| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
-Regulated Gene in Human and Rat Endometrium1
The Population Council and Rockefeller University, New York, New York 10021; and Nassau County Medical Center, State University of New York Stonybrook, Health Sciences Center (S.K.), Stonybrook, New York 10016
Address all correspondence and requests for reprints to: Indrani C. Bagchi, Ph.D., Department of Veterinary Biosciences, University of Illinois at Urbana-Champaign, Urbana, Illinois 61802. E-mail: ibagchi{at}uiuc.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/ß-inducible human genes p27 and 6–16, indicating that
these genes may belong to the same family. Consistent with this
finding, expression of IRG1 messenger RNA (mRNA) in rat uterus
increased about 20-fold in response to IFN. Uterine expression of
IRG1 was also stimulated by estrogen and was partially inhibited by an
antiestrogen, ICI 182,780. In pregnant rats, IRG1 expression was high
on day 1, but declined on days 2 and 3. The level of IRG1 mRNA again
rose transiently on day 4 immediately preceding implantation. In
situ hybridization analysis localized the IRG1 mRNA expression
in the endometrial epithelium and the surrounding stroma.
Interestingly, the expression of p27, which shows high homology to
IRG1, was strongly enhanced in human endometrium during the
midsecretory phase of the menstrual cycle, overlapping the putative
window of implantation. Both IRG1 and p27 mRNAs are therefore induced
in the endometrium in an implantation stage-specific manner. We also
observed a synergistic interaction between IFN and estrogen receptor
signaling pathways that led to maximal induction of p27 mRNA in
Ishikawa cells. Although the functional roles of IRG1 and p27 remain
unclear, we describe for the first time, identification of a gene
family regulated by IFN in both rodent and human uteri. More
importantly, our studies reveal that a complex interplay between the
steroid hormone and IFN pathways regulates the expression of these
genes in the endometrium at the time of implantation. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
As a first step toward understanding the molecular basis of the
acquisition of uterine receptivity, we sought to identify the genes
whose expression is induced in the rat uterus at the onset of
implantation. By employing a gene expression screening technique
(10), we isolated a complementary DNA (cDNA)
representing a novel gene whose expression in the uterus is under dual
regulation of IFN and estrogen. Nucleotide sequence analysis
of the cDNA revealed that it encodes a new member of a family of human
interferon (IFN)-/ß-inducible genes (11, 12, 13). We
termed this newly identified gene IFN-regulated gene 1 (IRG1). Although
IFN alone was able to induce the expression of IRG1, its maximal
expression in the uterus required the presence of both estrogen and
IFN. IRG1 was expressed in rat endometrium during the
preimplantation period. Interestingly, p27, which shows strong homology
to IRG1, was also induced in human endometrium within the putative
window of implantation. This remarkable conservation of implantation
stage-specific expression of IRG1 and p27 across species predicts a
critical role of these IFN-regulated genes in the implantation
process.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and IFNß were
purchased from ICN Biomedicals, Inc. (Costa Mesa, CA), and
IFN
was purchased from Genzyme Corp. (Cambridge,
MA).
Animals
All experiments involving animals were approved by institutional
animal care and use committee of the Rockefeller University. Virgin
female rats (Sprague Dawley, from Charles River Laboratories, Inc. Wilmington, MA; 60–75 days of age), in proestrus, were
mated with adult males. The different stages of the cycle in the
nonpregnant rats were ascertained by examining vaginal smears. The
presence of a vaginal plug after mating was designated day 1 of
pregnancy. The animals were killed at various stages of gestation, and
the uteri were collected. The uteri were freed of embryonic tissue
either by repeated flushings (days 1–5) or by individually removing
the embryos from the implantation sites (day 6). These embryo-free
tissues were used for Northern blots, RT-PCR, and in situ
hybridization studies. In some experiments, animals were ovariectomized
and 1 week later were injected sc with estradiol (2 µg/kg BW),
progesterone (40 mg/kg BW), or a combination of both hormones or
vehicle (sesame oil) as described in Results. Ovariectomized
animals were also injected with 1 x 104 and
5 x 104 U IFN and 5 x
104 U/rat of IFN. The rats were killed 24
h after final injection.
Endometrial tissues
Human endometrial tissues were obtained as part of endometrial
curettage from healthy, nonpregnant females, between the ages of
25–40 yr, before elective sterilization with informed consent. These
tissues were obtained in accordance with the rules and regulations of
the institution and after approval of the institutional review board at
the Nassau County Medical Center. Endometrial tissues were transported
to the laboratory in Hanks’ Balanced Salt Solution on ice. Tissues
were then snap-frozen in liquid nitrogen and stored at -70 C until
further use. Endometrial tissues were classified according to serum
levels of estradiol and progesterone and histology according to the
criteria of Noyes et al. (14).
Gene expression screen
Whole uteri were isolated from nonpregnant (estrus stage) and
pregnant (day 4) rats and processed for polyadenylated
[poly(A)+] RNA isolation employing a fast track
messenger RNA (mRNA) isolation kit (Invitrogen, San Diego,
CA). Double stranded cDNA was synthesized with 10 µg
poly(A)+ RNA using a ZAP-cDNA synthesis kit from
Stratagene (La Jolla, CA) and was divided into two
aliquots. One aliquot was used to construct a cDNA library (
ZAP II
kit from Stratagene), and the other was used in the gene
expression screening protocol. The gene expression screen technique was
performed essentially as described by Wang and Brown (10).
Briefly, 5 µg double stranded cDNA from uterus of either nonpregnant
or pregnant rats was digested with AluI plus RsaI
and then ligated with 15 µg double stranded, phosphorylated
deoxyoligonucleotide linkers. The nucleotide sequence of the
oligonucleotides were CTCTTGCTTGAATTCGGACTA and
TAGTCCGAATTCAAGCAAGAGCACA. After ligation, reactions were
electrophoresed on a 1.4% low melting agarose gel to remove the
unligated linkers. The linker-ligated AluI/RsaI
cDNA fragments in the size range of 0.15–1.5 kb were recovered from
the gel. For PCR amplification, 2 µl linker-ligated cDNA fragments in
molten agarose was used (94 C, 1 min; 50 C, 1 min; 72 C, 2 min; 25 sec
of autoextension/cycle; 30 cycles). This reaction yielded about 150
µg cDNA. Subtractive hybridization was then carried out using 100
µg cDNA isolated from uteri of nonpregnant animals as driver, 5 µg
cDNA from uteri of pregnant animals as tracer, and vice
versa. The procedure was repeated through 4 cycles, and
populations enriched in genes, which were either up- or down-regulated
during pregnancy, were obtained. The enriched cDNA fragments were then
ligated to pBluescript vector (Stratagene), and
transformed into competent Escherichia coli DH5 cells
resulting in libraries of up- and down-regulated cDNAs.
Isolation and sequence analysis of IRG1 cDNA
A library of up- or down-regulated genes was plated. Duplicate
filters were lifted from the plate and probed with a
32P-labeled cDNA pool enriched in either up- or
down-regulated genes. We screened about 2000 colonies of either library
and identified colonies that displayed positive signals when probed
with up-regulated, but not down-regulated, cDNAs and vice
versa. We isolated DNA from these clones and used them as probes
for Northern blot analysis to confirm that the isolated clones are
indeed up- or down-regulated during pregnancy. During Northern
blotting, mRNA obtained from either nonpregnant or pregnant (day 4)
uteri were run on a gel, transferred to a nylon membrane, and probed
with 32P-labeled DNA isolated from potential
clones. By this method we identified a 300-bp clone that was
up-regulated during pregnancy. The partial clone was then used to
screen a uterine cDNA library (pregnancy day 4) that we had constructed
earlier. A full-length clone was then isolated, and determination of
its nucleotide sequence revealed it to be a novel gene. We termed this
gene IRG1.
Northern blot analysis
For Northern analysis, 6–8 µg poly(A)+
mRNA or 20 µg total RNA were separated by formaldehyde agarose gel
electrophoresis and transferred to Duralon membrane
(Stratagene). Blots were prehybridized in 50
mM NaPO4 (pH 6.5), 5 x SSC
(standard saline citrate), 5 x Denhardt’s solution, 50%
formamide, 0.1% SDS, and 100 µg/ml salmon sperm DNA for 4 h at
42 C. Hybridization was carried out overnight in the same buffer
containing 106 cpm/ml
32P-labeled IRG1 cDNA fragment. The filters were
washed twice for 15 min each time in 1 x SSC/0.1% SDS at room
temperature, then twice for 20 min each time in 0.2 x SSC/0.1%
SDS at 55 C, and the filters were exposed to x-ray films for 24–72 h.
The intensity of a signal on the autoradiogram was estimated by
densitometric scanning. To correct for RNA loading, IRG1 signals were
normalized to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
signal in the same blot. For this, the filters were stripped of the
radioactive IRG1 probe by washing for 5 min in 0.1% SDS at 95 C. The
blots were then reprobed with a 32P-labeled GAPDH
probe (CLONTECH Laboratories, Inc., Palo Alto, CA) as
described above.
In situ hybridization
Uterine tissue from pregnant animals (day 4, 1700 h) was
collected and frozen. Tissues were fixed in 4% paraformaldehyde at 4
C. Cryostat sections were cut at 8 µm and attached to 3-aminopropyl
triethyl silane (Sigma)-coated slides. In situ
hybridization was performed with digoxygenin (DIG)-labeled sense or
antisense RNA probes of IRG1 gene. DIG-labeled RNA probes were
synthesized from IRG1 cDNA using T3 or T7 RNA polymerase and
DIG-labeled nucleotides according to manufacturer’s specifications
(Roche Molecular Biochemicals, Indianapolis, IN).
Prehybridization was carried out in a damp chamber at 55 C for 60 min
in hybridization buffer (50% formamide, 5 x SSC, 2% blocking
reagent, 0.02% SDS, and 0.1% N-laurylsarcosine).
Hybridization was carried out at 55 C overnight in a damp humidified
chamber. To develop the substrate, sections were sequentially washed in
2 x SSC, 1 x SSC, and 0.1 x SSC for 15 min in each
buffer at 37 C. Sections were then incubated with anti-DIG alkaline
phosphatase-conjugated antibody. Excess antibody was washed away, and
the color substrate (nitro blue tetrazolium salt and
5-bromo-4-chloro-3-indoylphosphate) was added. Slides were allowed to
develop in the dark, and color was visualized under light microscopy
until maximum levels of staining were achieved. Control incubations
used a DIG-labeled RNA sense strand and were performed under identical
conditions. For human endometrium, in situ hybridization was
performed with DIG-labeled antisense RNA probes complimentary to the
p27 gene.
Transient transfection experiments
Ishikawa endometrial adenocarcinoma cells were maintained in
DMEM (Life Technologies, Inc., Grand Island, NY)
supplemented with 5% FBS (HyClone Laboratories, Inc.,
Logan, UT). Cells (5 x 105) were plated on
10-cm tissue culture dishes in phenol red-free medium containing 5%
charcoal-stripped serum. After 24–48 h cells were transiently
transfected with plasmid DNAs using Lipofectamine (Life Technologies, Inc.) according to the manufacturer’s guidelines.
Typically, cells received 1 µg estrogen receptor (ER) plasmid.
After 24 h the cells were washed with PBS and incubated in fresh
phenol red-free medium with 1)
10-7 M
estrogen, 2) 10-7
M estrogen, and
10-5 M ICI, 3)
1000 U/ml IFN, 4) IFN and estrogen, and 5) solvent. Cells were
harvested after 24 h, and RNA was isolated for Northern blot
analysis. The experiment was repeated twice.
RT-PCR
Total RNA (0.1 µg) was subjected to RT reaction using a
Stratascript RT-PCR kit. Briefly, the RNA samples were mixed with
oligo(deoxythymidine) primer, incubated at 65 C for 5 min, and annealed
at room temperature. First strand cDNA was synthesized using Moloney
murine leukemia virus reverse transcriptase at 37 C, and the
reaction was stopped by heating the tubes at 95 C for 5 min. PCR
reaction was then performed in a 100-µl total volume using 35 ng
p27-specific primers; 200 µM each of deoxy (d)-ATP, dGTP,
dCTP, and dTTP; 1.5 mM Mg2+; and 0.5
µl Taq DNA polymerase (Perkin-Elmer Corp.,
Palo Alto, CA). The conditions for PCR were 94 C for 30 sec for one
cycle, followed by 94 C for 30 sec, 65 Cfor 30 sec, and 68 C for 2 min
for 25 cycles. PCR products were electrophoresed on agarose gels and
processed for Southern blot analysis. RT-PCR reactions were also
performed with human and rat IFN-specific primers under identical
conditions.
Southern blot analysis
PCR products (2 µl each) were run on 1% agarose gel. After
electrophoresis, the gel was transferred to a Duralon membrane
(Stratagene). The membrane was prehybridized in 6 x
SSC, 5 x Denhardt’s, 0.5% SDS, and 100 µg/ml salmon sperm DNA
for 2 h at 68 C. Hybridization was performed in the same buffer
containing 106 cpm/ml
32P-labeled cDNA fragment of p27 overnight at 68
C. The membrane was washed with 2 x SSC and 0.1% SDS for 15 min
at room temperature in 0.1 x SSC containing 0.5% SDS at 68 C for
45 min and exposed to x-ray film for 12 h.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Figure 1
represents Northern blot
analysis of mRNA obtained from uteri of rats in estrus (lane 1) and on
day 4 of pregnancy (lane 2). When the blot was probed with a
32P-labeled cDNA clone corresponding to a
potential up-regulated gene, only a faint signal was detected in lane 1
(Fig. 1). In contrast, a strong signal corresponding to 900 bp emerged
in lane 2. Hybridization of the blot with a control probe (GAPDH)
displayed signals of comparable intensities, indicating equal loading
of mRNA in both lanes. These results indicated that the gene we
isolated is indeed up-regulated in the uteri of pregnant (day 4) rats.
Using this cDNA fragment as a probe, we isolated a full-length cDNA
from a rat uterus (day 4) cDNA library. Nucleotide sequence analysis of
the isolated cDNA and comparison with the GenBank database indicated it
to be a novel gene (GenBank accession no. AF154572). Subsequent
characterization of this gene in our laboratory revealed that it is
regulated by IFNs. Therefore, it was designated IRG1.
|
/ß-regulated gene family/ß-inducible gene p27 (11).
The p27 gene encodes a putative protein of 122 amino acids
(11). It displays 88% identity with the predicted IRG1
protein over a stretch of 77 amino acids (Fig. 2A). Previous reports indicated that p27
also shares 31% overall amino acid sequence identity with another
IFN/ß-regulated gene, 6–16 (12, 13). When we aligned
the amino acid sequences of p27, 6–16, and IRG1 to obtain maximal
similarity, a highly conserved core domain containing amino acids was
revealed (Fig. 2B). Whereas the homology regions of IRG1 and p27 shared
greater than 90% similarity, those of IRG1 and 6–16 showed about 75%
similarity. These results raise the possibility that p27, 6–16, and
IRG1 belong to a structurally related family of IFN/ß-regulated
genes.
|
/ß (11), we investigated whether IRG1 is induced
in rat uterus in response to IFNs. Animals were first ovariectomized to
eliminate any influence of ovarian steroids on IRG1 expression and then
were injected with IFN or IFN (as control). mRNA isolated from
uteri of treated animals was subjected to Northern blot analysis using
an IRG1-specific probe. As shown in Fig. 3, treatment with increasing amounts of
IFN induced uterine IRG1 mRNA expression in a dose-dependent manner
(compare lanes 1, 2, and 3). In contrast, treatment of animals with
similar doses of IFN failed to induce IRG1 mRNA (lane 4).
Therefore, consistent with our finding that IRG1 belongs to the same
gene family as human p27, its expression in the rat uterus is indeed
regulated by IFN.
|
, a high level
of IRG1 mRNA was detected on day 1 of pregnancy. The level of this mRNA
dropped markedly by day 2 of gestation and remained low on day 3. It
reached a peak on day 4 and then declined progressively on days 5 and 6
of pregnancy. The relative level of expression of IRG1 was estimated by
densitometric scanning, followed by normalization with respect to the
control GAPDH mRNA signal. By our estimate, the level of IRG1 mRNA on
day 4 was about 5-fold higher than that on day 2 of gestation (Fig. 4B). As IRG1 expression is regulated by IFN, we also monitored the
temporal pattern of IFN mRNA expression during early pregnancy by
RT-PCR (Fig. 4C). Interestingly, IFN mRNA expression peaked on
days 1 and 4 of pregnancy, indicating that its profile closely
reflected that of IRG1 mRNA. These results are consistent with a
regulatory role for IFN in the transient bursts of IRG1 mRNA
expression that occurred in the uterus on days 1 and 4 of
gestation.
|
). Uterine sections from day 4 pregnant
animals were hybridized with a 300-bp DIG-labeled antisense or sense
RNA probe containing sequences from IRG1 cDNA. Although control uterine
sections (pregnant, day 4) hybridized with the sense RNA probe did not
exhibit any significant signal (Fig 5B), we observed a strong
hybridization signal in the luminal and glandular epithelial cells of
these uterine sections upon hybridization with the antisense probe
(Fig. 5, A and C). Specific hybridization signal was also found in the
stroma in the immediate vicinity of luminal epithelium. These results
demonstrate that the epithelial and stromal cells are the sites of
induction of uterine IRG1 mRNA synthesis on day 4 of pregnancy.
|
, only a low level of IRG1 mRNA
was detectable in uteri of ovariectomized rats (lane ovex). Treatment
with progesterone alone for 4 consecutive days (lane
P1234) failed to induce IRG1 mRNA in the uterus.
In contrast, IRG1 mRNA was markedly induced after treatment with
estrogen alone for 4 days (lane E1234). The net
estrogen-dependent stimulation in IRG1 mRNA after 4 days of treatment
was quantitated to be about 3-fold relative to the level in the
ovariectomized animals. Simultaneous administration of estrogen and
progesterone elicited the same response as estrogen alone (lane
{E+P}1234), indicating that progesterone does
not significantly affect uterine IRG1 expression.
|
, treatment with ICI 182,780
caused a partial (
40%) decline in the preimplantation induction of
IRG1 mRNA. These results confirmed that estrogen acting via its nuclear
receptors contributes significantly to the regulation of IRG1
expression in the pregnant uterus during implantation. Interestingly,
the failure of ICI 182,780 to completely block IRG1 expression pointed
to an estrogen-independent component of this regulation. Consistent
with this prediction, we observed (Fig. 3) that IFN can regulate
IRG1 expression in the uterus independently of estrogen.
Synergistic activation of p27 gene by IFN and estrogen-bound ER
in Ishikawa endometrial cells
Previous studies indicated that treatment with IFN or estrogen
induced the expression of human gene p27, which exhibits high homology
to rat IRG1, in breast carcinoma MCF-7 cells (11).
Interestingly, IFN also induced p27 mRNA in cell lines lacking ER
(11). We therefore investigated whether IFNs and/or
estrogen regulate the expression of p27 in Ishikawa cells, which are
transformed human endometrial cells of epithelial origin
(16). p27 expression was monitored by RT-PCR analysis
using total RNA isolated from these cells. As shown in Fig. 7A, treatment of Ishikawa cells with
IFN did not induce p27 mRNA (lane 2). In contrast, a dramatic
increase in the level of p27 mRNA was observed when cells were treated
with either IFN or IFNß (lanes 3 and 4). These results indicated
that p27 expression in the endometrial cells is indeed regulated by
type I IFNs.
|
to boost the level of ER and then treated with either
estrogen, IFN, or a combination of estrogen and IFN. After
treatment with these ligands, the p27 expression was monitored by
Northern blot analysis using total RNA isolated from these cells. As
shown in Fig. 7B, a low basal promoter activity was observed when cells
were transfected with expression vector harboring human ER in the
absence of estrogen (lane 1). However, when ER expression vector was
transfected in the presence of estrogen, a 6- to 8-fold induction in
p27 mRNA was observed (lane 2). This ER-mediated induction of p27
transcript was dependent on estrogen, as treatment of cells with ICI
182,780 significantly blocked IRG1 expression (lane 3). Treatment of
cells with IFN alone also increased the level of p27 mRNA in
Ishikawa cells, and this response was much more robust (30-fold)
relative to that induced by estrogen (lane 4). Interestingly, when
Ishikawa cells were treated with a combination of IFN and estrogen
(lane 5), we observed a synergistic or greater than additive response
(100-fold). These results indicated that ER and IFN pathways
converge on the promoter of the p27 gene to effect its maximal
expression.
p27 mRNA is expressed in human endometrium within the putative
window of implantation
As IRG1 is expressed in the rat uterus at the onset of
implantation, it was of interest to examine the expression profile of
p27 in human endometrium. In human, the implantation window is thought
to open in the midsecretory phase between days 18–24 of the menstrual
cycle (17, 18, 19, 20, 21). To monitor the expression of p27 mRNA in
human endometrium during the menstrual cycle, we analyzed RNA isolated
from human endometrial biopsies at proliferative, mid-ecretory, and
late secretory phases by RT-PCR. The PCR-amplified products were then
subjected to Southern blot analysis employing as probe a radiolabeled
p27 cDNA fragment. The results shown in Fig. 8A indicate that low levels of p27
transcripts were detected in the proliferative phase (lanes P1, P2, and
P3). However, the level of p27 mRNA increased dramatically in the
midsecretory phase (lanes M1, M2, and M3), which then declined
significantly by the late secretory phase of the cycle (lanes S1, S2,
and S3). Interestingly, the profile of p27 mRNA closely followed that
of IFN mRNA during the menstrual cycle (Fig. 8B). Collectively,
these results raise the possibility that the rise in IFN level
during the midsecretory phase drives the expression of p27 in human
endometrium within the putative window of implantation.
|
, a
strong hybridization of the probe to the glandular epithelial cells was
observed in the sections of the midsecretory phase endometrium (Fig. 8C, panel C'). In contrast, a low hybridization signal was present in
glandular epithelial cells of the proliferative or late secretory phase
endometrium (Fig. 8C, panels A' and B', respectively). Control uterine
sections (day 20) hybridized with the corresponding sense RNA probe of
equal length did not exhibit any signal demonstrating the specificity
of the hybridization reaction (Fig. 8C, panel D'). These results
further confirmed that p27 mRNA is induced in the glandular epithelial
cells of human endometrium during the midsecretory phase of the
menstrual cycle overlapping the putative window of implantation. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in the periimplantation uterus. This gene, IRG1, shares
remarkable amino acid sequence identity with a previously identified
IFN/ß-inducible human gene, p27. We demonstrated that the
expression of IRG1 as well as p27 in endometrial epithelial cells is
indeed controlled by IFN/ß. We also noted that both IRG1 and p27
exhibit sequence similarity with a conserved homology domain of another
IFN/ß-inducible gene, 6–16, indicating that these three genes may
constitute a newly emerging family of IFN-regulated genes.
The spatio-temporal expression of IRG1 in rat uterus during early
pregnancy is consistent with its regulation by IFN. IRG1 expression
peaked on days 1 and 4 of gestation coincident with high expression of
IFN on these days (Fig. 4, A–C). At the onset of pregnancy in
rodents, clusters of macrophages appear near the uterine lumen close to
the implantation sites (23). Interestingly, we found that
IRG1 mRNA is expressed in the surface and glandular epithelial cells as
well as in the stroma in the immediate vicinity of the uterine lumen on
day 4 of gestation. It is conceivable that IFN secreted by the
immune cells localized near the implantation sites regulate IRG1
expression in epithelial and the surrounding stromal cells in a
paracrine or autocrine manner. In human endometrium, the macrophages
substantially increase in number during the secretory phase of the
menstrual cycle (26, 27). They represent as much as
5–15% of the endometrial stromal cells and are distributed throughout
the uterine stroma (26, 27). We observed that the temporal
expression of IRG1 mRNA in human endometrium during the menstrual cycle
closely follows the profile of IFN mRNA. For example, an increase in
IFN mRNA during the midsecretory phase of the cycle was accompanied
by a marked induction of IRG1 mRNA expression in the endometrial
glands.
The steroid hormone estrogen also stimulated the expression of IRG1 in
rat uterus. Although progesterone had no effect on IRG1 expression,
treatment of ovariectomized rats with estrogen led to a 3-fold increase
in the level of this mRNA in the uterus. Estrogen also contributed to
uterine IRG1 expression during pregnancy. Treatment of pregnant animals
with antiestrogen ICI, which strongly inhibits the transcriptional
activity of the ER, blocked uterine IRG1 expression by as much as 40%.
As uterine epithelial cells are known to contain abundant ERs during
early pregnancy, it is likely that these receptors play a significant
role in IRG1 expression in the epithelial cells at the time of
implantation (28). During pregnancy in the rat, the
circulating level of estrogen is high on day 1, drops off during days 2
and 3, rises transiently on day 4, and then falls again. Consistent
with this profile of estrogen, IRG1 expression in the uterus was
highest on days 1 and 4 of pregnancy. Our studies in Ishikawa
endometrial cells also confirmed that estrogen-bound ER acts in concert
with IFN to maximally induce p27 mRNA. The expression of IRG1 and
p27 is therefore regulated by a complex interplay of estrogen and
IFN.
It appears that of these two modulators of IRG1 expression, IFN is
the dominant one. Whereas the administration of IFN alone induced
strong IRG1 expression in ovariectomized rats and cultured cells in the
absence of estrogen, we have no evidence to suggest that estrogen can
induce this gene in the absence of IFN. Expression of IRG1 is
minimal in the uteri of cycling rats, even in the presence of high
estrogen during the estrous stage, presumably due to a lack of IFN
expression during the reproductive cycle (Kumar, S., and I. C.
Bagchi, unpublished results). In pregnant rats, a rise in the level of
IFN mRNA was accompanied by abundant IRG1 mRNA expression on days 1
and 4 of pregnancy. As the IFN mRNA level dropped off after
implantation, IRG1 expression also declined. We observed a similar
scenario when we monitored p27 mRNA expression in human endometrium
during the menstrual cycle. p27 mRNA was barely detectable in
estrogen-dominated proliferative endometrium in the absence of IFN
mRNA expression. As the IFN mRNA level rose in the midsecretory
phase overlapping the putative window of implantation, significant p27
mRNA expression was observed. The expression of p27 mRNA declined in
the late secretory phase with a concomitant diminution in the IFN
mRNA level.
A previous report by Rasmussen et al. described the
induction of p27 mRNA by IFN in a variety of human tumor cell lines
(11). High levels of p27 mRNA were also detected in
approximately 50% of primary human breast carcinomas
(11). Interestingly, treatment of human MCF7 breast cancer
cells, which are enriched in ER, with either estrogen or IFN led to
an induction of p27 mRNA (11). These results are very
similar to our finding that IRG1 expression in the uterus is under dual
regulation of estrogen and IFN. However, p27 mRNA was also expressed
in a number of human tumor cell lines, which apparently lack ERs
(11). These results are also consistent with our
observation that treatment with IFN induced expression of IRG1 mRNA
in the uterus and p27 mRNA in Ishikawa cells in an estrogen-independent
manner.
The mechanism of activation of the IRG1 or p27 gene by IFN probably
involves transcription factors termed STATs (signal transducers and
activators of transcription) (29, 30). IFN signaling is
initiated at the cell surface where the cytokine interacts with its
cognate receptor (29, 30). This binding activates
membrane-associated protein kinases, which phosphorylate latent STATs
that initially reside in the cytoplasm (29, 30). In
response to IFN, both Stat1 and Stat2 are phosphorylated, leading to
their association and nuclear translocation (29, 30). In
the nucleus, a stable multimeric complex that includes Stat1, Stat2,
and p48 is formed on the IFN-stimulated response element of target gene
leading to gene activation (29, 30). Whether the IRG1 or
p27 promoter contains a functional IFN-stimulated response element is
currently under investigation in our laboratory.
Treatment of Ishikawa cells in vitro with a combination of
estrogen-occupied ER and IFN produced synergistic activation of p27
expression. The observed transcriptional synergy on the p27 promoter is
probably due to interactions between the steroid hormone and IFN
signaling pathways by an unknown mechanism. Estrogen-dependent gene
activation is initiated upon binding of estrogen to its intracellular
receptor, ER or ERß (31, 32, 33, 34). It is generally
believed that a hormone-bound ER modulates transcription by binding to
the cognate DNA response element at the target gene promoter
(31, 32, 33, 34). However, several recent studies have suggested
that steroid receptors can regulate the activities of genes that are
simultaneously regulated by peptide hormones or growth factors or
cytokines, even when the promoters lack classical
steroid-responsive DNA elements (35, 36, 37, 38). It has
been documented that progesterone and glucocorticoid receptors can
activate target genes by docking on to promoter-bound transcription
factors such as Sp1 and Stat5 (36, 39, 40). Future studies
will focus on the mechanisms by which ER and IFN pathways converge
on the IRG1 or p27 promoter to regulate its expression in the
endometrium.
Previous studies demonstrated a critical role for an IFN known as
IFN
in establishing pregnancy in ruminants (41, 42, 43, 44).
IFN is expressed by the preimplantation trophoblast, and it
functions as a pregnancy recognition signal by preventing regression of
the corpus luteum (41, 42, 43, 44). Interestingly, the mechanism
of this antiluteolytic effect has been attributed to regulation of
endometrial ER gene expression in response to IFN
(45, 46, 47). Studies have shown that IFN represses
endometrial ER expression, which, in turn, down-regulates oxytocin
receptor and inhibits pulsatile release of
PGF2 (45, 46, 47). The altered
uterine release of PGF2 results in rescue of
the corpus luteum and continued release of progesterone. Expression of
type I IFN by mouse embryos and of type II IFN by the pig
conceptus has also been reported (48, 49).
The physiological role of IFNs of maternal origin during implantation
remains a mystery. The observation that the level of IFN rises
transiently at the onset of implantation (day 4) in the rat uterus and
within the putative window of implantation in the human endometrium
suggests an important regulatory role of this cytokine during early
pregnancy. The convergence of IFN-producing immune cells near the
implantation sites in rodents is also consistent with such a role.
Furthermore, the precise implantation stage-specific expression of IRG1
and p27, the downstream target genes of IFN in rodent and human
endometria, is conserved across species, predicting a critical role for
this signaling pathway at the time of implantation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Present address: Department of Veterinary Biosciences,
University of Illinois at Urbana-Champaign, Urbana, Illinois 61802.
3 Present address: Department of Molecular and Integrative
Physiology, University of Illinois at Urbana-Champaign, Urbana,
Illinois 61801.
Received September 15, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-inducible gene (p27) on human chromosome 14q32 and its
expression in breast carcinoma. Cancer Res 53:4096–4101
and ß-interferons and its expression in mouse cells. EMBO J 5:1601–1606[Medline]
and pregnancy.
J Interferon Cytokine Res 16:271–273[Medline]
: a novel pregnancy recognition signal. Am J Reprod
Immunol 37:412–420
in the
uterus during early pregnancy. J Reprod Fertil [Suppl] 54:329–339[Medline]
regulates expression of
endometrial receptors for estrogen and oxytocin but not progesterone.
Biol Reprod 53:732–745[Abstract]
suppresses transcription of the estrogen receptor and oxytocin receptor
genes in the ovine endometrium. Endocrinology 137:1144–1147[Abstract]
gene and protein
are spontaneously expressed by the porcine trophectoderm early in
gestation. Eur J Immunol 20:2485–2490[Medline]This article has been cited by other articles:
 |
|
 |
|
  F. W Bazer, T. E Spencer, G. A Johnson, R. C Burghardt, and G. Wu Comparative aspects of implantation Reproduction, August 1, 2009; 138(2): 195 - 209. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Joyce, J. R. Burghardt, R. C. Burghardt, R. N. Hooper, F. W. Bazer, and G. A. Johnson Uterine MHC Class I Molecules and {beta}2-Microglobulin Are Regulated by Progesterone and Conceptus Interferons during Pig Pregnancy J. Immunol., August 15, 2008; 181(4): 2494 - 2505. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T Asselah, I Bieche, S Narguet, A Sabbagh, I Laurendeau, M-P Ripault, N Boyer, M Martinot-Peignoux, D Valla, M Vidaud, et al. Liver gene expression signature to predict response to pegylated interferon plus ribavirin combination therapy in patients with chronic hepatitis C Gut, April 1, 2008; 57(4): 516 - 524. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. E Spencer, O. Sandra, and E. Wolf Genes involved in conceptus-endometrial interactions in ruminants: insights from reductionism and thoughts on holistic approaches Reproduction, February 1, 2008; 135(2): 165 - 179. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Joyce, R. C. Burghardt, R. D. Geisert, J. R. Burghardt, R. N. Hooper, J. W. Ross, M. D. Ashworth, and G. A. Johnson Pig Conceptuses Secrete Estrogen and Interferons to Differentially Regulate Uterine STAT1 in a Temporal and Cell Type-Specific Manner Endocrinology, September 1, 2007; 148(9): 4420 - 4431. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Joyce, J. R. Burghardt, R. C. Burghardt, R. N. Hooper, L. A. Jaeger, T. E. Spencer, F. W. Bazer, and G. A. Johnson Pig Conceptuses Increase Uterine Interferon-Regulatory Factor 1 (IRF1), but Restrict Expression to Stroma Through Estrogen-Induced IRF2 in Luminal Epithelium Biol Reprod, August 1, 2007; 77(2): 292 - 302. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Pan, L. Zhu, Y. Deng, and J. W. Pollard Microarray Analysis of Uterine Epithelial Gene Expression during the Implantation Window in the Mouse Endocrinology, October 1, 2006; 147(10): 4904 - 4916. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Li, M. K. Bagchi, and I. C. Bagchi Identification of a Signaling Pathway Involving Progesterone Receptor, Calcitonin, and Tissue Tranglutaminase in Ishikawa Endometrial Cells Endocrinology, May 1, 2006; 147(5): 2147 - 2154. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kim, Y. Choi, F. W. Bazer, and T. E. Spencer Identification of Genes in the Ovine Endometrium Regulated by Interferon {tau} Independent of Signal Transducer and Activator of Transcription 1 Endocrinology, December 1, 2003; 144(12): 5203 - 5214. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. J. Austin, B. M. Bany, E. L. Belden, L. A. Rempel, J. C. Cross, and T. R. Hansen Interferon-Stimulated Gene-15 (Isg15) Expression Is Up-Regulated in the Mouse Uterus in Response to the Implanting Conceptus Endocrinology, July 1, 2003; 144(7): 3107 - 3113. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Labrada, X. H. Liang, W. Zheng, C. Johnston, and B. Levine Age-Dependent Resistance to Lethal Alphavirus Encephalitis in Mice: Analysis of Gene Expression in the Central Nervous System and Identification of a Novel Interferon-Inducible Protective Gene, Mouse ISG12 J. Virol., October 11, 2002; 76(22): 11688 - 11703. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
