensitivity in mice that had been engineered to lack adipose tissue (48), demonstrating that PPAR{gamma} agonists can affect metabolism in the absence or near absence of fat. Conclusive evidence that PPAR{gamma} agonists mediate effects directly on muscle is likely to require gene knockout animals in which the PPAR{gamma} gene has been disrupted in specific tissues. We note that in our time-course studies, PEPCK expression in liver was altered only at the 7 day point, suggesting that its regulation may be secondary to changes in FFAs or other metabolites.

In conclusion, we have demonstrated that PPAR{gamma} regulates genes involved in key metabolic pathways in adipose tissue, muscle, and liver. In muscle, PPAR{gamma} activation decreased the expression of PDK4 and a series of genes involved in fatty acid metabolism. These changes are likely to account in part for the enhancement of glucose utilization mediated by PPAR{gamma} agonists. In liver, PPAR{gamma} activation reduced the expression of three genes involved in gluconeogenesis, which is likely to account for the effects of PPAR{gamma} agonists on hepatic glucose production. Thus, the therapeutic actions of PPAR{gamma} agonists represent their coordinate effects in multiple, insulin-sensitive tissues.


    Acknowledgments
 
We thank Michelle Franklin and Juli Brown for their assistance with the RTQ-PCR methodology, Franklin P. Spriggs for sample analysis, and members of the CuraGen Genomics facility for their contributions. We thank Dr. Steven Jacobs for discussions throughout the course of this work and for critical reading of the manuscript, and Dr. Jeff Cobb for critical reading of the manuscript.

Received September 19, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Spiegelman BM 1998 PPAR-gamma: adipogenic regulator and thiazolidinedione receptor. Diabetes 47:507–514[Abstract]
  2. Willson TM, Brown PJ, Sternbach DD, Henke BR 2000 The PPARs: from orphan receptors to drug discovery. J Med Chem 43:527–550[CrossRef][Medline]
  3. Krentz AJ, Bailey CJ, Melander A 2000 Thiazolidinediones for type 2 diabetes. Br Med J 321:252–253[Free Full Text]
  4. Saltiel AR, Olefsky JM 1996 Thiazolidinediones in the treatment of insulin resistance and type II diabetes. Diabetes 45:1661–1669[Abstract]
  5. Kliewer SA, Lehmann JM, Willson TM 1999 Orphan nuclear receptors: shifting endocrinology into reverse. Science 284:757–760[Abstract/Free Full Text]
  6. Henke BR, Blanchard SG, Brackeen MF, Brown KK, Cobb JE, Collins JL, Harrington Jr WW, Hashim MA, Hull-Ryde EA, Kaldor I, Kliewer SA, Lake DH, Leesnitzer LM, Lehmann JM, Lenhard JM, Orband-Miller LA, Miller JF, Mook Jr RA, Noble SA, Oliver Jr W, Parks DJ, Plunket KD, Szewczyk JR, Willson TM 1998 N-(2-Benzoylphenyl)-L-tyrosine PPAR{gamma} agonists. I. Discovery of a novel series of potent antihyperglycemic and antihyperlipidemic agents. J Med Chem 41:5020–5036[CrossRef][Medline]
  7. Brown KK, Henke BR, Blanchard SG, Cobb JE, Mook R, Kaldor I, Kliewer SA, Lehmann JM, Lenhard JM, Harrington WW, Novak PJ, Faison W, Binz JG, Hashim MA, Oliver WO, Brown HR, Parks DJ, Plunket KD, Tong WQ, Menius JA, Adkison K, Noble SA, Willson TM 1999 A novel N-aryl tyrosine activator of peroxisome proliferator-activated receptor-{gamma} reverses the diabetic phenotype of the Zucker diabetic fatty rat. Diabetes 48:1415–1424[Abstract]
  8. Fiedorek FT, Wilson GG, Frith L, Patel J, Abou-Donia M 2000 Monotherapy with GI262570, a tyrosine-based non-thiazolidinedione PPAR{gamma} agonist, improves metabolic control in type 2 diabetes mellitus patients. Diabetes 49:157 (Abstract)[Abstract]
  9. Lowell BB 1999 PPAR{gamma}: an essential regulator of adipogenesis and modulator of fat cell function. Cell 99:239–242[CrossRef][Medline]
  10. Auwerx J 1999 PPAR{gamma}, the ultimate thrifty gene. Diabetologia 42:1033–1049[CrossRef][Medline]
  11. Shimkets RA, Lowe DG, Tai JT, Sehl P, Jin H, Yang R, Predki PF, Rothberg BE, Murtha MT, Roth ME, Shenoy SG, Windemuth A, Simpson JW, Simons JF, Daley MP, Gold SA, McKenna MP, Hillan K, Went GT, Rothberg JM 1999 Gene expression analysis by transcript profiling coupled to a gene database query. Nat Biotechnol 17:798–803[CrossRef][Medline]
  12. Heid CA, Stevens J, Livak KJ, Williams PM 1996 Real time quantitative PCR. Genome Res 6:986–994[Abstract/Free Full Text]
  13. Gibson UE, Heid CA, Williams PM 1996 A novel method for real time quantitative RT-PCR. Genome Res 6:995–1001[Abstract/Free Full Text]
  14. Tontonoz P, Hu E, Devine J, Beale EG, Spiegelman BM 1995 PPAR{gamma}2 regulates adipose expression of the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 15:351–357[Abstract]
  15. Martin G, Schoonjans K, Lefebvre AM, Staels B, Auwerx J 1997 Coordinate regulation of the expression of the fatty acid transport protein and acyl-CoA synthetase genes by PPAR{alpha} and PPAR{gamma} activators. J Biol Chem 272:28210–28217[Abstract/Free Full Text]
  16. Schoonjans K, Peinado-Onsurbe J, Lefebvre AM, Heyman RA, Briggs M, Deeb S, Staels B, Auwerx J 1996 PPAR{alpha} and PPAR{gamma} activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO J 15:5336–5348[Medline]
  17. Tontonoz P, Nagy L, Alvarez JG, Thomazy VA, Evans RM 1998 PPARgamma promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell 93:241–252[CrossRef][Medline]
  18. Matsuda J, Hosoda K, Itoh H, Son C, Doi K, Hanaoka I, Inoue G, Nishimura H, Yoshimasa Y, Yamori Y, Odaka H, Nakao K 1998 Increased adipose expression of the uncoupling protein-3 gene by thiazolidinediones in Wistar fatty rats and in cultured adipocytes. Diabetes 47:1809–1814[Abstract]
  19. Boss O, Hagen T, Lowell BB 2000 Uncoupling proteins 2 and 3: potential regulators of mitochondrial energy metabolism. Diabetes 49:143–156[Abstract]
  20. Clapham JC, Arch JRS, Chapman H, Haynes A, Lister C, Moore GBT, Piercy V, Carter SA, Lehner I, Smith SA, Beeley LJ, Godden RJ, Herrity N, Skehel M, Changani KK, Hockings PD, Reid DG, Squires SM, Hatcher J, Trail B, Latcham J, Rastan S, Harper AJ, Cadenas S, Buckingham JA, Brond MD, Abuin A 2000 Mice overexpressing human uncoupling protein-3 in skeletal muscle are hyperphagic and lean. Nature 406:415–418[CrossRef][Medline]
  21. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM 1994 mPPAR{gamma}2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8:1224–234[Abstract/Free Full Text]
  22. Tontonoz P, Hu E, Spiegelman BM 1994 Stimulation of adipogenesis in fibroblasts by PPAR{gamma}2, a lipid-activated transcription factor. Cell 79:1147–1156[CrossRef][Medline]
  23. Heuckeroth RO, Birkenmeier EH, Levin MS, Gordon JI 1987 Analysis of the tissue-specific expression, developmental regulation, and linkage relationships of a rodent gene encoding heart fatty acid binding protein. J Biol Chem 262:9709–9717[Abstract/Free Full Text]
  24. Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM 2000 Transcriptional regulation of adipogenesis. Genes Dev 14:1293–307[Free Full Text]
  25. Flier JS, Hollenberg AN 1999 ADD-1 provides major new insight into the mechanism of insulin action. Proc Natl Acad Sci USA 96:14191–14192[Free Full Text]
  26. Diamond RH, Du K, Lee VM, Mohn KL, Haber BA, Tewari DS, Taub R 1993 Novel delayed-early and highly insulin-induced growth response genes. Identification of HRS, a potential regulator of alternative pre-mRNA splicing. J Biol Chem 268:15185–15192[Abstract/Free Full Text]
  27. Haber B, Naji L, Cressman D, Taub R 1995 Coexpression of liver-specific and growth-induced genes in perinatal and regenerating liver: attainment and maintenance of the differentiated state during rapid proliferation. Hepatology 22:906–914[CrossRef][Medline]
  28. Kallen CB, Lazar MA 1996 Antidiabetic thiazolidinediones inhibit leptin (ob) gene expression in 3T3–L1 adipocytes. Proc Natl Acad Sci USA 93:5793–5796[Abstract/Free Full Text]
  29. De Vos P, Lefebvre AM, Miller SG, Guerre-Millo M, Wong K, Saladin R, Hamann LG, Staels B, Briggs MR, Auwerx J 1996 Thiazolidinediones repress ob gene expression in rodents via activation of peroxisome proliferator-activated receptor {gamma}. J Clin Invest 98:1004–1009[Medline]
  30. Hofmann C, Lorenz K, Braithwaite SS, Colca JR, Palazuk BJ, Hotamisligil GS, Spiegelman BM 1994 Altered gene expression for tumor necrosis factor-{alpha} and its receptors during drug and dietary modulation of insulin resistance. Endocrinology 134:264–270[Abstract/Free Full Text]
  31. Davies GF, Khandelwal RL, Roesler WJ 1999 Troglitazone inhibits expression of the phosphoenolpyruvate carboxykinase gene by an insulin-independent mechanism. Biochim Biophys Acta 1:122–131
  32. Hofmann C, Lorenz K, Williams D, Palazuk BJ, Colca JR 1995 Insulin sensitization in diabetic rat liver by an antihyperglycemic agent. Metab Clin Exp 44:384–389[Medline]
  33. Suter SL, Nolan JJ, Wallace P, Gumbiner B, Olefsky JM 1992 Metabolic effects of new oral hypoglycemic agent CS-045 in NIDDM subjects. Diabetes Care 15:193–203[Abstract]
  34. Fujiwara T, Okuno A, Yoshioka S, Horikoshi H 1995 Suppression of hepatic gluconeogenesis in long-term troglitazone treated diabetic KK and C57BL/KsJ-db/db mice. Metab Clin Exp 44:486–490[Medline]
  35. Fujiwara T, Yoshioka S, Yoshioka T, Ushiyama I, Horikoshi H 1988 Characterization of new oral antidiabetic agent CS-045. Studies in KK and ob/ob mice and Zucker fatty rats. Diabetes 37:1549–1558[Abstract]
  36. Sreenan S, Keck S, Fuller T, Cockburn B, Burant CF 1999 Effects of troglitazone on substrate storage and utilization in insulin-resistant rats. Am J Physiol 276:E1119—E1129
  37. Shimokawa T, Kato M, Watanabe Y, Hirayama R, Kurosaki E, Shikama H, Hashimoto S 1998 In vivo effects of pioglitazone on uncoupling protein-2 and -3 mRNA levels in skeletal muscle of hyperglycemic KK mice. Biochem Biophys Res Commun 251:374–378[CrossRef][Medline]
  38. Wu P, Inskeep K, Bowker-Kinley MM, Popov KM, Harris RA 1999 Mechanism responsible for inactivation of skeletal muscle pyruvate dehydrogenase complex in starvation and diabetes. Diabetes 48:1593–1599[Abstract]
  39. Hu E, Tontonoz P, Spiegelman BM 1995 Transdifferentiation of myoblasts by the adipogenic transcription factors PPAR{gamma} and C/EBP{alpha}. Proc Natl Acad Sci USA 92:9856–98560[Abstract/Free Full Text]
  40. Park KS, Ciaraldi TP, Lindgren K, Abrams-Carter L, Mudaliar S, Nikoulina SE, Tufari SR, Veerkamp JH, Vidal-Puig A, Henry RR 1998 Troglitazone effects on gene expression in human skeletal muscle of type II diabetes involve up-regulation of peroxisome proliferator-activated receptor-{gamma}. J Clin Endocrin Metab 83:2830–2835[Abstract/Free Full Text]
  41. Randle PJ 1998 Regulatory interactions between lipids and carbohydrates: the glucose fatty acid cycle after 35 years. Diabetes Metab Rev 14:263–283[CrossRef][Medline]
  42. Majer M, Popov KM, Harris RA, Bogardus C, Prochazka M 1998 Insulin downregulates pyruvate dehydrogenase kinase (PDK) mRNA: potential mechanism contributing to increased lipid oxidation in insulin-resistant subjects. Mol Genet Metab 65:181–186[CrossRef][Medline]
  43. Ide T, Nakazawa T, Mochizuki T, Murakami K 2000 Tissue-specific actions of antidiabetic thiazolidinediones on the reduced fatty acid oxidation in skeletal muscle and liver of Zucker diabetic fatty rats. Metab Clin Exp 49:521–525[Medline]
  44. Rebrin K, Steil GM, Getty L, Bergman RN 1995 Free fatty acid as a link in the regulation of hepatic glucose output by peripheral insulin. Diabetes 44:1038–1045[Abstract]
  45. Zierath JR, Ryder JW, Doebber T, Woods J, Wu M, Ventre J, Li Z, McCrary C, Berger J, Zhang B, Moller DE 1998 Role of skeletal muscle in thiazolidinedione insulin sensitizer (PPAR{gamma} agonist) action. Endocrinology 139:5034–5041[Abstract/Free Full Text]
  46. Loviscach M, Rehman N, Carter L, Mudaliar S, Mohadeen P, Ciaraldi TP, Veerkamp JH, Henry RR 2000 Distribution of peroxisome proliferator-activated receptors (PPARs) in human skeletal muscle and adipose tissue: relation to insulin action. Diabetologia 43:304–311[CrossRef][Medline]
  47. Park KS, Ciaraldi TP, Abrams-Carter L, Mudaliar S, Nikoulina SE, Henry RR 1998 Troglitazone regulation of glucose metabolism in human skeletal muscle cultures from obese type II diabetic subjects. J Clin Endocrinol Metab 83:1636–1643[Abstract/Free Full Text]
  48. Burant CF, Sreenan S, Hirano K, Tai TA, Lohmiller J, Lukens J, Davidson NO, Ross S, Graves RA 1997 Troglitazone action is independent of adipose tissue. J Clin Invest 100:2900–2908[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
T. Takazawa, T. Yamauchi, A. Tsuchida, M. Takata, Y. Hada, M. Iwabu, M. Okada-Iwabu, K. Ueki, and T. Kadowaki
Peroxisome Proliferator-activated Receptor {gamma} Agonist Rosiglitazone Increases Expression of Very Low Density Lipoprotein Receptor Gene in Adipocytes
J. Biol. Chem., October 30, 2009; 284(44): 30049 - 30057.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
A. K. G. Kadegowda, M. Bionaz, L. S. Piperova, R. A. Erdman, and J. J. Loor
Peroxisome proliferator-activated receptor-{gamma} activation and long-chain fatty acids alter lipogenic gene networks in bovine mammary epithelial cells to various extents
J Dairy Sci, September 1, 2009; 92(9): 4276 - 4289.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
N. Anderson and J. Borlak
Molecular Mechanisms and Therapeutic Targets in Steatosis and Steatohepatitis
Pharmacol. Rev., September 1, 2008; 60(3): 311 - 357.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. Cadoudal, E. Distel, S. Durant, F. Fouque, J.-M. Blouin, M. Collinet, S. Bortoli, C. Forest, and C. Benelli
Pyruvate Dehydrogenase Kinase 4: Regulation by Thiazolidinediones and Implication in Glyceroneogenesis in Adipose Tissue
Diabetes, September 1, 2008; 57(9): 2272 - 2279.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
B. Ravikumar, J. Gerrard, C. Dalla Man, M. J. Firbank, A. Lane, P. T. English, C. Cobelli, and R. Taylor
Pioglitazone Decreases Fasting and Postprandial Endogenous Glucose Production in Proportion to Decrease in Hepatic Triglyceride Content
Diabetes, September 1, 2008; 57(9): 2288 - 2295.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. Sevastianova, J. Sutinen, K. Kannisto, A. Hamsten, M. Ristola, and H. Yki-Jarvinen
Adipose tissue inflammation and liver fat in patients with highly active antiretroviral therapy-associated lipodystrophy
Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E85 - E91.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. E. Kershaw, M. Schupp, H.-P. Guan, N. P. Gardner, M. A. Lazar, and J. S. Flier
PPAR{gamma} regulates adipose triglyceride lipase in adipocytes in vitro and in vivo
Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1736 - E1745.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Ranalletta, X. Q. Du, Y. Seki, A. S. Glenn, M. Kruse, A. Fiallo, I. Estrada, T.-S. Tsao, A. E. Stenbit, E. B. Katz, et al.
Hepatic response to restoration of GLUT4 in skeletal muscle of GLUT4 null mice
Am J Physiol Endocrinol Metab, November 1, 2007; 293(5): E1178 - E1187.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. I. Anghel, E. Bedu, C. D. Vivier, P. Descombes, B. Desvergne, and W. Wahli
Adipose Tissue Integrity as a Prerequisite for Systemic Energy Balance: A CRITICAL ROLE FOR PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR {gamma}
J. Biol. Chem., October 12, 2007; 282(41): 29946 - 29957.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
W. Liao, M. T. A. Nguyen, T. Yoshizaki, S. Favelyukis, D. Patsouris, T. Imamura, I. M. Verma, and J. M. Olefsky
Suppression of PPAR-{gamma} attenuates insulin-stimulated glucose uptake by affecting both GLUT1 and GLUT4 in 3T3-L1 adipocytes
Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E219 - E227.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Pravenec and T. W. Kurtz
Molecular Genetics of Experimental Hypertension and the Metabolic Syndrome: From Gene Pathways to New Therapies
Hypertension, May 1, 2007; 49(5): 941 - 952.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
B. L. Wajchenberg
{beta}-Cell Failure in Diabetes and Preservation by Clinical Treatment
Endocr. Rev., April 1, 2007; 28(2): 187 - 218.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. O. Li, D. G. Mashek, J. An, S. D. Doughman, C. B. Newgard, and R. A. Coleman
Overexpression of Rat Long Chain Acyl-CoA Synthetase 1 Alters Fatty Acid Metabolism in Rat Primary Hepatocytes
J. Biol. Chem., December 1, 2006; 281(48): 37246 - 37255.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
L. Yang, C.-C. Chan, O.-S. Kwon, S. Liu, J. McGhee, S. A. Stimpson, L. Z. Chen, W. W. Harrington, W. T. Symonds, and D. C. Rockey
Regulation of peroxisome proliferator-activated receptor-{gamma} in liver fibrosis
Am J Physiol Gastrointest Liver Physiol, November 1, 2006; 291(5): G902 - G911.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
B. Lu, A. H. Moser, J. K. Shigenaga, K. R. Feingold, and C. Grunfeld
Type II nuclear hormone receptors, coactivator, and target gene repression in adipose tissue in the acute-phase response
J. Lipid Res., October 1, 2006; 47(10): 2179 - 2190.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
A. Gastaldelli, Y. Miyazaki, A. Mahankali, R. Berria, M. Pettiti, E. Buzzigoli, E. Ferrannini, and R. A. DeFronzo
The Effect of Pioglitazone on the Liver: Role of adiponectin
Diabetes Care, October 1, 2006; 29(10): 2275 - 2281.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Laplante, W. T. Festuccia, G. Soucy, Y. Gelinas, J. Lalonde, J. P. Berger, and Y. Deshaies
Mechanisms of the Depot Specificity of Peroxisome Proliferator-Activated Receptor {gamma} Action on Adipose Tissue Metabolism.
Diabetes, October 1, 2006; 55(10): 2771 - 2778.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. Allen, F. Zhang, S. A. Moodie, L. E. Clemens, A. Smith, F. Gregoire, A. Bell, G. E.O. Muscat, and T. A. Gustafson
Halofenate Is a Selective Peroxisome Proliferator-Activated Receptor {gamma} Modulator With Antidiabetic Activity
Diabetes, September 1, 2006; 55(9): 2523 - 2533.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
Y. I. Kim, F. N. Lee, W. S. Choi, S. Lee, and J. H. Youn
Insulin Regulation of Skeletal Muscle PDK4 mRNA Expression Is Impaired in Acute Insulin-Resistant States.
Diabetes, August 1, 2006; 55(8): 2311 - 2317.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. H. Pietilainen, K. Kannisto, E. Korsheninnikova, A. Rissanen, J. Kaprio, E. Ehrenborg, A. Hamsten, and H. Yki-Jarvinen
Acquired Obesity Increases CD68 and Tumor Necrosis Factor-{alpha} and Decreases Adiponectin Gene Expression in Adipose Tissue: A Study in Monozygotic Twins
J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2776 - 2781.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Hummasti and P. Tontonoz
The Peroxisome Proliferator-Activated Receptor N-Terminal Domain Controls Isotype-Selective Gene Expression and Adipogenesis
Mol. Endocrinol., June 1, 2006; 20(6): 1261 - 1275.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
K. B. Sotiropoulos, A. Clermont, Y. Yasuda, C. Rask-Madsen, M. Mastumoto, J. Takahashi, K. Della Vecchia, T. Kondo, L. P. Aiello, and G. L. King
Adipose-specific effect of rosiglitazone on vascular permeability and protein kinase C activation: novel mechanism for PPAR{gamma} agonist's effects on edema and weight gain
FASEB J, June 1, 2006; 20(8): 1203 - 1205.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Gastaldelli, Y. Miyazaki, M. Pettiti, E. Santini, D. Ciociaro, R. A. DeFronzo, and E. Ferrannini
The Effect of Rosiglitazone on the Liver: Decreased Gluconeogenesis in Patients with Type 2 Diabetes
J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 806 - 812.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
A. B. Goldfine, S. Crunkhorn, M. Costello, H. Gami, E. J. Landaker, M. Niinobe, K. Yoshikawa, D. Lo, A. Warren, J. Jimenez-Chillaron, et al.
Necdin and E2F4 Are Modulated by Rosiglitazone Therapy in Diabetic Human Adipose and Muscle Tissue
Diabetes, March 1, 2006; 55(3): 640 - 650.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Tsukahara, R. Tsukahara, S. Yasuda, N. Makarova, W. J. Valentine, P. Allison, H. Yuan, D. L. Baker, Z. Li, R. Bittman, et al.
Different Residues Mediate Recognition of 1-O-Oleyllysophosphatidic Acid and Rosiglitazone in the Ligand Binding Domain of Peroxisome Proliferator-activated Receptor {gamma}
J. Biol. Chem., February 10, 2006; 281(6): 3398 - 3407.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M. Loffler, M. Bilban, M. Reimers, W. Waldhausl, and T. M. Stulnig
Blood Glucose-Lowering Nuclear Receptor Agonists Only Partially Normalize Hepatic Gene Expression in db/db Mice
J. Pharmacol. Exp. Ther., February 1, 2006; 316(2): 797 - 804.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Claret, H. Corominola, I. Canals, J. Saura, S. Barcelo-Batllori, J. J. Guinovart, and R. Gomis
Tungstate Decreases Weight Gain and Adiposity in Obese Rats through Increased Thermogenesis and Lipid Oxidation
Endocrinology, October 1, 2005; 146(10): 4362 - 4369.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
A. I. Shulman and D. J. Mangelsdorf
Retinoid X Receptor Heterodimers in the Metabolic Syndrome
N. Engl. J. Med., August 11, 2005; 353(6): 604 - 615.
[Full Text] [PDF]


Home page
DiabetesHome page
B. Staels and J.-C. Fruchart
Therapeutic Roles of Peroxisome Proliferator-Activated Receptor Agonists
Diabetes, August 1, 2005; 54(8): 2460 - 2470.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. S. Golfman, C. R. Wilson, S. Sharma, M. Burgmaier, M. E. Young, P. H. Guthrie, M. Van Arsdall, J. V. Adrogue, K. K. Brown, and H. Taegtmeyer
Activation of PPAR{gamma} enhances myocardial glucose oxidation and improves contractile function in isolated working hearts of ZDF rats
Am J Physiol Endocrinol Metab, August 1, 2005; 289(2): E328 - E336.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Reifel-Miller, K. Otto, E. Hawkins, R. Barr, W. R. Bensch, C. Bull, S. Dana, K. Klausing, J.-A. Martin, R. Rafaeloff-Phail, et al.
A Peroxisome Proliferator-Activated Receptor {alpha}/{gamma} Dual Agonist with a Unique in Vitro Profile and Potent Glucose and Lipid Effects in Rodent Models of Type 2 Diabetes and Dyslipidemia
Mol. Endocrinol., June 1, 2005; 19(6): 1593 - 1605.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
K M Eny, A El-Sohemy, M C Cornelis, Y-K Sung, and S-C Bae
Catalase and PPARg2 genotype and risk of systemic lupus erythematosus in Koreans
Lupus, May 1, 2005; 14(5): 351 - 355.
[Abstract] [PDF]


Home page
DiabetesHome page
I. Bogacka, H. Xie, G. A. Bray, and S. R. Smith
Pioglitazone Induces Mitochondrial Biogenesis in Human Subcutaneous Adipose Tissue In Vivo
Diabetes, May 1, 2005; 54(5): 1392 - 1399.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
H. K.R. Karlsson, K. Hallsten, M. Bjornholm, H. Tsuchida, A. V. Chibalin, K. A. Virtanen, O. J. Heinonen, F. Lonnqvist, P. Nuutila, and J. R. Zierath
Effects of Metformin and Rosiglitazone Treatment on Insulin Signaling and Glucose Uptake in Patients With Newly Diagnosed Type 2 Diabetes: A Randomized Controlled Study
Diabetes, May 1, 2005; 54(5): 1459 - 1467.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
D. K. Kramer, L. Al-Khalili, S. Perrini, J. Skogsberg, P. Wretenberg, K. Kannisto, H. Wallberg-Henriksson, E. Ehrenborg, J. R. Zierath, and A. Krook
Direct Activation of Glucose Transport in Primary Human Myotubes After Activation of Peroxisome Proliferator-Activated Receptor {delta}
Diabetes, April 1, 2005; 54(4): 1157 - 1163.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
G. Boden, C. Homko, M. Mozzoli, L. C. Showe, C. Nichols, and P. Cheung
Thiazolidinediones Upregulate Fatty Acid Uptake and Oxidation in Adipose Tissue of Diabetic Patients
Diabetes, March 1, 2005; 54(3): 880 - 885.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
Z. T. Bloomgarden
Thiazolidinediones
Diabetes Care, February 1, 2005; 28(2): 488 - 493.
[Full Text] [PDF]


Home page
DiabetesHome page
H. Noushmehr, E. D'Amico, L. Farilla, H. Hui, K. A. Wawrowsky, W. Mlynarski, A. Doria, N. A. Abumrad, and R. Perfetti
Fatty Acid Translocase (FAT/CD36) Is Localized on Insulin-Containing Granules in Human Pancreatic {beta}-Cells and Mediates Fatty Acid Effects on Insulin Secretion
Diabetes, February 1, 2005; 54(2): 472 - 481.
[Abstract] [Full Text] [PDF]


Home page
British Journal of Diabetes & Vascular DiseaseHome page
Y. Miyazaki, E. De Filippis, M. Bajaj, E. Wajcberg, L. Glass, C. Triplitt, E. Cersosimo, L. J Mandarino, and R. A Defronzo
Predictors of improved glycaemic control with rosiglitazone therapy in type 2 diabetic patients: a practical approach for the primary care physician
The British Journal of Diabetes & Vascular Disease, January 1, 2005; 5(1): 28 - 35.
[Abstract] [PDF]


Home page
Mol. Pharmacol.Home page
D. V. Erbe, S. Wang, Y.-L. Zhang, K. Harding, L. Kung, M. Tam, L. Stolz, Y. Xing, S. Furey, A. Qadri, et al.
Ertiprotafib Improves Glycemic Control and Lowers Lipids via Multiple Mechanisms
Mol. Pharmacol., January 1, 2005; 67(1): 69 - 77.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. Knouff and J. Auwerx
Peroxisome Proliferator-Activated Receptor-{gamma} Calls for Activation in Moderation: Lessons from Genetics and Pharmacology
Endocr. Rev., December 1, 2004; 25(6): 899 - 918.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Berthiaume, H. Sell, J. Lalonde, Y. Gelinas, A. Tchernof, D. Richard, and Y. Deshaies
Actions of PPAR{gamma} agonism on adipose tissue remodeling, insulin sensitivity, and lipemia in absence of glucocorticoids
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2004; 287(5): R1116 - R1123.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. Miyazaki, A. Mahankali, E. Wajcberg, M. Bajaj, L. J. Mandarino, and R. A. DeFronzo
Effect of Pioglitazone on Circulating Adipocytokine Levels and Insulin Sensitivity in Type 2 Diabetic Patients
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4312 - 4319.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
I. Bogacka, H. Xie, G. A. Bray, and S. R. Smith
The Effect of Pioglitazone on Peroxisome Proliferator-Activated Receptor-{gamma} Target Genes Related to Lipid Storage In Vivo
Diabetes Care, July 1, 2004; 27(7): 1660 - 1667.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. R. Kast-Woelbern, S. L. Dana, R. M. Cesario, L. Sun, L. Y. de Grandpre, M. E. Brooks, D. L. Osburn, A. Reifel-Miller, K. Klausing, and M. D. Leibowitz
Rosiglitazone Induction of Insig-1 in White Adipose Tissue Reveals a Novel Interplay of Peroxisome Proliferator-activated Receptor {gamma} and Sterol Regulatory Element-binding Protein in the Regulation of Adipogenesis
J. Biol. Chem., June 4, 2004; 279(23): 23908 - 23915.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. Tonelli, W. Li, P. Kishore, U. B. Pajvani, E. Kwon, C. Weaver, P. E. Scherer, and M. Hawkins
Mechanisms of Early Insulin-Sensitizing Effects of Thiazolidinediones in Type 2 Diabetes
Diabetes, June 1, 2004; 53(6): 1621 - 1629.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. Savolainen, T. J. Kotti, W. Schmitz, T. I. Savolainen, R. T. Sormunen, M. Ilves, S. J. Vainio, E. Conzelmann, and J. K. Hiltunen
A mouse model for {alpha}-methylacyl-CoA racemase deficiency: adjustment of bile acid synthesis and intolerance to dietary methyl-branched lipids
Hum. Mol. Genet., May 1, 2004; 13(9): 955 - 965.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
H.-i. Kim and Y.-h. Ahn
Role of Peroxisome Proliferator-Activated Receptor-{gamma} in the Glucose-Sensing Apparatus of Liver and {beta}-Cells
Diabetes, February 1, 2004; 53(90001): S60 - 65.
[Abstract] [Full Text]


Home page
DiabetesHome page
S.-y. Kim, H.-i. Kim, S.-K. Park, S.-S. Im, T. Li, H. G. Cheon, and Y.-h. Ahn
Liver Glucokinase Can Be Activated by Peroxisome Proliferator-Activated Receptor-{gamma}
Diabetes, February 1, 2004; 53(90001): S66 - 70.
[Abstract] [Full Text]


Home page
HypertensionHome page
W. A. Hsueh and D. Bruemmer
Peroxisome Proliferator-Activated Receptor {gamma}: Implications for Cardiovascular Disease
Hypertension, February 1, 2004; 43(2): 297 - 305.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
K. Levin, O. Hother-Nielsen, J. E. Henriksen, and H. Beck-Nielsen
Effects of Troglitazone in Young First-Degree Relatives of Patients With Type 2 Diabetes
Diabetes Care, January 1, 2004; 27(1): 148 - 154.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. CANNON and J. NEDERGAARD
Brown Adipose Tissue: Function and Physiological Significance
Physiol Rev, January 1, 2004; 84(1): 277 - 359.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Jia, C. Qi, Z. Zhang, T. Hashimoto, M. S. Rao, S. Huyghe, Y. Suzuki, P. P. Van Veldhoven, M. Baes, and J. K. Reddy
Overexpression of Peroxisome Proliferator-activated Receptor-{alpha} (PPAR{alpha})-regulated Genes in Liver in the Absence of Peroxisome Proliferation in Mice Deficient in both L- and D-Forms of Enoyl-CoA Hydratase/Dehydrogenase Enzymes of Peroxisomal {beta}-Oxidation System
J. Biol. Chem., November 21, 2003; 278(47): 47232 - 47239.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Gavrilova, M. Haluzik, K. Matsusue, J. J. Cutson, L. Johnson, K. R. Dietz, C. J. Nicol, C. Vinson, F. J. Gonzalez, and M. L. Reitman
Liver Peroxisome Proliferator-activated Receptor {gamma} Contributes to Hepatic Steatosis, Triglyceride Clearance, and Regulation of Body Fat Mass
J. Biol. Chem., September 5, 2003; 278(36): 34268 - 34276.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. A. Holt, T. G. Consler, S. P. Williams, A. H. Ayscue, L. M. Leesnitzer, G. B. Wisely, and A. N. Billin
Helix 1/8 Interactions Influence the Activity of Nuclear Receptor Ligand-Binding Domains
Mol. Endocrinol., September 1, 2003; 17(9): 1704 - 1714.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
Y. Miyazaki, H. He, L. J. Mandarino, and R. A. DeFronzo
Rosiglitazone Improves Downstream Insulin Receptor Signaling in Type 2 Diabetic Patients
Diabetes, August 1, 2003; 52(8): 1943 - 1950.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C.-H. Lee, P. Olson, and R. M. Evans
Minireview: Lipid Metabolism, Metabolic Diseases, and Peroxisome Proliferator-Activated Receptors
Endocrinology, June 1, 2003; 144(6): 2201 - 2207.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Tordjman, G. Chauvet, J. Quette, E. G. Beale, C. Forest, and B. Antoine
Thiazolidinediones Block Fatty Acid Release by Inducing Glyceroneogenesis in Fat Cells
J. Biol. Chem., May 23, 2003; 278(21): 18785 - 18790.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. C. Sugden and M. J. Holness
Recent advances in mechanisms regulating glucose oxidation at the level of the pyruvate dehydrogenase complex by PDKs
Am J Physiol Endocrinol Metab, May 1, 2003; 284(5): E855 - E862.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. E. Cleasby, P. A. T. Kelly, B. R. Walker, and J. R. Seckl
Programming of Rat Muscle and Fat Metabolism by in Utero Overexposure to Glucocorticoids
Endocrinology, March 1, 2003; 144(3): 999 - 1007.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
H. Lan, M. E. Rabaglia, J. P. Stoehr, S. T. Nadler, K. L. Schueler, F. Zou, B. S. Yandell, and A. D. Attie
Gene Expression Profiles of Nondiabetic and Diabetic Obese Mice Suggest a Role of Hepatic Lipogenic Capacity in Diabetes Susceptibility
Diabetes, March 1, 2003; 52(3): 688 - 700.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J.-M. Ye, M. A. Iglesias, D. G. Watson, B. Ellis, L. Wood, P. B. Jensen, R. V. Sorensen, P. J. Larsen, G. J. Cooney, K. Wassermann, et al.
PPARalpha /gamma ragaglitazar eliminates fatty liver and enhances insulin action in fat-fed rats in the absence of hepatomegaly
Am J Physiol Endocrinol Metab, March 1, 2003; 284(3): E531 - E540.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
D. Cameron-Smith, L. M Burke, D. J Angus, R. J Tunstall, G. R Cox, A. Bonen, J. A Hawley, and M. Hargreaves
A short-term, high-fat diet up-regulates lipid metabolism and gene expression in human skeletal muscle
Am. J. Clinical Nutrition, February 1, 2003; 77(2): 313 - 318.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Laplante, H. Sell, K. L. MacNaul, D. Richard, J. P. Berger, and Y. Deshaies
PPAR-{gamma} Activation Mediates Adipose Depot-Specific Effects on Gene Expression and Lipoprotein Lipase Activity: Mechanisms for Modulation of Postprandial Lipemia and Differential Adipose Accretion
Diabetes, February 1, 2003; 52(2): 291 - 299.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Qi, L. Kazdova, V. Zidek, V. Landa, V. Kren, H. A. Pershadsingh, E. St. Lezin, N. A. Abumrad, M. Pravenec, and T. W. Kurtz
Pharmacogenetic Evidence That Cd36 Is a Key Determinant of the Metabolic Effects of Pioglitazone
J. Biol. Chem., December 6, 2002; 277(50): 48501 - 48507.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J.-M. Ye, G. Frangioudakis, M. A. Iglesias, S. M. Furler, B. Ellis, N. Dzamko, G. J. Cooney, and E. W. Kraegen
Prior Thiazolidinedione Treatment Preserves Insulin Sensitivity in Normal Rats during Acute Fatty Acid Elevation: Role of the Liver
Endocrinology, December 1, 2002; 143(12): 4527 - 4535.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. D. Girnun, F. E. Domann, S. A. Moore, and M. E. C. Robbins
Identification of a Functional Peroxisome Proliferator-Activated Receptor Response Element in the Rat Catalase Promoter
Mol. Endocrinol., December 1, 2002; 16(12): 2793 - 2801.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
S. H. Lee and K. L. Hossner
Coordinate regulation of ovine adipose tissue gene expression by propionate
J Anim Sci, November 1, 2002; 80(11): 2840 - 2849.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. E. Ross, R. L. Erickson, I. Gerin, P. M. DeRose, L. Bajnok, K. A. Longo, D. E. Misek, R. Kuick, S. M. Hanash, K. B. Atkins, et al.
Microarray Analyses during Adipogenesis: Understanding the Effects of Wnt Signaling on Adipogenesis and the Roles of Liver X Receptor {alpha} in Adipocyte Metabolism
Mol. Cell. Biol., August 15, 2002; 22(16): 5989 - 5999.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. M. Rondinone, J. M. Trevillyan, J. Clampit, R. J. Gum, C. Berg, P. Kroeger, L. Frost, B. A. Zinker, R. Reilly, R. Ulrich, et al.
Protein Tyrosine Phosphatase 1B Reduction Regulates Adiposity and Expression of Genes Involved in Lipogenesis
Diabetes, August 1, 2002; 51(8): 2405 - 2411.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. M. Stulnig, U. Oppermann, K. R. Steffensen, G. U. Schuster, and J.-A. Gustafsson
Liver X Receptors Downregulate 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Expression and Activity
Diabetes, August 1, 2002; 51(8): 2426 - 2433.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
R. A. Coleman, T. M. Lewin, C. G. Van Horn, and M. R. Gonzalez-Baro
Do Long-Chain Acyl-CoA Synthetases Regulate Fatty Acid Entry into Synthetic Versus Degradative Pathways?
J. Nutr., August 1, 2002; 132(8): 2123 - 2126.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. M. Muoio, P. S. MacLean, D. B. Lang, S. Li, J. A. Houmard, J. M. Way, D. A. Winegar, J. C. Corton, G. L. Dohm, and W. E. Kraus
Fatty Acid Homeostasis and Induction of Lipid Regulatory Genes in Skeletal Muscles of Peroxisome Proliferator-activated Receptor (PPAR) alpha Knock-out Mice. EVIDENCE FOR COMPENSATORY REGULATION BY PPARdelta
J. Biol. Chem., July 12, 2002; 277(29): 26089 - 26097.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
Y. Tamori, J. Masugi, N. Nishino, and M. Kasuga
Role of Peroxisome Proliferator-Activated Receptor-{gamma} in Maintenance of the Characteristics of Mature 3T3-L1 Adipocytes
Diabetes, July 1, 2002; 51(7): 2045 - 2055.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. M. Willson and J. T. Moore
Minireview: Genomics Versus Orphan Nuclear Receptors--A Half-Time Report
Mol. Endocrinol., June 1, 2002; 16(6): 1135 - 1144.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. L. Gerhold, F. Liu, G. Jiang, Z. Li, J. Xu, M. Lu, J. R. Sachs, A. Bagchi, A. Fridman, D. J. Holder, et al.
Gene Expression Profile of Adipocyte Differentiation and Its Regulation by Peroxisome Proliferator-Activated Receptor-{gamma} Agonists
Endocrinology, June 1, 2002; 143(6): 2106 - 2118.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
O. Barbier, I. P. Torra, Y. Duguay, C. Blanquart, J.-C. Fruchart, C. Glineur, and B. Staels
Pleiotropic Actions of Peroxisome Proliferator-Activated Receptors in Lipid Metabolism and Atherosclerosis
Arterioscler Thromb Vasc Biol, May 1, 2002; 22(5): 717 - 726.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
D. M. Muoio, J. M. Way, C. J. Tanner, D. A. Winegar, S. A. Kliewer, J. A. Houmard, W. E. Kraus, and G. L. Dohm
Peroxisome Proliferator-Activated Receptor-{alpha} Regulates Fatty Acid Utilization in Primary Human Skeletal Muscle Cells
Diabetes, April 1, 2002; 51(4): 901 - 909.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. Albrektsen, K. S. Frederiksen, W. E. Holmes, E. Boel, K. Taylor, and J. Fleckner
Novel Genes Regulated by the Insulin Sensitizer Rosiglitazone During Adipocyte Differentiation
Diabetes, April 1, 2002; 51(4): 1042 - 1051.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
R. Walczak and P. Tontonoz
PPARadigms and PPARadoxes: expanding roles for PPAR{gamma} in the control of lipid metabolism
J. Lipid Res., February 1, 2002; 43(2): 177 - 186.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Yu, W.-Q. Cao, P. Kashireddy, K. Meyer, Y. Jia, D. E. Hughes, Y. Tan, J. Feng, A. V. Yeldandi, M. S. Rao, et al.
Human Peroxisome Proliferator-activated Receptor alpha (PPARalpha ) Supports the Induction of Peroxisome Proliferation in PPARalpha -deficient Mouse Liver
J. Biol. Chem., November 2, 2001; 276(45): 42485 - 42491.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Way, C. Z. Gorgun, Q. Tong, K. T. Uysal, K. K. Brown, W. W. Harrington, W. R. Oliver Jr., T. M. Willson, S. A. Kliewer, and G. S. Hotamisligil
Adipose Tissue Resistin Expression Is Severely Suppressed in Obesity and Stimulated by Peroxisome Proliferator-activated Receptor gamma Agonists
J. Biol. Chem., July 6, 2001; 276(28): 25651 - 25653.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. D. Rosen and B. M. Spiegelman
PPARgamma : a Nuclear Regulator of Metabolism, Differentiation, and Cell Growth
J. Biol. Chem., October 5, 2001; 276(41): 37731 - 37734.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Way, J. M.
Right arrow Articles by Kliewer, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Way, J. M.
Right arrow Articles by Kliewer, S. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals