help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, S.
Right arrow Articles by Segaloff, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, S.
Right arrow Articles by Segaloff, D. L.
Endocrinology Vol. 142, No. 5 2013-2021
Copyright © 2001 by The Endocrine Society


ARTICLES

Identification of an SAS (Sp1c Adjacent Site)-Like Element in the Distal 5'-Flanking Region of the Rat Lutropin Receptor Gene Essential for Cyclic Adenosine 3',5'-Monophosphate Responsiveness1

Shiyou Chen, Xuebo Liu and Deborah L. Segaloff

Department of Physiology and Biophysics, The University of Iowa College of Medicine, Iowa City, Iowa 52242

Address all correspondence and requests for reprints to: Deborah L. Segaloff, Ph.D., Department of Physiology and Biophysics, The University of Iowa College of Medicine, Iowa City, Iowa 52242. E-mail: deborah-segaloff{at}uiowa.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
One of the hallmarks of the differentiation of granulosa cells is the estradiol and FSH/cAMP-dependent induction of the LH receptor (LHR). Previous studies using granulosa cells isolated from diethylstilbestrol-pretreated immature rats identified a novel cAMP-responsive element termed the SAS site (Sp1c adjacent site) in the promoter region of the rat (r) LHR gene. The studies presented herein show that there is an additional distal site located at nucleotide (nt) -933/-924 that appears to interact with the same transcription factor that binds to the promoter SAS site. Similar to the SAS site, the complex formed between granulosa cell nuclear extracts and this distal site is enhanced by cAMP treatment of the granulosa cells. The core sequence required for the formation of the DNA/protein complex at this distal rLHR site was determined to be AGTGG(A)GGGG. With the exception of adenine at -928, substitution of any residue within this sequence prevented formation of this complex. The core sequence of this distal site differs from that of the proximal SAS site, which is GGGGG, and hence the distal site has been termed a SAS-like site. Reporter gene assays using constructs containing the -2,109/-1 region of the rLHR demonstrate that mutation of the distal SAS-like site abolishes the cAMP-induced transcription of the rLHR gene in rat granulosa cells, underscoring the functional significance of this site. Given the lack of sequences in the 5'-flanking region of the rLHR gene consistent with known cAMP-responsive elements, the identification of the novel SAS and SAS-like sites in the rLHR gene provides important clues toward understanding the mechanisms by which the rLHR gene is induced by FSH/cAMP.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE DIFFERENTIATION of ovarian granulosa cells is a complex process that involves the induction of many genes, one of which is the LH/CG receptor (LHR) gene (see Ref. 1 for a review). The induction of the LHR gene is essential for the ability of the granulosa cells of the growing follicle to respond to pituitary LH with increased steroidogenesis and ovulation and for the luteal cells of the ruptured follicle to respond to placental human (h) CG with increased steroid production. The induction of the LHR in differentiating granulosa cells has been shown to be due to the concerted actions of both FSH and estradiol (2, 3, 4, 5). A landmark study by Erickson et al. in 1979 (6) showed that granulosa cells isolated from hypophysectomized rats pretreated with estradiol could be made to differentiate in culture and express the LHR if cultured in the absence of serum. Later studies showed that granulosa cells from diethylstilbestrol (DES)-treated immature rats could also be used. These findings have provided subsequent investigators with an excellent model system to study granulosa cell differentiation in general and LHR induction specifically. The ability of FSH to induce the LHR in rat granulosa cells from estradiol-pretreated rats can be mimicked by other agents that increase intracellular cAMP levels or by the addition of exogenous membrane-permeable cAMP analogs, suggesting that the actions of FSH on LHR induction are mediated, at least in part, by cAMP (7, 8, 9, 10).

The FSH/cAMP-mediated induction of the LHR, as measured by increased receptor numbers, is paralleled by an increase in the levels of LHR messenger RNA (mRNA) (5, 11). It has further been shown that the ability of FSH/cAMP to increase LHR mRNA is due, at least in part, to a significant (~10-fold) increase in the rate of transcription of the LHR gene (11). In spite of the role of cAMP in the induction of LHR gene transcription, a search of the 2-kb region of 5'-flanking sequences of the rat (r) LHR gene does not reveal any motifs resembling known cAMP-responsive elements (12). Reporter gene assays using constructs driven by increasing lengths of the 2-kb 5'-flanking region and electrophoretic mobility shift assays (EMSAs) using probes corresponding to different portions of this region both suggested that the cAMP-mediated induction of the rLHR gene requires the concerted actions of multiple cis-and trans-acting elements (13).

Four cAMP-responsive elements in the rLHR 5'-flanking region have thus far been identified. Three of these are SP1 elements (13). These three Sp1 sites are located at nucleotide (nt) -83, -103, and -143 and are termed the Sp1a, Sp1b, and Sp1c sites, respectively (13). Each Sp1 site binds both Sp1 and Sp3 transcription factors (13). EMSAs using nuclear extracts from either control or 8-Br-cAMP-treated rat granulosa cells reveal two complexes: the larger complex I contains Sp1 and Sp3 and the smaller complex II contains Sp3 only. Granulosa cells transfected with reporter gene constructs exhibit diminished basal and cAMP responsiveness of rLHR gene transcription when any of the three Sp1 sites are mutated (13). Recently, a novel cAMP-responsive element in the promoter region of the rLHR gene was mapped to nt -146/-142 (14). Because this site overlaps with and extends upstream from the Sp1c site at nt -143/-138 it was termed a SAS site for Sp1c adjacent site. The proximal SAS site was shown to consist of a core sequence of GGGGG. EMSAs performed with a labeled probe containing the SAS site incubated with nuclear extracts from granulosa cells revealed a complex, termed complex A, whose abundance was increased when the assay was performed with extracts from 8-Br-cAMP-treated cells (14). Mutations were described that could selectively disrupt either the Sp1c site (as evidenced by a lack of complex I and complex II) or the SAS site (as documented by a lack of complex A formation). Using these site-selective mutations it was shown that the selective disruption of either the Sp1c site or the SAS site results in diminished cAMP responsiveness of the rLHR gene in granulosa cells (14). It was further shown that the formation of complex A at the SAS site does not require the participation of either Sp1 or Sp3 factors (14). Therefore, although the two sites overlap, the SAS and Sp1c sites appear to act independently in mediating cAMP responsiveness to the rLHR gene.

In the present study we sought to determine whether there were additional cis elements in the rLHR gene that bound the same transcription factor(s) as the SAS site, and if so, whether they too helped mediate cAMP responsiveness. We report herein the identification of a site in the distal portion of the 5'-flanking region of the rLHR gene that can compete for complex A formation. Although also G rich, the consensus sequence for this distal site is different than that of the more proximal SAS site. Significantly, mutation of this distal site within the context of a reporter gene driven by 2.1 kb of 5'-flanking sequence of the rLHR gene abolishes cAMP responsiveness. These results implicate the distal SAS-like site as being essential for the cAMP-mediated responsiveness of the rLHR gene.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents
DMEM, Ham’s F-12 nutrient mixture, Waymouth’s MB 752/1 medium, and oligonucleotides were obtained from Life Technologies, Inc. (Gaithersburg, MD). 8-Br-cAMP, DES, BSA, and corticosterone were purchased from Sigma (St. Louis, MO). A mix of insulin, transferrin, and selenons (ITS) was purchased from Collaborative Research (Bedford, MA). Restriction endonucleases and T4 polynucleotide kinase were obtained from New England Biolabs, Inc. (Beverly, MA). [32P]ATP was purchased from NEN Life Science Products (Boston, MA). Poly(dI-dC) was obtained from Pharmacia Biotech (Piscataway, NJ). Luciferin was from Analytical Luminescence Laboratory (Ann Arbor, MI). Antibodies to Sp1 and Sp3 were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Primary cultures of granulosa cells
Immature Sprague Dawley female rats (20–21 days of age, from Harlan Sprague Dawley, Inc., Indianapolis, IN) were primed sc with SILASTIC brand capsules (18 mm) containing 25 mg DES (a nonsteroidal estrogen) for 5 days. The ovaries were then excised and the granulosa cells were released as previously described (11). The granulosa cells were plated on fibronectin-coated tissue culture plates and cultured in growth medium (DMEM/Ham’s F-12 (1:1) supplemented with 10 mM HEPES, pH 7.4, 50 µg/ml gentamycin, 0.1% BSA, 1 µg/ml ITS, and 18 ng/ml corticosterone) at 37 C in a 5% CO2 incubator.

Nuclear extracts and gel mobility shift assays
Granulosa cells released from the ovaries of DES-pretreated rats were plated on 60-mm fibronectin-coated plates at a cell density of 4 x 106 cells per dish and incubated with or without 3 mM 8-Br-cAMP for 40 h. The nuclear extracts were then prepared as previously described (15). The protein concentrations were determined by Bradford assay (16). Typically, the yield was approximately 6–12 µg nuclear protein per dish.

For EMSAs examining the formation of complex A, the following conditions were used. Nuclear proteins (2 µg) were incubated 60 min on ice with 10 fmol (~10,000 cpm) of a 32P-labeled probe corresponding to nt -187/-2 of the rLHR in a total volume of 25 µl of binding buffer (10 mM Tris, pH 7.6, 1 mM EDTA, 1 mM dithiothreitol, 10% glycerol, 100 mM KCl) also containing 3–5 µg poly (dI-dC). For competition experiments, unlabeled competitor DNA was added simultaneously with the labeled fragments at molar excess ratios as indicated. The resulting DNA-protein complexes were resolved by electrophoresis on 5% polyacrylamide gels run in 20 mM Tris-acetate, 1 mM EDTA, pH 8.0, for approximately 2 h at 180 V. Under these conditions, complex A can be observed in the lower portion of the gel. These conditions, however, do not permit detection of Sp1 and/or Sp3 binding to the Sp1 sites.

Gels were either developed by autoradiography or exposed to a Cyclone storage phosphor screen (Packard Instrument Co., Meriden, CT) for 4 h at room temperature. The screen was scanned by Scan control software and quantified using OptiQuant software (Packard Instrument Co.).

DNA reporter gene constructs and mutagenesis
Because the rLHR gene contains multiple transcriptional start sites, the numbering of the 5'-flanking region of the gene is based relative to the translation initiation codon (12). The rLHR-2056-luc construct that contains the luciferase reporter gene and the fragment from -2,056 to -2 of the 5'-flanking region of the rLHR gene was a gift from Dr. Mario Ascoli (University of Iowa, Iowa City, IA). The promoterless pLLV3-luciferase plasmid was originally provided by Dr. Richard Maurer (Oregon Health Sciences University, Portland, OR). Mutants were generated by the PCR using the overlap extension method (17, 18). The entire PCR region for each mutant was verified by sequence analysis (19).

Transient cell transfection and luciferase assays
Granulosa cells were plated in 60-mm dishes at 4 x 106 cells per dish for 16 h, and then were transiently transfected by the calcium-phosphate precipitation method (20) using 24 µg of plasmid per 60 mm dish. After 4 h of exposure to the DNA precipitation, the cells were washed three times with Waymouth’s MB752/1 medium supplemented with 0.1% BSA, refed with fresh growth medium, and cultured in the absence or presence of 3 mM 8-Br-cAMP. In earlier experiments it was determined that maximal cAMP-inducible luciferase activity was observed 40–48 h after transfection. For the experiments shown, cells were lysed 40 h after transfection with 250 µl of lysis buffer (25 mM glycylglycine hydrochloride, 15 mM MgSO4, 4 mM EGTA, 1 mM dithiothreitol, 0.5% NP-40) for 15 min at room temperature. The cell debris was removed by brief centrifugation, and the supernatant was transferred to a clean tube. The luciferase assay was performed as described previously (21). Protein concentrations of the lysates were determined by the Bradford assay (16). The data for luciferase assays were normalized and reported as light units per mg protein. Earlier studies had shown that similar results were obtained regardless of whether or not the data were further standardized to ß-galactosidase activity as determined by cotransfection with the cDNA for ß-galactosidase. Therefore, in the experiments shown this was not performed. Also, in earlier experiments, we had determined that 8-Br-cAMP had no effect on the luciferase activity of the empty vector transfected in the rat granulosa cells.

Data presentation
The gel shift assays and competition assays were repeated at least three times with different preparations of nuclear extracts and the representative experiments are included as shown.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
When nuclear extracts from uninduced rat granulosa cells are incubated with a labeled probe that contains the SAS element and an EMSA is performed, a complex, designated complex A, is observed in the lower portion of the gel. A greater abundance of complex A is observed when extracts from 8-Br-cAMP-treated cells are used (Fig. 1Go). Complex A has been shown to bind to a newly described cAMP-responsive element termed the SAS site in the promoter region of the 5'-flanking region of the rLHR gene (14). The following series of EMSAs were performed to determine whether there are other sites in the 5'-flanking region of the rLHR gene that can recognize the transcription factor binding to the promoter SAS element (as defined by the ability of the site to compete for complex A formation to the SAS site). Toward this end, nuclear extracts from 8-Br-cAMP-induced granulosa cells were incubated with a labeled -187/-2 probe, which contains the SAS site in the presence of an excess of an unlabeled oligonucleotide corresponding to a portion of the 5'-flanking region of the rLHR gene. The regions corresponding to each of the competing oligonucleotides are shown in Table 1Go. As would be expected, an unlabeled probe corresponding to nt -187/-2 (probe 1) completely inhibited complex A formation as well as other complexes formed with the promoter region of the gene. Interestingly, however, fragments 6 and 7, corresponding to nt -1,026/-808 and -1,106/-880, respectively, specifically competed for complex A formation (Fig. 1BGo). All other DNA fragments examined were without effect. These data suggest the presence of one or more SAS or SAS-like sites within the distal -1,106/-808 region of the rLHR gene.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 1. Competitive gel shift assays using a variety of upstream rLHR fragments with the promoter region of the rLHR gene. EMSAs were performed using a 32P-labeled fragment corresponding to nt -187/-2 of the rLHR gene promoter. The labeled probe was incubated with 2 µg of nuclear extracts isolated from uninduced [control (C)] or 8-Br-cAMP-induced (I) rat granulosa cells. The competing probes, indicated by number and shown in Table 1Go, were added simultaneously with the labeled probe at the molar excess ratios indicated. Panel A, Competing probes encompassing the region from nt -838 to -2; panel B, competing probes encompassing the region from nt -1,457 to -808; panel C, competing probes encompassing the region from nt -2,056 to -1,372.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Competing DNA fragments used in Fig. 1Go

 
Having shown that unlabeled probes 6 and 7 could compete for complex A formation in EMSAs using a labeled probe 1 that contains the SAS site, we then did the reverse experiment. That is, we performed EMSAs in which either probe 6 (Fig. 2AGo) or probe 7 (Fig. 2BGo) was labeled. An excess of unlabeled probe 7 competed for complex A formation with probe 6 (Fig. 2AGo), and an excess of unlabeled probe 6 competed for complex A formation with probe 7 (Fig. 2BGo). Therefore, the SAS or SAS-like site must lie within the region common to both probes 6 and 7, corresponding to nt -1,106/-880. In addition, it was also observed that an excess of unlabeled probe 1, which contains the SAS site, effectively competed for complex A formation to either labeled probe 6 or 7 (Fig. 2Go, A and B). These data similarly suggest that the transcription factor(s) that binds to the SAS site in the promoter region also binds to a site(s) in the distal nt -1,106/-880 region of the rLHR gene.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 2. The factor that binds to the promoter SAS element and forms complex A also binds to the distal rLHR region. EMSAs were performed using a 32P-labeled fragment corresponding to probe 6 (nt -1,026/-808, panel A) or probe 7 (nt -1,106/-880, panel B). The labeled probe was incubated with 2 µg of nuclear extracts isolated from uninduced (C) or 8-Br-cAMP-induced (I) rat granulosa cells. The competing probes, indicated by number and shown in Table 1Go, were added simultaneously with the labeled probe at the molar excess ratios indicated.

 
The following experiments were then performed to delineate the location of the distal site(s) that recognizes the SAS-binding factors. Competitive EMSAs were done in which nuclear extracts from 8-Br-cAMP-induced granulosa cells were incubated with labeled probe 6, corresponding to nt -1,106/-808 of the rLHR gene, in the absence or presence of an excess of unlabeled oligonucleotide corresponding to a smaller fragment within the nt -1,106/-808 region (Fig. 3Go). The smallest unlabeled fragment that inhibited complex A formation corresponded to nt -934/-915. A shorter unlabeled probe corresponding to nt -929/-910 was unable to compete for complex A formation, suggesting that nucleotides within the -934/-929 region were required for recognition of the SAS-binding protein(s). To test this hypothesis, nt -930 and -929 within the unlabeled -934/-915 probe were mutated. As shown in Fig. 3Go, mutation of these two residues abolished the ability of the nt -934/-915 to prevent complex A formation.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 3. Further narrowing of the distal rLHR region involved in complex A formation. Panel A, Competitive mobility shift assays were performed using a 32P-labeled probe 6 fragment corresponding to nt -1,026/-808 of the rLHR gene. The labeled probe was incubated with 2 µg of nuclear extracts isolated from 8-Br-cAMP-induced (I) rat granulosa cells. The competing fragments, for which the rLHR regions are indicated in the figure, were incubated with the labeled fragment at a molar excess ratio of 100. The sequence of the fragment corresponding to nt -934/-915 is CAGTGGAGGGGAAATGACCC, where the underlined residues were substituted with TCA in the mutated -934/-915 fragment. Below the results of the EMSA is a diagram schematically showing the different competing oligonucleotides that were used to narrow down the distal region involved in complex A formation.

 
The unlabeled probes corresponding to portions of the distal -949/-910 region of the rLHR were then tested for their ability to compete for complex A formation to the SAS site in the promoter region (Fig. 4Go). Mutation of nt -930 and -929 of the -934/-915 probe abolished its ability to compete for complex A formation. These data suggest that the same transcription factor(s) is recognized by both the distal site in the -934/-915 region and by the SAS site in the promoter region.



View larger version (88K):
[in this window]
[in a new window]
 
Figure 4. The distal region of the rLHR inhibits the formation of complex A with the promoter region. Mobility shift assays were performed using the promoter region fragment (nt -187/-2) as the 32P-labeled probe. This was incubated with 2 µg of nuclear extracts from rat granulosa cells induced (I) with 8-Br-cAMP. The competing fragments, for which the rLHR regions are indicated in the figure, were incubated with the labeled fragment at a molar excess ratio of 100. The sequence of the fragment corresponding to nt -934/-915 is CAGTGGAGGGGAAATGACCC, where the underlined residues were substituted with TCA in the mutated -934/-915 fragment.

 
The core sequence for the distal site recognizing the SAS-binding protein(s) was further defined by competitive EMSAs in which extracts from 8-Br-cAMP-induced granulosa cells were incubated with a labeled probe corresponding to nt -1,026/-808 in the presence of a competing unlabeled oligonucleotide corresponding to nt -936/-915 that contained a substitution of one nucleotide. The competing nucleotides were present at either a 100-fold (Fig. 5AGo) or a 200-fold (Fig. 5BGo) excess of labeled probe. Under these conditions, the appearance of complex A indicates the lack of ability of a given oligonucleotide to compete for complex A, thereby suggesting a role of the mutated nucleotide in binding the SAS factor. The residues thus determined to be required for the binding of the SAS factor to the distal site are underlined in the sequence shown in Fig. 5Go. Interestingly, the core sequence is noncontiguous, with the AGTGG sequence of nt -933/-929 separated by a single A with the GGGG sequence of nt -927/-924. EMSAs examining the formation of complex A formation between nuclear extracts of 8-Br-cAMP-treated cells and a nt -187/-2 probe containing the SAS site further show that the same core sequence of the distal site is necessary for competing with complex A formation at the promoter SAS site (Fig. 6Go).



View larger version (87K):
[in this window]
[in a new window]
 
Figure 5. Identification of the core sequence of the distal element involved in complex A formation. Shown are the results of a mobility shift assay using a fragment corresponding to nt -1,026/-808 (probe 6) of rLHR gene as the labeled probe. The labeled probe was incubated with 2 µg of nuclear extracts isolated from 8-Br-cAMP-induced rat granulosa cells in the absence (lane 1) or presence (lanes 2–15) of an unlabeled competing oligonucleotide at a 100-fold (panel A) or a 200-fold (panel B) molar excess. The unlabeled competing oligonucleotides corresponded to nt -936/-915 of the rLHR in which one residue between nt -936/-923 was substituted. Those residues whose substitution did not cause competition for complex A formation are underlined.

 


View larger version (91K):
[in this window]
[in a new window]
 
Figure 6. The core sequence of the distal element also inhibits complex A formation at the SAS site in the rLHR promoter. Mobility shift assays were performed using the promoter region fragment (probe 1, nt -187/-2) as the 32P-labeled probe. The labeled probe was incubated with 2 µg of nuclear extracts isolated from 8-Br-cAMP-induced rat granulosa cells in the absence (lane 1) or presence (lanes 2–15) of an unlabeled competing oligonucleotide at a 100-fold (A) or a 200-fold (B) molar excess. The unlabeled competing oligonucleotides corresponded to nt -936/-915 of the rLHR in which one residue between nt -936/-923 was substituted. Those residues whose substitution did not cause competition for complex A formation are underlined.

 
Interestingly, the presence of a GGAGGGG sequence within the distal SAS-like site suggests that it may function as a Sp1 site. This is particularly relevant given that the proximal SAS site overlaps with a Sp1 site known to bind Sp1 and Sp3 (13, 14). In that case, it was shown that although the SAS site and Sp1c sites overlap, the formation of complex A to the SAS site was independent of Sp1 or Sp3 binding to the Sp1c site. To examine the potential involvement of Sp1 and/or Sp3 in complex A formation at the distal SAS-like site, we performed EMSAs in the absence or presence of antibodies to Sp1 or Sp3. Using antibodies at concentrations previously shown by us to affect Sp1 and Sp3 binding to the proximal Sp1 sites, we were unable to detect an effect of either antibody on complex A formation to the distal SAS-like site (Fig. 7Go). These results suggest that even if Sp1 and/or Sp3 bind to this region of the rLHR gene, they do not participate in complex A formation to the distal SAS-like site.



View larger version (89K):
[in this window]
[in a new window]
 
Figure 7. Lack of Sp1 and Sp3 binding in complex A formation to the distal SAS-like site. Shown are the results of a mobility shift assay using a fragment corresponding to nt -1,026/-808 (probe 6) of rLHR gene as the labeled probe. The labeled probe was incubated with or without 2 µg of nuclear extracts isolated from 8-Br-cAMP-induced rat granulosa cells as indicated. Competing probe 6 or antibodies to Sp1 or Sp3 were added simultaneously with the labeled probe and extract.

 
The results obtained thus far demonstrate that there is a distal site in the rLHR gene located between nt -934/-925 that appears to bind the same transcription factor(s) that binds to the SAS site located in the promoter region of the rLHR gene at nt -146/-142. Since the proximal SAS site is known to confer cAMP responsiveness, we next examined whether the distal SAS-like site was similarly involved in cAMP responsiveness of the rLHR gene. Toward this end, granulosa cells were transfected with reporter gene constructs driven by the wild-type sequence of nt -2,056/-1 of the rLHR gene or one in which the proximal SAS and distal SAS-like sites were individually or collectively mutated. As shown in Fig. 8Go, 8Go-Br-cAMP treatment induces a 4.4-fold increase in luciferase activity in granulosa cells transfected with the wild-type construct and only a 2.1-fold increase in cells transfected with a construct containing a mutation of the promoter SAS site. The cAMP responsiveness is reduced to only 1.3-fold (where there is no statistical difference between the basal and cAMP-stimulated cells) when the distal SAS-like site is mutated. Given the ablation of the cAMP responsiveness of the rLHR gene by mutation of the distal SAS-like site, it is not surprising that the additional mutation of the promoter SAS site on top of the mutation of the distal SAS-like site had no further effect on reducing cAMP responsiveness. These results clearly demonstrate an essential role for the distal SAS-like site in the cAMP responsiveness of the rLHR gene. It should be noted that the SAS and SAS-like sites are also involved in basal transcription of the rLHR gene as well. Although mutation of each site reduces basal rLHR gene transcription to approximately 60% of control, the combined mutations of the two sites reduces basal transcription to only 32% of control.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 8. The effect of the distal SAS-like element on transcriptional activity of the rLHR rat granulosa cells. Rat granulosa cells were transfected with luciferase reporter gene constructs containing either the wild-type sequence of nt -2,056/-1 of the rLHR gene (wt), or nt -2,056/-1 containing mutations of the proximal SAS site, the distal SAS-like site, or both the proximal SAS and distal SAS-like sites. The proximal SAS site was mutated as described for SAS(mt2) previously (14 ) where the GGGGG sequence of -150/-145 was replaced by TATCAT. The distal SAS-like site was mutated by substituting nucleotides CA at positions -930 and -929 with GG. The cells were incubated without (C) or with (I) 8-Br-cAMP and then assayed for luciferase activity. Results shown are the mean ± SEM of three independent experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The rLHR gene in differentiating granulosa cells is transcriptionally induced by the synergistic actions of both estradiol and FSH, the latter of which acts, at least in part, via cAMP-mediated mechanisms (7, 8, 9, 10). Although the rLHR gene is hormonally regulated, its gene structure is related to that of housekeeping genes. Thus, it does not have a TATA box, but it has multiple transcriptional start sites and a GC-rich region with a cluster of Sp1 sites within the proximal portion of the 5'-flanking region (12, 22). The minimal promoter required for basal transcription of the rLHR gene in rat granulosa cells has been mapped to nt -155/-1 (using the translational start site as the point of referencing for numbering) (13). It has been shown for TATA-less genes that Sp1 sites typically play a role in assembling the transcription factors required for basal activity (23). Consistent with this, the basal transcription of the rLHR gene in granulosa cells requires the functional integrity of all three Sp1 sites (13).

Previous studies suggested the presence of multiple cAMP-responsive elements within the 2.1-kb 5'-flanking sequence of the rLHR gene (13). Because this region of the rLHR gene lacks sequence motifs consistent with known cAMP-responsive elements, the first task to be undertaken is to identify the specific DNA sequences that mediate cAMP responsiveness. Previous studies have shown that each of the three Sp1 sites within the promoter region of the rLHR gene contributes to the cAMP responsiveness of this gene (13). In addition, another element in the promoter region was identified as conferring cAMP responsiveness. This element, consisting of a GGGGG core sequence at nt -146/-142, does not fit any known consensus sequences for binding sites of transcription factors. This novel site, termed an SAS site, lies adjacent to and partially overlapping the Sp1c site at nt -143/-138. The studies presented herein show that there is an additional site, located in the distal region of the rLHR gene at nt -933/-924, that appears to recognize the same transcription factor(s) as that recognized by the proximal SAS site, as suggested by EMSA competition assays (cf. Figs. 4Go and 6Go). The core sequence of this site, AGTGG(A)GGGG, is also G-rich, but it is distinct from that of the SAS site. Therefore, we have designated the distal site as being an SAS-like site.

The proximal SAS site overlaps with a Sp1 site in the rLHR gene (Sp1c) that has been shown to bind both Sp1 and Sp3 (13). Through a series of experiments using mutations selective for the SAS site vs. the Sp1c site, it was concluded that the integrity of the Sp1c site was not required for complex A formation to the SAS site (14). Interestingly, the GGAGGGG sequence within the distal SAS-like site also resembles a Sp1 site. However, we have determined that neither Sp1 nor Sp3 proteins are associated with the complex A that forms to the distal SAS-like site (Fig. 7Go).

The proximal SAS site and the distal SAS-like site each form a complex termed complex A on EMSAs with nuclear extracts from rat granulosa cells. Competitive EMSAs suggest that the same transcription factor(s) binds to the proximal SAS and the distal SAS-like sites. Although complex A is detectable when using extracts from uninduced granulosa cells, the abundance of the complex is markedly increased when extracts from 8-Br-cAMP-treated cells are used. This induced binding of a transcription factor(s) to the SAS and SAS-like sites by cAMP suggests that these sites may be involved in the cAMP responsiveness of the rLHR gene. Whereas mutagenesis of the proximal SAS-like site reduces cAMP responsiveness by 50–60%, mutagenesis of the distal SAS-like site ablates cAMP responsiveness of the rLHR gene in granulosa cells. These data suggest that the integrity of the distal SAS-like site is essential for the cAMP-mediated increase in rLHR gene transcription. As such, the data further suggest that the proximal SAS site and three proximal Sp1 sites are either redundant with respect to the distal SAS-like site or they require the integrity of the distal SAS-like site to mediate their effects on cAMP responsiveness.

Although SAS and SAS-like sites appear to bind the same transcription factor(s), their respective core sequences that are required for the formation of complex A, as detected on EMSAs, are distinct. Previous studies on the proximal SAS element suggest that the core sequence at nt -146/-142 consists of GGGGG (14). This was determined by EMSAs examining complex A formation between the SAS site and granulosa cell nuclear extracts and the effects of competing oligonucleotides that contained single nucleotide substitutions. Other competitive EMSAs using competing oligonucleotides containing multiple substitutions, however, implicate the nucleotides upstream of the core GGGGG sequence as also contributing to complex A formation at the promoter SAS site, perhaps via lower affinity interactions that are only detected when more than one nucleotide at a time is substituted (14). Therefore, the SAS element may involve the GGGT immediately upstream of the core GGGGG sequence as well. The distal SAS-like site, as determined by EMSAs using competing oligonucleotides with individual nucleotide substitutions suggests a core sequence of AGTGG(A)GGGG, at nt -933/-924 where the ACTGG and GGGG nucleotides are essential, but not the intervening adenine. Although the absolute sequences of the promoter SAS site and the distal SAS-like site are distinct, they share the feature of being G rich, each containing a string of several guanine nucleotides. Several other cis-elements that are similarly rich in guanine nucleotides have been reported. These include the elements that bind the transcription factors G-string (24), G-fer (25), BGP1 (26, 27), and IF-1 (28, 29), as well as Zif268 (30). Interestingly, oligonucleotides corresponding to the binding sequences for G-string, G-fer, and IF-1 specifically inhibit complex A formation to the promoter SAS site (14). This raises the possibility that the transcription factor binding to the SAS and SAS-like sites may be related to the G-string family of transcription factors.

The present study extends the repertoire of cis-elements within the rLHR gene that are now known to confer cAMP responsiveness to the rLHR gene in differentiating granulosa cells. The identification of cis-elements conferring cAMP responsiveness to the rLHR gene in granulosa cells provides the foundation for further studies now identifying the transcription factors participating in cAMP responsiveness of the rLHR gene and the coordination and hierarchy of the multiple cAMP-responsive elements.


    Footnotes
 
1 These studies were supported by NIH Grant HD-33931 (to D.L.S.). The services and facilities of the University of Diabetes and Endocrinology Research Center, supported by NIH Grant DK-25295, are also acknowledged. Back

Received September 28, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Richards JS 1994 Hormonal control of gene expression in the ovary. Endocr Rev 15:725–751[CrossRef][Medline]
  2. Richards JS, Ireland JJ, Rao MC, Bernath GA, Midgley Jr AR 1976 Ovarian follicular development in the rat: hormone receptor regulation by estradiol, follicle stimulating hormone and luteinizing hormone. Endocrinology 99:1562–1570[Abstract]
  3. Uilenbroek JTJ, Richards JS 1979 Ovarian follicular development during the rat estrous cycle: gonadotropin receptors and follicular responsiveness. Biol Reprod 20:1159–1165[Abstract]
  4. Richards JS, Kersey KA 1989 Changes in theca and granulosa cell function in antral follicles developing during pregnancy in the rat: gonadotropin receptors, cyclic AMP, and estradiol-17ß. Biol Reprod 21:1185–1201[Abstract]
  5. Segaloff DL, Wang H, Richards JS 1990 Hormonal regulation of LH/CG receptor mRNA in rat ovarian cells during follicular development and luteinization. Mol Endocrinol 4:1856–1865[Abstract]
  6. Erickson GF, Wang C, Hsueh AJW 1979 FSH induction of functional LH receptors in granulosa cells cultured in a chemically defined medium. Nature 279:336–338[CrossRef][Medline]
  7. Segaloff DL, May J, Schomberg DW, Limbird L 1984 A model system for the biochemical study of luteinizing hormone/chorionic gonadotropin receptor synthesis. Biochim Biophys Acta 804:31–36[Medline]
  8. Knecht M, Catt KJ 1982 Induction of luteinizing hormone receptors by adenosine 3',5'-monophosphate in cultured granulosa cells. Endocrinology 111:1192–1200[Medline]
  9. Nimrod A 1981 The induction of ovarian LH-receptors by FSH is mediated by cyclic AMP. FEBS Lett 131:31–33[CrossRef][Medline]
  10. Erickson GF, Wang C, Casper R, Mattson G, Hofeditz C 1982 Studies on the mechanism of LH receptor control by FSH. Mol Cell Endocrinol 27:17–30[CrossRef][Medline]
  11. Shi H, Segaloff DL 1995 A role for increased lutropin/choriogonadotropin receptor (LHR) gene transcription in the follitropin-stimulated induction of the LHR in granulosa cells. Mol Endocrinol 9:734–744[Abstract]
  12. Wang H, Nelson S, Ascoli M, Segaloff D 1992 The 5'-flanking region of the rat luteinizing hormone/chorionic gonadotropin receptor gene confers Leydig cell expression and negative regulation of gene transcription by 3',5'-cyclic adenosine monophosphate. Mol Endocrinol 6:320–326[Abstract]
  13. Chen S, Shi H, Liu X, Segaloff DL 1999 Multiple elements and protein factors coordinate the basal and cAMP-induced transcription of the lutropin receptor gene in rat granulosa cells. Endocrinology 140:2100–2109[Abstract/Free Full Text]
  14. Chen S, Liu X, Segaloff DL 2000 A novel cyclic adenosine 3',5'-monophosphate-responsive element involved in the transcriptional regulation of the lutropin receptor gene in granulosa cells. Mol Endocrinol 14:1498–508[Abstract/Free Full Text]
  15. Nelson S, Liu X, Noblett L, Fabritz J, Ascoli M 1994 Characterization of the functional properties and nuclear binding proteins of the rat luteinizing hormone/chorionic gonadotropin receptor promoter in Leydig cells. Endocrinology 135:1729–1739[Abstract]
  16. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 53:304–308
  17. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR 1989 Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59[CrossRef][Medline]
  18. Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR 1989 Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77:61–68[CrossRef][Medline]
  19. Sanger F, Nicklen S, Coulson AR 1977 DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463–5467[Abstract/Free Full Text]
  20. Sirois J, Richards JS 1993 Transcriptional regulation of the rat prostaglandin endoperoxide synthase-2 gene in granulosa cells. J Biol Chem 268:21931–21938[Abstract/Free Full Text]
  21. Lynch JP, Lala DS, Peluso JJ, Luo W, Parker K, White BA 1993 Steroidogenic factor 1, an orphan nuclear receptor, regulates the expression of the rat aromatase gene in gonadal tissues. Mol Endocrinol 7:776–786[Abstract/Free Full Text]
  22. Tsai-Morris CH, Xie X, Wang W, Buczko E, Dufau ML 1993 Promoter and regulatory regions of the rat luteinizing hormone receptor gene. J Biol Chem 268:4447–4452[Abstract/Free Full Text]
  23. Pugh BF, Tjian R 1991 Transcription from a TATA-less promoter requires a multisubunit TFIID complex. Genes Dev 5:1935–1945[Abstract/Free Full Text]
  24. Xiang M, Lu S, Musso M, Karsenty G, Klein WH 1991 A G-string positive cis-regulatory element in the LpS1 promoter binds two distinct nuclear factors distributed non-uniformly in Lytechinus pictus embryos. Development 113:1345–1355[Abstract]
  25. Barresi R, Sirito M, Karsenty G, Ravazzolo R 1994 A negative cis-acting G-fer element participates in the regulation of expression of the human H-ferritin-encoding gene (FERH). Gene 140:195–201[CrossRef][Medline]
  26. Lewis CD, Clark SP, Felsenfeld G, Gould H 1988 An erythrocyte-specific protein that binds to the poly(dG) region of the chicken ß-globin gene promoter. Genes Dev 2:863–873[Abstract/Free Full Text]
  27. Clark SP, Lewis CD, Felsenfeld G 1990 Properties of BGP1, a poly(dG)-binding protein from chicken erythrocytes. Nucleic Acids Res 18:5119–5126[Abstract/Free Full Text]
  28. Karsenty G, de Crombrugghe B 1990 Two different negative and one positive regulatory factors interact with a short promoter segment of the {alpha}1(I) collagen gene. J Biol Chem 265:9934–9942[Abstract/Free Full Text]
  29. Karsenty G, de Crombrugghe B 1991 Conservation of regulatory elements in the promoters of the coordinately expressed {alpha}2(I) and {alpha}1(I) collagen genes. Biochem Biophys Res Commun 177:538–544[CrossRef][Medline]
  30. Christy B, Nathans D 1989 DNA binding site of the growth factor-inducible protein Zif268. Proc Natl Acad Sci USA 86:8737–8741[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
ReproductionHome page
J. L Juengel, K. L Reader, A. H Bibby, S. Lun, I. Ross, L. J Haydon, and K. P McNatty
The role of bone morphogenetic proteins 2, 4, 6 and 7 during ovarian follicular development in sheep: contrast to rat.
Reproduction, March 1, 2006; 131(3): 501 - 513.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. F. Couse, M. M. Yates, B. J. Deroo, and K. S. Korach
Estrogen Receptor-{beta} Is Critical to Granulosa Cell Differentiation and the Ovulatory Response to Gonadotropins
Endocrinology, August 1, 2005; 146(8): 3247 - 3262.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Youn, Y. Koo, I. Ji, and T. H. Ji
An Upstream Initiator-Like Element Suppresses Transcription of the Rat Luteinizing Hormone Receptor Gene
Mol. Endocrinol., May 1, 2005; 19(5): 1318 - 1328.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, S.
Right arrow Articles by Segaloff, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, S.
Right arrow Articles by Segaloff, D. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals