| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Diabetes Section, Gerontology Research Center, National Institute on Aging, NIH, Baltimore, Maryland 21224
Address all correspondence and requests for reprints to: Josephine M. Egan, M.D., Diabetes Section, #23, NIA/NIH, 5600 Nathan Shock Drive, Baltimore, Maryland 21224. E-mail: eganj{at}vax.grc.nia.nih.gov
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Recent evidence indicates that some GLP-1-related events in ß-cells are not necessarily mediated through PKA (7, 8). GLP-1 can elevate cytosolic calcium and stimulate insulin promoter activity independent of the PKA pathway. GLP-1 also leads to increases in tyrosine phosphorylation of SNAP-25, a synaptic associated protein which is not PKA-mediated, because PKA phosphorylates serine/threonine residues only (9).
Pancreatic duodenal homeobox-1 protein (PDX-1, also called IDX-1, IPF1, STF1, and IUF1) is a transcription factor with essential functions for pancreas development, islet formation and maintenance of the ß-cell phenotype (10, 11). Absence of PDX-1 leads to pancreatic agenesis in rodents and humans (12, 13) and mutations in PDX-1 lead to MODY-type diabetes with reduced insulin secretion in humans (14, 15). In the adult pancreas, PDX-1 binds to A-box motifs of the insulin gene promoter and is involved in glucose-mediated up-regulation of the insulin gene (16). It is also involved in the transciptional regulation of the glucose sensing genes, GLUT2, and glucokinase (17). We and others (18, 19) have previously demonstrated that GLP-1 up-regulates PDX-1, both messenger RNA (mRNA) and protein levels, as well as its translocation to nuclei in an insulinoma cell line and this is concurrent with increased binding activity of PDX-1 protein to the rat insulin gene promoter (18). Glucose treatment results in PDX-1 translocation between 1530 min with a return to basal levels by 2 h (16, 18). No increase in total PDX-1 protein levels has been seen with glucose treatment alone. GLP-1-mediated translocation reaches a maximum at 2 h (18, 19), total PDX-1 protein levels are significantly increased by 3 h and the amount of nuclear PDX-1 is still elevated 12 h after the addition of GLP-1 (18).
Recent studies indicate that GLP-1, as well as increasing intracellular cAMP levels, activates phosphatidylinositol 3-kinase and mitogen activated protein (MAP) kinase in cultured INS-1 (19) and CHO cells (20). Here we concentrated on examining specifically whether GLP-1-mediated effects on PDX-1 are cAMP/PKA dependent. We have used inhibitors and stimulators of PKA activation and cAMP agonists to examine the involvement of PKA in the up-regulation of transcription, translation and translocation of the PDX-1 gene in RIN 104638 cells following acute treatment with GLP-1.
| Materials and Methods |
|---|
|
|
|---|
Cell culture and treatment
RIN 104638 cells (Passage1525) were cultured in a 5%
CO2/95% air incubator at 37 C in medium M199
containing 6 mM glucose and supplemented with 5% FBS,
0.03% (wt/vol) glutamine, 50 U/ml penicillin, and 50 µg/ml
streptomycin. When grown to 7080% confluency in 6- or 12-well plates
or 35 or 60 mm3 dishes and before any
experiments, cells were washed twice with PBS and once with
glucose-free buffer containing 130 mM NaCl, 5
mM KCl, 1 mM sodium phosphate,1 mM
MgSO4, 2 mM
CaCl2, 20 mM HEPES buffer (pH 7.4),
and 0.1% BSA (RIA grade, Sigma).
Static insulin secretion
RIN 104638 cells were cultured in 12-well plates. Cells were
preincubated for 2 periods of 30 min in the glucose-free buffer in a 37
C humidified air incubator. After the second 30-min period the
inhibitors and cAMP analogs were added for 20 min before the subsequent
addition of glucose (6 mM final concentration) and
GLP-1 (50 or 10 nM, as indicated in Fig. 1
) for a further 1 h period. At the
end of the experiment, the buffer was collected, centrifuged to remove
cellular debris and saved at -80 C, for quantification of insulin by
RIA as before (21). The cells were lysed with 0.5 ml
formic acid and saved at -20 C for analysis of protein by the Bradford
method (Bio-Rad Laboratories, Inc. Richmond, CA).
|
Transient transfections and treatment
RIN 104638 cells cultured in 6-well plates were transfected
(18) with the PDX-1.c-myc plasmid (2 µg)
(22) using LIPOFECTAMINE Plus reagent (Life Technologies, Inc., Gaithersburg, MD) according to the
manufacturers instructions. After 6872 h, the transfected cells
were treated as outlined above under Cell culture and
treatment. We examined the effects of various treatment regimens
on the translocation of both the endogenous and transfected PDX-1.
Using both PDX-1 and c-myc antibodies we could confirm and
more accurately quantify our findings.
Western blot analysis
Whole cell protein was extracted by the addition of lysis buffer
(20 mM HEPES, pH 7.9, 20% glycerol, 0.4 M
NaCl, 1 mM EDTA, 2.5 mM DTT, 1 mM
PMSF, 10 µg/ml aprotinin, and 1% Triton X-100 (vol/vol). Nuclear
extracts were obtained using the mini-extract method (23).
All proteins were separated by SDS polyacrylamide gel (10%),
electrophoresis and transferred to polyvinylidene difluoride membranes.
Immunoblots of whole cell extracts were probed with rabbit antimouse
PDX-1 antibody. The immunoblots of nuclear extracts from transfected
cells were probed with anti-PDX-1 and anti-c-myc antibodies.
Blots were developed using horseradish peroxidase-conjugated secondary
antibodies and the ECL detection system (Amersham Pharmacia Biotech, Arlington Heights, IL). The images were quantified by
ImageQuant (Molecular Dynamics, Inc., Sunnyvale, CA).
Northern blot analysis
Total RNA was isolated from the cells using the TRIzol Reagent
(Life Technologies, Inc., Gaithersburg, MD) protocol
(24), 10 µg of total RNA was separated on 1%
agarose/formaldehyde gels and transferred to nylon membranes.
Hybridization was carried out with the
a32P-labeled-PDX-1 probe (18). An
18S oligonucleotide probe was used for normalization as we have shown
this be the best method of normalization in RIN cells under conditions
of glucose and GLP-1 stimulation (25). The images were
quantified by ImageQuant.
Electrophoretic mobility shift assays
This was carried out as we outlined before (18).
Briefly, double-stranded oligodeoxynucleotide probes to the rat
insulin-I A1 element (-89 to -69, AGAGCCCTTAATGGGCCAAA) were
end-labeled with (a32P) dATP and
Escherichia coli Klenow DNA polymerase I. Five micrograms of
nuclear extracts were incubated with labeled double-stranded
oligodeoxynucleotide probes and 1 ng of polydeoxyinosine
deoxycytidylic acid for 20 min at room temperature in 20 µl of
binding buffer (20 mM KCl, 1.25 mM
MgCl2,10 mM Tris-HCl, 5% glycerol).
Samples were separated on a 6% nondenaturing polyacrylamide gel using
0.5x Tris buffered saline (TBS) as running buffer. The images were
quantified by ImageQuant.
Statistical methods
Values are expressed as mean ± SEM.
Significance of the differences from the densitometric data of the
western and Northern blots between groups was determined by one-way
ANOVA. P < 0.05 was taken as significant.
| Results |
|---|
|
|
|---|
GLP-1 (50 nM) -stimulated cAMP levels increased 1.7-fold (4.17 ±0.27 vs. 2.43 ± 0.23 pmol/µg protein; n = 3, mean ± SE, P < 0.05) above basal levels. Maximum cAMP levels were achieved after 20 min treatment. Addition of H-89 (10 µM), KT 5720 (100 nM) and PKI-(1422)-amide (20 µM) did not alter GLP-1-induced cAMP levels.
Effect of PKA inhibitors and cAMP on PDX-1 translocation
GLP-1-mediated insulin secretion in our RIN 104638
cells is maximum at 10 nM (Fig. 1
, A and B, and Ref.
25). To ensure we were always at maximum stimulatory
concentrations of GLP-1 we used the higher concentration
(50 nM) in the following experiments. We also
individualized the concentrations of the inhibitors of PKA activation
to those concentrations which caused maximal inhibition of
GLP-1-mediated insulin secretion. Maximal translocation of
PDX-1 by GLP-1 is seen at 2 h (18).
Figure 2
, A and C, shows Western blot
analysis of nuclear extracts from RIN cells transfected with the
PDX-1.c-myc plasmid and treated with various agents for the
times shown in the presence or absence of H-89 and PKI-(1422)-amide,
respectively. The top blot (Fig. 2A
) was probed with c-myc
antibody (giving one band) and the middle blot probed with PDX-1
antibody (which resulted in two bands-the endogenous PDX-1 with a
molecular mass of 43 kDa and the transfected PDX-1.c-myc
with a mass of 46 kDa). H-89 (10 µm) and
PKI-(1422)-amide (20 µm) concentrations that maximally inhibited
GLP-1-mediated insulin secretion, prevented
GLP-1-mediated PDX-1 translocation of the endogenous and
transfected PDX-1 to the nuclei at the 2 h time point. Rp-cAMPS
and KT5720 did likewise (data not shown) when used at the
concentrations that caused maximal inhibition of
GLP-1-mediated insulin secretion. PKI-(1422)-amide,
which has previously been shown to inhibit GLP-1 mediated
insulin secretion and PKA activation in ß-cells (27, 28), also prevented GLP-1-mediated translocation of
PDX-1 (Fig. 2C
). Forskolin treatment resulted in PDX-1 translocation
which was prevented by H-89 (Fig. 2
, A and B), Rp-cAMPS, KT5720 and
PKI-(1422)-amide (data not shown). Similar data were obtained with
8Br-cAMP: it induced translocation of PDX-1, which was prevented by
H-89 and PKI-(1422)-amide (Fig. 2
, AC).
|
Effects of PKA inhibitors, glucose and cAMP on PDX-1 protein
levels
Treatment of RIN cells with GLP-1 for 2 or more hours
results in increased total cellular PDX-1 (Ref. 18 and
Fig. 3
, AC, P < 0.05).
PDX-1 protein levels reach maximum levels at 3 h
(18). This was prevented by concurrent incubation with
H-89 (Fig. 3
, A and B) or PKI-(1422)-amide (Fig. 3C
). 8Br-cAMP
produced similar effects to GLP-1 and its effects were
also prevented by both H-89 (Fig. 3B
) and PKI-(1422)-amide (Fig. 3C
).
The presence of 6 mM glucose in the buffer for 0.5 h
or 3 h did not increase total PDX-1 protein (Fig. 3
, A and B).
|
|
|
|
| Discussion |
|---|
|
|
|---|
PKA inhibitors did not influence glucose-mediated PDX-1 nuclear translocation and glucose-mediated translocation still occurred when glucose was added to the cells in conjunction with the inhibitors and GLP-1, demonstrating that there are two separate pathways for the action of glucose and GLP-1. Glucose causes PDX-1 translocation as early as 1530 min after treatment (16, 18). It has already been demonstrated that glucose regulates PDX-1 nuclear translocation and insulin gene promoter activity via pathways that were shown to be wortmannin-LY 294002 (PI 3-kinase inhibitors) sensitive and not cAMP sensitive (16, 30, 31). More recently it was confirmed in MIN 6 cells that the glucose-mediated translocation process requires PI 3-kinase activation (32). We show conclusively in RIN 104638 cells that glucose-mediated PDX-1 translocation does not require PKA activation. The electromobility shift assays reflect the fact the PKA inhibitors prevented translocation by GLP-1: therefore, there was reduced PDX-1 available for binding to the A1 site of the insulin promoter. However, PKA inhibitors did not prevent glucose-mediated translocation: hence in that situation PDX-1 was available in the nucleus for binding.
In conjunction with PDX-1 translocation, total PDX-1 protein levels were increased by GLP-1, forskolin, and 8-Bromo-cAMP. No such increase was seen when PKA inhibitors are present with the aforementioned compounds. PDX-1 protein levels were not influenced by glucose treatment alone and PKA inhibitors did not influence basal levels of the protein. GLP-1 also increased mRNA levels of PDX-1, which again is prevented by PKA inhibitors.
It would appear that GLP-1 increases total PDX-1 levels by two mechanisms. It increases PDX-1 mRNA levels that must lead to its translation to protein, as DRB, a transcription inhibitor, prevented any rise in PDX-1 protein levels by GLP-1. When cycloheximide, a protein synthesis inhibitor, was added to the cells while they were being treated with GLP-1, protein levels of PDX-1 were still increased, compared with basal, which must mean GLP-1 stabilizes preexist PDX-1. Therefore, GLP-1 increases PDX-1 trancription and stabilizes the protein.
Unlike published data from MacFarlane and colleagues (16), but similar to Rafiq et al. (32), we could not see a conversion of PDX-1 from a 31-kDa unphosphorylated form to a 46-kDa phosphorylated form upon glucose stimulation. Phosphorylation of PDX-1 has been proposed to be involved in PDX-1 nuclear translocation. We see no such shift in the molecular mass of either the endogenous or overexpressed PDX-1.c-myc. We only see the bigger form using either N- or C-terminal antibodies to PDX-1, which is also the same form present in the nuclear extracts. Even cells which had been in a glucose-free buffer for 2 or more hours still had only the high molecular mass form present. Different responses must reside in differences between cell types.
In summary, GLP-1 effects on PDX-1 translocation and protein levels in RIN cells are a PKA-dependent phenomena. In contrast, glucose-mediated PDX-1 translocation is not PKA-mediated and indeed is on-going even as the GLP-1-mediated translocation is prevented by PKA inhibitors. These divergent effects are probably associated with independent functional roles and may be of importance in diabetes. We have shown in obese diabetic db/db mice, as well as in nondiabetic mice, that GLP-1 regulates expression of PDX-1 (33). More recently, in the pancreata of old glucose intolerant Wistar rats we showed up-regulation of both PDX-1 protein and mRNA by GLP-1 (34). In type 2 diabetes, it is possible that glucose-mediated PDX-1 translocation is resistant to glucose, as is insulin secretion, whereas GLP-1 may still influence PDX-1 regulation as it does secretion, similar to what has been demonstrated in animal models.
Received August 3, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
W. Kim and J. M. Egan The Role of Incretins in Glucose Homeostasis and Diabetes Treatment Pharmacol. Rev., December 1, 2008; 60(4): 470 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sonoda, T. Imamura, T. Yoshizaki, J. L. Babendure, J.-C. Lu, and J. M. Olefsky {beta}-Arrestin-1 mediates glucagon-like peptide-1 signaling to insulin secretion in cultured pancreatic {beta} cells PNAS, May 6, 2008; 105(18): 6614 - 6619. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Salehi, B. A. Aulinger, and D. A. D'Alessio Targeting {beta}-Cell Mass in Type 2 Diabetes: Promise and Limitations of New Drugs Based on Incretins Endocr. Rev., May 1, 2008; 29(3): 367 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Winzell and B. Ahren Durable islet effects on insulin secretion and protein kinase A expression following exendin-4 treatment of high-fat diet-fed mice J. Mol. Endocrinol., February 1, 2008; 40(2): 93 - 100. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Keller, S. McWeeney, A. Arsenlis, J. Drouin, C. V. E. Wright, H. Wang, C. B. Wollheim, P. White, K. H. Kaestner, and R. H. Goodman Characterization of Pancreatic Transcription Factor Pdx-1 Binding Sites Using Promoter Microarray and Serial Analysis of Chromatin Occupancy J. Biol. Chem., November 2, 2007; 282(44): 32084 - 32092. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. F. Dai, Y. Zhang, Y. Kang, Q. Wang, H. Y. Gaisano, K.-H. Braunewell, C. B. Chan, and M. B. Wheeler The Neuronal Ca2+ Sensor Protein Visinin-like Protein-1 Is Expressed in Pancreatic Islets and Regulates Insulin Secretion J. Biol. Chem., August 4, 2006; 281(31): 21942 - 21953. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Liu, W. Zhen, Z. Yang, J. D. Carter, H. Si, and K. A. Reynolds Genistein Acutely Stimulates Insulin Secretion in Pancreatic {beta}-Cells Through a cAMP-Dependent Protein Kinase Pathway. Diabetes, April 1, 2006; 55(4): 1043 - 1050. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. Gibson, M. C. Lawrence, C. J. Gibson, C. A. Vanderbilt, K. McGlynn, D. Arnette, W. Chen, J. Collins, B. Naziruddin, M. F. Levy, et al. Inhibition of Glucose-Stimulated Activation of Extracellular Signal-Regulated Protein Kinases 1 and 2 by Epinephrine in Pancreatic {beta}-Cells. Diabetes, April 1, 2006; 55(4): 1066 - 1073. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. K. Hagman, L. B. Hays, S. D. Parazzoli, and V. Poitout{paragraph} Palmitate Inhibits Insulin Gene Expression by Altering PDX-1 Nuclear Localization and Reducing MafA Expression in Isolated Rat Islets of Langerhans J. Biol. Chem., September 16, 2005; 280(37): 32413 - 32418. [Abstract] [Full Text] [PDF] |
||||
![]() |
G Uckaya, P Delagrange, A Chavanieu, G Grassy, M-F Berthault, A Ktorza, E Cerasi, G Leibowitz, and N Kaiser Improvement of metabolic state in an animal model of nutrition-dependent type 2 diabetes following treatment with S 23521, a new glucagon-like peptide 1 (GLP-1) analogue J. Endocrinol., March 1, 2005; 184(3): 505 - 513. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, X. Cao, L.-X. Li, P. L. Brubaker, H. Edlund, and D. J. Drucker {beta}-Cell Pdx1 Expression Is Essential for the Glucoregulatory, Proliferative, and Cytoprotective Actions of Glucagon-Like Peptide-1 Diabetes, February 1, 2005; 54(2): 482 - 491. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. G. Holz and O. G. Chepurny Diabetes Outfoxed by GLP-1? Sci. Signal., January 25, 2005; 2005(268): pe2 - pe2. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. D'Alessio and T. P. Vahl Glucagon-like peptide 1: evolution of an incretin into a treatment for diabetes Am J Physiol Endocrinol Metab, June 1, 2004; 286(6): E882 - E890. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Brubaker and D. J. Drucker Minireview: Glucagon-Like Peptides Regulate Cell Proliferation and Apoptosis in the Pancreas, Gut, and Central Nervous System Endocrinology, June 1, 2004; 145(6): 2653 - 2659. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Ferreira, H. C. L. Barbosa, L. F. Stoppiglia, V. Delghingaro-Augusto, E. A. Pereira, A. C. Boschero, and E. M. Carneiro Decreased Insulin Secretion in Islets from Rats Fed a Low Protein Diet Is Associated with a Reduced PKA{alpha} Expression J. Nutr., January 1, 2004; 134(1): 63 - 67. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kawamori, Y. Kajimoto, H. Kaneto, Y. Umayahara, Y. Fujitani, T. Miyatsuka, H. Watada, I. B. Leibiger, Y. Yamasaki, and M. Hori Oxidative Stress Induces Nucleo-Cytoplasmic Translocation of Pancreatic Transcription Factor PDX-1 Through Activation of c-Jun NH2-terminal Kinase Diabetes, December 1, 2003; 52(12): 2896 - 2904. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bulotta, R. Perfetti, H. Hui, and L. G. Boros GLP-1 stimulates glucose-derived de novo fatty acid synthesis and chain elongation during cell differentiation and insulin release J. Lipid Res., August 1, 2003; 44(8): 1559 - 1565. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kishi, T. Nakamura, Y. Nishio, H. Maegawa, and A. Kashiwagi Sumoylation of Pdx1 is associated with its nuclear localization and insulin gene activation Am J Physiol Endocrinol Metab, April 1, 2003; 284(4): E830 - E840. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Doyle and J. M. Egan Pharmacological Agents That Directly Modulate Insulin Secretion Pharmacol. Rev., March 1, 2003; 55(1): 105 - 131. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lechner and J. F. Habener Stem/progenitor cells derived from adult tissues: potential for the treatment of diabetes mellitus Am J Physiol Endocrinol Metab, February 1, 2003; 284(2): E259 - E266. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. X. Cawley, Y. M. Rodriguez, A. Maldonado, and Y. P. Loh Trafficking of Mutant Carboxypeptidase E to Secretory Granules in a {beta}-Cell Line Derived from Cpefat/Cpefat Mice Endocrinology, January 1, 2003; 144(1): 292 - 298. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. MacDonald, W. El-kholy, M. J. Riedel, A. M. F. Salapatek, P. E. Light, and M. B. Wheeler The Multiple Actions of GLP-1 on the Process of Glucose-Stimulated Insulin Secretion Diabetes, December 1, 2002; 51(90003): S434 - 442. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Hardikar, X. Y. Wang, L. J. Williams, J. Kwok, R. Wong, M. Yao, and B. E. Tuch Functional Maturation of Fetal Porcine {beta}-Cells by Glucagon-Like Peptide 1 and Cholecystokinin Endocrinology, September 1, 2002; 143(9): 3505 - 3514. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Demeterco, P. Itkin-Ansari, B. Tyrberg, L. P. Ford, R. A. Jarvis, and F. Levine c-Myc Controls Proliferation Versus Differentiation in Human Pancreatic Endocrine Cells J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3475 - 3485. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. G. Chepurny, M. A. Hussain, and G. G. Holz Exendin-4 as a Stimulator of Rat Insulin I Gene Promoter Activity via bZIP/CRE Interactions Sensitive to Serine/Threonine Protein Kinase Inhibitor Ro 31-8220 Endocrinology, June 1, 2002; 143(6): 2303 - 2313. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Lawrence, H. S. Bhatt, and R. A. Easom NFAT Regulates Insulin Gene Promoter Activity in Response to Synergistic Pathways Induced by Glucose and Glucagon-Like Peptide-1 Diabetes, March 1, 2002; 51(3): 691 - 698. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |