Endocrinology Vol. 142, No. 5 1975-1981
Copyright © 2001 by The Endocrine Society
Parathyroid Hormone Stimulates fra-2 Expression in Osteoblastic Cells in Vitro and in Vivo1
L. K. Mccauley,
A. J. Koh-Paige,
H. Chen,
C. Chen,
C. Ontiveros,
R. Irwin and
L. R. McCabe
Department of Periodontics/Prevention/Geriatrics (L.K.M., A.J.K.,
H.C., C.C.), University of Michigan, Ann Arbor, Michigan 48109-1078;
and Department of Physiology (C.O., R.I., L.R.M.), Michigan State
University, East Lansing, Michigan 48824-1101
Address all correspondence and requests for reprints to: Laurie K. McCauley, Department of Periodontics/Prevention/Geriatrics, University of Michigan, 1011 North University Avenue, Ann Arbor, Michigan 48109-1078. E-mail: mccauley{at}umich.edu
 |
Abstract
|
|---|
PTH and PTH-related protein (PTHrP) are key mediators of skeletal
development and homeostasis through their activation of the PTH-1
receptor. Previous studies have found that several AP-1 family members
are regulated by PTH, such as c-fos, fra-1,
and c-jun. There are numerous genes in the bone
microenvironment that contain AP-1 sites, and different Fos family
members are reported to have opposing transcriptional activities at
AP-1 sites. The purpose of this study was to identify the effects of
PTH on expression of the AP-1 protein complex member, fra-2,
to extend our understanding of transcriptional regulators of PTH
action. PTH induction of fra-2 messenger RNA (mRNA) levels
in MC3T3-E1 preosteoblastic cells was maximal with 0.1 µM
PTH (134). The expression in vitro was greatest 1
h after treatment and was present with N-terminal PTH but not PTH
(734) or (5384). Cycloheximide treatment induced fra-2
expression, and actinomycin D inhibited basal and PTHrP-induced
expression. AP-1 protein in nuclear extracts of MC3T3-E1 cells was
increased with PTH treatment at 3 h and consisted of high levels
of Fra-2 protein, as evidenced by a supershift in an electrophoretic
mobility shift assay and Western blot analysis. Up-regulation of
steady-state fra-2 mRNA was also noted in
vivo, where injection of PTH (134) (20 µg) resulted in a
more-than-7-fold maximal increase in fra-2 mRNA expression
in the calvaria of mice, after 1 h of treatment. These data add to
the transcriptional mediators induced by PTH and suggest that the
interplay of AP-1 family members will provide insight into regulatory
pathways of PTH and PTHrP for their anabolic and catabolic actions in
bone.
 |
Introduction
|
|---|
PTH IS THE major systemic
calcium-regulating hormone with well-documented anabolic and catabolic
effects in bone. PTH-related protein (PTHrP) is a regulator of
cartilage development, where it is thought to promote proliferation of
growth plate chondrocytes (1, 2). Although animal studies
of PTH and PTHrP action have provided insight into their actions in
skeletal tissues, the mechanisms of their effects are still unclear. A
better understanding of the downstream events in signaling of the PTH-1
receptor is necessary to clarify anabolic and catabolic actions in
bone.
The c-fos protooncogene is an immediate-early response gene
that undergoes rapid transcriptional activation by PTH
(3, 4, 5). When PTH is administered to rats in
vivo, messenger RNA (mRNA) for c-fos is detected in
PTH-1 receptor bearing cells within 1 h of administration
(6, 7). It is clear that c-fos plays a major
role in bone. Early in development, c-fos is expressed
primarily in the growth regions of developing cartilage and bone. Mice
with ablation of the c-fos gene develop osteopetrosis and
lack osteoclasts; and mice that overexpress c-fos develop
chondroblastic osteosarcomas (8, 9).
To date, seven proteins are included in the AP-1 family of
transcription factors (10). Before binding DNA, Fos
proteins (c-Fos, FosB, Fra-1, and Fra-2) form heterodimers with Jun
proteins (c-Jun, Jun B, and Jun D) through a leucine zipper motif
(11). AP-1 sites are located in the promoters of several
genes expressed by osteoblasts, including osteocalcin, interleukin-6,
and macrophage colony-stimulating factor (12, 13, 14).
Expression of Jun and Fos family members is modulated during osteoblast
proliferation and differentiation; and recently, these proteins have
been shown to be key mediators in the positive regulation of bone
formation (15, 16, 17). Nuclear proteins for all of the AP-1
family members are high during osteoblast proliferation. During
differentiation, levels decline, and Fra-2 and Jun D are the principal
proteins present (18). Modulation of Fra-2 expression by
overexpression or antisense oligonucleotide treatment suggests that
Fra-2 is an important factor involved in the development of the mature
osteoblast phenotype. Most studies have focused on the ability of PTH
to stimulate c-fos or c-jun gene expression, but
other AP-1 family members may also be regulated by PTH. PTH has also
been found to increase fra-1, fos B, and
jun-B (19), but there are no reports regarding
the effects of PTH on fra-2. The purpose of this study was
to evaluate the effects of PTH on fra-2 expression in bone
in vitro and in vivo.
 |
Materials and Methods
|
|---|
Cell culture
MC3T3-E1 cells were obtained from Dr. M. Kumegawa via Dr.
Renny Franceschi (University of Michigan, Ann Arbor, MI) and maintained
as described (20). Primary murine calvarial cells were
isolated via collagenase digestion as described, and the third digest
was used without passage (21). Cells were plated at
50,000/cm2 in
-modified Eagles medium with
10% FBS, 100 U/ml penicillin, and streptomycin and were induced to
differentiate (47 days) for maximal PTH-1 receptor expression
(21) with the addition of 50 µg/ml
L-ascorbic acid (Fisher Scientific, Itasca,
IL) and 10 mM ß-glycerophosphate (Sigma, St.
Louis, MO).
Gene expression studies in vitro
Total RNA was isolated from MC3T3-E1 or primary murine calvarial
cells treated with various doses of PTH (134) for 024 h. Northern
blot analyses were performed as described (4). Briefly,
total RNA was isolated by the guanidinium isothiocyanate method and
quantified by spectrophotometry. Total RNA (10 µg) was
electrophoresed on 1.2% agarose-formaldehyde gels, transferred to
nylon membranes (Duralon U.V.; Stratagene, La Jolla, CA),
and cross-linked with UV light. Nylon membranes were hybridized with a
complementary DNA probe for fra-2 (18) or
c-fos (4) labeled with
[
-32P] deoxycytidine triphosphate, using
random primer labeling (Amersham Pharmacia Biotech,
Piscataway, NJ). Blots were stripped and reprobed with a complementary
DNA for 18S ribosomal RNA (22) to control for RNA loading.
After hybridization and washing, radioactive cpm were quantified
using an Instant Imager (Packard Instrument Co., San Diego, CA). Blots
were also exposed to Biomax or X-OMAT film (Eastman Kodak Co., Rochester, NY) at -80 C for 2472 h, and band intensity
was determined by image analysis.
Gene expression studies in vivo
Mice were injected with 50 µl of 0.9% saline solution alone
(vehicle) or vehicle containing 20 µg PTH (134) sc over the
calvaria. Noninjected controls were also evaluated. Mice were killed at
the indicated time periods and calvaria were dissected, flash-frozen in
liquid N2, and processed using a mortar and
pestle for RNA isolation, as described (23). Northern blot
analysis was performed as above.
Electrophoretic mobility shift assay (EMSA)
Nuclear extracts were isolated from MC3T3-E1 cells stimulated
with PTH (134) (0.1 µM) or PTHrP (134) (0.1
µM) for 3 h, via hypotonic lysis, as described
(24). Protein concentrations were determined by the
Bradford assay (Pierce Chemical Co., Rockford, IL).
Nuclear extracts (2.5 µg) were incubated, for 20 min at 24 C, with
50,000 cpm 32P-end labeled
(T4-polynucleotide kinase; Amersham Pharmacia Biotech) AP-1 oligonucleotide (CGCTTGATGAGTCAGCCGGAA)
with or without an excess of unlabeled competitor oligonucleotide. For
supershift experiments, antibodies (4 µg) for Fra-2, Fra-1, Fos, FosB
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA), and
cAMP response element binding protein (CREB) (Rockland Immunochemicals, Gilbertsville, PA) were added to binding
reactions and incubated overnight on ice. The samples were loaded on
prerun (30 min; 150 V) 5% polyacrylamide gels and run for 3 h at
150V at 4 C. Gels were dried and exposed to films (410 h) at -80
C.
Western blot analysis
Nuclear extracts (30 µg/lane) were resolved by SDS-PAGE and
transferred onto polyvinylidene difluoride membrane
(Trans-blot transfer medium, Bio-Rad Laboratories, Inc., Hercules, CA). Membranes were blocked in 7% nonfat dried
milk in Tris-buffered saline (TBS) overnight at 4 C. After two washes
in TBS plus 0.05% Tween-20, membranes were incubated overnight at 4 C
in a 1:100 dilution of Fra-2 antibody (Santa Cruz Biotechnology, Inc.) in TBS plus 1% BSA. Membranes were washed four times in
TBS and incubated for 45 min with secondary antibody. After three
washes in TBS, blots were developed by chemiluminescent detection
according to protocols supplied by the manufacturer (ECL,
Amersham International, Aylesbury, UK).
 |
Results
|
|---|
PTH-induced fra-2 expression in vitro
PTH treatment (12 h) stimulated an increase in steady-state mRNA
for fra-2 in MC3T3-E1 osteoblastic cells and primary murine
calvarial cell cultures (Fig. 1
). Detectable
increases were noted at a dose of 10 pM and were
greater than 4-fold at 1 µM. The level of
c-fos mRNA, a known PTH-regulated transcription factor
(4), in the same cell cultures was also dose dependently
increased. Relative to fra-2 expression, PTH-induced
c-fos expression was an average of 2-fold higher at
concentrations greater than 100 pM. An
investigation of the time response of fra-2 mRNA expression
to PTH (134)-treatment indicated that gene expression was rapid, with
maximal increase at 1 h. (Fig. 2
).
The PTH-stimulated up-regulation in fra-2 mRNA gene
expression was found with PTH (134) but not with PTH (734) or PTH
(5384) (Fig. 3
). PTHrP (134)
stimulated fra-2 at equivalent doses as PTH and
forskolin-treatment also stimulated fra-2 expression (data
not shown).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 1. Northern blot analysis of dose effect of PTH
(1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 ) on steady-state fra-2 mRNA levels. Cells were
treated with 1.0 pM1.0 µM PTH or vehicle control. Total RNA
was isolated, and Northern blot analysis was performed to detect
fra-2 gene expression. A, Representative fra-2
blot from MC3T3-E1 cells treated for 1 h; B, plot of mean ±
SEM of cpm [fra-2, c-fos
relative to 18S, then expressed as treatment/control (T/C)] from three
experiments; C, representative blot from primary calvarial cells
treated with PTH (1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 ) (0.1 µM) for 2 h; D, plot
of mean ± SEM of cpm (fra-2, relative to
18S, then expressed as T/C) from primary calvarial cells isolated and
treated separately.
|
|

View larger version (45K):
[in this window]
[in a new window]
|
Figure 2. Northern blot analysis of temporal regulation
(024 h) for steady-state fra-2 mRNA levels induced by
PTH (1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 )(0.1 µM). MC3T3-E1 cells were treated for the
indicated time points, total RNA was isolated, and Northern blot
analysis was performed to detect fra-2 gene expression.
A, Representative fra-2 blot; B, plot of mean ±
SEM of cpm (fra-2, relative to 18S, then
expressed as T/C) from two experiments.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
Figure 3. Northern blot analysis of steady-state
fra-2 mRNA levels induced by PTH analogs (0.1
µM). MC3T3-E1 cells were treated with PTH analogs for
1 h, followed by total RNA isolation and Northern blot analysis
for fra-2 gene expression. A, Representative blot; B, plot
of mean ± SEM of cpm (fra-2, relative to
18S, then expressed as T/C) from three experiments.
|
|
To evaluate the molecular mechanisms of PTH-stimulated fra-2
induction, transcriptional and translational regulators were used. The
protein synthesis inhibitor, cycloheximide (CHX), was administered to
osteoblastic cultures, with or without PTHrP stimulation (Fig. 4A
). CHX alone led to an induction of
fra-2 mRNA typical of an immediate early response gene. CHX
in combination with PTHrP also resulted in high levels of
fra-2 expression, with a trend toward increased expression
vs. CHX alone. Actinomycin D pretreatment (1 h) of MC3T3-E1
cells resulted in an abrogation of PTHrP stimulation of
fra-2 mRNA after 3 h (Fig. 4
, B and C), suggesting that
the PTHrP effect is dependent on transcription.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 4. Northern blot analysis of steady-state
fra-2 mRNA levels from MC3T3-E1 cells treated with CHX (A)
or actinomycin D (B and C) and PTHrP. A, Plot of Northern blot analysis
of MC3T3-E1 cells treated with CHX (1 µg/ml), PTHrP (0.1
µM), or a combination of CHX and PTHrP. The mean ±
SEM of cpm (fra-2, relative to 18S, then
expressed as T/C) from three experiments is plotted. At 1 h,
PTHrP-treated cells had elevated fra-2 expression
vs. control and CHX (P < 0.05); and
at 3 h, all treatment groups were significantly elevated
vs. control (P < 0.01). B,
Representative plot of MC3T3-E1 cells pretreated with actinomycin D (1
µg/ml) then PTHrP (0.1 µM) for 3 h, followed by
total RNA isolation and Northern blot analysis for fra-2
gene expression. C, Plot of mean ± SEM of cpm
(fra-2, relative to 18S) from two experiments; actinomycin D
significantly reduced the PTHrP-stimulated fra-2 mRNA
(P < 0.001).
|
|
PTH-induced fra-2 expression in vivo
A single administration of PTH (20 µg) over the calvaria of mice
was effective in inducing an increase of more than 7-fold in
steady-state fra-2 mRNA expression in bone vs.
vehicle-injected or noninjected controls (Fig. 5
). The time response for
fra-2 induction in vivo is demonstrated in Fig. 6
. There was maximal expression of
steady-state fra-2 mRNA 1 h after injection; and by
8 h, levels returned to baseline values. The expression of
c-fos in these calvaria followed a pattern similar to that
of fra-2.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 5. Northern blot analysis of PTH regulation of
steady-state fra-2 mRNA levels in vivo. PTH
(20 µg) or vehicle only was injected sc over the calvaria. After
1 h, calvaria was dissected from PTH-treated, vehicle-treated, or
noninjected controls. Total RNA was isolated and Northern blot analysis
performed for fra-2. A, Representative blot; B, plot of
mean ± SEM of cpm (fra-2 x 100,
relative to 18S; n = 3/group).
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Figure 6. Northern blot analysis of temporal PTH regulation
of steady-state fra-2 and c-fos mRNA levels
in vivo. PTH (20µg) was injected sc over the calvaria.
After 0, 1, 3, 8, and 12 h, mice were killed, calvaria dissected,
and total RNA isolated. Northern blot to detect fra-2 and
c-fos gene expression was performed. A, Representative
blot; B, plot of mean ± SEM of cpm (fra-2
or c-fos relative to 18S; T/C; n = 5/group).
|
|
PTH induces AP-1 DNA binding activity and Fra-2 protein
To determine whether the PTH-induced fra-2 gene
expression resulted in an increase in AP-1 binding activity and
specifically an increase in nuclear fra-2 protein, EMSAs
were performed. Extracts from PTH- and PTHrP-treated MC3T3-E1 cells
were incubated with an oligonucleotide probe containing the consensus
AP-1 sequence. Figure 7
shows that PTH
and PTHrP treatment both resulted in a shift in the AP-1 binding that
was indicative of an increase in the nuclear accumulation of AP-1
protein. This shift was nearly abolished with the addition of 0.25 µg
unlabeled AP-1 oligonucleotide. A strong Fra-2 supershift was present
in both PTH- and PTHrP-treated cultures, supporting the finding of
Fra-2 protein in the nucleus 3 h after treatment. A detectable,
but much lighter, supershift was also present with an antibody to CREB.
At 8 h after PTHrP-treatment, AP-1 shift and supershifted nuclear
protein levels of Fra-2 were reduced, compared with 3 h, and were
similar to control levels (Fig. 7B
). In comparison with other Fos
family members (c-Fos, Fos B, and Fra-1), Fra-2 was the most highly
expressed 3 h after PTHrP treatment (Fig. 8
). Western blot analysis confirmed the
specific up-regulation of Fra-2, at the protein level, with PTH and
PTHrP treatment (Fig. 9
).

View larger version (65K):
[in this window]
[in a new window]
|
Figure 7. EMSA. Nuclear extracts from MC3T3-E1 cells
(PTH- or PTHrP-treated, 0.1 µM) incubated with
radiolabeled AP-1 consensus site, with or without unlabeled competitor
(comp; 10x, lane 11, or 25x, lane 12) and with or without Fra-2 or
CREB antibodies. A, HeLa extract (lanes 13) was run as a positive
control for AP-1, and probe without nuclear extracts as a negative
control (lane 4). PTH and PTHrP treatment (3 h) resulted in
increased AP-1 protein that was supershifted with Fra-2 antibody (lanes
9 and 14). B, MC3T3-E1 cell extract from untreated cells (lanes 1 and
4) or PTHrP treatment 0.1 µM for 3 h (lanes 2 and 5)
or 8 h (lanes 3 and 6), with or without Fra-2 antibody supershift
(lanes 46). Peak nuclear protein binding is detected at 3 h.
|
|

View larger version (74K):
[in this window]
[in a new window]
|
Figure 8. EMSA. Nuclear extracts from MC3T3-E1 cells (PTH-
or PTHrP-treated, 0.1 µM, 3 h) incubated with
radiolabeled AP-1 consensus site and with or without Fra-2, Fra-1, Fos
B, or c-Fos antibodies. The greatest supershift was found with the
Fra-2 antibodies.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
Figure 9. Western blot analysis of nuclear proteins isolated
from MC3T3-E1 cells treated with PTHrP (top) or PTH
(bottom) for 3 h. PTH and PTHrP increased Fra-2
proteins in nuclear extracts from osteoblastic cells.
|
|
 |
Discussion
|
|---|
AP-1 is one of the most widely studied transcription factors. The
AP-1 protein components are encoded by immediate-early genes, and AP-1
binding sites are found in numerous genes. Examples of genes containing
AP-1 sites that are important in bone are osteocalcin, type I collagen,
interleukin-6, M-CSF, and collagenase-3 (12, 13, 14, 25, 26).
Findings that PTH modulates members of the AP-1 family is likely to be
important for the biologic activities of PTH and PTHrP. It is well
known that PTH up-regulates c-fos; but, to our knowledge,
effects of PTH or PTHrP to stimulate fra-2 in bone have not
been well described.
The sequences of c-fos and fra-2 are very
similar, with highly conserved intron-exon structures
(27). The similarity of structure suggests that both
originated from a single ancestral gene. In concert with this, Fra-2
and Fos proteins are able to form heterodimers with Jun family members
(28, 29). Additionally, Fra-2 can support osteoclast
differentiation in place of c-Fos; although to a much lower extent than
c-Fos or Fra-1 (30). Evaluation of fra-2 during
development indicates that expression is high in bone but has a
different spatial distribution than c-fos. Specifically,
in situ hybridization for fra-2 revealed
expression in the bony and cartilaginous side of the growth plate and
not in the perichondrium during embryonic development, whereas
c-fos is expressed in the perichondrial growth region of the
cartilaginous skeleton (31). Functionally, other
differences have been noted in keratinocytes, where Fra-2:Jun B
heterodimers negatively regulate AP-1-mediated gene expression but
c-Fos:Jun B heterodimers activate AP-1 transcriptional activity
(32). In contrast, in osteoblasts, overexpression of
fra-2 and jun-D activates (while c-fos
and c-jun suppress) osteocalcin expression (18, 33). Because many genes expressed during both proliferation and
differentiation stages contain AP-1 target sequences, mechanisms for
both the induction and suppression of gene expression through AP-1
sites are likely to be operative in bone. This may also explain the
diversity of effects PTH has on genes active in the bone
microenvironment that contain AP-1 sites.
Interestingly, the studies reported here indicate differences of PTH
induction of fra-2, comparing in vitro and
in vivo experiments. A higher dose of PTH is required to
stimulate gene expression of fra-2 than c-fos
in vitro. Detectable and significant levels of
c-fos are induced with as little as 1.0
pM PTH (134) (4); whereas
increases in fra-2 seem to require a higher dose. However,
the in vivo studies resulted in similar levels of expression
of c-fos and fra-2 with PTH injection. Similarly,
the time course of PTH-mediated fra-2 expression in
vitro is different from that reported for c-fos or
c-jun (3, 4). The increase in fra-2
expression in vitro is maintained over a longer time period
than that of c-fos or c-jun. The significance of
this duration effect is unclear, but it suggests that AP-1 family
members likely have distinct roles in response to extracellular signals
in the bone microenvironment. Given the reported negative influence of
Fra-2 and Jun D on collagenase expression (34), Fra-2
could be involved in a negative feedback response to PTH effects. Other
in vitro studies, comparing c-fos and
fra-2 expression in fibroblasts, noted that both were
induced by phorbol ester but that fra-2 transcripts were
delayed, relative to c-fos (35). The delayed
expression of fra-2 may be explained by findings that
c-fos is responsible, in part, for the up-regulation of
fra-2 because of AP-1 sites in the fra-2 promoter
(36). Data are sparse regarding the induction of
fra-2 in vivo, especially relative to its
induction by PTH in bone.
The translation of PTH-induced fra-2 mRNA into protein was
evidenced by Western blot analysis and gel shift analysis, which
demonstrated increased AP-1 consensus site binding of nuclear extracts
from PTH-treated cells vs. vehicle-treated cells. The Fra-2
protein comprised a large portion of the AP-1 shifted band, as
evidenced by the strong supershift with a Fra-2 antibody. This suggests
that Fra-2 could play a major role in PTH effects in osteoblasts.
Similar to previous reports, a CREB antibody was also capable of
supershifting the PTH-induced AP-1 shift (37); although
this was minimal, compared with the Fra-2 response. CREB has been
reported to interact at AP-1 sites and repress AP-1 transcriptional
activity (32, 38).
During osteoblast differentiation, Fra-2 and Jun D are the most
abundant AP-1 family members, and inhibition of fra-2 with
antisense oligonucleotides results in a suppression of osteoblast
differentiation (18). This suggests that PTH may act on
osteoblasts to promote differentiation through stimulation of
fra-2. However, because we and others have previously
reported that PTH inhibits osteoblast differentiation in
vitro (39, 40), coinduction of other AP-1 family
members such as fra-1 or c-jun, or unrelated
transcription factors, may be responsible for counteracting this effect
of fra-2. Recent evidence indicates that PTH regulates the
collagenase-3 promoter via the interaction of the AP-1 site and the
runt binding domain site in UMR 10601 cells (37).
Overexpression of c-fos, c-jun,
osteoblast-specific factor-2, and core binding factor-ß increased the
response to PTH in UMR 10601 cells; whereas overexpression of Fra-2
and Jun D decreased basal and PTH-induced collagenase-3 activity in
primary osteoblasts (34). Although little information is
available regarding the induction of fra-2 by PTH in this
model, our data similarly support findings that other AP-1 family
members, such as fra-2, may be responsible for PTH effects
on downstream target genes.
The identification of fra-2 up-regulation, both in
vitro and in vivo, is a valuable addition to the
repertoire of transcriptional mediators induced by PTH. Furthermore,
these data indicate that complex changes in AP-1 member binding to DNA
is likely active in the signaling of PTH to evoke its anabolic and
catabolic actions in bone.
 |
Acknowledgments
|
|---|
Diane Robins and Arno Scheller are acknowledged for their
assistance in technical aspects of the EMSAs.
 |
Footnotes
|
|---|
1 This work was supported by NIH Grant DK-53904 and the Center for
Biorestoration of Oral Health at the University of Michigan. 
Received August 29, 2000.
 |
References
|
|---|
-
Karaplis AC, Luz A, Glowacki J, Bronson RT,
Tybulewicz VLJ, Kronenberg HM, Mulligan RC 1994 Lethal skeletal
dysplasia from targeted disruption of the parathyroid hormone-related
peptide gene. Genes Dev 8:277289[Abstract/Free Full Text]
-
Strewler GJ 2000 Mechanisms of disease: the
physiology of parathyroid hormone-related protein. N Engl J
Med 342:177185[Free Full Text]
-
Clohisy JC, Scott DK, Brakenhoff KD, Quinn CO,
Partridge NC 1992 Parathyroid hormone induces c-fos and
c-jun messenger RNA in rat osteoblastic cells. Mol
Endocrinol 6:18341842[Abstract/Free Full Text]
-
McCauley LK, Koh AJ, Beecher CA, Rosol TJ 1997 The
proto-oncogene c-fos is transcriptionally regulated by PTH
and PTHrP in a cAMP-dependent manner in osteoblastic cells.
Endocrinology 138:54275433[Abstract/Free Full Text]
-
Pearman AT, Chou WY, Bergman KD, Pulumati MR, Partridge
NC 1996 Parathyroid hormone induces c-fos promoter
activity in osteoblastic cells through phosphorylated cAMP response
element (CRE)-binding protein binding to the major CRE. J Biol
Chem 271:2571525721[Abstract/Free Full Text]
-
Lee K, Deeds JD, Chiba S, Un-No M, Bond AT, Segre
GV 1994 Parathyroid hormone induces sequential c-fos
expression in bone cells in vivo: In situ
localization of its receptor and c-fos messenger ribonucleic
acids. Endocrinology 134:441450[Abstract/Free Full Text]
-
Liang JD, Hock JM, Sandusky GE, Santerre RF, Onyia
JE 1999 Immunohistochemical localization of selected early
response genes expressed in trabecular bone of young rats given hPTH
134. Calcif Tissue Int 65:369373[CrossRef][Medline]
-
Grigoriadis AE, Wang ZQ, Cecchini MG, Hofstetter W,
Felix R, Fleisch HA, Wagner EF 1994 c-Fos: a key regulator of
osteoclast-macrophage lineage determination and bone remodeling.
Science 266:443448[Abstract/Free Full Text]
-
Grigoriadis AE, Wang ZQ, Wagner EF 1995 Fos and
bone cell development: lessons from a nuclear oncogene. Trends Genet 11:436441[CrossRef][Medline]
-
Herdegen T, Leah JD 1998 Inducible and constitutive
transcription factors in the mammalian nervous system: control of gene
expression by Jun, Fos, and Krox, and CREB/ATF proteins. Brain
Res Rev 28:370490[CrossRef][Medline]
-
Curran T, Franza BR 1988 Fos and Jun: the AP-1
connection. Cell 55:395397[CrossRef][Medline]
-
Stein GS, Lian JB, Van Wijnen AJ, Montecino M 1996 Transcriptional control of osteoblast growth and differentiation.
Physiol Rev 76:593629[Abstract/Free Full Text]
-
Keller ET, Chang C, Ershler WB 1996 Inhibition of
NFkappaß activity through maintenance of Ikappaß levels contributes
to dihydrotestosterone-mediated repression of the interleukin-6
promoter. J Biol Chem 271:2626726275[Abstract/Free Full Text]
-
Rubin J, Fan D, Wade A, Murphy TC, Gewant H, Nanes MS,
Fan X, Moerenhout M, Hofstetter W 2000 Transcriptional regulation
of the expression of macrophage colony stimulating factor. Mol Cell
Endocrinol 160:193202[CrossRef][Medline]
-
McCabe LR, Kockz M, Lian J, Stein J, Stein G 1995 Selective expression of fos- and jun-related genes during osteoblast
proliferation and differentiation. Exp Cell Res 218:255262[CrossRef][Medline]
-
Jochum W, David JP, Elliott C, Wutz A, Plenk H, Matsuo
K, Wagner EF 2000 Increased bone formation and osteosclerosis in
mice overexpressing the transcription factor Fra-1. Nat Med 6:980984[CrossRef][Medline]
-
Sabatakos G, Sims NA, Chen K, Aoki K, Kelz MB, Amling M,
Bouali Y, Mukhopadhyay K, Ford K, Nestler EJ, Baron R 2000 Overexpression of
FosB transcription factor(s) increases bone
formation and inhibits adipogenesis. Nat Med 6:985990[CrossRef][Medline]
-
McCabe LR, Banerjee C, Kundu R, Harrison RJ, Dobner PR,
Stein JL, Lian JB, Stein GS 1996 Developmental expression and
activities of specific Fos and Jun proteins are functionally related to
osteoblast maturation: Role of fra-2 and jun D.
Endocrinology 137:43984408[Abstract]
-
Koe RC, Clohisy JC, Tyson DR, Pulumati MR, Cook TF,
Partridge NC 1997 Parathyroid hormone versus phorbol ester
stimulation of activator protein-1 gene family members in rat
osteosarcoma cells. Calcif Tissue Int 61:5258[CrossRef][Medline]
-
McCauley LK, Koh AJ, Beecher CA, Cui Y, Decker JD,
Francheschi RT 1995 Effects of differentiation and transforming
growth factor beta on PTH/PTHrP receptor mRNA levels in MC3T3E1
cells. J Bone Miner Res 10:12431255[Medline]
-
McCauley LK, Koh AJ, Beecher CA, Cui Y, Rosol TJ,
Franceschi RT 1996 PTH/PTHrP receptor is temporally regulated
during osteoblast differentiation and is associated with collagen
synthesis. J Cell Biochem 61:638647[CrossRef][Medline]
-
McCauley LK, Beecher CA, Melton ME, Werkmeister JR,
Jüppner H, Abou-Samra AB, Segre GV, Rosol TJ 1994 Transforming growth factor ß regulates steady state PTH/PTHrP
receptor mRNA levels and PTHrP binding in ROS 17/2.8 osteosarcoma
cells. Mol Cell Endocrinol 101:331336[CrossRef][Medline]
-
Grone A, McCauley LK, Capen CC, Rosol TJ 1997 PTH/PTHrP receptor expression in humoral hypercalcemia of malignancy in
nude mice with the canine apocrine adenocarcinoma (CAC-8). J Endocrinol 153:123129[Abstract/Free Full Text]
-
Andrews NC, Faller DV 1991 A rapid micropreparation
technique for extraction of DNA-binding proteins from limiting numbers
of mammalian cells. Nucleic Acids Res 19:24992501[Free Full Text]
-
Partridge NC, Bloch SR, Pearman AT 1994 Signal
transduction pathways mediating parathyroid hormone regulation of
osteoblastic gene expression. J Cell Biochem 55:321327[CrossRef][Medline]
-
Chung KY, Agarwal A, Uitto J, Mauviel A 1996 An
AP-1 binding sequence is essential for regulation of the human
alpha2(I) collagen (COL1A2) promoter activity by transforming growth
factor-beta. J Biol Chem 271:32723278[Abstract/Free Full Text]
-
Foletta VC 1996 Transcription factor AP-1, and the
role of Fra-2. Immunol Cell Biol 74:121133[Medline]
-
Halazonetis TD, Georgopoulos K, Greenberg ME, Leder
P 1988 c-Jun dimerizes with itself and with c-Fos, forming
complexes of different DNA binding affinities. Cell 55:917924[CrossRef][Medline]
-
Nishina H, Sato H, Suzuki T, Sato M, Iba H 1990 Isolation and characterization of fra-2, an additional
member of the fos gene family. Proc Natl Acad Sci USA 87:36193623[Abstract/Free Full Text]
-
Matsuo K, Owens JM, Tonko M, Elliott C, Chambers TJ,
Wagner EF 2000 Fos/1 is a transcriptional target of
c-Fos during osteoclast differentiation. Nat Genet 24:184187[CrossRef][Medline]
-
Carrasco D, Bravo R 1995 Tissue-specific expression
of the fos-related transcription factor fra-2
during mouse development. Oncogene 10:10691079[Medline]
-
Rutberg SE, Adams TL, Olive M, Alexander N, Vinson C,
Yuspa SH 1999 CRE DNA binding proteins bind to the AP-1 target
sequence and suppress AP-1 transcriptional activity in mouse
keratinocytes. Oncogene 18:15691579[CrossRef][Medline]
-
Schule R, Umesono K, Mangelsdorf DJ, Bolada J, Pike JW,
Evans RM 1990 Jun-Fos and receptors for vitamins A and D recognize
a common response element in the human osteocalcin gene. Cell 61:497504[CrossRef][Medline]
-
Winchester SK, Selvamurugan N, DAlonzo RC, Partridge
NC 2000 Developmental regulation of collagenase-3 mRNA in normal
differentiating osteoblasts through the activator protein-1 and the
runt domain binding sites. J Biol Chem 275:2331023318[Abstract/Free Full Text]
-
Yoshida T, Suzuki T, Sato H, Nishina H, Iba H 1993 Analysis of fra-2 gene expression. Nucleic Acids Res 21:27152721[Abstract/Free Full Text]
-
Sonobe MH, Yoshida T, Murakami M, Kameda T, Iba H 1995 The fra-2 promoter can respond to serum-stimulation
through AP-1 complexes. Oncogene 10:689696[Medline]
-
Selvamurugan N, Chou W, Pearman AT, Pulumati MR,
Partridge NC 1998 Parathyroid hormone regulates the rat
collagenase-3 promoter in osteoblastic cells through the cooperative
interaction of the activator protein-1 site and the runt
domain binding sequence. J Biol Chem 273:1064710657[Abstract/Free Full Text]
-
Hai T, Curran T 1991 Cross-family dimerization of
transcription factors Fos/Jun and ATF/CREB alters DNA binding
specificity. Proc Natl Acad Science USA 88:37203724[Abstract/Free Full Text]
-
Koh AJ, Beecher CA, Rosol TJ, McCauley LK 1999 3',5'-Cyclic adenosine monophosphate activation in osteoblastic cells:
effects of parathyroid hormone-1 receptors and osteoblastic
differentiation in vitro. Endocrinology 140:31543162[Abstract/Free Full Text]
-
Bellows CG, Ishida H, Aubin JE, Heersche JNM 1990 Parathyroid hormone reversibly suppresses the differentiation of
osteoprogenitor cells into functional osteoblasts. Endocrinology 127:31113116[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
S. Yu, R. T. Franceschi, M. Luo, X. Zhang, D. Jiang, Y. Lai, Y. Jiang, J. Zhang, and G. Xiao
Parathyroid Hormone Increases Activating Transcription Factor 4 Expression and Activity in Osteoblasts: Requirement for Osteocalcin Gene Expression
Endocrinology,
April 1, 2008;
149(4):
1960 - 1968.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Q. Pirih, A. Tang, I. C. Ozkurt, J. M. Nervina, and S. Tetradis
Nuclear Orphan Receptor Nurr1 Directly Transactivates the Osteocalcin Gene in Osteoblasts
J. Biol. Chem.,
December 17, 2004;
279(51):
53167 - 53174.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Chang, A. Rewari, M. Centrella, and T. L. McCarthy
Fos-related Antigen 2 Controls Protein Kinase A-induced CCAAT/Enhancer-binding Protein {beta} Expression in Osteoblasts
J. Biol. Chem.,
October 8, 2004;
279(41):
42438 - 42444.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. C. Ozkurt, F. Q. Pirih, and S. Tetradis
Parathyroid Hormone Induces E4bp4 Messenger Ribonucleic Acid Expression Primarily through Cyclic Adenosine 3',5'-Monophosphate Signaling in Osteoblasts
Endocrinology,
August 1, 2004;
145(8):
3696 - 3703.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Chen, A. J. Koh, N. S. Datta, J. Zhang, E. T. Keller, G. Xiao, R. T. Franceschi, N. J. D'Silva, and L. K. McCauley
Impact of the Mitogen-activated Protein Kinase Pathway on Parathyroid Hormone-related Protein Actions in Osteoblasts
J. Biol. Chem.,
July 9, 2004;
279(28):
29121 - 29129.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Demiralp, H.-L. Chen, A. J. Koh, E. T. Keller, and L. K. McCauley
Anabolic Actions of Parathyroid Hormone during Bone Growth Are Dependent on c-fos
Endocrinology,
October 1, 2002;
143(10):
4038 - 4047.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zayzafoon, S. Botolin, and L. R. McCabe
p38 and Activating Transcription Factor-2 Involvement in Osteoblast Osmotic Response to Elevated Extracellular Glucose
J. Biol. Chem.,
September 27, 2002;
277(40):
37212 - 37218.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-L. Chen, B. Demiralp, A. Schneider, A. J. Koh, C. Silve, C.-Y. Wang, and L. K. McCauley
Parathyroid Hormone and Parathyroid Hormone-related Protein Exert Both Pro- and Anti-apoptotic Effects in Mesenchymal Cells
J. Biol. Chem.,
May 24, 2002;
277(22):
19374 - 19381.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Gopalakrishnan, H. Ouyang, M. J. Somerman, L. K. McCauley, and R. T. Franceschi
Matrix {gamma}-Carboxyglutamic Acid Protein Is a Key Regulator of PTH-Mediated Inhibition of Mineralization in MC3T3-E1 Osteoblast-Like Cells
Endocrinology,
October 1, 2001;
142(10):
4379 - 4388.
[Abstract]
[Full Text]
[PDF]
|
 |
|