help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jin, L.
Right arrow Articles by Lloyd, R. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jin, L.
Right arrow Articles by Lloyd, R. V.
Endocrinology Vol. 142, No. 5 1703-1709
Copyright © 2001 by The Endocrine Society

ARTICLES

Analysis of Homogeneous Populations of Anterior Pituitary Folliculostellate Cells by Laser Capture Microdissection and Reverse Transcription-Polymerase Chain Reaction1

Long Jin, Itaru Tsumanuma, Katharina H. Ruebel, Jill M. Bayliss and Ricardo V. Lloyd

Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, Minnesota 55905

Address all correspondence and requests for reprints to: Dr. R. V. Lloyd, Department of Laboratory Medicine and Pathology, 200 1st Street SW, Rochester, Minnesota 55905. E-mail: lloyd.ricardo{at}mayo.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pituitary folliculostellate (FS) cells are usually located between the secretory cells in the anterior pituitary, and they produce many peptides that exert a paracrine effect on hormone-producing pituitary cells. Previous approaches have been unsuccessful in obtaining homogeneous populations of FS cells. We used a combination of immunostaining with S100 protein followed by laser capture microdissection (Immuno-LCM) to obtain purified populations of rat FS cells. These cells were analyzed along with a mouse FS cell line (TtT/GF) by RT-PCR for gene expression.

RT-PCR analyses showed that both FS cell populations expressed the mRNAs for glial fibrillary acidic protein, S100 protein, transforming growth factor-ß1 (TGFß1), TGFß receptor, interleukin-6, leptin, leptin receptor, pituitary adenylate cyclase-activating polypeptide (PACAP), and PACAP receptors. Both FS cell populations were negative for PRL, GH, and POMC, supporting the homogeneity of the rat FS cell population. TGFß1, but not PACAP-38, treatment stimulated cell proliferation in both FS cell populations. TGFß1 increased leptin, but not interleukin-6, mRNA expression in rat FS cells. However, TGFß1 inhibited leptin RNA expression in the TtT/GF cell line, as shown by RT-PCR and Northern blot analysis.

These results indicate that 1) homogeneous populations of FS cells can be prepared by Immuno-LCM; 2) TGFß1 stimulates the proliferation of normal rat FS cells and the TtT/GF cell line; and 3) the effects of TGFß1 to stimulate leptin mRNA expression in rat FS cells but inhibit leptin mRNA expression in TtT/GF cells probably reflect alterations in signal transduction in the TtT/GF cell line.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
FOLLICULOSTELLATE (FS) cells, which were first described in the rat anterior pituitary gland (1), have been examined extensively by many investigators (2, 3, 4, 5). These studies have been facilitated by the use of S100 protein immunohistochemistry, as S100 protein is expressed by FS cells (6, 7, 8, 9, 10, 11, 12). Putative functions of these cells have included phagocytosis, a sustentacular role, and many paracrine functions (5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16). FS cells produce many substances that influence adjacent secretory anterior pituitary cells, including vascular endothelial growth factor (17), fibroblast growth factor (18), interleukin-6 (IL-6) (19), follistatin (20), leukemia inhibitory factor (21), nitric oxide synthase (22, 23), and leptin (24).

Studies of homogeneous FS cell populations have been impeded by the inability to obtain pure populations of these cells. Biophysical methods have resulted in enriched populations of FS cells for in vitro studies (25, 26, 27, 28). Some investigators have obtained pure populations of FS cells for analysis by developing cell lines (29, 30, 31, 32), but the similarities of FS cell lines to primary cultures of FS cells is unknown.

Recent development of more sophisticated methods of isolating pure cell populations has included laser capture microdissection (LCM). With LCM, homogenous populations of cells can be collected for molecular and other analyses (33, 34, 35, 36, 37, 38). Our laboratory and others have combined immunophenotypic characterizations of specific cell types with LCM (Immuno-LCM) to obtain highly homogeneous cell populations (36, 37, 38).

We used the Immuno-LCM technique to obtain homogeneous populations of rat FS cells in this study. These cells were compared with the mouse FS cell line, TtT/GF, and were shown to express many of the same gene products as the cell line. We observed that transforming growth factor-ß1 (TGFß1) stimulated the proliferation of both rat FS cells and TtT/GF cells. TGFß1 also regulated leptin gene expression in FS cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
Anterior pituitaries were obtained from 60- to 90-day-old adult female Wistar-Furth rats (Harlan Sprague Dawley, Inc., Indianapolis, IN). All procedures using rats were approved by the Mayo Foundation committee on use and care of animals. All experiments were conducted in accordance with the principles and procedures outlined in the NIH Guidelines for the Care and Use of Experimental Animals. The mouse FS cell line (TtT/GF) was a gift from Dr. K. Inoue (Gunma University, Maebashi, Japan). DMEM was supplemented with 15% horse serum, 2.5% FCS, 1 µg/ml insulin, and 1% antibiotics (all from Life Technologies, Inc., Grand Island, NY). TGFß1 was purchased from R & D Systems, Inc. (Minneapolis, MN), and pituitary adenylate cyclase-activating polypeptide-38 (PACAP-38) was obtained from Peninsula Laboratories, Inc. (Belmont, CA). The Pix Cell II Laser Capture Microdissection System was purchased from Arcturus Engineering, Inc. (Mountain View, CA).

Immuno-LCM
To prepare homogeneous populations of pituitary FS cells, normal rat pituitaries were freshly dissociated with 0.25% trypsin and cytospun onto glass slides using 1 x 104 cells/slide for Immuno-LCM analysis as previously reported (36). The pituitary cell cytospin slides were rehydrated with PBS buffer, and immunocytochemistry was performed using an anti-S100 antibody (from DAKO Corp., Carpinteria, CA; diluted 1:1000) to characterize FS cells in normal pituitaries. Immunostaining was performed within 2.5 h using the avidin-biotin peroxidase complex method, as previously described (36). The slides were then lightly counterstained with hematoxylin and dehydrated with 95% and 100% ethanol, incubated in xylene for 6 min, and air-dried before LCM. All reactions were performed in ribonuclease-free solution to prevent RNA degradation.

The Pix Cell II Laser Capture Microdissection instrument was used for LCM analysis. LCM parameters included a laser power of 90 milliwatts, laser pulse duration of 1.2 ms, and laser spot size of 7.5–15 µm diameter. The infrared laser was pulsed over cells of interest, and this melted the film directly on the targeted cells, embedding the captured cells. Approximately 400 S100-positive cells from each sample were captured using 2–3 slides.

After LCM, total RNA extraction from the captured cells was performed using the TRIzol reagent kit (Life Technologies, Inc.). The caps with LCM cells were immediately placed into sterile 0.5-ml microcentrifuge tubes (PGC Scientifics, Frederick, MD) containing 200 µl TRIzol reagent and inverted at room temperature for 1 h before storing at -70 C overnight. On the following day, the RNA extraction was performed according to the manufacturer’s instructions. After ethanol precipitation, the RNA pellet was resuspended in 10 µl diethylpyrocarbonate-H2O and used for the RT-PCR reactions.

Cell culture
To analyze the effects of TGFß1 and PACAP-38 on FS cells, the TtT/GF cells were grown in DMEM with complete serum in a 37 C, 5% CO2 atmosphere, as previously reported (39). Aliquots of TtT/GF cells were treated with TGFß1 (10-9 M) or PACAP-38 (250 nM) for 4 days and then harvested and used for RNA extraction. Dissociated rat pituitary cells were incubated in DMEM with 2% FCS, and aliquots of cells were treated with TGFß1 (10-9 M) or PACAP-38 (250 nM). After 4 days of treatment, the pituitary cells were harvested and attached to slides by cytocentrifugation using 1 x 104 cells/slide for Immuno-LCM analysis. At this cell density it was possible to capture individual cells without contamination from neighboring cells. The slides were fixed in 100% ethanol for 5 min, air-dried, and kept at -70 C until used in 1–2 weeks.

Thymidine incorporation
To analyze cell proliferation, [3H]thymidine incorporation was used for pituitary cells and TtT/GF cells. The dissociated normal pituitary cells were cultured in 2% FCS and treated with TGFß1 (10-9 M) or PACAP-38 (250 nM) for 4 days. The medium was changed, and fresh medium with 10 µCi [3H]thymidine (SA, 15.0 Ci/mmol; DuPont, Boston, MA) was added for 6 h. The cells were washed, harvested, and placed on glass slides by cytocentrifugation. After immunostaining for S100, the cells were subjected to autoradiography by dipping in NTB2 emulsion (Eastman Kodak Co., Rochester, NY) diluted 1:1 with distilled water. The slides were then stored in the dark at 4 C and developed after 3 days, as previously described (39).

To study the effects of TGFß1 and PACAP-38 on TtT/GF cell proliferation, the cells were seeded on 35-mm plastic dishes at 0.5 x 106 cells/dish. After 4 days in culture with 2% FCS, [3H]thymidine was added as described above. Cells were harvested, and the cell number from each dish was counted. [3H]Thymidine incorporation was examined by scintillation counting as previously described (24). The results were expressed as mean counts per min/105 cells ± SEM.

RT-PCR
First strand cDNA was prepared from total RNA by using a First Strand Synthesis Kit (Stratagene, La Jolla, CA), according to the manufacturer’s instruction. The RT reaction was performed in a final volume of 50 µl with 10 µl total RNA from LCM transfer cells or 5 µg total RNA from the FS cell line. Total RNA (5 µg) from normal rat pituitary tissues without LCM was used as a positive control. The sequences of primers for PCR and internal probes for Southern hybridization are as follows: rat S100b (GenBank accession no. X01090; product size, 211 bp), 5'-GTTGCCCTCATTGATGTCTTC (sense), 5'-AGACGAAGGCCATAAACTCCT (antisense), and 5'-CCATCCCCATCTTCGTCCAGCGTC- TCCATC (probe); mouse glial fibrillary acidic protein (GFAP; X02801; 391 bp), 5'- GCTGAACTGAACCAGCTTCGA (sense), 5'-CTTGGCCACATCCATCTCCAC (antisense), and 5'-AGAACTGGATCTCCTCCTCCAGCGATTCAA (probe); rat PACAP (M63006; 215 bp), 5'-CATCTTCACAGACAGCTATAG (sense), 5'-GTTTGGAAAGAACACATG- AGT (antisense), and 5'-CCCTAGCACGGCCGCCAAGTATTTCTTGAC (probe); rat PACAP-RI (303 bp) (40), 5'-CTTGTACAGAAGCTGCAGTCC (sense), 5'-CCGGTGCTTGAAGTCCATAGT (antisense), and 5'-GATGAGCAGTAGGGTGGAGCGGGCCAGCCG (probe); and mouse hypoxanthine phosphoribosyl transferase (HPRT; J0042; 478 bp), 5'-TTCCTCCTCAGACCGCTTTTT (sense), 5'-GTTTGCATTGTTTTACCAGTG (antisense), and 5'-AGCACACAGAGGGCCACAATGTGATGGCCT (probe). The other primers and probes used in this study have been published in previous reports, including those for rat leptin (244 bp) and leptin receptor (OB-Rb; 302 bp) (41), rat TGFß1 (161 bp) (39), and rat TGFß-RII (304 bp) (42). Rat GH (V01237; 376 bp) (36), rat PRL (344 bp) (36, 43), and rat POMC (K01877; 318 bp) (36) primers were also used as controls to check the homogeneity of LCM-captured FS cells. The specificity of the primers and probes were verified by GenBank searches. Most primers were designed to match both rat and mouse sequences.

PCR amplification was performed in a 50-µl final reaction volume containing 16 µl RT reaction product from 400 LCM captured cells as template DNA. For the FS cell line, a 100-µl final volume containing 10 µl RT reaction product was used. PCR amplification was performed for 40 cycles for LCM samples and 30 cycles for the FS cell line. The annealing temperatures ranged from 55–60 C and were obtained with the Oligo-5 software program (Molecular Biology Insights, Inc., Cascade, CO). After the final cycle, the elongation step was extended by 10 min at 72 C. The housekeeping gene, mouse HPRT, was amplified from the same RT products and used as an internal control. In some experiments the Immuno-LCM-captured FS cells were analyzed by RT-PCR for GH, PRL, or POMC to determine the homogeneity of the cell population. Omission of reverse transcriptase during the RT reaction was used as a negative control.

A 20-µl aliquot of the PCR product was analyzed by electrophoresis on a 2% agarose gel with ethidium bromide staining. Titration studies with different amounts of cDNA were performed to verify that each amplification was in the linear range. The PCR products were transferred to nylon membrane filters, and Southern hybridization was performed with 33P-labeled internal probes at 42 C for 18 h. After washing in 6 x SSC (standard saline citrate)/0.1% SDS at 23 C for 20 min and at 42 C for 10–20 min, autoradiography was performed with Kodak X-Omat-AR film (Eastman Kodak Co., Rochester, NY). The amounts of leptin and IL-6 mRNA were quantitated by densitometry, and the mRNA levels were normalized relative to HPRT.

Northern hybridization
Polyadenylated mRNA was isolated from 500 µg total RNA from TtT/GF cells using the Poly A Tract mRNA Isolation System Kit (Promega Corp., Madison, WI), electrophoresed on a denaturing 1% agarose formaldehyde gel, and transferred to a nylon filter. A rat leptin cDNA fragment (synthesized by RT-PCR in our laboratory) was labeled with 32P using a Random Primed DNA Labeling Kit (Roche Molecular Biochemicals, Indianapolis, IN) and used for Northern hybridization. 32P-Labeled HPRT and ß-actin (44) oligonucleotide probes were used to assess equal loading of RNA in the Northern blot. The amounts of leptin, HPRT, and ß-actin mRNAs were quantitated by densitometry, and the leptin mRNA level was normalized relative to HPRT and ß-actin.

Quantitation
S100 immunostaining positive cells in the normal pituitary were enumerated after cytocentrifugation, and the results were expressed as the percentage of total pituitary cells. For S100 protein immunostaining combined with thymidine incorporation, a minimum of 200 S100- positive cells for each slide were counted, and [3H]thymidine-positive cells were expressed as a percentage of total S100-positive cells. Three experiments with triplicate slides per group were performed. Student’s t test was used for statistical analysis. Results were expressed as the mean ± SEM.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
LCM and FS cell characterization
FS cells were obtained from dissociated rat anterior pituitary cells. After immunostaining for S100 protein, the FS cells could be readily identified by cytoplasmic and nuclear positivity and represented 5–10% of the total cells/slide. S100-positive cells were collected by Immuno-LCM and used for RNA extraction (Fig. 1Go). RT-PCR analysis showed that rat FS cells expressed mRNA for S100 protein, GFAP, leptin, the long form of the leptin receptor, IL-6, TGFß1, TGFßII, PACAP-38, and PACAP receptor I (Fig. 2AGo). The cells were negative for PRL, GH, and POMC mRNA, supporting the specificity of the procedure for capturing FS cells (Fig. 2BGo). Aliquots of total RNA from the TtT/GF cell line and normal pituitary were analyzed with the same primers. Only PACAP-38 mRNA was not detected in the TtT/GF cell line, which may be related to the rat primers used. PRL, GH, and POMC mRNA were detected in the normal pituitary, but not in the TtT/GF cells (Fig. 2BGo).



View larger version (77K):
[in this window]
[in a new window]
  		Figure 1. LCM of cells from pituitary after immunostaining for S100 protein. A, Normal FS cells stained positively for S100 protein. The arrow shows the cell to be captured. B, The cell indicated by the arrow is captured and transferred to the cap. C, The captured cell is transferred from cap to the TRIzol reagent and used for RNA extraction and RT-PCR.

 


View larger version (42K):
[in this window]
[in a new window]
  		Figure 2. RT-PCR analysis of FS cells. Approximately 400 S100-positive cells were collected and analyzed by RT-PCR. A, Analysis of various mRNA in FS cells. Lane 1, Rat pituitary FS cell; lane 3, TtT/GF cells; lane 5, normal rat pituitary without LCM used as positive control. Lanes 2, 4, and 6, Negative control lanes without RT. The top panel is the ethidium bromide-stained gel, and the bottom panel is a Southern hybridization with the internal probes described in Materials and Methods. B, Analysis of PRL, GH, and POMC expression. The lanes are the same as in A. Only the normal pituitary control expressed these hormone mRNAs.

 
Analysis of the effects of TGFB1 and PACAP-38 on FS cell proliferation
After 4-day culture of dissociated pituitary cells and analysis of [3H]thymidine incorporation in the presence of 10-9 M TGFß1, there was a 1.5- to 2-fold increase in the number of FS cells compared with that in control dishes (Fig. 3AGo). Analysis of TtT/GF cells in a similar experiment indicated that TGFß1 also stimulated proliferation of these cells (Fig. 3BGo). In contrast, PACAP-38 did not stimulate the growth of FS cells in normal rat pituitary or the TtT/GF cell line.



View larger version (33K):
[in this window]
[in a new window]
  		Figure 3. Analysis of the effects of TGFß1 and PACAP-38 on pituitary FS cells and TtT/GF cells proliferation. A, Dissociated pituitary cells were treated for 4 days in vitro. [3H]Thymidine uptake was analyzed by S100 immunostaining and autoradiography. TGFß1, but not PACAP-38, stimulated FS cell growth. Three experiments with 3 slides/group were used. A minimum of 200 positive cells/slide were enumerated. S100-positive cells represented 5–10% of the cells/slide. B, TtT/GF cell proliferation was detected by scintillation counting. Data are the mean ± SEM from three experiments. **, P < 0.01.

 
TGFB1 regulates leptin mRNA expression
After treatment of dissociated pituitary cells for 4 days with TGFßI or PACAP-38 followed by Immuno-LCM, RT-PCR, and Southern hybridization, there was increase in leptin, but not IL-6, mRNA expression (Fig. 4Go, A and B). This effect was specific for TGFß1, as PACAP-38 did not influence leptin or IL-6 mRNA expression.



View larger version (65K):
[in this window]
[in a new window]
  		Figure 4. A, Upper panel, RT-PCR analysis of the effects of TGFß1 and PACAP-38 on leptin and IL-6 mRNA expression in pituitary FS cells. Cultured cells were collected by Immuno-LCM, analyzed by RT-PCR, and normalized with HPRT. Lane 1, Control pituitary FS cells; lane 2, TGFß1-treated FS cells; lane 3, PACAP-38-treated FS cells; lane 4, normal rat pituitary cells without LCM, used as a positive control; lane 5, normal rat pituitary cells without RT, used as a negative control. The top panel in A shows the ethidium bromide-stained gel; the bottom panel of A shows Southern hybridization with the internal probe described in Materials and Methods. B, Lower panel, Densitometric analysis showed a 1.8-fold increase in leptin mRNA by TGFß1 treatment. Data are the mean ± SEM from three experiments.

 
When the TtT/GF cells were treated with TGFß1 and PACAP-38 for 4 days, there was a 2-fold reduction in leptin expression by TGFß1, but not by PACAP-38 (Fig. 5Go, A and B). The level of IL-6 mRNA expression was not influenced by TGFß1 or PACAP-38 treatment. To confirm the changes in leptin mRNA by TGFß1, Northern hybridization with polyadenylated mRNA was performed, and these results also showed a 2-fold decline in the level of leptin mRNA expression when the results were normalized relative to ß-actin (Fig. 6Go, A and B). Similar results were obtained when the data were normalized relative to HPRT (data not shown). PACAP-38 treatment did not change the mRNA levels of leptin (Fig. 6Go, A and B).



View larger version (65K):
[in this window]
[in a new window]
  		Figure 5. A, Upper panel, Analysis of the effects of TGFß1 and PACAP-38 on leptin and IL-6 mRNA expression on TtT/GF cells. After 4 days of culture in the presence of TGFß1 or PACAP-38, the cells were analyzed by RT-PCR. Lane 1, Control TtT/GF cells; lane 2, TGFß1-treated cells; lane 3, PACAP-38-treated cells; lane 4, negative control without RT. The top panel in A shows the ethidium bromide-stained gel; the bottom panel of A shows Southern hybridization with the internal probe described in Materials and Methods. B, Lower panel, Densitometric analysis showed that TGFß1 decreased leptin expression in TtT/GF cells by RT-PCR analysis. Data are the mean ± SEM from three experiments.

 


View larger version (48K):
[in this window]
[in a new window]
  		Figure 6. A, Upper panel, Northern analysis of TtT/GF cells after TGFß1 or PACAP-38 treatment. The cells were treated similarly as in Fig. 4Go. Polyadenylated mRNA was analyzed by Northern hybridization with a 32P-labeled leptin cDNA probe. The blot was rehybridized with a ß-actin oligonucleotide probe to check for equal loading and normalization. Lane 1, Control FS cells; lane 2, TGFß1-treated cells; lane 3, PACAP-38-treated cells. B, Lower panel, Densitometric analysis showed that TGFß1 decreased leptin expression in TtT/GF cells.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
FS cells have been studied extensively in the pituitaries of many vertebrates (5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23). However, homogeneous populations of these cells have not been previously available (24, 25, 26, 27). We used a combination of immunophenotyping FS cells from dissociated rat pituitary cells and collection by LCM (Immuno-LCM) to obtain highly purified populations of FS cells. Analysis of GH, PRL, and POMC expression by RT-PCR analysis showed that the collected FS cells were not contaminated with these other cell types, indicating a highly purified cell population.

The rat FS cells were compared with a stable mouse pituitary-derived FS cell (TtT/GF). RT-PCR analyses showed that both cells from primary culture and the cell lines expressed similar mRNA transcripts, including S100 protein, GFAP, TGFß1, IL-6, leptin, and leptin receptor. PACAP-38 was not detected in the TtT/GF cell line, but this was probably related to the rat primers used to detect PACAP-38. The rat PACAP sequence showed 93% homology with mouse PACAP (GenBank accession no. D14716). However, both rat FS cells and TtT/GF cells expressed PACAP receptor I. This latter finding is in agreement with a previous study showing that the TtT/GF cells responded to PACAP-27 and PACAP-38 treatment by increasing cAMP levels (31).

Our study also showed that TGFß1, but not PACAP-38, stimulated the proliferation of both primary culture of FS cells and the TtT/GF cell line. Although previous studies with the TtT/GF cell line showed that PACAP-38 stimulated cell proliferation (31), we did not see this effect in the present study. Possible reasons for these differences may be related to the specific cell passage, as the earlier experiments (31) were performed with these cells more than 8 yr ago. Differences in cell culture conditions may also account for the observed differences. Ham’s F-12 and bicarbonate were not used in the current studies, but were used by Matsumoto et al. (31).

This study shows that leptin was expressed by rat FS cells and the TtT/GF cell line, a finding that was recently reported in a study of human FS cells (24). The stimulation of FS cell proliferation by TGFß1 was unexpected. Earlier studies from our laboratory (39) and others (45) showed that TGFß1 inhibited the growth of anterior pituitary cells. In our earlier study 10-9 M TGFß1 inhibited whereas 1 x 10-13 M TGFß1 stimulated PRL cell proliferation, so the effect was concentration dependent (39). Interestingly, TGFß1 stimulated leptin expression in normal rat pituitary FS cells while inhibiting leptin expression in the TtT/GF cell line. Because hormone-producing anterior pituitary cells express leptin receptor (24), the production of leptin by FS cells may exert a paracrine effect on these cells in the anterior pituitary.

The significance of the down-regulation of leptin mRNA in the TtT/GF cell line, which is the opposite effect of that seen in the normal FS cell, was unexpected and may be due to genetic alterations in the genes controlling leptin signal transduction in this immortalized cell line. Further studies are needed to explore the mechanisms regulating these differences. TGFß1 signal transduction occurs by the SMAD protein pathway (46, 47). Some studies have shown that cells lacking SMAD-2 may escape from TGFß-mediated growth inhibition (48), so the types of SMAD proteins expressed by FS cells may provide clues to the mechanism of growth stimulation or inhibition by TGFß1. Our preliminary experiments have identified various SMAD proteins in the TtT/GF cell line, including SMAD-2 and SMAD-4 (unpublished data). However, further studies of the phosphorylation of SMAD proteins and the mechanisms regulating phosphorylation and dimerization may provide mechanistic insights into the roles of these proteins in FS cell signaling.

In summary, we have used combined immunophenotyping with S100 protein and LCM to prepare homogeneous populations of rat pituitary FS cells. Molecular analyses of rat FS cells and the mouse FS cell line TtT/GF have shown that TGFß1 stimulates proliferation in both types of FS cells. TGFß1 also stimulated leptin mRNA expression in FS cells, but inhibited leptin mRNA expression in the TtT/GF cell line, suggesting alterations in signal transduction mechanisms in the TtT/GF cell line. Because Immuno-LCM is a relatively rapid method to obtain pure populations of FS cells, this approach should stimulate many functional studies of this anterior pituitary cell type.


   Acknowledgments
 
We thank the National Hormone and Pituitary Program for the antibodies for pituitary hormones, and Dr. K. Inoue (Gunma University, Maebashi, Japan) for the TtT/GF cell line.


   Footnotes
 
1 This work was supported in part by NIH Grants CA-90249 and CA-37231. Back

Received August 29, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Farquhar MG 1957 "Corticotrophs" of the rat adenohypophysis as revealed by electron microscopy [Abstract]. Anat Rec 127:291
  2. Kagayama M 1965 The follicular cell in the pars distalis of the dog pituitary gland: an electron microscope study. Endocrinology 77:1053–1060[Abstract/Free Full Text]
  3. Horvath E, Kovacs K, Penz G, Ezrin C 1974 Origin, possible function and fate of "follicular cells" in the anterior lobe of the human pituitary. An electron microscopic study. Am J Pathol 77:199–212[Medline]
  4. Salazar H 1968 Ultrastructural evidence for the existence of a non-secretory, sustentacular cell in the human adenohypophysis. Anat Rec 160:419–420[CrossRef]
  5. Shiotani Y 1980 An electron microscopic study on stellate cells in the rabbit adenohypophysis under various endocrine conditions. Cell Tissue Res 213:237–246[Medline]
  6. Nakajima T, Yamaguchi H, Takahashi K 1980 S-100 acidic protein in folliculostellate cells of the rat pituitary anterior lobe. Brain Res 191:523–531[CrossRef][Medline]
  7. Cocchia D, Miani N 1980 Immunocytochemical localization of the brain-specific S-100 protein in the pituitary gland of adult rat. J Neurocytol 9:771–782[CrossRef][Medline]
  8. Shirasawa N, Kihara H, Yamaguchi S, Yoshimura F 1983 Pituitary folliculo-stellate cells immunostained with S-100 acidic protein antiserum in postnatal, castrated and thyroidectomized rats. Cell Tissue Res 231:235–249[Medline]
  9. Shirasawa N, Yamaguchi S, Yoshimura F 1984 Granulated folliculo-stellate cells and growth hormone cells immunostained with anti-S-100 protein serum in the pituitary glands of the goat. Cell Tissue Res 237:7–14[Medline]
  10. Lauriola L, Cocchia D, Sentinelli S, Maggiano N, Maira G, Michetti F 1984 Immunohistochemical detection of folliculo-stellate cells in human pituitary adenomas. Virchows Arch [B] 47:189–197
  11. Hofler H, Walter GF, Denk H 1984 Immunohistochemistry of folliculo-stellate cells in normal human adenohypophyses and in pituitary adenomas. Acta Neuropathol 65:35–40[CrossRef][Medline]
  12. Girod C, Trouillas J, Dubois MP 1985 Immunocytochemical localization of S-100 acidic protein in stellate cells (folliculo-stellate cells) of the anterior lobe of the normal human pituitary. Cell Tissue Res 241:505–511[CrossRef][Medline]
  13. Lloyd RV, Mailloux J 1988 Analysis of S-100 protein positive folliculo-stellate cells in rat pituitary tissues. Am J Pathol 133:338–346[Abstract]
  14. Baes M, Allaerts W, Denef C 1987 Evidence for functional communication between folliculo-stellate cells and hormone-secreting cells in perifused anterior pituitary cell aggregates. Endocrinology 120:685–691[Abstract/Free Full Text]
  15. Allaerts W, Carmeliet P, Denef C 1990 New perspectives in the function of pituitary folliculo-stellate cells. Mol Cell Endocrinol 71:73–81[CrossRef][Medline]
  16. Marin F, Stefaneanu L, Kovacs K 1991 Folliculo-stellate cells of the pituitary. Endocr Pathol 2:180–192
  17. Ferrara N, Henzel WJ 1989 Pituitary follicular cells secrete a novel heparin-binding growth factor specific for vascular endothelial cells. Biochem Biophys Res Commun 161:851–858[CrossRef][Medline]
  18. Ferrara N, Schweigerer L, Neufeld G, Mitchell R, Gospodarowicz D 1987 Pituitary follicular cells produce basic fibroblast growth factor. Proc Natl Acad Sci USA 84:5773–5777[Abstract/Free Full Text]
  19. Vankelecom H, Matthys P, Van Damme J, Heremans H, Billiau A, Denef C 1993 Immunocytochemical evidence that S-100-positive cells of the mouse anterior pituitary contain interleukin-6 immunoreactivity. J Histochem Cytochem 41:151–156[Abstract]
  20. Kaiser UB, Lee BL, Carroll RS, Unabia G, Chin WW, Childs GV 1992 Follistatin gene expression in the pituitary: localization in gonadotropes and folliculostellate cells in diestrous rats. Endocrinology 130:3048–3056[Abstract/Free Full Text]
  21. Ferrara N, Winer J, Henzel WJ 1992 Pituitary follicular cells secrete an inhibitor of aortic endothelial cell growth: identification as leukemia inhibitory factor. Proc Natl Acad Sci USA 89:698–702[Abstract/Free Full Text]
  22. Ceccatelli S, Hulting AL, Zhang X, Gustafsson L, Villar M, Hokfelt T 1993 Nitric oxide synthase in the rat anterior pituitary gland and the role of nitric oxide in regulation of luteinizing hormone secretion. Proc Natl Acad Sci USA 90:11292–11296[Abstract/Free Full Text]
  23. Lloyd RV, Jin L, Qian X, Zhang S, Scheithauer BW 1995 Nitric oxide synthase in the human pituitary gland. Am J Pathol 146:86–94[Abstract]
  24. Jin L, Burguera BG, Couce ME, Scheithauer BW, Lamsan J, Eberhardt NL, Kulig E, Lloyd RV 1999 Leptin and leptin receptor in normal and neoplastic human pituitary: evidence of a regulatory role for leptin on pituitary cell proliferation. J Clin Endocrinol Metab 84:2903–2911[Abstract/Free Full Text]
  25. Denef C, Hautekeete E, De Wolf A, Vanderschueren B 1978 Pituitary basophils from immature male and female rats: distribution of gonadotrophs and thyrotrophs as studied by unit gravity sedimentation. Endocrinology 103:724–735[Abstract/Free Full Text]
  26. Baes M, Allaerts W, Denef C 1987 Evidence for functional communication between folliculo-stellate cells and hormone-secreting cells in perifused anterior pituitary cell aggregates. Endocrinology 120:685–691
  27. Denef C, Maertens P, Allaerts W, Mignon A, Robberecht W, Swennen L, Carmeliet P 1989 Cell-to-cell communication in peptide target cells of anterior pituitary. Methods Enzymol 168:47–71[Medline]
  28. Qian X, Jin L, Lloyd RV 1998 Percoll density gradient-enriched populations of rat pituitary cells: interleukin 6 secretion, proliferative activity and nitric oxide synthase expression. Endocr Pathol 9:339–346
  29. Ishikawa H, Nogami H, Shirasawa N 1983 Novel clonal strains from adult rat anterior pituitary producing S-100 protein. Nature 303:711–713[CrossRef][Medline]
  30. Inoue K, Matsumoto H, Koyama C, Shibata K, Nakazato Y, Ito A 1992 Establishment of a folliculo-stellate-like cell line from a murine thyrotropic pituitary tumor. Endocrinology 131:3110–3116[Abstract/Free Full Text]
  31. Matsumoto H, Koyama C, Sawada T, Koike K, Hirota K, Miyake A, Arimura A, Inoue K 1993 Pituitary folliculo-stellate-like cell line (TtT/GF) responds to novel hypophysiotropic peptide (pituitary adenylate cyclase-activating peptide) showing increased adenosine 3',5'-monophosphate and interleukin-6 secretion and cell proliferation. Endocrinology 133:2150–2155[Abstract/Free Full Text]
  32. Yamasaki T, Fujita H, Inoue K, Fujita T, Yamashita N 1997 Regulation of K+ channels by cell contact in a cloned folliculo-stellate cell (TtT/GF). Endocrinology 138:4346–4350[Abstract/Free Full Text]
  33. Emmert-Buck MR, Bonner RF, Smith PD, Chuaqui RF, Zhuang Z, Goldstein SR, Weiss RA, Liotta LA 1996 Laser capture microdissection. Science 274:998–1001[Abstract/Free Full Text]
  34. Bonner RF, Emmert-Buck MR, Cole K, et al 1997 Laser capture microdissection. Molecular analysis of tissue. Science 278:1481–1483[Free Full Text]
  35. Schutze K, Lahr G 1998 Identification of expressed genes by laser-mediated manipulation of single cells. Nat Biotech 16:737–742[CrossRef][Medline]
  36. Jin L, Thompson CA, Qian X, Kuecker SJ, Kulig E, Lloyd RV 1999 Analysis of anterior pituitary hormone mRNA expression in immunophenotypically characterized single cells after laser capture microdissection. Lab Invest 79:511–512[Medline]
  37. Kuecker SJ, Jin L, Kulig E, Oudraogo GL, Roche PC, Lloyd RV 1999 Analysis of PRL, PRL-R, TGFB1 and TGFB1-RII gene expression in normal and neoplastic breast tissue after laser capture microdissection. Appl Immunohistochem Mol Morphol 7:192–200
  38. Fend F, Emmert-Buck MR, Chuaqui R, Cole K, Lee J, Liotta LA, Raffeld M 1998 Immuno-LCM: laser capture microdissection of immunostained frozen sections for mRNA analysis. Am J Pathol 154:61–66[Abstract/Free Full Text]
  39. Qian X, Jin L, Grande JP, Lloyd RV 1996 Transforming growth factor-ß and p27 expression in pituitary cells. Endocrinology 137:3051–3060[Abstract]
  40. Spengler D, Waeber C, Pantaloni C, Holsboer F, Bockaert J, Seeburg PH, Journot L 1993 Differential signal transduction by five splice variants of the PACAP receptor. Nature 365:170–175[CrossRef][Medline]
  41. Jin L, Zhang S, Burguera BG, Couce ME, Osamura RY, Kulig E, Lloyd RV 2000 Leptin and leptin receptor expression in rat and mouse pituitary cells. Endocrinology 141:333–339[Abstract/Free Full Text]
  42. Qian X, Jin L, Lloyd RV 1996 Expression and regulation of transforming growth factor B-1 in cultured normal and neoplastic rat pituitary cells. Endocr Pathol 7:77–90[Medline]
  43. Jin L, Qian X, Lloyd RV 1995 Comparison of mRNA expression detected by in situ PCR and in situ hybridization in endocrine cells. Cell Vision 2:314–321
  44. Jin L, Kulig E, Qian X, Scheithauer BW, Eberhardt NL, Lloyd RV 1998 A human pituitary adenoma cell line proliferates and maintains some differentiated functions following expression of SV40 large T antigen. Endocr Pathol 9:169–184
  45. Ramsdell JS 1991 Transforming growth factor-{alpha} and -ß are potent and effective inhibitors of GH4 pituitary tumor cell proliferation. Endocrinology 128:1981–1990[Abstract/Free Full Text]
  46. Heldin CH, Miyazono K, ten Dijke P 1997 TGF-ß signaling from cell membrane to nucleus through SMAD proteins. Nature 390:465–471[CrossRef][Medline]
  47. Massague J, Hata A, Liu F 1997 TGF-ß signaling through the SMAD pathway. Trends Cell Biol 7:187–192
  48. Nakao A, Roijer E, Imamura T, Souchelnytskyi S, Stenman G, Heldin CH, ten Dijke P 1997 Identification of Smad2, a human Mad-related protein in the transforming growth factor beta signaling pathway. J Biol Chem 272:2896–2900[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
J. P. Moore Jr., B. C. Villafuerte, C. A. Unick, and S. J. Winters
Developmental Changes in Pituitary Adenylate Cyclase Activating Polypeptide Expression during the Perinatal Period: Possible Role in Fetal Gonadotroph Regulation
Endocrinology, October 1, 2009; 150(10): 4802 - 4809.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
C. M. Grafer, R. Thomas, L. Lambrakos, I. Montoya, S. White, and L. M. Halvorson
GnRH Stimulates Expression of PACAP in the Pituitary Gonadotropes via Both the PKA and PKC Signaling Systems
Mol. Endocrinol., July 1, 2009; 23(7): 1022 - 1032.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. Oomizu, K. Chaturvedi, and D. K. Sarkar
Folliculostellate Cells Determine the Susceptibility of Lactotropes to Estradiol's Mitogenic Action
Endocrinology, March 1, 2004; 145(3): 1473 - 1480.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
G. Vlotides, K. Zitzmann, S. Hengge, D. Engelhardt, G. K. Stalla, and C. J. Auernhammer
Expression of Novel Neurotrophin-1/B-Cell Stimulating Factor-3 (NNT-1/BSF-3) in Murine Pituitary Folliculostellate TtT/GF Cells: Pituitary Adenylate Cyclase-Activating Polypeptide and Vasoactive Intestinal Peptide-Induced Stimulation of NNT-1/BSF-3 Is Mediated by Protein Kinase A, Protein Kinase C, and Extracellular-Signal-Regulated Kinase1/2 Pathways
Endocrinology, February 1, 2004; 145(2): 716 - 727.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
H. E. Turner, A. L. Harris, S. Melmed, and J. A. H. Wass
Angiogenesis in Endocrine Tumors
Endocr. Rev., October 1, 2003; 24(5): 600 - 632.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
L. P. Chapman, M. J. Epton, J. C. Buckingham, J. F. Morris, and H. C. Christian
Evidence for a Role of the Adenosine 5'-Triphosphate-Binding Cassette Transporter A1 in the Externalization of Annexin I from Pituitary Folliculo-Stellate Cells
Endocrinology, March 1, 2003; 144(3): 1062 - 1073.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
L. M. Bilezikjian, A. M. O. Leal, A. L. Blount, A. Z. Corrigan, A. V. Turnbull, and W. W. Vale
Rat Anterior Pituitary Folliculostellate Cells Are Targets of Interleukin-1{beta} and a Major Source of Intrapituitary Follistatin
Endocrinology, February 1, 2003; 144(2): 732 - 740.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
L. Chapman, A. Nishimura, J. C. Buckingham, J. F. Morris, and H. C. Christian
Externalization of Annexin I from A Folliculo-Stellate-Like Cell Line
Endocrinology, November 1, 2002; 143(11): 4330 - 4338.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
U. Renner, P. Lohrer, L. Schaaf, M. Feirer, K. Schmitt, C. Onofri, E. Arzt, and G. K. Stalla
Transforming Growth Factor-{beta} Stimulates Vascular Endothelial Growth Factor Production by Folliculostellate Pituitary Cells
Endocrinology, October 1, 2002; 143(10): 3759 - 3765.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
R. V. Lloyd, K. H. Ruebel, S. Zhang, and L. Jin
Pituitary Hyperplasia in Glycoprotein Hormone Alpha Subunit-, p18INK4C-, and p27kip-1-Null Mice : Analysis of Proteins Influencing p27kip-1 Ubiquitin Degradation
Am. J. Pathol., March 1, 2002; 160(3): 1171 - 1179.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. Baratta, R. Saleri, G. L. Mainardi, D. Valle, A. Giustina, and C. Tamanini
Leptin Regulates GH Gene Expression and Secretion and Nitric Oxide Production in Pig Pituitary Cells
Endocrinology, February 1, 2002; 143(2): 551 - 557.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jin, L.
Right arrow Articles by Lloyd, R. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jin, L.
Right arrow Articles by Lloyd, R. V.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals