help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bebia, Z.
Right arrow Articles by Zeleznik, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bebia, Z.
Right arrow Articles by Zeleznik, A. J.
Endocrinology Vol. 142, No. 6 2252-2259
Copyright © 2001 by The Endocrine Society

ARTICLES

Adenovirus-Directed Expression of Functional Luteinizing Hormone (LH) Receptors in Undifferentiated Rat Granulosa Cells: Evidence for Differential Signaling through Follicle-Stimulating Hormone and LH Receptors1

Zourab Bebia, Jeremy P. Somers, Guoquan Liu, Lynda Ihrig, Andrew Shenker and Anthony J. Zeleznik

Department of Cell Biology and Physiology (Z.B., J.P.S., L.I., A.J.Z.), University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261; and Department of Pediatrics, Northwestern University Medical School (G.L., A.S.), Chicago, Illinois 60614

Address all correspondence and requests for reprints to: Anthony J. Zeleznik, Ph.D., Department of Cell Biology and Physiology, University of Pittsburgh School of Medicine, S-327 Biomedical Science Tower, 3500 Terrace Street, Pittsburgh, Pennsylvania 15261. E-mail: zeleznik+{at}pitt.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study was conducted to determine the feasibility of using replication-defective adenovirus vectors to express receptors for LH. Two vectors were constructed, one that directs the expression of wild-type human LH receptor (LHr; AdRSVLHrwt) and another that directs the expression of the constitutively activated D578H mutant human LH receptor (AdRSVD578HLHr). When infected with AdRSVwtLHr and AdRSVD578HLHr, COS-1 cells expressed LH/hCG-binding sites as reflected by specific binding of [125I]hCG. To determine the ability of the vectors to confer LH responsiveness, undifferentiated rat granulosa cells, which possess only FSH receptors, were infected with AdRSVwtLHr and AdRSVD578HLHr. Expression of the constitutively activated D578H LHr increased basal (gonadotropin-independent) estrogen and progesterone production. Expression of the wild-type LHr in granulosa cells did not stimulate basal steroid production, but conferred responsiveness to exogenous LH. For both wild-type LHr and D578HLHr, the absolute levels of steroid production were dependent upon the input of viral titers.

Using these vectors, we compared effects of FSH and LH receptor activation in undifferentiated granulosa cells. Stimulation of undifferentiated granulosa cells by FSH and D578HLHr, as well as activation of wild-type LHr with LH resulted in comparable production of progesterone. In contrast, estradiol production in cells stimulated with FSH was greater than that in cells that expressed either D578H receptors or wild-type LHr in the presence of LH. Analysis of messenger RNAs (mRNAs) revealed that activations of FSH and the LH receptors were comparable in the induction of {alpha}-inhibin and 3ßhydroxysteroid dehydrogenase mRNAs. However, activation of FSH receptor led to significantly greater expression of P450 aromatase and LHr mRNAs than did activation of LHr. These results suggest that activation of FSH and LH receptors in granulosa cells may differ with respect to activating intracellular signaling pathways and stimulating gene expression.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
FOLLICULAR DEVELOPMENT is dependent upon the successive actions of FSH and LH. FSH, acting on immature early antral follicles, stimulates the expression of aromatase as well as the expression of the LH receptor (LHr). LH, acting on the FSH-stimulated follicle, stimulates luteinization of the follicle and the production of progesterone by the luteinizing granulosa cells (1, 2).

Both FSH and LH stimulate cAMP production by granulosa cells (3, 4). However, the differences in the responses of granulosa cells to FSH and LH with respect to the pattern of steroid secretion (estrogen vs. progesterone) as well as cellular proliferation has led to the suggestion that there may be signaling pathways in addition to cAMP that are used differentially by FSH and LH (2, 5). A difficulty in comparing the responses of granulosa cells to FSH and LH is that to analyze the actions of LH, granulosa cells must first be stimulated by FSH to induce LH receptors. Thus, it is uncertain whether any differences in the responses of granulosa cells to FSH and LH receptor activation are due to differences in intracellular signaling or whether they are due to development-dependent, FSH-mediated changes in expression of steroidogenic enzymes and other regulatory proteins involved in granulosa cell differentiation.

For ongoing studies on regulation of the primate corpus luteum, we developed adenovirus vectors that direct the expression of either the wild-type human LHr or the constitutively activated D578H human LHr (6), with the goal of using these for in vivo studies in monkeys. To test the functionality of these vectors, we used them to infect undifferentiated rat granulosa cells. Herein we show that these vectors are able to confer LH responsiveness to immature undifferentiated rat granulosa cells and moreover that there may be differences in the responses of undifferentiated granulosa cells to activation of FSH and LH receptors.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Unless otherwise noted, all regents were purchased from Sigma (St. Louis, MO). Human FSH (AFP-4161-B; 3205 IU Second International Reference Preparation of FSH/mg, 225 IU Second International Reference Preparation of LH/mg), human LH (AFP-0642-B; 4015 IU Second International Reference Preparation of LH/mg, <5 IU Second International Reference Preparation of FSH/mg), and antiserum to cAMP (lot CV-27) were provided by the National Hormone and Pituitary Program, NIDDK, NIH.

Adenovirus shuttle vectors pAdRSVwtLHr-c-FLAG-NpA and pAdRSV D578H LHr-c-FLAG-NpA were constructed identically. A 2147-bp insert containing either the wtLHr or the D578H LHr-coding region fused in-frame to a sequence encoding the FLAG epitope (GACTACAAGGACGACGATGACAAG) upstream from the stop codon was excised from the expression vectors pSG5wtLHr c-FLAG and pSG5 D578HLHr c-FLAG by digestion with EcoRI (Promega Corp., Madison WI) and subcloned by blunt end ligation into EcoRV-digested adenovirus shuttle vector pAd5RSVK-NpA (gift from Dr. Beverly L. Davidson, Department of Internal Medicine, University of Iowa College of Medicine, Ames, IA). Addition of the C-terminal FLAG epitope has no effect on the expression or functional activity of the wt and D578H mutant receptor (our unpublished results).

Ten micrograms of either pAdRSVwtLHr-c-FLAG-NpA or pAdRSV D578H LHr-c-FLAG-NpA were cotransfected with 10 µg of the plasmid pJM17, a plasmid containing a circularized adenovirus type 5 (variant dl309) genome (7), into the human embryonic kidney cell line 293 (8) using a calcium phosphate transfection system according to the manufacturer’s instructions (Life Technologies, Inc., Gaithersburg, MD). Twenty-four hours later, the cells were overlaid with semisolid medium consisting of 1.0% (wt/vol) GTG-low melting point agarose (FMC Corp., Rockland, ME) in Dulbecco’s Modified Eagle’s Medium containing 4.5 g/liter glucose (Life Technologies, Inc.) and 3% FBS at 37 C in 5% CO2. Fourteen days after transfection, plaques exhibiting viral cytopathic effect were identified and collected. Cells and virus from individual plaques were frozen on dry ice, thawed three times, and further propagated in 293 cells. When the cells exhibited complete viral cytopathic effect, the cells and medium were collected, frozen on dry ice three times, and then centrifuged (1000 x g, 4 C, 10 min) to remove cellular debris. Aliquots of virus stocks were diluted 50- and 100-fold in lysis solution [0.1% SDS, 10 mM Tris-HCl (pH 7.4), and 1 mM EDTA] and incubated for 10 min at 56 C in a shaking water bath. The OD of the samples was measured at 260 nm, and the value obtained was used to calculate virus content using the equation 1012 virus particles/ml/OD 260 U (9). Adenoviruses were propagated by infecting 293 cells with approximately 108 particles/ml in tissue culture medium without serum. Infected cells were incubated until they exhibited a nearly complete cytopathic effect and were processed as described above. Virus stocks were prepared to a concentration of 5 x 1012 particles/ml as described above and were diluted for use as indicated in Results.

[125I]hCG binding analysis
COS-1 cells, maintained in Dulbecco’s Modified Eagle’s Medium and 10% FBS, were infected with AdRSVwtLHr or AdRSV D578H LHr (5 x 1010 particles/ml). Seventy-two hours after infection, cells were scraped from the culture dishes and resuspended in PBS-0.1% BSA. [125I]hCG (CR 123) was prepared to a specific activity of 60–100 µCi/µg by the chloramine-T method (10). Aliquots of COS-1 cells (50 µg total cell protein) were incubated in duplicate with 1 x 105 cpm [125I]hCG in a total volume of 250 µl for 6 h at room temperature in the absence and presence of varying concentrations of unlabeled hFSH or hLH. After incubation, cells were washed with 2 ml PBS-0.1% BSA and centrifuged at 3000 x g for 30 min. The supernatant was decanted, and cell-associated radioactivity was measured with a {gamma}-spectrometer.

Granulosa cell culture
All procedures were approved by the University of Pittsburgh Institutional animal use and care committee. Immature female rats (20 or 25 days old) were purchased from Taconic Farms, Inc. (Germantown, NY). Granulosa cells were collected from the ovaries by puncturing follicles with a 25-gauge hypodermic needle, and cells were expressed into medium 199 (M199; Life Technologies, Inc.) containing 10% FBS. Granulosa cells were seeded into 6-well (~106 cells/well) or 24-well (~2 x 105 cells/well) tissue culture plates and allowed to attach overnight. The next morning, medium and unattached cells were removed, and the granulosa cell monolayers were exposed to adenoviruses in M199 without protein supplements for 2 h at 37 C with occasional rocking. Medium was replaced with fresh M199 containing 1 mg/ml BSA. Twenty-four hours after exposure to adenoviruses, medium was removed and replaced with M199 plus BSA also containing 50 ng/ml testosterone alone or in combination with hFSH or hLH. Forty-eight hours after the addition of hormones, tissue culture medium was collected, boiled for 10 min to inactivate phosphodiesterases, and stored at -20 C for subsequent RIAs. Total RNA was prepared from the cell monolayers using RNAzol B (Tel-Test, Inc., Friendswood, TX) according to the manufacturer’s directions.

Messenger RNA (mRNA) analysis
Samples of total RNA (1–5 µg) were analyzed for mRNAs for cytochrome P450 aromatase (P450arom), 3ß-hydroxysteroid dehydrogenase (3ßHSD), the {alpha}-subunit of inhibin, and the LH receptor by ribonuclease protection assay according to the instructions provided by the supplier (Ambion, Inc., Austin, TX). Antisense RNA probes were prepared using [32P]UTP from the following complementary DNA inserts: P450arom (bp 1034–1295) (11), rat LH receptor (bp 1–622) (12), {alpha}-subunit of inhibin (bp 694-1095) (13), 3ßHSD (bp 453–932) (14), and cyclophylin (bp 34–142) (15). Following electrophoresis (5% acrylamide containing 8 M urea), gels were dried and exposed to x-ray film for 16–96 h. Densitometric analysis of protected RNA fragments was performed using NIH Image (version 1.61). Densitometric signals from individual bands were divided by the respective density for cyclophylin to correct for differences in gel loading. For data presentation and statistical analysis, all values for individual mRNAs are expressed in relationship to the mean signal intensity of the respective mRNA in response to stimulation by 100 ng/ml FSH.

RIA
Estradiol and progesterone concentrations in culture medium were determined by RIAs as described previously (16). cAMP concentrations in culture medium were analyzed by RIA using [125I]cAMP-TME (2–0'-monosuccinlyl cAMP tyrosine methyl ester) (17) and anti-cAMP in accordance with the instructions provided by the National Hormone and Pituitary Program.

Statistics
Results were assessed for statistical significance by AVOVA, followed by comparison of group means with Fisher’s least significant difference analysis (StatView version 4.5, Abacus Concepts, Berkeley, CA).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Adenovirus-directed expression of wild-type and constitutively activated D578H human LHr
COS-1 cells were infected with Ad RSVwtLHr and AdRSVD578HLHr, and 72 h later [125I]hCG binding was assessed. As shown in Fig. 1Go, functional LH/hCGbinding sites were expressed in cells infected with both AdRSVwtLHr and AdRSVD578HLHr. Binding of [125I]hCG was specific, as unlabeled hLH, but not hFSH, effectively competed with [125I]hCG for binding to ectopically expressed LH receptors.



View larger version (18K):
[in this window]
[in a new window]
  		Figure 1. Adenovirus vectors direct the expression of [125I]hCG-binding sites in COS-1 cells. COS-1 cells were infected with either AdRSVLHrwt or AdRSV D578HLHr at a titer of 5 x 1010 particles/ml. Seventy-two hours later cells were scraped from culture dishes, and aliquots of cells (~50 mg cell protein) were incubated with 1 x 105 cpm [125I]hCG in the presence or absence of increasing amounts of unlabeled hFSH or LH. Free hormone was removed by centrifugation, and cell-associated radioactivity was measured. Untreated COS-1 cells did not exhibit [125I]hCG binding above background levels. Results show means of duplicate incubations.

 
To determine whether the adenovirus vectors also confer LH responsiveness, immature rat granulosa cells, which lack LH receptors, were infected with various concentrations of AdRSVwtLHr and AdRSVD578HLHr and incubated in medium 199 and 0.1% BSA for 24 h. Granulosa cells infected with AdRSVwtLHr were then incubated for 48 h in the presence or absence of 100 ng/ml hLH, whereas cells infected with AdRSVD578HLHr were incubated in the absence of LH for 48 h. As shown in Fig. 2Go, immature rat granulosa cells infected with AdRSVwtLHr did not exhibit enhanced steroid production in the absence of hLH, but addition of hLH to the medium led to the production of estrogen and progesterone. Exposure to Ad RSV D578HLHr led to increased production of both estradiol and progesterone by immature granulosa cells in the absence of stimulation by hLH, as would be predicted by the LH-independent constitutive activity of this mutant LH receptor. For both the wild-type and constitutively activated LH receptors, the absolute levels of steroid production were dependent upon the input viral titers, as increases in progesterone and estradiol production were observed in response to increases in exposure to both AdRSVwtLHr and AdRSVD578HLHr.



View larger version (26K):
[in this window]
[in a new window]
  		Figure 2. Replication-defective adenovirus vectors confer LH responsiveness to undifferentiated rat granulosa cells. Undifferentiated rat granulosa cells were plated overnight in the medium 199 containing 10% FBS. The next morning medium and unattached cells were removed, and monolayers were exposed to adenoviruses (LHr wild-type or LHr D578H) for 2 h, after which the virus-containing medium was removed and replaced with fresh medium 199 and 1 mg/ml BSA. After 24 h, medium was replaced with fresh medium 199 and BSA, 50 ng/ml testosterone, and LH (100 ng/ml). Forty-eight hours later medium was collected and analyzed for estradiol and progesterone content by RIA. The 1:100 dilution of adenovirus corresponds to a viral titer of 5 x 1010 particles/ml. Results show the mean ± 1 SEM of three separate groups of granulosa cells.

 
Comparison of the steroidogenic responses of immature rat granulosa cells to stimulation through the native FSH receptor and virus-directed LH receptors
Undifferentiated granulosa cells were stimulated with FSH or were infected with adenoviruses that direct the expression of wild-type or a constitutively activated LH receptor to determine whether there are differences in the responses of these cells to activation of FSH and LH receptors. As shown in Fig. 3Go, as expected, both estrogen and progesterone production by undifferentiated granulosa cells was stimulated by FSH, whereas these cells were unresponsive to LH because they lack LH receptors. Infection of cells with Ad RSVLHrwt did not affect basal steroidogenesis (as depicted by the LHrwt-LH bars), but conferred LH responsiveness with respect to both estrogen and progesterone production, as indicated by the LHrwt+LH bars. The constitutively activated LHr stimulated estrogen and progesterone production independently of gonadotropic stimulation.



View larger version (24K):
[in this window]
[in a new window]
  		Figure 3. Steroidogenic responses of undifferentiated granulosa cells and those expressing wild-type and constitutively activated D578H LH receptors. Undifferentiated rat granulosa cells were plated overnight in medium 199 containing 10% FCS. The next morning medium and unattached cells were removed, and monolayers were exposed to medium alone or adenoviruses (LHr wild-type or LHr D578H) at a 1:100 dilution (5 x 1010 particles/ml) for 2 h, after which the virus-containing medium was removed and replaced with fresh medium 199 and 1 mg/ml BSA. After 24 h, medium was replaced with fresh medium 199 and BSA, 50 ng/ml testosterone, and LH (100 ng/ml) or FSH (100 ng/ml). Forty-eight hours later medium was collected and analyzed for estradiol and progesterone content by RIA. Results show the mean ± 1 SEM of three separate groups of granulosa cells. The average total RNA content per well was 5.5 µg.

 
The extent of progesterone production was similar for cells stimulated by FSH, for cells expressing the wild-type LHr and stimulated with LH, and for cells expressing constitutively activated LHr. In each group, progesterone production was significantly stimulated over control values (P < 0.05), but there were no significant differences between the extent of progesterone production between cells stimulated by FSH, cells expressing the wild-type LHr and stimulated with LH, and cells expressing the constitutively activated receptors (P > 0.05). In contrast to the comparable production rates of progesterone in response to either FSH or LH receptor activation, there was a marked difference in the production of estrogen. Granulosa cells expressing the wild-type LHr responded to LH with increased estradiol production, whereas expression of the constitutively activated D578HLHr resulted in a comparable increase in estrogen production in the absence of LH. However, FSH stimulation resulted in a substantially greater increase in estrogen production by immature granulosa cells, which was significantly greater than that of granulosa cells that expressed either the wild-type or the constitutively activated LH receptors (P < 0. 05).

Comparison of mRNAs associated with granulosa cell differentiation in response to stimulation through the native FSH receptor and virus-directed LH receptors
After collection of medium from granulosa cells for the steroid analysis shown in Fig 3Go, total RNA was prepared from the cells and analyzed for levels of mRNA for {alpha}-inhibin, 3ßHSD, LHr, and P450arom by ribonuclease protection assays. As shown in Fig. 4Go, stimulation of immature granulosa cells by FSH resulted in a significant increase in {alpha}-inhibin, 3ßHSD, LHr, and P450arom mRNAs (P < 0.05) compared to unstimulated cells. Likewise, granulosa cells expressing the wild-type hLH receptor and stimulated by LH as well as granulosa cells expressing the constitutively activated D578HLHr showed significant increases in {alpha}-inhibin mRNA levels (P < 0.05). However, cells expressing the wild-type LHr and stimulated by LH as well as cells expressing the constitutively activated D578HLHr exhibited a much weaker stimulation of 3ßHSD and P450arom compared to FSH, whereas a detectable LHr mRNA fragment was not seen in RNA prepared from these cells.



View larger version (69K):
[in this window]
[in a new window]
  		Figure 4. Ribonuclease protection analysis of mRNA levels for {alpha}inhibin, LH receptor, P450arom, and 3ßHSD in the undifferentiated rat granulosa cell and granulosa cells infected with either the wild-type LHr or the constitutively activated D578H LHr. Total RNA was isolated from the cells presented in Fig. 3Go and analyzed for mRNAs for the {alpha}-subunit of inhibin, 3ßHSD, P450arom, and LHr by ribonuclease protection assay. Results show data collected from a single group of cells. Similar results were observed in two other groups of granulosa cells.

 
Comparison of cAMP production in response to stimulation through the native FSH receptor and virus-directed LHr
Although the aforementioned results are suggestive that there may be differences in the responses of immature rat granulosa cells to activation of FSH and LH receptors subsequent analysis of cAMP levels (Table 1Go) revealed that although both activation of the native FSH receptor as well as the recombinant LHr stimulated cAMP production, there were differences in the absolute amounts of cAMP produced in response to the individual treatments. In particular, levels of cAMP were higher in cells stimulated by FSH than in cells that expressed either the wild-type LHr or the constitutively activated LH receptor.


View this table:
[in this window]
[in a new window]
  		Table 1. cAMP production by undifferentiated granulosa cells and those expressing wild-type and constitutively activated LH D578H receptors

 
Steroidogenic responses of immature rat granulosa cells to activation of FSH and LH receptors that result in comparable levels of cAMP production
In attempt to achieve comparable levels of cAMP production, immature granulosa cells were stimulated with hFSH (25 and 100 ng/ml) and varying concentrations of AdRSVD578HLHr. As shown in Table 2Go, comparable levels of cAMP were produced in response to 25 ng/ml FSH and AdRSVD578HLHr at a dilution of 1:150 and in response to FSH at 100 ng/ml and AdRSV D578H LHr at a dilution of 1:100. Granulosa cells infected with AdRSVD578HLHr at an input of 1:50 produced slightly greater amounts of cAMP than FSH at 100 ng/ml.


View this table:
[in this window]
[in a new window]
  		Table 2. Dose-dependent cAMP production by undifferentiated granulosa cells stimulated with FSH or infected with AdRSVD578HLHr

 
Figure 5Go illustrates estrogen and progesterone production levels in this set of experiments. Progesterone production was similar in response to activation of either FSH or LH receptors. Mean estradiol levels were greater in response to FSH stimulation compared with cells expressing the constitutively activated LHr. However, these differences did not reach statistical significance at the 0.05 level.



View larger version (22K):
[in this window]
[in a new window]
  		Figure 5. Dose-dependent steroid responses of granulosa cells stimulated with FSH or transfected with constitutively activated D578H LHr. Undifferentiated granulosa cells were exposed to either hFSH (25 and 100 ng/ml) or AdRSV D578HLHr at 1:150, 1:100, and 1:50 dilutions. Forty-eight hours after the addition of FSH, medium was collected for analysis of estradiol and progesterone. Results show the mean ± 1 SEM of three separate groups of granulosa cells. The average total RNA content per well was 7.0 µg.

 
Figure 6Go illustrates that {alpha}-inhibin mRNA levels were stimulated at all concentrations of FSH and all inputs of AdRSVD578HLHr. Likewise, both stimulation by FSH and expression of the constitutively activated LH receptor stimulated 3ßHSD mRNA accumulation. At equivalent production rates of cAMP, FSH stimulation led to a greater expression of P450arom than did expression of D578HLHr. Similar to the results shown in Fig. 4Go, AdRSVD578HLHr was relatively ineffective in stimulating LHr mRNA. There were no significant differences between FSH (25 or 100 ng/ml) and AdRSV D578HLHr at 1:150 or 1:100 dilution on the expression of {alpha}-inhibin mRNA. Likewise, there were no significant differences between FSH at 25 ng/ml and AdRSV D578HLHr at 1:150 or between FSH at 100 ng/ml and AdRSVD578H LHr at 1:100 in the stimulation of 3ßHSD mRNA. FSH at 100 ng/ml was more effective than AdRSVD578HLHr at 1:150, 1:100, and 1:50 dilutions with respect to induction of P450arom and LHr mRNAs (P < 0.05).



View larger version (84K):
[in this window]
[in a new window]
  		Figure 6. Dose-dependent changes in mRNA levels for {alpha}-inhibin, LHr, P450arom, and 3ßHSD in the FSH-stimulated undifferentiated rat granulosa cell and granulosa cells expressing constitutively activated D578H LHr. Total RNA was isolated from the cells presented in Fig. 5Go and analyzed for mRNAs for the {alpha}-subunit of inhibin, 3ßHSD, P450arom, and LHr by ribonuclease protection assay. Similar results were observed in two other groups of granulosa cells.

 
Comparison of responses of undifferentiated granulosa cells to FSH, AdRSVD578HLHr, forskolin, and 8-bromo-cAMP (8BrcAMP)
To further investigate the apparent selective induction of LHr and P450arom by FSH, we compared the effects of FSH, AdRSVD578HLHr, 10 µM FSK, and 0.5 mM 8BrcAMP on the expression of mRNAs for {alpha}-inhibin, 3ßHSD, P450arom, and the LH receptor. Results presented in Fig. 7Go demonstrate again that FSH stimulation selectively induces mRNAs for the LHr as well as P450arom and that the responses of undifferentiated granulosa cells to FSK and 8BrcAMP were similar to activation of the LH receptor.



View larger version (85K):
[in this window]
[in a new window]
  		Figure 7. Comparison of responses of undifferentiated granulosa cells to FSH, AdRSVD578HLHr, forskolin, and 8BrcAMP. Undifferentiated rat granulosa cells were plated overnight in medium 199 containing 10% FCS. The next morning medium and unattached cells were removed, and monolayers were exposed to medium alone or AdRSVLHrD578H at 1:100 dilution (5 x 1010 particles/ml) for 2 h, after which the virus-containing medium was removed and replaced with fresh medium 199 and 1 mg/ml BSA. After 24 h, medium was replaced with fresh medium 199 and BSA, 50 ng/ml testosterone and FSH (100 ng/ml), forskolin (FSK; 10 µM), or 8BrcAMP (0.5 mM). Forty-eight hours later total RNA was prepared from the monolayers and analyzed for mRNAs by ribonuclease protection assay.

 
Adenovirus-directed expression of ß-galactosidase does not affect FSH-stimulated cAMP, steroidogenesis, or mRNA levels
In four separate groups of granulosa cells, basal cAMP production was 0.1 ± 0.04 pmol/ml·48 h, which was increased to 20.62 ± 4.26 pmol/ml·48 h by 100 ng/ml FSH. Infection of cells with ADRSVß-gal did not affect either basal cAMP production (0.08 ± 0.03 pmol/ml·48 h) or FSH-stimulated cAMP production (18.76 ± 1.09 pmol/ml·48 h). Likewise, AdRSVß-gal did not affect FSH-stimulated estradiol production (17.9 ± 3.75 vs. 15.57 ± 2.67 ng/ml·48 h) or progesterone production (8.16 ± 1.58 vs. 7.42 ± 1.41 ng/ml·48 h) for noninfected and infected cells, respectively. mRNAs for P450arom, LHr, 3ßHSD, and {alpha}-inhibin were similar for FSH-stimulated cells in the presence or absence of AdRSVß-gal (data not shown).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Granulosa cells from immature follicles produce cAMP in response to FSH, but not LH, due to their lack of LH receptors, whereas granulosa cells from preovulatory follicles, which possess both FSH and LH receptors, produce cAMP in response to both FSH and LH (2). A long-standing question is why there are differences in the effects of FSH and LH on granulosa cell function if both FSH and LH act through the cAMP signaling system. The principal responses of granulosa cells to FSH stimulation are the induction of aromatase and LH receptors, which are responsible for the production of estrogen and the ability of the follicle to ovulate and luteinize in response to the midcycle LH surge (18, 19). The major physiological response to LH is ovulation, luteinization, and the production of progesterone. In addition, LH stimulation of granulosa cells results in the suppression of aromatase as well as down-regulation of LH receptors (20, 21). One hypothesis for these separate effects is that LH appears to be more effective in stimulating cAMP production than FSH and that differences in the responses to FSH and LH could be due to differences in intracellular concentrations of cAMP generated by the two hormones (22). Another possibility is that, in addition to cAMP, other signaling pathways may be used by the gonadotropins (5). An inherent problem in comparing the responses of granulosa cells to FSH and LH is that to study LH responsiveness, granulosa cells must first undergo FSH-mediated differentiation, which, in addition to the induction of LH receptors, is associated with major changes in steroidogenic enzymes (2), accessory proteins involved in steroidogenesis (23), as well as changes in the downstream protein kinase A signaling system (24, 25). Thus, comparing the responses of immature granulosa cells to FSH with the responses of differentiated granulosa cells to LH could be confounded by the differences in the state of differentiation of the cells.

We demonstrated previously that replication-defective adenovirus vectors are able to efficiently direct the expression of recombinant proteins in granulosa cells as more than 90% of granulosa cells in primary culture exhibit adenovirus-directed expression of ß-galactosidase and green fluorescent protein reporter genes without adverse effects on cellular function (26). Because virtually all cells in culture are infected by virus, direct analysis of specific proteins on granulosa cell function can be assessed. In the current study, using adenovirus vectors that direct the expression of wild-type and a constitutively activated human LHr, we compared the responses of immature rat granulosa cells to FSH and LH, thereby eliminating the confounding variable of FSH-induced cellular differentiation.

Our current findings indicate that activation of the FSH receptor appeared to be more effective than activation of the LHr on the induction of mRNAs for aromatase and the LHr, whereas both receptors were similar with respect to stimulation of mRNAs encoding {alpha}-inhibin and 3ßHSD. Functionally, the FSHr appeared to be more effective in stimulating estrogen production, whereas progesterone production in response to activation of FSH and LH receptors was comparable. The differences in the responses to activation of FSH and LH did not appear to be due to differences in the absolute levels of cAMP accumulation, as adjusting the FSH concentrations and the concentrations of AdRSVD578HLHr to produce comparable levels of cAMP still resulted in the differential induction of aromatase and LHr mRNAs by FSH. Our observation that the preferential induction of the LHr by FSH in the presence of comparable levels of cAMP is in agreement with the previous findings of Welsh et al. (27) that demonstrated that FSH was more effective than forskolin in inducing LHr on immature granulosa cells at concentrations of each that resulted in similar production rates of cAMP and comparable levels of progesterone production. Similarly, Davoren and Hsueh (28) demonstrated that although FSH and vasoactive intestinal peptide stimulated progesterone production comparably by immature granulosa cells, FSH was more effective in inducing LHr. Thus, under a number of different approaches the FSH receptor, which is the physiological regulator of granulosa cell differentiation, appears to be more effective than other agents that stimulate cAMP production in regulating the hallmark genes involved in granulosa cell differentiation, P450 aromatase and the LHr. Physiologically, this could protect the ovary from inappropriate stimulation by other cAMP-stimulating agents such as catecholamines, etc.

Preferential action of FSH on immature granulosa cells is not absolute, in that activation of the wild-type LHr by LH as well as expression of the constitutively activated LHr did result in the induction of aromatase mRNA and estrogen production, albeit to an apparently lesser extent than did FSH. Likewise, although of very low intensity, we did observe protected fragments for the rat LHr in cells stimulated by AdRSV D578HLHr. These observations indicate that the activation of FSH and LH receptors does not result in unique responses of granulosa cells to each receptor, but, rather, that there is overlap between the activities of FSH and LH receptors. As documented in the literature, this is also apparent in granulosa cells that have undergone FSH-mediated differentiation. In these cells, substituting FSH with LH maintained their differentiated phenotype (29). Physiologically, this overlap may play a fundamental role in the process of follicular selection as recent studies in humans and sheep have shown that LH is able to maintain follicular development in the presence of declining FSH concentrations (30, 31). Finally, the observations that at appropriate dosages, recombinant FSH in the absence of LH is able to stimulate follicular development, ovulation, and luteinization in hypophysectomized rats indicates that overlap in the activities of FSH and LH receptors can occur at all stages of follicular growth (32).

The preferential ability of the FSHr to stimulate aromatase and LH receptor expression, however, suggests that intracellular signaling pathways may also be differentially activated by FSH and LH. On the one hand, FSH may activate additional pathways compared to LH. On the other hand, LH may activate pathways that are inhibitory to the actions of FSH. Both FSH and LH have been shown to coactivate a number of intracellular pathways including Ca2+ mobilization (33, 34), mitogen-activated protein kinase (35, 36), and tyrosine kinase pathways (37, 38). Recently, FSH has been shown to activate the protein kinase B pathway in a protein kinase-A independent fashion (39), and Babu et al. identified a unique FSH receptor variant that selectively stimulates the mitogen-activated protein kinase pathway (40). One pathway that appears to be activated preferentially by LH is phospholipase C (41, 42, 43). Downstream targets of this signaling system include the protein kinase C pathway, and pharmacological stimulation of the protein kinase C pathway has been shown to antagonize the effects of FSH on granulosa cell differentiation (44). In this regard, the D578H mutant LHr that we ectopically expressed in immature granulosa cells also confers constitutive activation of phospholipase C (6). Finally, although we achieved comparable 48-h production rates of cAMP in response to FSH and AdRSVD578HLHr, the possibility that subtle differences in the time course of cAMP production in response to FSH and LH receptor activation may have resulted in differential regulation of target genes cannot be excluded.

Many more genes than those studied in this report are influenced by FSH and LH (2). The extent to which each may be regulated (activated or repressed) by absolute levels of cAMP, different intracellular signaling pathways, or combinations of both have yet to be established. The strategy described in this report could provide a novel approach to examining this question.


   Acknowledgments
 
We acknowledge Drs. Deborah Segaloff, Ian Mason, and Stephen G. Hillier for providing complementary DNAs for this study. We also acknowledge Dr. Talal El-Hefnawy for his suggestions for optimizing the cAMP RIA, and Ms. Jessica Hudale for her help in constructing the adenovirus vectors.


   Footnotes
 
1 This work was supported by NIH Grants HD-16842 and HD-08610 (to A.J.Z.), CA-78436 (to A.S.), and NIH Training Grants HD-07332 (to Z.B.) and DK-07169 (to G.L.). Back

Received September 11, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Zeleznik AJ, Benyo DF 1994 Control of follicular development, corpus luteum function, and recognition of pregnancy in higher primates. In: Knobil E, Neill JD (eds) Physiology of Reproduction, Ed 2. Raven Press, New York, vol 2:751–782
  2. Richards JS 1994 Hormonal control of gene expression in the ovary. Endocr Rev 15:725–751[CrossRef][Medline]
  3. Adashi EY, Resnick CE 1986 3'5'-cyclic adenosine monophosphate as an intracellular second messenger of luteinizing hormone: application of forskolin criteria. J Cell Biochem 31:217–228[CrossRef][Medline]
  4. Richards JS, Jonassen JA, Rolfes AI, Kersey K, Reichert Jr LE 1979 Adenosine 3',5'-monophosphate, luteinizing hormone receptor, and progesterone during granulosa cell differentiation: effects of estradiol and follicle-stimulating hormone. Endocrinology 104:765–773[Medline]
  5. Leung PC, Steele GL 1992 Intracellular signaling in the gonads. Endocr Rev 13:476–498[CrossRef][Medline]
  6. Liu G, Duranteau L, Carol JC, Monroe J, Doyle DD, Shenker A 1999 Leydig cell tumors caused by an activating mutation of the gene encoding the luteinizing hormone receptor. N Engl J Med 341:1731–1734[Free Full Text]
  7. Gerard RD, Meidell RS 1994 Adenovirus vectors. In: Rickwood D, Hames BD (eds) DNA Cloning 4: A Practical Approach, Ed 2. Oxford University Press, Oxford, pp 285–306
  8. Graham FL, Smiley J, Russell WC, Nairn R 1977 Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 36:59–72[Abstract/Free Full Text]
  9. Mittereder N, March L, Trapnell BC 1996 Evaluation of the concentration and bioactivity of adenovirus vectors for gene therapy. J Virol 70:7498–7509[Abstract]
  10. Hunter WM, Greenwood FC 1962 Preparation of iodine-131 labeled growth hormone of high specific activity. Nature 194:495–496[CrossRef][Medline]
  11. Hickey GJ, Krasnow JS, Beattie WG, Richards JS 1990 Aromatase cytochrome P450 in rat ovarian granulosa cells before and after luteinization: adenosine 3',5'-monophosphate-dependent and independent regulation. Cloning and sequencing of rat aromatase cDNA and 5' genomic DNA. Mol Endocrinol 4:3–12[CrossRef][Medline]
  12. McFarland KC, Sprengel R, Phillips HS, Kohler M, Rosemblit N, Nikolics K, Segaloff DL, Seeburg PH 1989 Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family. Science 245:494–499[Abstract/Free Full Text]
  13. Esch FS, Shimasaki S, Cooksey K, Mercado M, Mason AJ, Ying SY, Ueno N, Ling N 1997 Complementary deoxyribonucleic acid (cDNA) cloning and DNA sequence analysis of rat ovarian inhibins. Mol Endocrinol 1:388–396[CrossRef][Medline]
  14. Lorence MC, Naville D, Graham-Lorence SE, Mack SO, Murry BA, Trant JM, Mason JI 1991 3ß-Hydroxysteroid dehydrogenase/{Delta}5–4-isomerase expression in rat and characterization of the testis isoform. Mol Cell Endocrinol: 80:21–31[CrossRef][Medline]
  15. Danielson PE, Forss-Petter S, Brow MA, Calavetta L, Douglass J, Milner RJ, Sutcliffe JG 1998 p1B15: a cDNA clone of the rat mRNA encoding cyclophilin. DNA 7:261–267
  16. Zeleznik AJ, Resko JA 1980 Progesterone does not inhibit gonadotropin-induced follicular maturation in the female rhesus monkey. Endocrinology 106:1820–1826[Abstract]
  17. Steiner AL, Parker CW, Kipnis DM 1972 Radioimmunoassay for cyclic nucleotides. I. Preparation of antibodies and iodinated cyclic nucleotides. J Biol Chem 247:1106–1113[Abstract/Free Full Text]
  18. Zeleznik AJ, Midgley Jr AR, Reichert Jr LE 1974 Granulosa cell maturation in the rat: increased binding of human chorionic gonadotropin following treatment with follicle stimulating hormone in vivo. Endocrinology 95:818–825[Medline]
  19. Erickson GF, Hsueh AJ 1978 Stimulation of aromatase activity by follicle stimulating hormone in rat granulosa cells in vivo and in vitro. Endocrinology 102:1275–1282[Medline]
  20. Hickey GJ, Chen SA, Besman MJ, Shively JE, Hall PF, Gaddy-Kurten D, Richards JS 1988 Hormonal regulation, tissue distribution, and content of aromatase cytochrome P450 messenger ribonucleic acid and enzyme in rat ovarian follicles and corpora lutea: relationship to estradiol biosynthesis. Endocrinology 122:1426–1436[Abstract]
  21. Segaloff DL, Wang HY, Richards JS 1990 Hormonal regulation of luteinizing hormone/chorionic gonadotropin receptor mRNA in rat ovarian cells during follicular development and luteinization. Mol Endocrinol 4:1856–1865[CrossRef][Medline]
  22. Yong EL, Hillier SG, Turner M, Baird DT, Ng SC, Bongso A, Ratnam SS 1994 Differential regulation of cholesterol side-chain cleavage (P450scc) and aromatase (P450arom) enzyme mRNA expression by gonadotropins and cyclic AMP in human granulosa cells. J Mol Endocrinol 12:239–249[Abstract/Free Full Text]
  23. Silverman E, Eimerl S, Orly J 1999 CCAAT enhancer-binding protein beta and GATA-4 binding regions within the promoter of the steroidogenic acute regulatory protein (StAR) gene are required for transcription in rat ovarian cells. J Biol Chem 274:17987–17996[Abstract/Free Full Text]
  24. Ratoosh SL, Lifka J, Hedin L, Jahsen T, Richards JS 1987 Hormonal regulation of the synthesis and mRNA content of the regulatory subunit of cyclic AMP-dependent protein kinase type II in cultured rat ovarian granulosa cells. J Biol Chem 262:7306–7313[Abstract/Free Full Text]
  25. Carr DW, Cutler Jr RE, Cottom JE, Salvador LM, Fraser IDC, Scott JD, Hunzicker-Dunn M 1999 Identification of cAMP-dependent protein kinase holoenzymes in preantral and preovulatory follicle enriched ovaries, and their association with A-kinase anchoring proteins. Biochem J 344:613–623
  26. Somers JP, DeLoia JA, Zeleznik AJ 1999 Adenovirus-directed expression of a nonphosphorylatable mutant of CREB (cAMP response element-binding protein) adversely affects the survival, but not the differentiation, of rat granulosa cells. Mol Endocrinol 13:1364–1372[Abstract/Free Full Text]
  27. Welsh Jr TH, Jia XC, Hsueh AJ 1984 Forskolin and phosphodiesterase inhibitors stimulate rat granulosa cell differentiation. Mol Cell Endocrinol 37:51–60[CrossRef][Medline]
  28. Davoren JB, Hsueh AJ 1985 Vasoactive intestinal peptide: a novel stimulator of steroidogenesis by cultured rat granulosa cells. Biol Reprod 33:37–52[Abstract]
  29. Piquette GN, LaPolt PS, Oikawa M, Hsueh AJ 1991 Regulation of luteinizing hormone receptor messenger ribonucleic acid levels by gonadotropins, growth factors, and gonadotropin-releasing hormone in cultured rat granulosa cells. Endocrinology 128:2449–2456[Abstract]
  30. Sullivan MW, Stewart-Akers A, Krasnow JS, Berga SL, Zeleznik AJ 1999 Ovarian responses in women to recombinant follicle-stimulating hormone and luteinizing hormone (LH): a role for LH in the final stages of follicular maturation. J Clin Endocrinol Metab 84:228–232[Abstract/Free Full Text]
  31. Campbell BK, Dobson H, Baird DT, Scaramuzzi RJ 1999 Examination of the relative role of FSH and LH in the mechanism of ovulatory follicle selection in sheep. J Reprod Fertil 117:355–367[Abstract/Free Full Text]
  32. Tapainen JS, Lapolt PS, Perlas E, Hsueh AJ 1993 Induction of ovarian follicle luteinization by recombinant follicle-stimulating hormone. Endocrinology 133:2875–2880[Abstract]
  33. Davis JS, Weakland LL, Farese RV, West LA 1987 Luteinizing hormone increases inositol trisphosphate and cytosolic free Ca2+ in isolated bovine luteal cells. J Biol Chem 262:8515–8521[Abstract/Free Full Text]
  34. Flores JA, Leong DA, Veldhuis JD 1992 Is the calcium signal induced by follicle-stimulating hormone in swine granulosa cells mediated by adenosine cyclic3',5'-monophosphate-dependent protein kinase? Endocrinology 130:1862–1866[Abstract]
  35. Cameron MR, Foster JS, Bukovsky A, Wimalasena J 1996 Activation of mitogen-activated kinases by gonadotropins and cyclic adenosine 5'-monophosphates in porcine granulosa cells. Biol Reprod 55:111–119[Abstract]
  36. Das S, Maizels ET, DeManno D, St Clair E, Adam SA, Hunzicker-Dunn M 1996 A stimulatory role of cyclic adenosine 3',5'-monophosphate in follicle-stimulating hormone-activated mitogen-activated protein kinase signaling pathway in rat ovarian granulosa cells. Endocrinology 137:967–974[Abstract]
  37. Shimamoto T, Yamoto M, Nakano R 1998 The role of tyrosine kinase in gonadotropin-induced ovulation in the rat ovary. Eur J Endocrinol 138:594–600[Abstract]
  38. Orly J, Rei Z, Greenberg NM, Richards JS 1994 Tyrosine kinase inhibitor AG18 arrests follicle-stimulating hormone-induced granulosa cell differentiation: use of reverse transcriptase-polymerase chain reaction assay for multiple messenger ribonucleic acids. Endocrinology 134:2336–2346[Abstract]
  39. Gonzalez-Robayna IJ, Falender AE, Ochsner S, Firestone GL, Richards JS 2000 Follicle-Stimulating hormone (FSH) stimulates phosphorylation and activation of protein kinase B (PKB/Akt) and serum and glucocorticoid-lnduced kinase (Sgk): evidence for A kinase-independent signaling by FSH in granulosa cells. Mol Endocrinol 14:1283–1300[Abstract/Free Full Text]
  40. Babu PS, Krishnamurthy H, Chedrese PJ, Sairam MR 2000 Activation of extracellular-regulated kinase pathways in ovarian granulosa cells by the novel growth factor type 1 follicle-stimulating hormone receptor. Role in hormone signaling and cell proliferation. J Biol Chem 275:27615–2726[Abstract/Free Full Text]
  41. Davis JS, Weakland LL, West LA, Farese RV 1986 Luteinizing hormone stimulates the formation of inositol trisphosphate and cyclic AMP in rat granulosa cells. Evidence for phospholipase C generated second messengers in the action of luteinizing hormone. Biochem J 238:597–604[Medline]
  42. Gudermann T, Birnbaumer M, Birnbaumer L 1992 Evidence for dual coupling of the murine luteinizing hormone receptor to adenylyl cyclase and phosphoinositide breakdown and Ca2+ mobilization. J Biol Chem 267:4479–4488[Abstract/Free Full Text]
  43. Kuhn B, Guderman T 1999 The luteinizing hormone receptor activates phospholipase C via preferential coupling to Gi2. Biochemistry 38:12490–12498[CrossRef][Medline]
  44. Shinohara O, Knecht M, Catt KJ 1985 Inhibition of gonadotropin-induced granulosa cell differentiation by activation of protein kinase C. Proc Natl Acad Sci USA 82:8518–8522[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
C. Herrmann-Lavoie, C. V. Rao, and A. Akoum
Chorionic Gonadotropin Down-Regulates the Expression of the Decoy Inhibitory Interleukin 1 Receptor Type II in Human Endometrial Epithelial Cells
Endocrinology, November 1, 2007; 148(11): 5377 - 5384.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
D. Saxena, R. Escamilla-Hernandez, L. Little-Ihrig, and A. J. Zeleznik
Liver Receptor Homolog-1 and Steroidogenic Factor-1 Have Similar Actions on Rat Granulosa Cell Steroidogenesis
Endocrinology, February 1, 2007; 148(2): 726 - 734.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
N. Andric and M. Ascoli
A Delayed Gonadotropin-Dependent and Growth Factor-Mediated Activation of the Extracellular Signal-Regulated Kinase 1/2 Cascade Negatively Regulates Aromatase Expression in Granulosa Cells
Mol. Endocrinol., December 1, 2006; 20(12): 3308 - 3320.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
T. N. Parakh, J. A. Hernandez, J. C. Grammer, J. Weck, M. Hunzicker-Dunn, A. J. Zeleznik, and J. H. Nilson
Follicle-stimulating hormone/cAMP regulation of aromatase gene expression requires beta-catenin
PNAS, August 15, 2006; 103(33): 12435 - 12440.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
M. Mihm, P.J. Baker, J.L.H. Ireland, G.W. Smith, P.M. Coussens, A.C.O. Evans, and J.J. Ireland
Molecular Evidence That Growth of Dominant Follicles Involves a Reduction in Follicle-Stimulating Hormone Dependence and an Increase in Luteinizing Hormone Dependence in Cattle
Biol Reprod, June 1, 2006; 74(6): 1051 - 1059.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
F. X. Donadeu and M. Ascoli
The Differential Effects of the Gonadotropin Receptors on Aromatase Expression in Primary Cultures of Immature Rat Granulosa Cells Are Highly Dependent on the Density of Receptors Expressed and the Activation of the Inositol Phosphate Cascade
Endocrinology, September 1, 2005; 146(9): 3907 - 3916.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
D.X. Lin, Z.M. Lei, and Ch.V. Rao
Dependence of Uterine Cyclooxygenase2 Expression on Luteinizing Hormone Signaling
Biol Reprod, August 1, 2005; 73(2): 256 - 260.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
D. Saxena, R. Safi, L. Little-Ihrig, and A. J. Zeleznik
Liver Receptor Homolog-1 Stimulates the Progesterone Biosynthetic Pathway during Follicle-Stimulating Hormone-Induced Granulosa Cell Differentiation
Endocrinology, August 1, 2004; 145(8): 3821 - 3829.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
C. M. Allan, A. Garcia, J. Spaliviero, F.-P. Zhang, M. Jimenez, I. Huhtaniemi, and D. J. Handelsman
Complete Sertoli Cell Proliferation Induced by Follicle-Stimulating Hormone (FSH) Independently of Luteinizing Hormone Activity: Evidence from Genetic Models of Isolated FSH Action
Endocrinology, April 1, 2004; 145(4): 1587 - 1593.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A. J. Zeleznik, D. Saxena, and L. Little-Ihrig
Protein Kinase B Is Obligatory for Follicle-Stimulating Hormone-Induced Granulosa Cell Differentiation
Endocrinology, September 1, 2003; 144(9): 3985 - 3994.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
M. Conti
Specificity of the Cyclic Adenosine 3',5'-Monophosphate Signal in Granulosa Cell Function
Biol Reprod, December 1, 2002; 67(6): 1653 - 1661.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bebia, Z.
Right arrow Articles by Zeleznik, A. J.
Right arrow Search for Related Content
PubMed