help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elmlinger, M. W.
Right arrow Articles by Ranke, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elmlinger, M. W.
Right arrow Articles by Ranke, M. B.
Endocrinology Vol. 142, No. 4 1652-1658
Copyright © 2001 by The Endocrine Society


ARTICLES

In Vivo Expression of Insulin-Like Growth Factor-Binding Protein-2 in Human Gliomas Increases with the Tumor Grade1

Martin W. Elmlinger, Martin H. Deininger, Burkhardt S. Schuett, Richard Meyermann, Frank Duffner, Ernst H. Grote and Michael B. Ranke

Pediatric Endocrinology, Children’s Hospital (M.W.E., M.B.R., B.S.S.), Institute of Brain Research (M.H.D., R.M.), and Department of Neurosurgery (F.D., E.H.G.), University of Tuebingen, D-72076 Tuebingen, Germany

Address all correspondence and requests for reprints to: Dr. Martin W. Elmlinger, Section of Pediatric Endocrinology, Children’s Hospital, University of Tuebingen, Hoppe-Seyler Strasse 1, D-72076 Tuebingen, Germany. E-mail: martin.elmlinger{at}med.uni-tuebingen.de


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human central nervous system tumors and glioma cell lines highly express the insulin-like growth factor-binding protein (IGFBP)-2. As IGFBP-2 can affect tumor growth, we studied the relationship between IGFBP-2 expression and the malignancy of brain tumors in vivo. To do so, we investigated by immunohistochemistry the accumulation of IGFBP-1, -2, and -3 in 50 human gliomas classified by the WHO Malignancy Scale. Double labeling using anti-CD68 (monocytes/macrophages), antiglial fibrillary acidic protein, and anti-CD3 (T cells) antibodies was performed to further characterize the IGFBP-1, -2, and -3+ cells. The expression of IGFBP messenger RNAs (mRNAs) was tested by RT-PCR in tumor samples from nine gliomas of different grades and in eight cell lines representing the cellular composition of human glioma. As controls, the accumulation of IGFBP-2 was investigated in normal brain and in the rat C6 glioblastoma model. IGFBP-1 and -3 accumulated in endothelial and macrophage/microglial cells. IGFBP-2+ macrophage/microglial and glioma cells clustered in the immediate vicinity of focal necrosis of the human gliomas as well as of the rat C6 glioblastoma. The labeling score of IGFBP-1 accumulation in endothelial cells correlated negatively (P = 0.0229), and that of IGFBP-2 accumulation in glioma cells correlated positively (P < 0.0006) with the tumor grade of the gliomas. In addition, RT-PCR analysis confirmed mRNA expression of IGFBP-1, -2, and -3 by the gliomas and glial cells. Small amounts of IGFBP-1 and -3 mRNA, but high amounts of IGFBP-2 mRNA, were detectable in macrophage-like and glioma cell lines.

The results suggest cell type-specific accumulation of IGFBP-1, -2, and -3 in human glial tumors of the brain. The increase in IGFBP-2 expression with this malignancy suggests a role of IGFBP-2 in the biology of human gliomas.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RECENTLY, IT HAS become apparent that the insulin-like growth factor (IGF) system plays an important role in the mechanism of cellular transformation and tumorigenesis in cancers, including brain tumors (1). Human gliomas often secrete elevated levels of IGFs and express increased numbers of IGF receptors compared with normal brain tissue (2). Antisense-mediated down-regulation of the IGF-I receptor resulted in massive apoptosis of tumor cells in vivo, leading to abrogation of tumorigenesis. In addition to the apoptotic effect, antitumor responses are elicited in syngeneic immunocompetent animals, protecting them from subsequent tumor challenge and causing regression of established tumors with no further recurrence (3, 4, 5). Accordingly, antisense blockade of IGF-I expression may reverse a phenotype that allows C6 glioma cells to evade the immune system (6).

In addition, alterations in the expression of IGF-binding proteins (IGFBPs), which modulate the biological actions of the IGFs (7), were found in brain tumors. Elevated concentrations of IGFBP-2 are detected frequently in the cerebrospinal fluid of patients with brain tumors. The most elevated levels of IGFBP-2 were measured in cerebrospinal fluid of highly malignant tumors (8). Furthermore, high levels of IGFBP-1, -2, and -3 were detected in the cyst fluid of a patient with a hypothalamic astrocytoma (9) and in a diverse range of gliomas (10). In vitro experiments revealed that the overexpression of IGFBP-2 in C6 glioma cells resulted in reduced growth potential of these cells (11). Taken together, these data emphasize an important role of IGFBP-2 in the biology of brain tumors.

Therefore, we studied the relationship between clinical features, i.e. malignancy, and the expression of IGFBP-2 in a wide range of human astrocytomas and in the rat C6 glioblastoma model (12). In particular, we investigated the accumulation of IGFBP-1, -2, and -3 in 22 human glioblastoma multiforme, 9 anaplastic astrocytomas, 1 gemistocytic astrocytoma, 5 protoplasmic astrocytomas, and 13 fibrillary astrocytomas by immunohistochemistry. In advance, all tumors were classified histopathologically according to the WHO Malignancy Scale (13). Double labeling experiments with antibodies directed against CD68 (monocytes/macrophages), glial fibrillary acidic protein (GFAP), CD31 (endothelial cells), CD3 (T cells), and human leukocyte antigen (HLA)-DR, -DP, and -DQ (major histocompatibility complex class II) were performed to characterize the cell type of IGFBP+ cells and to study the cell specificity of IGFBP expression. As controls, the accumulation of IGFBP-2 was investigated in normal brain and rat C6 glioblastoma model. To determine the expression of IGFBP-1, -2, and -3 messenger RNA (mRNA) in the gliomas, semiquantitative RT-PCR analysis was performed from total RNA of 9 gliomas of different grades and in 8 cell lines representing the cellular composition of human glioma. The accumulation of IGFBP-1, IGFBP-2, and IGFBP-3 was evaluated quantitatively by determination of labeling scores, which were compared with the grade of malignancy of each tumor.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human brain tumor specimens
Fifty brain tumor specimens were analyzed (Table 1Go): 22 glioblastoma multiforme, 9 anaplastic astrocytomas, 5 protoplasmic astrocytomas, 1 gemistocytic astrocytoma, and 13 fibrillary astrocytomas. All tumors were resected at the Department of Neurosurgery (Tuebingen, Germany) or at the Department of Neurosurgery of the Schildautalklinik (Seesen, Germany) and characterized with respect to their clinical features as previously described (14). Frontal cortex specimens of six neuropathologically unaltered control brains were obtained from autopsies at the Department of Pathology in Tuebingen (Table 2Go) and have been described previously (14).


View this table:
[in this window]
[in a new window]
 
Table 1. Endothelial IGFBP-1, -3, and -3 immunolabeling

 

View this table:
[in this window]
[in a new window]
 
Table 2. Control patients and immunohistochemical labeling scores of IGFBP-1, -2, and -3

 
Preparation of tissue sections and histology
Briefly, samples were fixed in 4% buffered formaldehyde (pH 7.4), dehydrated in an ascending alcohol sequence, and finally embedded in paraffin. Sections of 5-µm thickness were mounted on sialinized slides, deparaffinized in a descending alcohol sequence, transferred to distilled water, and stained by routine methods. Histological grading of the human tumor specimens was performed according to the WHO histopathological classification system (WHO Malignancy Scale) (14).

Immunohistochemistry
Before immunohistochemistry, the slices were irradiated in a microwave oven five times for 5 min each time in citrate buffer (2.1 g sodium citrate/liter, pH 6.0) and incubated in nonspecific porcine serum 1:10 in 90% Tris-balanced salt solution containing 0.025 M Tris and 0.15 M NaCl, pH 7.5 (TBS), for 15 min. The primary polyclonal rabbit antihuman IGFBP antibodies were all applied at a dilution of 1:2000 in TBS-BSA (10% BSA in TBS) to the sections overnight at 4 C. Antibody binding was detected by incubating the slices with a biotinylated swine antirabbit IgG F(ab)2 antibody (DAKO Corp., Hamburg, Germany) and consecutively with an AB complex (DAKO Corp.), both at a dilution of 1:400 in TBS for 30 min. The reaction was visualized with diaminobenzidine (Fluka, Buchs, Switzerland) as a substrate, and slices were consecutively counterstained with hematoxylin.

Double labeling experiments
In double labeling experiments, we first labeled the characterizing antigen. Briefly, slices were deparaffinized, irradiated in a microwave oven for antigenic retrieval, and incubated with nonspecific porcine serum as described above. Then the differentiating monoclonal mouse antibodies directed against human GFAP (Roche, Mannheim, Germany), CD68 (DAKO Corp.), CD3 (DAKO Corp.), and CD31 (DAKO Corp.) were added to the slices all at a dilution of 1:100 in TBS-BSA. The functional status of the cells was analyzed by using anti-HLA-DR, -DP, -DQ, -DR, -DP, and -DQ (DAKO Corp.; major histocompatibility class II). Visualization was achieved by adding rabbit antimouse IgG (DAKO Corp.) diluted at 1:20 in TBS for 30 min and APAAP complex (DAKO Corp.) diluted 1:80 in TBS for 30 min. Consecutively, we developed with Fast Blue BB salt chromogen-substrate solution, yielding a blue reaction product. To avoid antibody cross-reactivity in double labeling experiments, slices were once more irradiated in a microwave for 20 min in citrate buffer (15). Complete inhibition of alkaline phosphatase function was achieved as previously described (16). Then, IGFBP-1, -2, and -3 were immunolabeled as described above, using polyclonal antibodies to the respective human antigens (Mediagnost, Tuebingen, Germany).

Controls
Negative antibody controls included nonspecific isotype-matched primary antibodies. In each labeling experiment serial sections were incubated with TBS/BSA instead of the primary antibody to assess secondary antibody-mediated mislabeling. No labeling of the secondary antibody was observed in any labeling experiments. After overnight preabsorption of anti-IGFBP-1 antibody with 0.5 µg/ml of the IGFBP-1 protein purified from human amniotic fluid, the initially observed labeling pattern (Fig. 1AGo) was completely abrogated (not shown). After overnight incubation of anti-IGFBP-2 with 0.5 µg/ml recombinant IGFBP-2 protein (gift from Novartis, Basel, Switzerland), the initially observed labeling pattern (Fig. 1BGo) was completely abrogated. The same effect of preabsorption with IGFBP-2 was detectable in the rat C6 glioblastoma model (Figs. 1DGo and 2Go, A and B).



View larger version (136K):
[in this window]
[in a new window]
 
Figure 1. IGFBP-1 (A) and IGFBP-3 (C) immunoreactivities were predominantly observed in endothelial cells. IGFBP-2+ cells accumulated in the immediate vicinity of areas of focal necrosis (B). IGFBP-2 immunoreactivity in and adjacent to areas of focal necrosis was confirmed in the rat C6 glioma model (D). Double labeling experiments confirmed IGFBP-2 (yellowish color) in GFAP+ (E; violet color) and in CD68+ cells (F; violet color). Magnification: A–C, x400; D, x200; E and F, x1000.

 


View larger version (112K):
[in this window]
[in a new window]
 
Figure 2. Control to exclude nonspecific binding of the primary antibody. Immunostaining, as described in Materials and Methods, of IGFBP-2 without (left) or with preabsorption of the antirat IGFBP-2 antiserum with recombinant hIGFBP-2 in rat C-6 glioblastoma.

 
Single labeling immunohistochemistry controls included incubation of the tissue slices with nonimmune TBS/BSA, blocking experiments with the respective peptide, and blocking experiments with the differentiated peptide. In blocking experiments for IGFBP-1 and -2, the peptides were adhered to a polyvinylidene difluoride membrane commonly used for Western blotting and incubated with the respective antibodies overnight at 4 C.

Evaluation
Staining results were examined at x200 magnification using an eye-piece grid. Three independent areas of the tumor tissues and of areas of infiltrative tumor growth were evaluated for each section and labeling procedure. Areas of zonal necrosis were not taken into consideration. Endothelial IGFBP-1 and -3 immunolabeling was evaluated by counting positively labeled endothelial cells with respect to the total number of counterstained endothelial cells. IGFBP-2 labeling was evaluated by counting positively stained cells with respect to the overall number of counterstained nuclei. Positively stained cells were counted and assigned a semiquantitative labeling score. The mean labeling score (MLS) of the three evaluated areas was determined as follows: 0 = no staining, 1 = up to 2% labeled cells, 2 = 3% up to 20% labeled cells, 3 = 21% up to 50% labeled cells, and 4 = more than 51% labeled cells. Statistical analysis of pooled low grade glioma MLS (WHO I and II) vs. pooled high grade glioma MLS (WHO III and IV) was performed using the Mann-Whitney U test.

Cell lines
A set of eight commercially available (American Type Culture Collection, Manassas, VA) human cell lines, representing the cellular composition of human gliomas, was used to study the mRNA expression of IGFBP-1, -2, and -3. These included four glioma cell lines (LN-229, T98G, U373NG, and U138MG) (17), the lung fibroblast cell line CRL246, the histiocytic lymphoma cell line U937 with monocyte/macrophage morphology, and the myeloblastic AML cell line CCL246 (clone K61).

C6 rat glioblastoma cell culture and transplantation
The rat C6 glioblastoma cell line was obtained from the American Type Culture Collection and raised in RPMI 1640 medium with Glutamax II (Life Technologies, Inc., Paisley, UK) containing 10% FCS (Life Technologies, Inc.) and 1.2% penicillin/streptomycin (Fluka, Buchs, Switzerland) at 37 C in 5% CO2. Cells were implanted intracranially as previously described (12). Briefly, cells were harvested, and 5 µl cell suspension were injected into the basal ganglia region of Sprague Dawley rats at a concentration of 4 x 105/µl. After 2 weeks, rats were killed and perfused with 4% buffered formaldehyde, and tumors were removed for further analysis. Immunohistochemistry was performed using a rabbit polyclonal antiserum to rodent IGFBP-2 (from Austral, San Ramon, CA).

Semiquantitative RT-PCR
Semiquantitative RT-PCR was performed to assess the levels of IGFBP-1, IGFBP-2, IGFBP-3, IGF-I, and IGF-II mRNA (results for IGFs not shown) in tissue samples from nine representative glioma tissues of different grades and in six glioma cell lines. RT-PCR was performed according to a protocol described previously (18). The gliomas had been characterized with respect to their grade of malignancy (13). The cell lines were described above. PCR products stained with ethidium bromide, were analyzed by an imaging system and quantitated by a specific software (Aida, Raytest, Straubenhardt, Germany). Glyceraldehyde phosphate dehydrogenase (GAPDH) served as an internal standard of mRNA expression. The sequences of IGFBP-1-specific PCR primers were GAGAGCACGGAGATAA CTGAGG for the sense strand and TTGGTGACATGGAGAGCCTTCG for the antisense strand; the size of the amplicon was 131 bp. The primers for IGFBP-2 PCR have been published (18); the amplicon was 121 bp. Primers for IGFBP-3 PCR were TAGTGAGTCGGAGGAAGACC (sense) and GAGAAGTTCTGGGTATCTGTGC (antisense); the amplicon had a size of 192 bp. Northern blot analysis (not shown) was performed to confirm the presence of IGFBP-2 mRNA in the total RNA from glioma tissue.

Statistical methods
Data were analyzed using standard statistical methods, including Mann-Whitney U test. Significance was assigned a value of P < 0.05 for differences between two sets of data.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Differential expression patterns of IGFBP-1, -2, and -3 were observed in human gliomas (Table 1Go). IGFBP-1 immunoreactivity was observed predominantly in endothelial (Fig. 1AGo) and macrophage/microglial cells. In neuropathologically unaltered control brains, IGFBP-1, -2, and -3 were not expressed (Table 2Go). Occasionally, faint IGFBP-1, -2, and -3 immunoreactivity was observed in singular endothelial cells and neurons. In one patient, however, we observed prominent IGFBP-2 immunoreactivity in the plexus choroideus endothelial cells. Furthermore, no staining of IGFBPs was achieved, when antiserums were preabsorbed with the respective IGFBP, as a control. The effect of preabsorption with IGFBP-2 on IGFBP-2 immunostaining in rat C6 glioblastoma is shown in Fig. 2Go. As in the slices from human tumors, positive staining of IGFBP was completely abrogated by preabsorption of the antiserum with the respective antigen.

Using the Mann Whitney U test, we detected significantly (P = 0.023) more IGFBP-1+ endothelial cells in low grade gliomas (MLS = 2.105; SEM = 0.1857) than in high grade gliomas (MLS = 1.387; SEM = 0.1715). There were no significant differences (P = 0.586) in the number of IGFBP-1-immunoreactive macrophages/microglial cells in low (MLS = 1.0; SEM = 0.076) vs. high (MLS = 1.097; SEM = 0.097) grade gliomas.

IGFBP-2 immunoreactivity was detected in glioma, macrophages/microglial, and scattered endothelial cells. It is of note that IGFBP-2+ cells frequently accumulated in the immediate vicinity of areas of focal necrosis (Fig. 1BGo). Accordingly, we calculated a positive correlation of IGFBP-2+ cells with the grade of malignancy of the tumors. The number of IGFBP-2+ cells was significantly (P = 0.0006) lower in low grade gliomas (MLS = 1.0; SEM = 0.171) than in high grade gliomas (MLS = 2.129; SEM = 0.201). Double labeling experiments confirmed the coexpression of IGFBP-2 in GFAP+ (Fig. 1EGo), in CD68+ (Fig. 1FGo) and in HLA-DR, -DP, and -DQ+ cells. Accumulation of IGFBP-2+ cells in and adjacent to areas of necrosis was confirmed in the rat C6 glioma model (Fig. 1D).

IGFBP-3 immunoreactivity was distributed similarly to IGFBP-1 immunoreactivity, predominantly in endothelial cells (Fig. 1CGo) and in scattered macrophages/microglial cells. However, no significant differences (P = 0.080) were calculated in the amount of IGFBP-3+ endothelial cells in low (MLS = 1.789; SEM = 0.224) vs. high (MLS = 1.258; SEM = 0.202) grade gliomas. There were no significant (P = 0.82) differences in the number of IGFBP-3+ macrophages in low grade gliomas (MLS = 1.053; SEM = 0.093) compared with high grade gliomas (MLS = 1.097; SEM = 0.054).

Expression of mRNA of the respective IGFBPs was confirmed in a representative set of gliomas by RT-PCR and Northern blot (not shown) using total RNA from nine tumors of different grades (grades 1–4; Fig. 3Go). Of the three IGFBPs, IGFBP-1 reached higher mRNA levels relative to GAPDH mRNA in the gliomas, than IGFBP-2 and -3. Malignancies of higher grade (grades 3 and 4) tended to express higher IGFBP-2 mRNA levels than tumors of lower grade (grades 1 and 2). No differences in IGFBP-1 and IGFBP-3 mRNA expression were seen between tumors of high and low grades of malignancy (Fig. 3Go).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 3. Expression of mRNA of IGFBP-1, -2, and -3 and of the control gene GAPDH by RT-PCR analysis from total RNA of nine representative gliomas of ascending tumor grade (grades 1–4). The bars show the means of relative mRNA levels, quantified densitometrically in relation to the control gene GAPDH; the error bars represent the SD of three independent experiments. The size of the amplicons is indicated in the right panel in base pairs.

 
In accordance with the cell type specificity of IGFBP expression of the tumors in vivo, we found high expression of IGFBP-2 mRNA in the glioma, macrophage-like, and AML cell lines and low expression in the fibroblast cell line (Fig. 4Go). The mRNA of IGFBP-1 and IGFBP-3, of which significant protein expression was shown histochemically only in the endothelial cells, were weakly expressed in all of the cell lines.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 4. Expression of mRNA of IGFBP-1, -2, and -3 by RT-PCT analysis of total RNA in eight cell lines representing the cellular distribution of human gliomas. The cell line U937 has macrophage/monocyte morphology, CRL1490 is a lung fibroblast line, CCL246 is a T lymphoma cell line, and U138MG, W319, U373NG, T98G, and LN-229 are glioma cell lines. Data represent the means of duplicate measurements.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In a panel of 50 human gliomas of varying malignancy, we detected IGFBP-1 and -3 accumulation in endothelial and macrophages/microglial cells. IGFBP-2+ macrophages/microglial and glioma cells accumulated in the immediate vicinity of areas of focal necrosis. RT-PCR analysis confirmed that the gliomas were expressing IGFBP-1, -2, and -3 mRNA. In endothelial cells the expression of IGFBP-1 correlated negatively, and in glioma cells the expression of IGFBP-2 correlated positively with tumor malignancy. A tendency for higher levels of IGFBP-2 mRNA in tumors of higher grade of a representative set of nine gliomas further suggests a relationship between elevated IGFBP-2 and malignancy.

IGFBP-1 expression in endothelial cells has been described previously, but no correlation with malignancy has been reported to date (19, 20). The correlation of IGFBP-1 expression with malignancy in glial tumors of the brain is of note, because IGFBP-1 inhibits IGF-I mediated proliferation of a wide range of cell types, including breast cancer, mouse whole brain, arterial smooth muscle, and prostate cancer (21, 22, 23, 24). Moreover, IGFBP-1 has been demonstrated to affect apoptosis and cell adhesion in breast cancer cells by signal transduction through integrins (25). Increased expression of IGFBP-1 in low vs. high grade glioma therefore suggests the inactivation of a potential mechanism of antiangiogenesis in high grade human astrocytomas. Accordingly, high expression of IGFBP-1 mRNA was detected here in the gliomas, but not in the cell lines, as no endothelial cell line was included.

IGFBP-2 expression has been demonstrated to be involved in the development of the brain (26, 27). Furthermore, differential induction of IGFBP-2 expression in the brain has been associated with a variety of pathological conditions, including hypoxia, regeneration, and trauma (28, 29, 30). In meningeomas, plexus papillomas, and glioblastomas, a high IGF-II/IGFBP-2 mRNA ratio has been suggested to constitute a sign of biologically aggressive behavior that can influence treatment strategies (31, 32, 33). In brain tumors, IGFBP-2 accumulation has been localized to astrocytes and choroid plexus.

Our results provide further information on the cellular distribution of IGFBP-2-expressing cells in human gliomas. The immunohistochemistry of the tumors in vivo is in accordance with analysis of IGFBP-2 mRNA expression in the tumor cell lines, i.e. high expression in glioma and macrophage-like cell lines and low expression in the fibroblast cell line. As the IGFBP-2+ cells accumulated in the immediate vicinity of focal necrosis of the tumor, high expression of IGFBP-2 may indicate the presence of a highly malignant glioma. This is in accordance with the earlier finding of elevated concentrations of IGFBP-2 in the cerebrospinal fluid of patients with malignant brain tumors (8).

Furthermore, the present data add considerable knowledge about the involvement of IGFBP-2 in human glioma pathophysiology. In addition to the influence of IGFBP-2 in the IGF-dependent proliferation of glioma cells (11), IGF-independent effects of IGFBP-2 in the regulation of apoptosis and cell adhesion, i.e. metastasis, are likely in brain tumors. In future studies it has to be investigated whether IGFBP-2 affects tumorigenesis through RGD-specific binding to integrins, as it was seen for IGFBP-1 in breast cancer (25).

IGFBP-3 expression in endothelial cells is cytokine sensible and can be triggered by IGF-I and inhibited by transforming growth factor-ß (34). Most importantly, proapoptotic effects of IGFBP-3 have been described in glioblastoma multiforme (35). In addition, IGFBP-3 obviously plays a role in the modulation of breast cancer cell proliferation by tumor necrosis factor-{alpha} (36). However, clinical studies revealed that high levels of IGFBP-3 are associated with unfavorable prognostic features of breast cancer (37). Uniform and restricted cellular IGFBP-3 expression in astrocytomas of all malignancies therefore defines this peptide as potential antineoplastic agent in these neoplasias.

In conclusion, the association of elevated IGFBP-2 protein and mRNA with the malignancy and the cellular distribution indicates a possible role for IGFBP-2 in the processes of malignant transformation, tumor necrosis, and metastasis of brain tumors. The mechanism by which IGFBP-2 acts at the cellular level, however, remains to be elucidated. Furthermore, the measurement of IGFBP-2 in the serum and liquor by immunoassay may be of value in the diagnosis of a malignant brain tumor.


    Acknowledgments
 
We thank Katrin Trautmann for expert technical assistance.


    Footnotes
 
1 This work was supported by a grant from the German Research Council (DFG EL 167/3-1) and the Fortune Program (Grant 638-0-0) of the University of Tuebingen. Back

Received September 5, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Baserga R, Prisco M, Hongo A 1999 IGFs and cell growth. In: Rosenfeld RG, Roberts Jr CT (eds) The IGF System. Humana Press, Totowa, pp 329–353
  2. Morford LA, Boghaert ER, Brooks WH, Roszman TL 1997 Insulin-like growth factors (IGF) enhance three-dimensional (3D) growth of human glioblastomas. Cancer Lett 115:81–90[CrossRef][Medline]
  3. Resnicoff M 1998 Antitumor effects elicited by antisense-mediated downregulation of the insulin-like growth factor I receptor (review). Int J Mol Med 1:883–888[Medline]
  4. Hongo A, Yumet G, Resnicoff M, Romano G, O’Connor R, Baserga R 1998 Inhibition of tumorigenesis and induction of apoptosis in human tumor cells by the stable expression of a myristylated COOH terminus of the insulin-like growth factor I receptor. Cancer Res 58:2477–2484[Abstract/Free Full Text]
  5. Resnicoff M, Tjuvajev J, Rotman HL, Abraham D, Curtis M, Aiken R, Baserga R 1996 Regression of C6 rat brain tumors by cells expressing an antisense insulin-like growth factor I receptor RNA. J Exp Ther Oncol 1:385–389[Medline]
  6. Trojan J, Johnson TR, Rudin SD, Ilan J, Tykocinski ML, Ilan J 1993 Treatment and prevention of rat glioblastoma by immunogenic C6 cells expressing antisense insulin-like growth factor I RNA. Science 259:94–97[Abstract/Free Full Text]
  7. Ranke MB, Elmlinger MW 1997 Functional role of insulin-like growth factor binding proteines. Horm Res 48:9–15
  8. Muller HL, Oh Y, Lehrnbecher T, Blum WF, Rosenfeld RG 1994 Insulin-like growth factor binding protein-2 concentrations in cerebrospinal fluid and serum of children with malignant solid tumors or acute leukemia. J Clin Endocrinol Metab 79:428–434[Abstract]
  9. Zumkeller W, Saaf M, Rahn T 1993 Insulin-like growth factor (IGF)-I, -II and IGF-binding proteins in the cyst fluid of a patient with astrocytoma. Childs Nerv Syst 9:100–103[CrossRef][Medline]
  10. Unterman TG, Glick RP, Waites GT, Bell SC 1991 Production of insulin-like growth factor- binding proteins by human central nervous system tumors. Cancer Res 51:3030–3036[Abstract/Free Full Text]
  11. Bradshaw SL, D’Ercole AJ, Han VK 1999 Overexpression of insulin-like growth factor- binding protein-2 in C6 glioma cells results in conditional alteration of cellular growth. Endocrinology 140:575–584[Abstract/Free Full Text]
  12. Deininger MH, Schluesener HJ 1999 Cyclooxygenases-1 and -2 are differentially localized to microglia and endothelium in rat EAE and glioma. J Neuroimmunol 95:202–208[CrossRef][Medline]
  13. Kleihues P, Burger PC, Scheithauer BW 1993 The new classification of brain tumors. Brain Pathol 3:255–268[Medline]
  14. Deininger MH, Weller M, Streffer J, Mittelbronn M, Meyermann R 1999 Patterns of cyclooxygenase-1 and -2 expression in human glioma in vivo. Acta Neuropathol 98:240–244[CrossRef][Medline]
  15. Lan HY, Mu W, NG YY, Nikolic-Paterson DJ, Atkins RC 1996 A simple, reliable, and sensitive method for nonradioactive in situ hybridization: use of microwave heating to improve hybridization efficiency and preserve tissue morphology. J Histochem Cytochem 44:281–287[Abstract]
  16. Deininger MH, Meyermann R 1998 Multiple epitope labeling by the exclusive use of alkaline phosphatase conjugates in immunohistochemistry. Histochem Cell Biol 110:425–430[CrossRef][Medline]
  17. Weller M, Rieger J, Grimmel C, Van Meir EG, De Tribolet N, Krajewski S, Reed JC, von Deimling A, Dichgans J 1998 Predicting chemoresistance in human malignant glioma cells: the role of molecular genetic analysis. Int J Cancer 79:640–644[CrossRef][Medline]
  18. Elmlinger MW, Sanatani MS, Bell M, Dannecker GE, Ranke MB 1998 Elevated insulin-like growth factor binding protein (IGFBP)-2 and IGFBP-4 expression of leukemic cells is affected by autocrine/paracrine IGF-II action but not by IGF type I receptor expression. Eur J Endocrinol 138:337–343[Abstract]
  19. Keller ML, Roberts AJ, Seidel Jr GE 1998 Characterization of insulin-like growth factor-binding proteins in the uterus and conceptus during early conceptus elongation in cattle. Biol Reprod 59:632–642[Abstract/Free Full Text]
  20. Burren CP, Berka JL, Edmondson SR, Werther GA; Batch-JA 1996 Localization of mRNAs for insulin-like growth factor-I (IGF-I), IGF-I receptor, and IGF binding proteins in rat eye. Invest Ophthalmol Vis Sci 37:1459–68[Abstract/Free Full Text]
  21. Lee AV, Weng CN, Jackson JG, Yee D 1997 Activation of estrogen receptor-mediated gene transcription by IGF-I in human breast cancer cells. J Endocrinol 152:39–47[Abstract/Free Full Text]
  22. D’Ercole AJ, Ye P, Calikoglu AS, Gutierrez-Ospina G 1996 The role of the insulin-like growth factors in the central nervous system. Mol Neurobiol 13:227–255[Medline]
  23. Motani A, Rutherford C, Anggard EE, Ferns GA 1995 Insulin-like growth factor binding protein-1 inhibits arterial smooth muscle cell proliferation in vitro but does not reduce the neointimal response to balloon catheter injury. Atherosclerosis 118:57–66[CrossRef][Medline]
  24. Figueroa JA, Lee AV, Jackson JG, Yee D 1995 Proliferation of cultured human prostate cancer cells is inhibited by insulin-like growth factor (IGF) binding protein-1: evidence for an IGF-II autocrine growth loop. J Clin Endocrinol Metab 80:3476–3482[Abstract]
  25. Perks CM, Bowen S, Gill ZP, Newcomb PV, Holly JM 1999 Differential IGF-independent effects of insulin-like growth factor binding proteins (1–6) on apoptosis of breast epithelial cells. J Cell Biochem 15:652–664
  26. Sullivan KA, Feldman EL 1994 Immunohistochemical localization of insulin-like growth factor-II (IGF-II) and IGF-binding protein-2 during development of the rat brain. Endocrinology 135:540–547[Abstract]
  27. Werther GA, Russo V, Baker N, Butler G 1998 The role of the insulin-like growth factor system in the developing brain. Horm Res 49:37–40
  28. Klempt M, Klempt ND, Gluckman PD 1993 Hypoxia and hypoxia/ischemia affect the expression of insulin-like growth factor binding protein 2 in the developing rat brain. Brain Res Mol Brain Res 17:347–350[Medline]
  29. Gehrmann J, Yao DL, Bonetti B, Bondy CA, Brenner M, Zhou J, Kreutzberg GW, Webster HD 1994 Expression of insulin-like growth factor-I and related peptides during motoneuron regeneration. Exp Neurol 128:202–210[CrossRef][Medline]
  30. Sandberg-Nordqvist AC, von Holst H, Holmin S, Sara VR, Bellander BM, Schalling M 1996 Increase of insulin-like growth factor (IGF)-1, IGF binding protein-2 and -4 mRNAs following cerebral contusion. Brain Res Mol Brain Res 38:285–293[Medline]
  31. Nordqvist AC, Peyrard M, Pettersson H, Mathiesen T, Collins VP, Dumanski JP, Schalling M 1997 A high ratio of insulin-like growth factor II/insulin-like growth factor binding protein 2 messenger RNA as a marker for anaplasia in meningiomas. Cancer Res 57:2611–2614[Abstract/Free Full Text]
  32. Kubo S, Ogino S, Fukushima T, Olson PR, Kida M, Maruno M, Yoshimine T, Hyakawa T 1999 Immunohistochemical study of insulin-like growth factor II (IGF-II) and insulin-like growth factor binding protein-2 (IGFBP-2) in choroid plexus papilloma. Neurol Res 21:339–344[CrossRef][Medline]
  33. Fuller GN, Rhee CH, Hess KR, Caskey LS, Wang R, Bruner JM, Yung WK, Zhang W 1999 Reactivation of insulin-like growth factor binding protein 2 expression in glioblastoma multiforme: a revelation by parallel gene expression profiling. Cancer Res 59:4228–4232[Abstract/Free Full Text]
  34. Erondu NE, Dake BL, Moser DR, Lin M, Boes M, Bar RS 1996 Regulation of endothelial IGFBP-3 synthesis and secretion by IGF-I and TGF-ß. Growth Regul 6:1–9[Medline]
  35. Shen L, Dean NM, Glazer RI 1999 Induction of p53-dependent, insulin-like growth factor-binding protein-3-mediated apoptosis in glioblastoma multiforme cells by a protein kinase C{alpha} antisense oligonucleotide. Mol Pharmacol 55:396–402[Abstract/Free Full Text]
  36. Yu H, Levesque MA, Khosravi MJ, Papanastasiou-Diamandi A, Clark GM, Diamandis EP 1998 Insulin-like growth factor-binding protein-3 and breast cancer survival. Int J Cancer 79:624–628[CrossRef][Medline]
  37. Rozen F, Zhang J, Pollak M 1998 Antiproliferative action of tumor necrosis factor-{alpha} on MCF-7 breast cancer cells is associated with increased insulin-like growth factor binding protein-3 accumulation. Int J Oncol 13:865–869[Medline]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
E. K. Rowinsky, H. Youssoufian, J. R. Tonra, P. Solomon, D. Burtrum, and D. L. Ludwig
IMC-A12, a Human IgG1 Monoclonal Antibody to the Insulin-Like Growth Factor I Receptor
Clin. Cancer Res., September 15, 2007; 13(18): 5549s - 5555s.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Fukushima, T. Tezuka, T. Shimomura, S. Nakano, and H. Kataoka
Silencing of Insulin-like Growth Factor-binding Protein-2 in Human Glioblastoma Cells Reduces Both Invasiveness and Expression of Progression-associated Gene CD24
J. Biol. Chem., June 22, 2007; 282(25): 18634 - 18644.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
K. W Frommer, K. Reichenmiller, B. S Schutt, A. Hoeflich, M. B Ranke, G. Dodt, and M. W Elmlinger
IGF-independent effects of IGFBP-2 on the human breast cancer cell line Hs578T.
J. Mol. Endocrinol., August 1, 2006; 37(1): 13 - 23.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. K. Wang, L. Hu, G. N. Fuller, and W. Zhang
An Interaction between Insulin-like Growth Factor-binding Protein 2 (IGFBP2) and Integrin {alpha}5 Is Essential for IGFBP2-induced Cell Mobility
J. Biol. Chem., May 19, 2006; 281(20): 14085 - 14091.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Bredel, C. Bredel, D. Juric, G. R. Harsh, H. Vogel, L. D. Recht, and B. I. Sikic
Functional Network Analysis Reveals Extended Gliomagenesis Pathway Maps and Three Novel MYC-Interacting Genes in Human Gliomas
Cancer Res., October 1, 2005; 65(19): 8679 - 8689.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. C. Russo, B. S. Schutt, E. Andaloro, S. I. Ymer, A. Hoeflich, M. B. Ranke, L. A. Bach, and G. A. Werther
Insulin-Like Growth Factor Binding Protein-2 Binding to Extracellular Matrix Plays a Critical Role in Neuroblastoma Cell Proliferation, Migration, and Invasion
Endocrinology, October 1, 2005; 146(10): 4445 - 4455.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Vorwerk, K. Mohnike, H. Wex, F.-W. Rohl, M. Zimmermann, W. F. Blum, and U. Mittler
Insulin-Like Growth Factor Binding Protein-2 at Diagnosis of Childhood Acute Lymphoblastic Leukemia and the Prediction of Relapse Risk
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3022 - 3027.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Godard, G. Getz, M. Delorenzi, P. Farmer, H. Kobayashi, I. Desbaillets, M. Nozaki, A.-C. Diserens, M.-F. Hamou, P.-Y. Dietrich, et al.
Classification of Human Astrocytic Gliomas on the Basis of Gene Expression: A Correlated Group of Genes with Angiogenic Activity Emerges As a Strong Predictor of Subtypes
Cancer Res., October 15, 2003; 63(20): 6613 - 6625.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Wang, H. Wang, W. Shen, H. Huang, L. Hu, L. Ramdas, Y.-H. Zhou, W. S-L. Liao, G. N. Fuller, and W. Zhang
Insulin-like Growth Factor Binding Protein 2 Enhances Glioblastoma Invasion by Activating Invasion-enhancing Genes
Cancer Res., August 1, 2003; 63(15): 4315 - 4321.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Solomon, M. Grueterich, D.-Q. Li, D. Meller, S.-B. Lee, and S. C. G. Tseng
Overexpression of Insulin-like Growth Factor-Binding Protein-2 in Pterygium Body Fibroblasts
Invest. Ophthalmol. Vis. Sci., February 1, 2003; 44(2): 573 - 580.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Hoeflich, R. Reisinger, H. Lahm, W. Kiess, W. F. Blum, H. J. Kolb, M. M. Weber, and E. Wolf
Insulin-like Growth Factor-binding Protein 2 in Tumorigenesis: Protector or Promoter?
Cancer Res., December 1, 2001; 61(24): 8601 - 8610.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elmlinger, M. W.
Right arrow Articles by Ranke, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elmlinger, M. W.
Right arrow Articles by Ranke, M. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals