help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Q.
Right arrow Articles by Bagchi, I. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Q.
Right arrow Articles by Bagchi, I. C.
Endocrinology Vol. 142, No. 6 2390-2400
Copyright © 2001 by The Endocrine Society

ARTICLES

Identification and Implantation Stage-Specific Expression of an Interferon-{alpha}-Regulated Gene in Human and Rat Endometrium1

Quanxi Li2, Meilin Zhang, Sushma Kumar, Li-Ji Zhu, Dahu Chen, Milan K. Bagchi3 and Indrani C. Bagchi2

The Population Council and Rockefeller University, New York, New York 10021; and Nassau County Medical Center, State University of New York Stonybrook, Health Sciences Center (S.K.), Stonybrook, New York 10016

Address all correspondence and requests for reprints to: Indrani C. Bagchi, Ph.D., Department of Veterinary Biosciences, University of Illinois at Urbana-Champaign, Urbana, Illinois 61802. E-mail: ibagchi{at}uiuc.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Implantation of the developing blastocyst is regulated by multiple effectors, such as steroid hormones, growth factors, and cytokines. To understand how these diverse signaling pathways interact to modulate uterine gene expression, we employed a gene expression screen technique to identify the molecules that are induced in the periimplantation rat uterus. Here we report the isolation of a complementary DNA representing a novel gene, interferon-regulated gene 1 (IRG1). This gene exhibits significant homology to interferon (IFN)-{alpha}/ß-inducible human genes p27 and 6–16, indicating that these genes may belong to the same family. Consistent with this finding, expression of IRG1 messenger RNA (mRNA) in rat uterus increased about 20-fold in response to IFN{alpha}. Uterine expression of IRG1 was also stimulated by estrogen and was partially inhibited by an antiestrogen, ICI 182,780. In pregnant rats, IRG1 expression was high on day 1, but declined on days 2 and 3. The level of IRG1 mRNA again rose transiently on day 4 immediately preceding implantation. In situ hybridization analysis localized the IRG1 mRNA expression in the endometrial epithelium and the surrounding stroma. Interestingly, the expression of p27, which shows high homology to IRG1, was strongly enhanced in human endometrium during the midsecretory phase of the menstrual cycle, overlapping the putative window of implantation. Both IRG1 and p27 mRNAs are therefore induced in the endometrium in an implantation stage-specific manner. We also observed a synergistic interaction between IFN{alpha} and estrogen receptor signaling pathways that led to maximal induction of p27 mRNA in Ishikawa cells. Although the functional roles of IRG1 and p27 remain unclear, we describe for the first time, identification of a gene family regulated by IFN{alpha} in both rodent and human uteri. More importantly, our studies reveal that a complex interplay between the steroid hormone and IFN pathways regulates the expression of these genes in the endometrium at the time of implantation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
IN HUMANS and rodents, implantation of the embryo occurs 4–6 days after fertilization when the blastocyst reaches the uterus (1, 2). The blastocyst initially adheres to and penetrates the uterine epithelium and subsequently invades the uterine stroma. The uterus simultaneously undergoes pronounced changes in cell proliferation, differentiation, and remodeling that prepare it to be receptive to invasion by the embryo (1, 2, 3, 4, 5, 6). The specific modifications leading to acquisition of the receptive state of the uterus are regulated by a complex and timely interplay of a variety of effectors, including steroid hormones, growth factors, and cytokines (2, 7, 8, 9). However, the identity of the molecules that are induced or suppressed by these effectors and the precise nature of the mechanisms through which these molecules promote uterine receptivity remain unclear.

As a first step toward understanding the molecular basis of the acquisition of uterine receptivity, we sought to identify the genes whose expression is induced in the rat uterus at the onset of implantation. By employing a gene expression screening technique (10), we isolated a complementary DNA (cDNA) representing a novel gene whose expression in the uterus is under dual regulation of IFN{alpha} and estrogen. Nucleotide sequence analysis of the cDNA revealed that it encodes a new member of a family of human interferon (IFN)-{alpha}/ß-inducible genes (11, 12, 13). We termed this newly identified gene IFN-regulated gene 1 (IRG1). Although IFN{alpha} alone was able to induce the expression of IRG1, its maximal expression in the uterus required the presence of both estrogen and IFN{alpha}. IRG1 was expressed in rat endometrium during the preimplantation period. Interestingly, p27, which shows strong homology to IRG1, was also induced in human endometrium within the putative window of implantation. This remarkable conservation of implantation stage-specific expression of IRG1 and p27 across species predicts a critical role of these IFN-regulated genes in the implantation process.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents
Progesterone and 17ß-estradiol were purchased from Sigma (St. Louis, MO). Recombinant IFN{alpha} and IFNß were purchased from ICN Biomedicals, Inc. (Costa Mesa, CA), and IFN{gamma} was purchased from Genzyme Corp. (Cambridge, MA).

Animals
All experiments involving animals were approved by institutional animal care and use committee of the Rockefeller University. Virgin female rats (Sprague Dawley, from Charles River Laboratories, Inc. Wilmington, MA; 60–75 days of age), in proestrus, were mated with adult males. The different stages of the cycle in the nonpregnant rats were ascertained by examining vaginal smears. The presence of a vaginal plug after mating was designated day 1 of pregnancy. The animals were killed at various stages of gestation, and the uteri were collected. The uteri were freed of embryonic tissue either by repeated flushings (days 1–5) or by individually removing the embryos from the implantation sites (day 6). These embryo-free tissues were used for Northern blots, RT-PCR, and in situ hybridization studies. In some experiments, animals were ovariectomized and 1 week later were injected sc with estradiol (2 µg/kg BW), progesterone (40 mg/kg BW), or a combination of both hormones or vehicle (sesame oil) as described in Results. Ovariectomized animals were also injected with 1 x 104 and 5 x 104 U IFN{alpha} and 5 x 104 U/rat of IFN{gamma}. The rats were killed 24 h after final injection.

Endometrial tissues
Human endometrial tissues were obtained as part of endometrial curettage from healthy, nonpregnant females, between the ages of 25–40 yr, before elective sterilization with informed consent. These tissues were obtained in accordance with the rules and regulations of the institution and after approval of the institutional review board at the Nassau County Medical Center. Endometrial tissues were transported to the laboratory in Hanks’ Balanced Salt Solution on ice. Tissues were then snap-frozen in liquid nitrogen and stored at -70 C until further use. Endometrial tissues were classified according to serum levels of estradiol and progesterone and histology according to the criteria of Noyes et al. (14).

Gene expression screen
Whole uteri were isolated from nonpregnant (estrus stage) and pregnant (day 4) rats and processed for polyadenylated [poly(A)+] RNA isolation employing a fast track messenger RNA (mRNA) isolation kit (Invitrogen, San Diego, CA). Double stranded cDNA was synthesized with 10 µg poly(A)+ RNA using a ZAP-cDNA synthesis kit from Stratagene (La Jolla, CA) and was divided into two aliquots. One aliquot was used to construct a cDNA library ({lambda}ZAP II kit from Stratagene), and the other was used in the gene expression screening protocol. The gene expression screen technique was performed essentially as described by Wang and Brown (10). Briefly, 5 µg double stranded cDNA from uterus of either nonpregnant or pregnant rats was digested with AluI plus RsaI and then ligated with 15 µg double stranded, phosphorylated deoxyoligonucleotide linkers. The nucleotide sequence of the oligonucleotides were CTCTTGCTTGAATTCGGACTA and TAGTCCGAATTCAAGCAAGAGCACA. After ligation, reactions were electrophoresed on a 1.4% low melting agarose gel to remove the unligated linkers. The linker-ligated AluI/RsaI cDNA fragments in the size range of 0.15–1.5 kb were recovered from the gel. For PCR amplification, 2 µl linker-ligated cDNA fragments in molten agarose was used (94 C, 1 min; 50 C, 1 min; 72 C, 2 min; 25 sec of autoextension/cycle; 30 cycles). This reaction yielded about 150 µg cDNA. Subtractive hybridization was then carried out using 100 µg cDNA isolated from uteri of nonpregnant animals as driver, 5 µg cDNA from uteri of pregnant animals as tracer, and vice versa. The procedure was repeated through 4 cycles, and populations enriched in genes, which were either up- or down-regulated during pregnancy, were obtained. The enriched cDNA fragments were then ligated to pBluescript vector (Stratagene), and transformed into competent Escherichia coli DH5{alpha} cells resulting in libraries of up- and down-regulated cDNAs.

Isolation and sequence analysis of IRG1 cDNA
A library of up- or down-regulated genes was plated. Duplicate filters were lifted from the plate and probed with a 32P-labeled cDNA pool enriched in either up- or down-regulated genes. We screened about 2000 colonies of either library and identified colonies that displayed positive signals when probed with up-regulated, but not down-regulated, cDNAs and vice versa. We isolated DNA from these clones and used them as probes for Northern blot analysis to confirm that the isolated clones are indeed up- or down-regulated during pregnancy. During Northern blotting, mRNA obtained from either nonpregnant or pregnant (day 4) uteri were run on a gel, transferred to a nylon membrane, and probed with 32P-labeled DNA isolated from potential clones. By this method we identified a 300-bp clone that was up-regulated during pregnancy. The partial clone was then used to screen a uterine cDNA library (pregnancy day 4) that we had constructed earlier. A full-length clone was then isolated, and determination of its nucleotide sequence revealed it to be a novel gene. We termed this gene IRG1.

Northern blot analysis
For Northern analysis, 6–8 µg poly(A)+ mRNA or 20 µg total RNA were separated by formaldehyde agarose gel electrophoresis and transferred to Duralon membrane (Stratagene). Blots were prehybridized in 50 mM NaPO4 (pH 6.5), 5 x SSC (standard saline citrate), 5 x Denhardt’s solution, 50% formamide, 0.1% SDS, and 100 µg/ml salmon sperm DNA for 4 h at 42 C. Hybridization was carried out overnight in the same buffer containing 106 cpm/ml 32P-labeled IRG1 cDNA fragment. The filters were washed twice for 15 min each time in 1 x SSC/0.1% SDS at room temperature, then twice for 20 min each time in 0.2 x SSC/0.1% SDS at 55 C, and the filters were exposed to x-ray films for 24–72 h. The intensity of a signal on the autoradiogram was estimated by densitometric scanning. To correct for RNA loading, IRG1 signals were normalized to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) signal in the same blot. For this, the filters were stripped of the radioactive IRG1 probe by washing for 5 min in 0.1% SDS at 95 C. The blots were then reprobed with a 32P-labeled GAPDH probe (CLONTECH Laboratories, Inc., Palo Alto, CA) as described above.

In situ hybridization
Uterine tissue from pregnant animals (day 4, 1700 h) was collected and frozen. Tissues were fixed in 4% paraformaldehyde at 4 C. Cryostat sections were cut at 8 µm and attached to 3-aminopropyl triethyl silane (Sigma)-coated slides. In situ hybridization was performed with digoxygenin (DIG)-labeled sense or antisense RNA probes of IRG1 gene. DIG-labeled RNA probes were synthesized from IRG1 cDNA using T3 or T7 RNA polymerase and DIG-labeled nucleotides according to manufacturer’s specifications (Roche Molecular Biochemicals, Indianapolis, IN). Prehybridization was carried out in a damp chamber at 55 C for 60 min in hybridization buffer (50% formamide, 5 x SSC, 2% blocking reagent, 0.02% SDS, and 0.1% N-laurylsarcosine). Hybridization was carried out at 55 C overnight in a damp humidified chamber. To develop the substrate, sections were sequentially washed in 2 x SSC, 1 x SSC, and 0.1 x SSC for 15 min in each buffer at 37 C. Sections were then incubated with anti-DIG alkaline phosphatase-conjugated antibody. Excess antibody was washed away, and the color substrate (nitro blue tetrazolium salt and 5-bromo-4-chloro-3-indoylphosphate) was added. Slides were allowed to develop in the dark, and color was visualized under light microscopy until maximum levels of staining were achieved. Control incubations used a DIG-labeled RNA sense strand and were performed under identical conditions. For human endometrium, in situ hybridization was performed with DIG-labeled antisense RNA probes complimentary to the p27 gene.

Transient transfection experiments
Ishikawa endometrial adenocarcinoma cells were maintained in DMEM (Life Technologies, Inc., Grand Island, NY) supplemented with 5% FBS (HyClone Laboratories, Inc., Logan, UT). Cells (5 x 105) were plated on 10-cm tissue culture dishes in phenol red-free medium containing 5% charcoal-stripped serum. After 24–48 h cells were transiently transfected with plasmid DNAs using Lipofectamine (Life Technologies, Inc.) according to the manufacturer’s guidelines. Typically, cells received 1 µg estrogen receptor {alpha} (ER{alpha}) plasmid. After 24 h the cells were washed with PBS and incubated in fresh phenol red-free medium with 1) 10-7 M estrogen, 2) 10-7 M estrogen, and 10-5 M ICI, 3) 1000 U/ml IFN{alpha}, 4) IFN{alpha} and estrogen, and 5) solvent. Cells were harvested after 24 h, and RNA was isolated for Northern blot analysis. The experiment was repeated twice.

RT-PCR
Total RNA (0.1 µg) was subjected to RT reaction using a Stratascript RT-PCR kit. Briefly, the RNA samples were mixed with oligo(deoxythymidine) primer, incubated at 65 C for 5 min, and annealed at room temperature. First strand cDNA was synthesized using Moloney murine leukemia virus reverse transcriptase at 37 C, and the reaction was stopped by heating the tubes at 95 C for 5 min. PCR reaction was then performed in a 100-µl total volume using 35 ng p27-specific primers; 200 µM each of deoxy (d)-ATP, dGTP, dCTP, and dTTP; 1.5 mM Mg2+; and 0.5 µl Taq DNA polymerase (Perkin-Elmer Corp., Palo Alto, CA). The conditions for PCR were 94 C for 30 sec for one cycle, followed by 94 C for 30 sec, 65 Cfor 30 sec, and 68 C for 2 min for 25 cycles. PCR products were electrophoresed on agarose gels and processed for Southern blot analysis. RT-PCR reactions were also performed with human and rat IFN{alpha}-specific primers under identical conditions.

Southern blot analysis
PCR products (2 µl each) were run on 1% agarose gel. After electrophoresis, the gel was transferred to a Duralon membrane (Stratagene). The membrane was prehybridized in 6 x SSC, 5 x Denhardt’s, 0.5% SDS, and 100 µg/ml salmon sperm DNA for 2 h at 68 C. Hybridization was performed in the same buffer containing 106 cpm/ml 32P-labeled cDNA fragment of p27 overnight at 68 C. The membrane was washed with 2 x SSC and 0.1% SDS for 15 min at room temperature in 0.1 x SSC containing 0.5% SDS at 68 C for 45 min and exposed to x-ray film for 12 h.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Isolation of IRG1 cDNA
To identify the genes that are potential regulators of implantation in the rat, we focused our efforts within a narrow gestational window between fertilization (day 1) and implantation (day 5). Our experimental strategy involved application of a gene expression screen technique previously described by Wang and Brown (10). We isolated mRNAs from uteri of nonpregnant (estrus stage) and pregnant (day 4 of gestation) rats. The embryos were removed from each pregnant (day 4) uterine horn by repeated flushings to avoid contamination by embryonic mRNAs during isolation of uterine mRNAs. We synthesized cDNAs from the isolated mRNAs and amplified these cDNAs by PCR. Using these two cDNA pools, we carried out differential gene screening. After performing repeated cycles of a protocol involving removal of common genes and enrichment of differentially expressed genes, we isolated several genes that are potentially up- or down-regulated in the uterus during the periimplantation period. The differential expression of isolated cDNAs was then confirmed by Northern blotting experiments.

Figure 1Go represents Northern blot analysis of mRNA obtained from uteri of rats in estrus (lane 1) and on day 4 of pregnancy (lane 2). When the blot was probed with a 32P-labeled cDNA clone corresponding to a potential up-regulated gene, only a faint signal was detected in lane 1 (Fig. 1Go). In contrast, a strong signal corresponding to 900 bp emerged in lane 2. Hybridization of the blot with a control probe (GAPDH) displayed signals of comparable intensities, indicating equal loading of mRNA in both lanes. These results indicated that the gene we isolated is indeed up-regulated in the uteri of pregnant (day 4) rats. Using this cDNA fragment as a probe, we isolated a full-length cDNA from a rat uterus (day 4) cDNA library. Nucleotide sequence analysis of the isolated cDNA and comparison with the GenBank database indicated it to be a novel gene (GenBank accession no. AF154572). Subsequent characterization of this gene in our laboratory revealed that it is regulated by IFNs. Therefore, it was designated IRG1.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 1. IRG1 mRNA expression is induced during early pregnancy. Lanes 1 and 2, mRNAs (6 µg) isolated from uteri of nonpregnant (estrus) and pregnant (day 4) animals, respectively. The blot was hybridized to a 32P-labeled probe of either rat IRG1 cDNA (top) or GAPDH gene (bottom).

 
IRG1 is a member of an IFN{alpha}/ß-regulated gene family
The IRG1 cDNA harbors an open reading frame of 525 bp in length. The conceptual translation of the cDNA predicts a protein of 175 amino acids. A search of GenBank databases showed that IRG1 cDNA exhibits striking nucleotide sequence homology to a previously identified cDNA representing the human IFN{alpha}/ß-inducible gene p27 (11). The p27 gene encodes a putative protein of 122 amino acids (11). It displays 88% identity with the predicted IRG1 protein over a stretch of 77 amino acids (Fig. 2AGo). Previous reports indicated that p27 also shares 31% overall amino acid sequence identity with another IFN{alpha}/ß-regulated gene, 6–16 (12, 13). When we aligned the amino acid sequences of p27, 6–16, and IRG1 to obtain maximal similarity, a highly conserved core domain containing amino acids was revealed (Fig. 2BGo). Whereas the homology regions of IRG1 and p27 shared greater than 90% similarity, those of IRG1 and 6–16 showed about 75% similarity. These results raise the possibility that p27, 6–16, and IRG1 belong to a structurally related family of IFN{alpha}/ß-regulated genes.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 2. Nucleotide and deduced amino acid sequence of rat IRG1. A, Homology between IRG1 and IFN-inducible gene p27 is indicated. B, Homology among IRG1, p27, and 6–16 is indicated. The conserved core domain is shown by the shaded box.

 
Uterine expression of IRG1 in vivo is regulated by IFN{alpha}
As IRG1 exhibited marked homology to p27, which is regulated by IFN{alpha}/ß (11), we investigated whether IRG1 is induced in rat uterus in response to IFNs. Animals were first ovariectomized to eliminate any influence of ovarian steroids on IRG1 expression and then were injected with IFN{alpha} or IFN{gamma} (as control). mRNA isolated from uteri of treated animals was subjected to Northern blot analysis using an IRG1-specific probe. As shown in Fig. 3Go, treatment with increasing amounts of IFN{alpha} induced uterine IRG1 mRNA expression in a dose-dependent manner (compare lanes 1, 2, and 3). In contrast, treatment of animals with similar doses of IFN{gamma} failed to induce IRG1 mRNA (lane 4). Therefore, consistent with our finding that IRG1 belongs to the same gene family as human p27, its expression in the rat uterus is indeed regulated by IFN{alpha}.



View larger version (39K):
[in this window]
[in a new window]
  		Figure 3. Induction of IRG1 mRNA by IFN{alpha} in rat uterus. RNA (20 µg/lane) was subjected to Northern blot analysis and hybridized with a 32P-labeled IRG1 (upper panel) or GAPDH (lower panel) probe. Lane 1, RNA from uteri of animals injected with vehicle only after ovariectomy; lane 2, RNA from uteri of animals injected with IFN{alpha} (1 x 104 U); lane 3, RNA from uteri of animals injected with IFN{alpha} (5 x 104 U); lane 4, RNA from uteri of animals injected with IFN{gamma} (5 x 104).

 
IRG1 mRNA is transiently induced in periimplantation rat uterus
We next examined the profile of IRG1 mRNA expression in pregnant rat uterus during days 1–6 of gestation by employing Northern blot analysis. Whole uteri devoid of embryos were used for this experiment (see Materials and Methods). As shown in Fig. 4AGo, a high level of IRG1 mRNA was detected on day 1 of pregnancy. The level of this mRNA dropped markedly by day 2 of gestation and remained low on day 3. It reached a peak on day 4 and then declined progressively on days 5 and 6 of pregnancy. The relative level of expression of IRG1 was estimated by densitometric scanning, followed by normalization with respect to the control GAPDH mRNA signal. By our estimate, the level of IRG1 mRNA on day 4 was about 5-fold higher than that on day 2 of gestation (Fig. 4BGo). As IRG1 expression is regulated by IFN{alpha}, we also monitored the temporal pattern of IFN{alpha} mRNA expression during early pregnancy by RT-PCR (Fig. 4C). Interestingly, IFN{alpha} mRNA expression peaked on days 1 and 4 of pregnancy, indicating that its profile closely reflected that of IRG1 mRNA. These results are consistent with a regulatory role for IFN{alpha} in the transient bursts of IRG1 mRNA expression that occurred in the uterus on days 1 and 4 of gestation.



View larger version (19K):
[in this window]
[in a new window]
  		Figure 4. Profile of expression of IRG1 mRNA in rat uterus during early pregnancy. A, Total RNA (20 µg) was isolated from uteri of animals at 1, 2, 3, 4, 5, and 6 days of pregnancy and subjected to Northern blot analysis using IRG1 (upper panel) or GAPDH (lower panel) cDNA probes. B, The intensity of the signal corresponding to the IRG1 transcript was quantitated by densitometric scanning of the autoradiogram and normalized with respect to the GAPDH signals of the Northern blot shown in A. C, Profile of expression of IFN{alpha} mRNA in rat uterus at different stages of pregnancy. The RT-PCR method was employed. Total RNA (0.1 µg) isolated from uteri of animals on days 1–6 of gestation were subjected to RT using oligo(deoxythymidine) primer. The first strand cDNA products were amplified employing primer sets specific for IFN{alpha} or GAPDH. The intensity of the signal corresponding to the IFN{alpha} transcript on different days of pregnancy was plotted. The results are representative of two independent experiments.

 
IRG1 mRNA is expressed in the endometrial epithelia and surrounding stroma
The site of expression of IRG1 mRNA in the preimplantation uterus was investigated by employing in situ hybridization (Fig. 5Go). Uterine sections from day 4 pregnant animals were hybridized with a 300-bp DIG-labeled antisense or sense RNA probe containing sequences from IRG1 cDNA. Although control uterine sections (pregnant, day 4) hybridized with the sense RNA probe did not exhibit any significant signal (Fig 5BGo), we observed a strong hybridization signal in the luminal and glandular epithelial cells of these uterine sections upon hybridization with the antisense probe (Fig. 5Go, A and C). Specific hybridization signal was also found in the stroma in the immediate vicinity of luminal epithelium. These results demonstrate that the epithelial and stromal cells are the sites of induction of uterine IRG1 mRNA synthesis on day 4 of pregnancy.



View larger version (61K):
[in this window]
[in a new window]
  		Figure 5. Localization of IRG1 mRNA in pregnant rat uterus. Uterine sections from pregnant (day 4) rats were subjected to in situ hybridization. The hybridization was performed employing a 300-bp digoxygenin-labeled antisense (A and C) or sense (B) complementary RNA probe specific for IRG1 gene as described in Materials and Methods. g and l, Glandular and luminal epithelia, respectively.

 
Uterine expression of IRG1 is regulated by estrogen
We next examined whether steroid hormones regulate IRG1 expression in the uterus. For this purpose, we administered estrogen and/or progesterone to ovariectomized rats. A week after ovariectomy, the animals were treated with four daily injections of estrogen alone, progesterone alone, and estrogen plus progesterone. Uteri were collected from animals 24 h after the last injection, and mRNAs were isolated from these tissues for Northern blot analysis. As shown in Fig. 6AGo, only a low level of IRG1 mRNA was detectable in uteri of ovariectomized rats (lane ovex). Treatment with progesterone alone for 4 consecutive days (lane P1234) failed to induce IRG1 mRNA in the uterus. In contrast, IRG1 mRNA was markedly induced after treatment with estrogen alone for 4 days (lane E1234). The net estrogen-dependent stimulation in IRG1 mRNA after 4 days of treatment was quantitated to be about 3-fold relative to the level in the ovariectomized animals. Simultaneous administration of estrogen and progesterone elicited the same response as estrogen alone (lane {E+P}1234), indicating that progesterone does not significantly affect uterine IRG1 expression.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 6. Estrogen induces IRG1 mRNA in uteri of ovariectomized rats. A, Poly(A)+ RNA (6 µg/lane) was subjected to Northern blot analysis and hybridized with a 32P-labeled IRG1 (upper panel) or GAPDH (lower panel) probe. Lanes ovex, E1234, P1234, and {E+P}1234, RNA from uteri of animals injected with vehicle, estrogen, progesterone, and estrogen plus progesterone, respectively, for 4 consecutive days. B, Upper panel, RNA (20 µg/lane) was subjected to Northern blot analysis and hybridized with a 32P-labeled IRG1 or GAPDH probe. Lanes 1 and 2, RNA from the uteri of animals injected with vehicle and ICI 182,780 (1 mg/kg BW), respectively. Lower panel, Quantitation of RNA signals was performed by densitometric scanning of the bands in the Northern blot followed by normalization with respect to GAPDH signals.

 
To further examine the regulation of IRG1 mRNA by estrogen during early pregnancy, we studied the effects of an antiestrogen, ICI 182,780, which is known to block the transcriptional activity of ER (15). Animals were injected on day 3 of pregnancy with either vehicle (control) or ICI 182,780. Uteri were collected from animals on day 4, and mRNAs were isolated from these tissues for Northern blot analysis. As shown in Fig. 6BGo, treatment with ICI 182,780 caused a partial (~40%) decline in the preimplantation induction of IRG1 mRNA. These results confirmed that estrogen acting via its nuclear receptors contributes significantly to the regulation of IRG1 expression in the pregnant uterus during implantation. Interestingly, the failure of ICI 182,780 to completely block IRG1 expression pointed to an estrogen-independent component of this regulation. Consistent with this prediction, we observed (Fig. 3Go) that IFN{alpha} can regulate IRG1 expression in the uterus independently of estrogen.

Synergistic activation of p27 gene by IFN{alpha} and estrogen-bound ER in Ishikawa endometrial cells
Previous studies indicated that treatment with IFN{alpha} or estrogen induced the expression of human gene p27, which exhibits high homology to rat IRG1, in breast carcinoma MCF-7 cells (11). Interestingly, IFN{alpha} also induced p27 mRNA in cell lines lacking ER (11). We therefore investigated whether IFNs and/or estrogen regulate the expression of p27 in Ishikawa cells, which are transformed human endometrial cells of epithelial origin (16). p27 expression was monitored by RT-PCR analysis using total RNA isolated from these cells. As shown in Fig. 7AGo, treatment of Ishikawa cells with IFN{gamma} did not induce p27 mRNA (lane 2). In contrast, a dramatic increase in the level of p27 mRNA was observed when cells were treated with either IFN{alpha} or IFNß (lanes 3 and 4). These results indicated that p27 expression in the endometrial cells is indeed regulated by type I IFNs.



View larger version (19K):
[in this window]
[in a new window]
  		Figure 7. Regulation of p27 mRNA by IFNs and ER in Ishikawa endometrial cells. A, Induction of p27 mRNA in response to different types of IFNs in Ishikawa cells was analyzed by RT-PCR. Lanes v, {gamma}, {alpha}, and ß, Cells treated with vehicle or 1000 U/ml IFN{gamma}, IFN{alpha}, and IFNß, respectively. B, Upper panel, Northern blot analysis of p27 mRNA in Ishikawa cells. Cells were incubated with solvent (lane 1), 10-7 M estrogen (lane 2), 10-7 M estrogen plus 10-5 M ICI 182,780 (lane 3), 1000 U/ml IFN{alpha} (lane 4), and 1000 U/ml f IFN{alpha} plus 10-7 M estrogen (lane 5). Lower panel, Quantitation of p27 RNA signals was performed by densitometric scanning of the bands in the Northern blot shown in the above panel followed by normalization with respect to GAPDH signals (not shown).

 
We next examined the possibility that p27 expression, like that of IRG1, might be regulated by estrogen-complexed ER. For this experiment, Ishikawa cells were first transfected with an expression vector harboring ER{alpha} to boost the level of ER and then treated with either estrogen, IFN{alpha}, or a combination of estrogen and IFN{alpha}. After treatment with these ligands, the p27 expression was monitored by Northern blot analysis using total RNA isolated from these cells. As shown in Fig. 7BGo, a low basal promoter activity was observed when cells were transfected with expression vector harboring human ER{alpha} in the absence of estrogen (lane 1). However, when ER expression vector was transfected in the presence of estrogen, a 6- to 8-fold induction in p27 mRNA was observed (lane 2). This ER-mediated induction of p27 transcript was dependent on estrogen, as treatment of cells with ICI 182,780 significantly blocked IRG1 expression (lane 3). Treatment of cells with IFN{alpha} alone also increased the level of p27 mRNA in Ishikawa cells, and this response was much more robust (~30-fold) relative to that induced by estrogen (lane 4). Interestingly, when Ishikawa cells were treated with a combination of IFN{alpha} and estrogen (lane 5), we observed a synergistic or greater than additive response (~100-fold). These results indicated that ER and IFN{alpha} pathways converge on the promoter of the p27 gene to effect its maximal expression.

p27 mRNA is expressed in human endometrium within the putative window of implantation
As IRG1 is expressed in the rat uterus at the onset of implantation, it was of interest to examine the expression profile of p27 in human endometrium. In human, the implantation window is thought to open in the midsecretory phase between days 18–24 of the menstrual cycle (17, 18, 19, 20, 21). To monitor the expression of p27 mRNA in human endometrium during the menstrual cycle, we analyzed RNA isolated from human endometrial biopsies at proliferative, mid-ecretory, and late secretory phases by RT-PCR. The PCR-amplified products were then subjected to Southern blot analysis employing as probe a radiolabeled p27 cDNA fragment. The results shown in Fig. 8AGo indicate that low levels of p27 transcripts were detected in the proliferative phase (lanes P1, P2, and P3). However, the level of p27 mRNA increased dramatically in the midsecretory phase (lanes M1, M2, and M3), which then declined significantly by the late secretory phase of the cycle (lanes S1, S2, and S3). Interestingly, the profile of p27 mRNA closely followed that of IFN{alpha} mRNA during the menstrual cycle (Fig. 8BGo). Collectively, these results raise the possibility that the rise in IFN{alpha} level during the midsecretory phase drives the expression of p27 in human endometrium within the putative window of implantation.



View larger version (63K):
[in this window]
[in a new window]
  		Figure 8. Profile of expression of p27 mRNA in human endometrium on different days of the menstrual cycle. A, Total RNA (0.1 µg) were isolated from human endometrium at proliferative (P1, P2, P3), midsecretory (M1, M2, M3), and late secretory (S1, S2, S3) phases of the menstrual cycle and subjected to RT-PCR using p27-specific (upper panel) or GAPDH-specific (lower panel) primers. P, M, and S, Three different endometrial phases of the menstrual cycle: proliferative (days 5–12), midsecretory (days 18–24), and late secretory (days 25–28). Each phase is represented by three different samples, 1, 2, and 3. B, The profile of expression of IFN{alpha} mRNA in human endometrium at different stages of the menstrual cycle was analyzed by RT-PCR analysis. The intensity of the signal corresponding to the IFN{alpha} transcript at different stages of the cycle was plotted. C, Localization of p27 mRNAs in human endometrium by in situ hybridization. A', B', and C', Hybridization of endometrial sections on days 8, 26, and 20 with an antisense RNA probe. D', Hybridization of an endometrial section on day 20 with the corresponding sense RNA probe.

 
To identify the site(s) of p27 mRNA expression in the human endometrium, we performed in situ hybridization analysis using sections of human endometrial specimens at the proliferative (day 5), midsecretory (day 20), and late secretory (day 26) phases of the menstrual cycle. We used a 400-bp digoxygenin-labeled antisense RNA probe containing sequences from the p27 gene. As shown in Fig. 8CGo, a strong hybridization of the probe to the glandular epithelial cells was observed in the sections of the midsecretory phase endometrium (Fig. 8CGo, panel C'). In contrast, a low hybridization signal was present in glandular epithelial cells of the proliferative or late secretory phase endometrium (Fig. 8CGo, panels A' and B', respectively). Control uterine sections (day 20) hybridized with the corresponding sense RNA probe of equal length did not exhibit any signal demonstrating the specificity of the hybridization reaction (Fig. 8CGo, panel D'). These results further confirmed that p27 mRNA is induced in the glandular epithelial cells of human endometrium during the midsecretory phase of the menstrual cycle overlapping the putative window of implantation.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The IFNs function as cytokines and control diverse biological activities, ranging from inhibition of cell proliferation and induction of differentiation to modulation of the immune system (22). Previous studies have shown that the endometrium contains a full range of immune cells, including macrophages, leukocytes, and NK cells, that synthesize a number of cytokines, including IFNs (23, 24, 25, 26, 27). However, little is known about the target genes that are regulated by IFNs in the uterus. A clear understanding of the role of the IFNs in endometrial physiology requires identification of genes that are regulated by these cytokines. In this study we report for the first time isolation of a target gene for IFN{alpha} in the periimplantation uterus. This gene, IRG1, shares remarkable amino acid sequence identity with a previously identified IFN{alpha}/ß-inducible human gene, p27. We demonstrated that the expression of IRG1 as well as p27 in endometrial epithelial cells is indeed controlled by IFN{alpha}/ß. We also noted that both IRG1 and p27 exhibit sequence similarity with a conserved homology domain of another IFN{alpha}/ß-inducible gene, 6–16, indicating that these three genes may constitute a newly emerging family of IFN-regulated genes.

The spatio-temporal expression of IRG1 in rat uterus during early pregnancy is consistent with its regulation by IFN{alpha}. IRG1 expression peaked on days 1 and 4 of gestation coincident with high expression of IFN{alpha} on these days (Fig. 4Go, A–C). At the onset of pregnancy in rodents, clusters of macrophages appear near the uterine lumen close to the implantation sites (23). Interestingly, we found that IRG1 mRNA is expressed in the surface and glandular epithelial cells as well as in the stroma in the immediate vicinity of the uterine lumen on day 4 of gestation. It is conceivable that IFN{alpha} secreted by the immune cells localized near the implantation sites regulate IRG1 expression in epithelial and the surrounding stromal cells in a paracrine or autocrine manner. In human endometrium, the macrophages substantially increase in number during the secretory phase of the menstrual cycle (26, 27). They represent as much as 5–15% of the endometrial stromal cells and are distributed throughout the uterine stroma (26, 27). We observed that the temporal expression of IRG1 mRNA in human endometrium during the menstrual cycle closely follows the profile of IFN{alpha} mRNA. For example, an increase in IFN{alpha} mRNA during the midsecretory phase of the cycle was accompanied by a marked induction of IRG1 mRNA expression in the endometrial glands.

The steroid hormone estrogen also stimulated the expression of IRG1 in rat uterus. Although progesterone had no effect on IRG1 expression, treatment of ovariectomized rats with estrogen led to a 3-fold increase in the level of this mRNA in the uterus. Estrogen also contributed to uterine IRG1 expression during pregnancy. Treatment of pregnant animals with antiestrogen ICI, which strongly inhibits the transcriptional activity of the ER, blocked uterine IRG1 expression by as much as 40%. As uterine epithelial cells are known to contain abundant ERs during early pregnancy, it is likely that these receptors play a significant role in IRG1 expression in the epithelial cells at the time of implantation (28). During pregnancy in the rat, the circulating level of estrogen is high on day 1, drops off during days 2 and 3, rises transiently on day 4, and then falls again. Consistent with this profile of estrogen, IRG1 expression in the uterus was highest on days 1 and 4 of pregnancy. Our studies in Ishikawa endometrial cells also confirmed that estrogen-bound ER acts in concert with IFN{alpha} to maximally induce p27 mRNA. The expression of IRG1 and p27 is therefore regulated by a complex interplay of estrogen and IFN{alpha}.

It appears that of these two modulators of IRG1 expression, IFN{alpha} is the dominant one. Whereas the administration of IFN{alpha} alone induced strong IRG1 expression in ovariectomized rats and cultured cells in the absence of estrogen, we have no evidence to suggest that estrogen can induce this gene in the absence of IFN{alpha}. Expression of IRG1 is minimal in the uteri of cycling rats, even in the presence of high estrogen during the estrous stage, presumably due to a lack of IFN{alpha} expression during the reproductive cycle (Kumar, S., and I. C. Bagchi, unpublished results). In pregnant rats, a rise in the level of IFN{alpha} mRNA was accompanied by abundant IRG1 mRNA expression on days 1 and 4 of pregnancy. As the IFN{alpha} mRNA level dropped off after implantation, IRG1 expression also declined. We observed a similar scenario when we monitored p27 mRNA expression in human endometrium during the menstrual cycle. p27 mRNA was barely detectable in estrogen-dominated proliferative endometrium in the absence of IFN{alpha} mRNA expression. As the IFN{alpha} mRNA level rose in the midsecretory phase overlapping the putative window of implantation, significant p27 mRNA expression was observed. The expression of p27 mRNA declined in the late secretory phase with a concomitant diminution in the IFN{alpha} mRNA level.

A previous report by Rasmussen et al. described the induction of p27 mRNA by IFN{alpha} in a variety of human tumor cell lines (11). High levels of p27 mRNA were also detected in approximately 50% of primary human breast carcinomas (11). Interestingly, treatment of human MCF7 breast cancer cells, which are enriched in ER, with either estrogen or IFN{alpha} led to an induction of p27 mRNA (11). These results are very similar to our finding that IRG1 expression in the uterus is under dual regulation of estrogen and IFN{alpha}. However, p27 mRNA was also expressed in a number of human tumor cell lines, which apparently lack ERs (11). These results are also consistent with our observation that treatment with IFN{alpha} induced expression of IRG1 mRNA in the uterus and p27 mRNA in Ishikawa cells in an estrogen-independent manner.

The mechanism of activation of the IRG1 or p27 gene by IFN{alpha} probably involves transcription factors termed STATs (signal transducers and activators of transcription) (29, 30). IFN{alpha} signaling is initiated at the cell surface where the cytokine interacts with its cognate receptor (29, 30). This binding activates membrane-associated protein kinases, which phosphorylate latent STATs that initially reside in the cytoplasm (29, 30). In response to IFN{alpha}, both Stat1 and Stat2 are phosphorylated, leading to their association and nuclear translocation (29, 30). In the nucleus, a stable multimeric complex that includes Stat1, Stat2, and p48 is formed on the IFN-stimulated response element of target gene leading to gene activation (29, 30). Whether the IRG1 or p27 promoter contains a functional IFN-stimulated response element is currently under investigation in our laboratory.

Treatment of Ishikawa cells in vitro with a combination of estrogen-occupied ER and IFN{alpha} produced synergistic activation of p27 expression. The observed transcriptional synergy on the p27 promoter is probably due to interactions between the steroid hormone and IFN signaling pathways by an unknown mechanism. Estrogen-dependent gene activation is initiated upon binding of estrogen to its intracellular receptor, ER{alpha} or ERß (31, 32, 33, 34). It is generally believed that a hormone-bound ER modulates transcription by binding to the cognate DNA response element at the target gene promoter (31, 32, 33, 34). However, several recent studies have suggested that steroid receptors can regulate the activities of genes that are simultaneously regulated by peptide hormones or growth factors or cytokines, even when the promoters lack classical steroid-responsive DNA elements (35, 36, 37, 38). It has been documented that progesterone and glucocorticoid receptors can activate target genes by docking on to promoter-bound transcription factors such as Sp1 and Stat5 (36, 39, 40). Future studies will focus on the mechanisms by which ER and IFN{alpha} pathways converge on the IRG1 or p27 promoter to regulate its expression in the endometrium.

Previous studies demonstrated a critical role for an IFN known as IFN{tau} in establishing pregnancy in ruminants (41, 42, 43, 44). IFN{tau} is expressed by the preimplantation trophoblast, and it functions as a pregnancy recognition signal by preventing regression of the corpus luteum (41, 42, 43, 44). Interestingly, the mechanism of this antiluteolytic effect has been attributed to regulation of endometrial ER gene expression in response to IFN{tau} (45, 46, 47). Studies have shown that IFN{tau} represses endometrial ER expression, which, in turn, down-regulates oxytocin receptor and inhibits pulsatile release of PGF2{alpha} (45, 46, 47). The altered uterine release of PGF2{alpha} results in rescue of the corpus luteum and continued release of progesterone. Expression of type I IFN by mouse embryos and of type II IFN by the pig conceptus has also been reported (48, 49).

The physiological role of IFNs of maternal origin during implantation remains a mystery. The observation that the level of IFN{alpha} rises transiently at the onset of implantation (day 4) in the rat uterus and within the putative window of implantation in the human endometrium suggests an important regulatory role of this cytokine during early pregnancy. The convergence of IFN{alpha}-producing immune cells near the implantation sites in rodents is also consistent with such a role. Furthermore, the precise implantation stage-specific expression of IRG1 and p27, the downstream target genes of IFN{alpha} in rodent and human endometria, is conserved across species, predicting a critical role for this signaling pathway at the time of implantation.


   Acknowledgments
 
We thank Michelle Macaraig for excellent technical assistance. We also thank Evan Read for the artwork, and Jean Schweis for carefully reading the manuscript.


   Footnotes
 
1 This work was supported by NIH Grants R01-HD-34527 and R01-HD-39291, National Cooperative Program on Markers of Uterine Receptivity for Blastocyst Implantation Grant U01-HD-34760 (to I.C.B.), and NIH Grants R01-DK-50257 and U54-HD-13541 (to M.K.B.). Back

2 Present address: Department of Veterinary Biosciences, University of Illinois at Urbana-Champaign, Urbana, Illinois 61802. Back

3 Present address: Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801. Back

Received September 15, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Psychoyos A 1973 Endocrine control of egg implantation. In: Greep RO, Astwood EG (eds) Handbook of Physiology. American Physiological Society, Washington DC, pp 187–215
  2. Carson DD, Bagchi I, Dey SK, Enders AC, Fazleabas AT, Lessey BA, Yoshinaga K 2000 Embryo implantation. Dev Biol 223:217–237[CrossRef][Medline]
  3. Schlafke S, Enders AC 1975 Cellular basis of interaction between trophoblast and uterus at implantation. Biol Reprod 12:41–65[CrossRef][Medline]
  4. Yoshinaga K 1988 Uterine receptivity for blastocyst implantation. Ann NY Acad Sci 541:424–431[Medline]
  5. Parr MB, Parr EL 1989 The implantation reaction. In: Wynn RM, Jollie WP (eds) Biology of the Uterus. Plenum Press, New York, pp 233–277
  6. Glasser SR 1990 Biochemical and structural changes in uterine endometrial cell types following natural or artificial deciduogenic stimuli. In: Denker HW, Aplin JD (eds) Trophoblast Research (Trophoblast Invasion and Endometrial Receptivity: Novel Aspects of the Cell Biology of Embryo Implantation). Plenum Press, New York, pp 377–416
  7. Psychoyos A 1976 Hormonal control of uterine receptivity for nidation. J Reprod Fertil [Suppl] 25:17–28
  8. Psychoyos A 1986 Uterine receptivity for nidation. Ann NY Acad Sci 476:36–42[Medline]
  9. Sharkey A 1998 Cytokines and implantation: reviews of reproduction. J Reprod Fertil 3:52–61
  10. Wang Z, Brown DD 1991 A gene expression screen. Proc Natl Acad Sci USA 88:11505–11509[Abstract/Free Full Text]
  11. Rasmussen UB, Wolf C, Mattei MG, Chenard MP, Bellocq JP, Chambon P, Rio MC, Basset P 1993 Identification of a new interferon-{alpha}-inducible gene (p27) on human chromosome 14q32 and its expression in breast carcinoma. Cancer Res 53:4096–4101[Abstract/Free Full Text]
  12. Friedman RL, Manly SP, McMahon M, Kerr IM, Stark GR 1984 Transcriptional and post-transcriptional regulation of interferon-induced gene expression in human cells. Cell 38:745–755[CrossRef][Medline]
  13. Kelly JM, Porter ACG, Chernajovsky Y, Gilbert CS, Stark GR, Kerr IM 1986 Characterization of a human gene inducible by {alpha} and ß-interferons and its expression in mouse cells. EMBO J 5:1601–1606[Medline]
  14. Noyes RW, Hertig AI, Rock J 1950 Dating the endometrial biopsy. Fertil Steril 1:3–25
  15. Wakeling AE, Bowler J 1988 Biology and mode of action of pure antioestrogens. J Steroid Biochem 30:141–148[CrossRef][Medline]
  16. Nishida M, Kasahara K, Kaneko M, Iwasaki H 1985 Establishment of a new human endometrial adenocarcinoma cell line, Ishikawa cells, containing estrogen and progesterone receptors. Acta Obstet Gynecol Jpn 37:1103–1111
  17. Hertig AT, Rock J, Adams EC 1956 A description of 34 human ova within the first 17 days of development. Am J Anat 98:435–493
  18. Formigli L, Formigli G, Roccio C 1987 Donation of fertilized uterine ova to infertile women. Fertil Steril 47:62–65
  19. Rogers PAW, Murphy CR 1989 Uterine receptivity for implantation: human studies. In: Yoshinaga K (ed) Blastocyst Implantation. Serono Symposia, pp 231–238
  20. Navot DM, Anderson TL, Droesch K, Scott RT, Kreiner RT, Kreiner D, Rosenwaks Z 1989 Hormonal manipulation of endometrial maturation. J Clin Endocrinol Metab 68:801–807[Abstract]
  21. Navot DM, Scott RT, Droesch K,Veeck LL, Liu HC, Rosenwaks Z 1991 The window of embryo transfer and the efficiency of human conception in vitro. Fertil Steril 55:114–117[Medline]
  22. Stark GR, Kerr IM, Williams BRG, Silverman RH, Schreiber RD 1998 How cells respond to interferons. Annu Rev Biochem 67:227–264[CrossRef][Medline]
  23. Hunt JS 1989 Cytokine networks in the uteroplacental unit: macrophages as pivotal regulatory cells. J Reprod Immunol 16:1–17[CrossRef][Medline]
  24. Pollard JW 1991 Lymphohematopoietic cytokines in the female reproductive tract. Curr Opin Immunol 3:772–777[CrossRef][Medline]
  25. Tabibzadeh S 1991 Human endometrium: an active site of cytokine production and action. Endocr Rev 12:272–290[CrossRef][Medline]
  26. Bonatz G, Hansmann M, Buchholz L, Mettler L, Radzun H, Semm K 1992 Macrophage- and lymphocyte-subtypes in the endometrium during different phases of the ovarian cycle. Int J Gynaecol Obstet 37:29[CrossRef][Medline]
  27. Morris H, Edwards J, Tiltman A, Emms M 1985 Endometrial lymphoid tissue: an immunohistological study. J Clin Pathol 38:644–652[Abstract/Free Full Text]
  28. Zhu LJ, Bove KC, Polihronis M, Bagchi MK, Bagchi IC 1998 Calcitonin is a progesterone-regulated marker which forecasts the receptive state of endometrium during implantation. Endocrinology 139:3923–3934[Abstract/Free Full Text]
  29. Darnell Jr JE, Kerr IM, Stark GR 1994 Jak-Stat pathways and transcriptional actvation in response to IFNs and other extracellular signaling proteins. Science 264:1415–1420[Abstract/Free Full Text]
  30. Darnell Jr JE 1997 STATs and gene regulation. Science 277:1630–1635[Abstract/Free Full Text]
  31. Katzenellenbogen BS, Korach KS 1997 A new actor in the estrogen receptor drama–enter ER-ß. Endocrinology 138:861–862[Free Full Text]
  32. O’Malley BW 1990 The steroid receptor superfamily: more excitement predicted for the future. Mol Endocrinol 4:363–369[CrossRef][Medline]
  33. Beato M 1989 Gene regulation by steroid hormones. Cell 56:335–344[CrossRef][Medline]
  34. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  35. Stocklin E, Wissler M, Gouilleux F, Groner B 1996 Functional interactions between Stat5 and the glucocorticoid receptor. Nature 383:726–728[CrossRef][Medline]
  36. Owen GI, Richer JK, Tung L, Takimoto G, Horwitz KB 1998 Progesterone regulates transcription of the p21(WAF1) cyclin-dependent kinase inhibitor gene through Sp1 and CBP/p300. J Biol Chem 273:10696–10701[Abstract/Free Full Text]
  37. Boruk M, Savory JG, Hache RJ 1998 AF-2-dependent potentiation of CCAAT enhancer binding protein b-mediated transcriptional activation by glucocorticoid receptor. Mol Endocrinol 12:1749–1763[Abstract/Free Full Text]
  38. Cha HH, Cram EJ, Wang EC, Huang AJ, Kasler HG, Firestone GL 1988 Glucocorticoids stimulate p21 gene expression by targeting multiple transcriptional elements within a steroid responsive region of the p21waf1/cip1 promoter in rat hepatoma cells. J Biol Chem 273:1998–2007[Abstract/Free Full Text]
  39. Richer JK, Lange CA, Manning NG, Owen G, Powell R, Horwitz KB 1998 Convergence of progesterone with growth factor and cytokine signaling in breast cancer. Progesterone receptors regulate signal transducers and activators of transcription expression and activity. J Biol Chem 273:31317–31326[Abstract/Free Full Text]
  40. Wyszomierski SL, Yeh J, Rosen J 1999 Glucocorticoid receptor/signal transducer and activator of transcription 5(STAT5) interactions enhance STAT5 activation by prolonging STAT5 DNA binding and tyrosine phosphorylation. Mol Endocrinol 13:330–343[Abstract/Free Full Text]
  41. Roberts RM 1996 Interferon-{tau} and pregnancy. J Interferon Cytokine Res 16:271–273[Medline]
  42. Spencer TE, Ott TL, Bazer FW 1996 tau-Interferon: pregnancy recognition signal in ruminants. Proc Soc Exp Biol Med 213:215–229[Medline]
  43. Bazer FW, Spencer TE, Ott TL 1997 Interferon {tau}: a novel pregnancy recognition signal. Am J Reprod Immunol 37:412–420
  44. Hansen TR, Austin KJ, Perry DJ, Pru JK, Teixeira MG, Johnson GA 1999 Mechanism of action of interferon-{tau} in the uterus during early pregnancy. J Reprod Fertil [Suppl] 54:329–339[Medline]
  45. Spencer TE, Becker WC, George P, Mirando MA, Ogle TF, Bazer FW 1995 Ovine interferon-{tau} regulates expression of endometrial receptors for estrogen and oxytocin but not progesterone. Biol Reprod 53:732–745[Abstract]
  46. Lamming GE, Wathes DC, Flint AP, Payne JH, Stevenson KR, Vallet JL 1995 Local action of trophoblast interferons in suppression of the development of oxytocin and oestradiol receptors in ovine endometrium. J Reprod Fertil 105:165–175[Abstract/Free Full Text]
  47. Spencer TE, Bazer FW 1996 Ovine interferon {tau} suppresses transcription of the estrogen receptor and oxytocin receptor genes in the ovine endometrium. Endocrinology 137:1144–1147[Abstract]
  48. Riego E, Perez A, Martinez R, Castro FO, Llenart R, de la Fuente J 1995 Differential constitutive expression of interferon genes in early mouse embryos. Mol Reprod Dev 41:157–166[CrossRef][Medline]
  49. Lefevre F, Martinat-Botte F, Guillomot M, Zouari K, Charley B, La Bonnardiere C 1990 Interferon-{gamma} gene and protein are spontaneously expressed by the porcine trophectoderm early in gestation. Eur J Immunol 20:2485–2490[Medline]



This article has been cited by other articles:


Home page
 GutHome page
T Asselah, I Bieche, S Narguet, A Sabbagh, I Laurendeau, M-P Ripault, N Boyer, M Martinot-Peignoux, D Valla, M Vidaud, et al.
Liver gene expression signature to predict response to pegylated interferon plus ribavirin combination therapy in patients with chronic hepatitis C
Gut, April 1, 2008; 57(4): 516 - 524.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
T. E Spencer, O. Sandra, and E. Wolf
Genes involved in conceptus-endometrial interactions in ruminants: insights from reductionism and thoughts on holistic approaches
Reproduction, February 1, 2008; 135(2): 165 - 179.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. M. Joyce, R. C. Burghardt, R. D. Geisert, J. R. Burghardt, R. N. Hooper, J. W. Ross, M. D. Ashworth, and G. A. Johnson
Pig Conceptuses Secrete Estrogen and Interferons to Differentially Regulate Uterine STAT1 in a Temporal and Cell Type-Specific Manner
Endocrinology, September 1, 2007; 148(9): 4420 - 4431.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
M. M. Joyce, J. R. Burghardt, R. C. Burghardt, R. N. Hooper, L. A. Jaeger, T. E. Spencer, F. W. Bazer, and G. A. Johnson
Pig Conceptuses Increase Uterine Interferon-Regulatory Factor 1 (IRF1), but Restrict Expression to Stroma Through Estrogen-Induced IRF2 in Luminal Epithelium
Biol Reprod, August 1, 2007; 77(2): 292 - 302.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
H. Pan, L. Zhu, Y. Deng, and J. W. Pollard
Microarray Analysis of Uterine Epithelial Gene Expression during the Implantation Window in the Mouse
Endocrinology, October 1, 2006; 147(10): 4904 - 4916.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
Q. Li, M. K. Bagchi, and I. C. Bagchi
Identification of a Signaling Pathway Involving Progesterone Receptor, Calcitonin, and Tissue Tranglutaminase in Ishikawa Endometrial Cells
Endocrinology, May 1, 2006; 147(5): 2147 - 2154.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. Kim, Y. Choi, F. W. Bazer, and T. E. Spencer
Identification of Genes in the Ovine Endometrium Regulated by Interferon {tau} Independent of Signal Transducer and Activator of Transcription 1
Endocrinology, December 1, 2003; 144(12): 5203 - 5214.
[Abstract] [Full Text] [PDF]

Home page