| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Cell Biology and Physiology (Z.B., J.P.S., L.I., A.J.Z.), University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261; and Department of Pediatrics, Northwestern University Medical School (G.L., A.S.), Chicago, Illinois 60614
Address all correspondence and requests for reprints to: Anthony J. Zeleznik, Ph.D., Department of Cell Biology and Physiology, University of Pittsburgh School of Medicine, S-327 Biomedical Science Tower, 3500 Terrace Street, Pittsburgh, Pennsylvania 15261. E-mail: zeleznik+{at}pitt.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Using these vectors, we compared effects of FSH and LH receptor
activation in undifferentiated granulosa cells. Stimulation of
undifferentiated granulosa cells by FSH and D578HLHr, as well as
activation of wild-type LHr with LH resulted in comparable production
of progesterone. In contrast, estradiol production in cells stimulated
with FSH was greater than that in cells that expressed either D578H
receptors or wild-type LHr in the presence of LH. Analysis of messenger
RNAs (mRNAs) revealed that activations of FSH and the LH receptors were
comparable in the induction of 
-inhibin and 3ßhydroxysteroid
dehydrogenase mRNAs. However, activation of FSH receptor led to
significantly greater expression of P450 aromatase and LHr mRNAs than
did activation of LHr. These results suggest that activation of FSH and
LH receptors in granulosa cells may differ with respect to activating
intracellular signaling pathways and stimulating gene expression.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Both FSH and LH stimulate cAMP production by granulosa cells (3, 4). However, the differences in the responses of granulosa cells to FSH and LH with respect to the pattern of steroid secretion (estrogen vs. progesterone) as well as cellular proliferation has led to the suggestion that there may be signaling pathways in addition to cAMP that are used differentially by FSH and LH (2, 5). A difficulty in comparing the responses of granulosa cells to FSH and LH is that to analyze the actions of LH, granulosa cells must first be stimulated by FSH to induce LH receptors. Thus, it is uncertain whether any differences in the responses of granulosa cells to FSH and LH receptor activation are due to differences in intracellular signaling or whether they are due to development-dependent, FSH-mediated changes in expression of steroidogenic enzymes and other regulatory proteins involved in granulosa cell differentiation.
For ongoing studies on regulation of the primate corpus luteum, we developed adenovirus vectors that direct the expression of either the wild-type human LHr or the constitutively activated D578H human LHr (6), with the goal of using these for in vivo studies in monkeys. To test the functionality of these vectors, we used them to infect undifferentiated rat granulosa cells. Herein we show that these vectors are able to confer LH responsiveness to immature undifferentiated rat granulosa cells and moreover that there may be differences in the responses of undifferentiated granulosa cells to activation of FSH and LH receptors.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Adenovirus shuttle vectors pAdRSVwtLHr-c-FLAG-NpA and pAdRSV D578H LHr-c-FLAG-NpA were constructed identically. A 2147-bp insert containing either the wtLHr or the D578H LHr-coding region fused in-frame to a sequence encoding the FLAG epitope (GACTACAAGGACGACGATGACAAG) upstream from the stop codon was excised from the expression vectors pSG5wtLHr c-FLAG and pSG5 D578HLHr c-FLAG by digestion with EcoRI (Promega Corp., Madison WI) and subcloned by blunt end ligation into EcoRV-digested adenovirus shuttle vector pAd5RSVK-NpA (gift from Dr. Beverly L. Davidson, Department of Internal Medicine, University of Iowa College of Medicine, Ames, IA). Addition of the C-terminal FLAG epitope has no effect on the expression or functional activity of the wt and D578H mutant receptor (our unpublished results).
Ten micrograms of either pAdRSVwtLHr-c-FLAG-NpA or pAdRSV D578H LHr-c-FLAG-NpA were cotransfected with 10 µg of the plasmid pJM17, a plasmid containing a circularized adenovirus type 5 (variant dl309) genome (7), into the human embryonic kidney cell line 293 (8) using a calcium phosphate transfection system according to the manufacturer’s instructions (Life Technologies, Inc., Gaithersburg, MD). Twenty-four hours later, the cells were overlaid with semisolid medium consisting of 1.0% (wt/vol) GTG-low melting point agarose (FMC Corp., Rockland, ME) in Dulbecco’s Modified Eagle’s Medium containing 4.5 g/liter glucose (Life Technologies, Inc.) and 3% FBS at 37 C in 5% CO2. Fourteen days after transfection, plaques exhibiting viral cytopathic effect were identified and collected. Cells and virus from individual plaques were frozen on dry ice, thawed three times, and further propagated in 293 cells. When the cells exhibited complete viral cytopathic effect, the cells and medium were collected, frozen on dry ice three times, and then centrifuged (1000 x g, 4 C, 10 min) to remove cellular debris. Aliquots of virus stocks were diluted 50- and 100-fold in lysis solution [0.1% SDS, 10 mM Tris-HCl (pH 7.4), and 1 mM EDTA] and incubated for 10 min at 56 C in a shaking water bath. The OD of the samples was measured at 260 nm, and the value obtained was used to calculate virus content using the equation 1012 virus particles/ml/OD 260 U (9). Adenoviruses were propagated by infecting 293 cells with approximately 108 particles/ml in tissue culture medium without serum. Infected cells were incubated until they exhibited a nearly complete cytopathic effect and were processed as described above. Virus stocks were prepared to a concentration of 5 x 1012 particles/ml as described above and were diluted for use as indicated in Results.
[125I]hCG binding analysis
COS-1 cells, maintained in Dulbecco’s Modified Eagle’s Medium
and 10% FBS, were infected with AdRSVwtLHr or AdRSV D578H LHr (5
x 1010 particles/ml). Seventy-two hours after
infection, cells were scraped from the culture dishes and resuspended
in PBS-0.1% BSA. [125I]hCG (CR 123) was
prepared to a specific activity of 60–100 µCi/µg by the
chloramine-T method (10). Aliquots of COS-1 cells (50 µg
total cell protein) were incubated in duplicate with 1 x
105 cpm [125I]hCG in a
total volume of 250 µl for 6 h at room temperature in the
absence and presence of varying concentrations of unlabeled hFSH or
hLH. After incubation, cells were washed with 2 ml PBS-0.1% BSA and
centrifuged at 3000 x g for 30 min. The supernatant
was decanted, and cell-associated radioactivity was measured with a
-spectrometer.
Granulosa cell culture
All procedures were approved by the University of Pittsburgh
Institutional animal use and care committee. Immature female rats (20
or 25 days old) were purchased from Taconic Farms, Inc.
(Germantown, NY). Granulosa cells were collected from the ovaries by
puncturing follicles with a 25-gauge hypodermic needle, and cells were
expressed into medium 199 (M199; Life Technologies, Inc.)
containing 10% FBS. Granulosa cells were seeded into 6-well
(
106 cells/well) or 24-well (2 x
105 cells/well) tissue culture plates and allowed
to attach overnight. The next morning, medium and unattached cells were
removed, and the granulosa cell monolayers were exposed to adenoviruses
in M199 without protein supplements for 2 h at 37 C with
occasional rocking. Medium was replaced with fresh M199 containing 1
mg/ml BSA. Twenty-four hours after exposure to adenoviruses, medium was
removed and replaced with M199 plus BSA also containing 50 ng/ml
testosterone alone or in combination with hFSH or hLH. Forty-eight
hours after the addition of hormones, tissue culture medium was
collected, boiled for 10 min to inactivate phosphodiesterases, and
stored at -20 C for subsequent RIAs. Total RNA was prepared from the
cell monolayers using RNAzol B (Tel-Test, Inc.,
Friendswood, TX) according to the manufacturer’s directions.
Messenger RNA (mRNA) analysis
Samples of total RNA (1–5 µg) were analyzed for mRNAs for
cytochrome P450 aromatase (P450arom), 3ß-hydroxysteroid dehydrogenase
(3ßHSD), the -subunit of inhibin, and the LH receptor by
ribonuclease protection assay according to the instructions provided by
the supplier (Ambion, Inc., Austin, TX). Antisense RNA
probes were prepared using [32P]UTP from the
following complementary DNA inserts: P450arom (bp 1034–1295)
(11), rat LH receptor (bp 1–622) (12),
-subunit of inhibin (bp 694-1095) (13), 3ßHSD (bp
453–932) (14), and cyclophylin (bp 34–142)
(15). Following electrophoresis (5% acrylamide containing
8 M urea), gels were dried and exposed to x-ray film for
16–96 h. Densitometric analysis of protected RNA fragments was
performed using NIH Image (version 1.61). Densitometric signals from
individual bands were divided by the respective density for cyclophylin
to correct for differences in gel loading. For data presentation and
statistical analysis, all values for individual mRNAs are expressed in
relationship to the mean signal intensity of the respective mRNA in
response to stimulation by 100 ng/ml FSH.
RIA
Estradiol and progesterone concentrations in culture medium were
determined by RIAs as described previously (16). cAMP
concentrations in culture medium were analyzed by RIA using
[125I]cAMP-TME (2–0'-monosuccinlyl cAMP
tyrosine methyl ester) (17) and anti-cAMP in accordance
with the instructions provided by the National Hormone and Pituitary
Program.
Statistics
Results were assessed for statistical significance by AVOVA,
followed by comparison of group means with Fisher’s least significant
difference analysis (StatView version 4.5, Abacus Concepts, Berkeley,
CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, functional LH/hCGbinding sites were expressed in cells infected
with both AdRSVwtLHr and AdRSVD578HLHr. Binding of
[125I]hCG was specific, as unlabeled hLH, but
not hFSH, effectively competed with [125I]hCG
for binding to ectopically expressed LH receptors.
|
, immature
rat granulosa cells infected with AdRSVwtLHr did not exhibit enhanced
steroid production in the absence of hLH, but addition of hLH to the
medium led to the production of estrogen and progesterone. Exposure to
Ad RSV D578HLHr led to increased production of both estradiol and
progesterone by immature granulosa cells in the absence of stimulation
by hLH, as would be predicted by the LH-independent constitutive
activity of this mutant LH receptor. For both the wild-type and
constitutively activated LH receptors, the absolute levels of steroid
production were dependent upon the input viral titers, as
increases in progesterone and estradiol production were observed in
response to increases in exposure to both AdRSVwtLHr and
AdRSVD578HLHr.
|
, as
expected, both estrogen and progesterone production by undifferentiated
granulosa cells was stimulated by FSH, whereas these cells were
unresponsive to LH because they lack LH receptors. Infection of cells
with Ad RSVLHrwt did not affect basal steroidogenesis (as depicted by
the LHrwt-LH bars), but conferred LH responsiveness with respect to
both estrogen and progesterone production, as indicated by the LHrwt+LH
bars. The constitutively activated LHr stimulated estrogen and
progesterone production independently of gonadotropic stimulation.
|
Comparison of mRNAs associated with granulosa cell differentiation
in response to stimulation through the native FSH receptor and
virus-directed LH receptors
After collection of medium from granulosa cells for the steroid
analysis shown in Fig 3
, total RNA was prepared from the cells and
analyzed for levels of mRNA for -inhibin, 3ßHSD, LHr, and P450arom
by ribonuclease protection assays. As shown in Fig. 4, stimulation of immature granulosa
cells by FSH resulted in a significant increase in -inhibin,
3ßHSD, LHr, and P450arom mRNAs (P < 0.05) compared
to unstimulated cells. Likewise, granulosa cells expressing the
wild-type hLH receptor and stimulated by LH as well as granulosa cells
expressing the constitutively activated D578HLHr showed significant
increases in -inhibin mRNA levels (P < 0.05).
However, cells expressing the wild-type LHr and stimulated by LH as
well as cells expressing the constitutively activated D578HLHr
exhibited a much weaker stimulation of 3ßHSD and P450arom compared to
FSH, whereas a detectable LHr mRNA fragment was not seen in RNA
prepared from these cells.
|
) revealed that although both
activation of the native FSH receptor as well as the recombinant LHr
stimulated cAMP production, there were differences in the absolute
amounts of cAMP produced in response to the individual treatments. In
particular, levels of cAMP were higher in cells stimulated by FSH than
in cells that expressed either the wild-type LHr or the constitutively
activated LH receptor.
|
, comparable levels of cAMP were
produced in response to 25 ng/ml FSH and AdRSVD578HLHr at a dilution of
1:150 and in response to FSH at 100 ng/ml and AdRSV D578H LHr at a
dilution of 1:100. Granulosa cells infected with AdRSVD578HLHr at an
input of 1:50 produced slightly greater amounts of cAMP than FSH at 100
ng/ml.
|
illustrates estrogen and
progesterone production levels in this set of experiments. Progesterone
production was similar in response to activation of either FSH or LH
receptors. Mean estradiol levels were greater in response to FSH
stimulation compared with cells expressing the constitutively activated
LHr. However, these differences did not reach statistical significance
at the 0.05 level.
|
illustrates that -inhibin
mRNA levels were stimulated at all concentrations of FSH and all inputs
of AdRSVD578HLHr. Likewise, both stimulation by FSH and expression of
the constitutively activated LH receptor stimulated 3ßHSD mRNA
accumulation. At equivalent production rates of cAMP, FSH stimulation
led to a greater expression of P450arom than did expression of
D578HLHr. Similar to the results shown in Fig. 4, AdRSVD578HLHr was
relatively ineffective in stimulating LHr mRNA. There were no
significant differences between FSH (25 or 100 ng/ml) and AdRSV
D578HLHr at 1:150 or 1:100 dilution on the expression of -inhibin
mRNA. Likewise, there were no significant differences between FSH at 25
ng/ml and AdRSV D578HLHr at 1:150 or between FSH at 100 ng/ml and
AdRSVD578H LHr at 1:100 in the stimulation of 3ßHSD mRNA. FSH at 100
ng/ml was more effective than AdRSVD578HLHr at 1:150, 1:100, and 1:50
dilutions with respect to induction of P450arom and LHr mRNAs
(P < 0.05).
|
-inhibin, 3ßHSD, P450arom, and the LH receptor.
Results presented in Fig. 7 demonstrate
again that FSH stimulation selectively induces mRNAs for the LHr as
well as P450arom and that the responses of undifferentiated granulosa
cells to FSK and 8BrcAMP were similar to activation of the LH
receptor.
|
-inhibin were similar for FSH-stimulated cells in the presence or
absence of AdRSVß-gal (data not shown). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We demonstrated previously that replication-defective adenovirus vectors are able to efficiently direct the expression of recombinant proteins in granulosa cells as more than 90% of granulosa cells in primary culture exhibit adenovirus-directed expression of ß-galactosidase and green fluorescent protein reporter genes without adverse effects on cellular function (26). Because virtually all cells in culture are infected by virus, direct analysis of specific proteins on granulosa cell function can be assessed. In the current study, using adenovirus vectors that direct the expression of wild-type and a constitutively activated human LHr, we compared the responses of immature rat granulosa cells to FSH and LH, thereby eliminating the confounding variable of FSH-induced cellular differentiation.
Our current findings indicate that activation of the FSH receptor
appeared to be more effective than activation of the LHr on the
induction of mRNAs for aromatase and the LHr, whereas both receptors
were similar with respect to stimulation of mRNAs encoding -inhibin
and 3ßHSD. Functionally, the FSHr appeared to be more effective in
stimulating estrogen production, whereas progesterone production in
response to activation of FSH and LH receptors was comparable. The
differences in the responses to activation of FSH and LH did not appear
to be due to differences in the absolute levels of cAMP accumulation,
as adjusting the FSH concentrations and the concentrations of
AdRSVD578HLHr to produce comparable levels of cAMP still resulted in
the differential induction of aromatase and LHr mRNAs by FSH. Our
observation that the preferential induction of the LHr by FSH in the
presence of comparable levels of cAMP is in agreement with the previous
findings of Welsh et al. (27) that demonstrated
that FSH was more effective than forskolin in inducing LHr on immature
granulosa cells at concentrations of each that resulted in similar
production rates of cAMP and comparable levels of progesterone
production. Similarly, Davoren and Hsueh (28) demonstrated
that although FSH and vasoactive intestinal peptide stimulated
progesterone production comparably by immature granulosa cells, FSH was
more effective in inducing LHr. Thus, under a number of different
approaches the FSH receptor, which is the physiological regulator of
granulosa cell differentiation, appears to be more effective than other
agents that stimulate cAMP production in regulating the hallmark genes
involved in granulosa cell differentiation, P450 aromatase and the LHr.
Physiologically, this could protect the ovary from inappropriate
stimulation by other cAMP-stimulating agents such as catecholamines,
etc.
Preferential action of FSH on immature granulosa cells is not absolute, in that activation of the wild-type LHr by LH as well as expression of the constitutively activated LHr did result in the induction of aromatase mRNA and estrogen production, albeit to an apparently lesser extent than did FSH. Likewise, although of very low intensity, we did observe protected fragments for the rat LHr in cells stimulated by AdRSV D578HLHr. These observations indicate that the activation of FSH and LH receptors does not result in unique responses of granulosa cells to each receptor, but, rather, that there is overlap between the activities of FSH and LH receptors. As documented in the literature, this is also apparent in granulosa cells that have undergone FSH-mediated differentiation. In these cells, substituting FSH with LH maintained their differentiated phenotype (29). Physiologically, this overlap may play a fundamental role in the process of follicular selection as recent studies in humans and sheep have shown that LH is able to maintain follicular development in the presence of declining FSH concentrations (30, 31). Finally, the observations that at appropriate dosages, recombinant FSH in the absence of LH is able to stimulate follicular development, ovulation, and luteinization in hypophysectomized rats indicates that overlap in the activities of FSH and LH receptors can occur at all stages of follicular growth (32).
The preferential ability of the FSHr to stimulate aromatase and LH receptor expression, however, suggests that intracellular signaling pathways may also be differentially activated by FSH and LH. On the one hand, FSH may activate additional pathways compared to LH. On the other hand, LH may activate pathways that are inhibitory to the actions of FSH. Both FSH and LH have been shown to coactivate a number of intracellular pathways including Ca2+ mobilization (33, 34), mitogen-activated protein kinase (35, 36), and tyrosine kinase pathways (37, 38). Recently, FSH has been shown to activate the protein kinase B pathway in a protein kinase-A independent fashion (39), and Babu et al. identified a unique FSH receptor variant that selectively stimulates the mitogen-activated protein kinase pathway (40). One pathway that appears to be activated preferentially by LH is phospholipase C (41, 42, 43). Downstream targets of this signaling system include the protein kinase C pathway, and pharmacological stimulation of the protein kinase C pathway has been shown to antagonize the effects of FSH on granulosa cell differentiation (44). In this regard, the D578H mutant LHr that we ectopically expressed in immature granulosa cells also confers constitutive activation of phospholipase C (6). Finally, although we achieved comparable 48-h production rates of cAMP in response to FSH and AdRSVD578HLHr, the possibility that subtle differences in the time course of cAMP production in response to FSH and LH receptor activation may have resulted in differential regulation of target genes cannot be excluded.
Many more genes than those studied in this report are influenced by FSH and LH (2). The extent to which each may be regulated (activated or repressed) by absolute levels of cAMP, different intracellular signaling pathways, or combinations of both have yet to be established. The strategy described in this report could provide a novel approach to examining this question.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received September 11, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
5–4-isomerase expression in rat
and characterization of the testis isoform. Mol Cell Endocrinol: 80:21–31[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  R. Escamilla-Hernandez, L. Little-Ihrig, K. E. Orwig, J. Yue, U. Chandran, and A. J. Zeleznik Constitutively Active Protein Kinase A Qualitatively Mimics the Effects of Follicle-Stimulating Hormone on Granulosa Cell Differentiation Mol. Endocrinol., August 1, 2008; 22(8): 1842 - 1852. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Herrmann-Lavoie, C. V. Rao, and A. Akoum Chorionic Gonadotropin Down-Regulates the Expression of the Decoy Inhibitory Interleukin 1 Receptor Type II in Human Endometrial Epithelial Cells Endocrinology, November 1, 2007; 148(11): 5377 - 5384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Saxena, R. Escamilla-Hernandez, L. Little-Ihrig, and A. J. Zeleznik Liver Receptor Homolog-1 and Steroidogenic Factor-1 Have Similar Actions on Rat Granulosa Cell Steroidogenesis Endocrinology, February 1, 2007; 148(2): 726 - 734. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Andric and M. Ascoli A Delayed Gonadotropin-Dependent and Growth Factor-Mediated Activation of the Extracellular Signal-Regulated Kinase 1/2 Cascade Negatively Regulates Aromatase Expression in Granulosa Cells Mol. Endocrinol., December 1, 2006; 20(12): 3308 - 3320. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. N. Parakh, J. A. Hernandez, J. C. Grammer, J. Weck, M. Hunzicker-Dunn, A. J. Zeleznik, and J. H. Nilson Follicle-stimulating hormone/cAMP regulation of aromatase gene expression requires beta-catenin PNAS, August 15, 2006; 103(33): 12435 - 12440. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Mihm, P.J. Baker, J.L.H. Ireland, G.W. Smith, P.M. Coussens, A.C.O. Evans, and J.J. Ireland Molecular Evidence That Growth of Dominant Follicles Involves a Reduction in Follicle-Stimulating Hormone Dependence and an Increase in Luteinizing Hormone Dependence in Cattle Biol Reprod, June 1, 2006; 74(6): 1051 - 1059. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. X. Donadeu and M. Ascoli The Differential Effects of the Gonadotropin Receptors on Aromatase Expression in Primary Cultures of Immature Rat Granulosa Cells Are Highly Dependent on the Density of Receptors Expressed and the Activation of the Inositol Phosphate Cascade Endocrinology, September 1, 2005; 146(9): 3907 - 3916. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D.X. Lin, Z.M. Lei, and Ch.V. Rao Dependence of Uterine Cyclooxygenase2 Expression on Luteinizing Hormone Signaling Biol Reprod, August 1, 2005; 73(2): 256 - 260. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Saxena, R. Safi, L. Little-Ihrig, and A. J. Zeleznik Liver Receptor Homolog-1 Stimulates the Progesterone Biosynthetic Pathway during Follicle-Stimulating Hormone-Induced Granulosa Cell Differentiation Endocrinology, August 1, 2004; 145(8): 3821 - 3829. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Allan, A. Garcia, J. Spaliviero, F.-P. Zhang, M. Jimenez, I. Huhtaniemi, and D. J. Handelsman Complete Sertoli Cell Proliferation Induced by Follicle-Stimulating Hormone (FSH) Independently of Luteinizing Hormone Activity: Evidence from Genetic Models of Isolated FSH Action Endocrinology, April 1, 2004; 145(4): 1587 - 1593. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Zeleznik, D. Saxena, and L. Little-Ihrig Protein Kinase B Is Obligatory for Follicle-Stimulating Hormone-Induced Granulosa Cell Differentiation Endocrinology, September 1, 2003; 144(9): 3985 - 3994. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Conti Specificity of the Cyclic Adenosine 3',5'-Monophosphate Signal in Granulosa Cell Function Biol Reprod, December 1, 2002; 67(6): 1653 - 1661. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
