help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, M.-C.
Right arrow Articles by Miller, W. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, M.-C.
Right arrow Articles by Miller, W. L.
Endocrinology Vol. 142, No. 6 2569-2576
Copyright © 2001 by The Endocrine Society


ARTICLES

Creation and Activity of COS-1 Cells Stably Expressing the F2 Fusion of the Human Cholesterol Side-Chain Cleavage Enzyme System1

Mei-Chuan Huang and Walter L. Miller

Department of Pediatrics and the Metabolic Research Unit, University of California, San Francisco, San Francisco, California 94143-0978

Address all correspondence and requests for reprints to: Prof. Walter L. Miller, Department of Pediatrics, Building MR-IV, Room 209, University of California San Francisco, San Francisco, California 94143-0978. E-mail: wlmlab{at}itsa.ucsf.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A fusion construct for the human cholesterol side-chain cleavage enzyme system termed F2 (H2N-P450scc-adrenodoxin reductase-adrenodoxin-COOH), was stably expressed in nonsteroidogenic COS-1 cells. Multiple clones were obtained and analyzed, identifying the clone COS-F2–130 as the most active in converting 22R-hydroxycholesterol (22R-OH-C) to pregnenolone. The F2 fusion construct was properly transcribed and translated in COS-F2–130 cells, indicating that these cells did not proteolytically cleave the F2 protein. Steroid analyses show that the COS-F2–130 cells do not convert appreciable quantities of pregnenolone to other steroids. Isolated COS-F2–130 mitochondria showed enhanced steroidogenesis when incubated with biosynthetic N-62 StAR protein in vitro. The cells were easily transfectable with StAR expression vectors, showing that COS-F2–130 cells exhibited both StAR-independent and StAR-dependent activity. Transient expression of either full-length or N-62 StAR stimulated steroidogenesis to approximately 45% of the maximal steroidogenic capacity, as indicated by incubation with 22R-OH-C. Single, double, and triple transfections of individual vectors expressing P450scc, adrenodoxin reductase, and adrenodoxin demonstrated that the P450 moiety of the F2 fusion protein could only receive electrons from the covalently linked adrenodoxin moiety, but that free adrenodoxin reductase could foster activity of the fusion enzyme. COS-F2–130 cells provide a useful system for studying steroidogenesis, as these are the only cells described to date that convert cholesterol to pregnenolone but lack downstream enzymes that catalyze other steroidogenic reactions.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE FIRST and rate limiting step in the biosynthesis of all steroid hormones is the conversion of cholesterol to pregnenolone (1, 2, 3, 4, 5). This reaction is catalyzed by the mitochondrial cholesterol side chain cleavage enzyme system, in which electrons from NADPH are taken up by a flavoprotein, termed adrenodoxin reductase (AdRed), which then passes the electrons to an iron-sulfur protein termed adrenodoxin (Adx), which then passes them to mitochondrial P450scc (5, 6, 7). One pair of electrons is needed to catalyze each of the three successive steps required to convert cholesterol to pregnenolone: 20{alpha}-hydroxylation, 22-hydroxylation and scission of the 20, 22 carbon-carbon bond (2, 5). Because this reaction is rate-limiting and is the principal site of hormonal regulation, it has been the subject of extensive studies, which have revealed two modes of regulation: acute and chronic. The acute regulation of steroidogenesis, e.g. the induction of corticosteroid synthesis within minutes of a stress, is at the level of movement of the cholesterol substrate into mitochondria, which requires the steroidogenic acute regulatory protein (StAR) (8, 9, 10). The chronic regulation of steroidogenesis, i.e. the determination of net cellular steroidogenic capacity, is at the level of the transcriptional regulation of the various steroidogenic enzymes, particularly P450scc (11, 12, 13). P450scc is thus the enzymatic regulatory step because it is the slowest steroidogenic enzyme, turning over only one mole of cholesterol per mole of enzyme per second (14).

Studies of the conversion of cholesterol to pregnenolone remain difficult and cumbersome for several reasons. First, the apparent enzymology of P450scc in whole cells or in isolated mitochondria is limited by the rate at which cholesterol enters mitochondria under the influence of StAR-like factors. This problem can be circumvented by using soluble hydroxysterols such as 20{alpha}-hydroxycholesterol or 22R-hydroxycholesterol (22R-OH-C) as substrate, as these bypass the action of StAR (9, 15, 16, 17). Second, cholesterol side chain cleavage activity is crucially dependent on the ratio of adrenodoxin (but not adrenodoxin reductase) to P450scc, so that modest increases in adrendoxin concentrations substantially increase the apparent P450scc activity, as measured by pregnenolone production (18, 19, 20). Similar data indicate that adrenodoxin is limiting with other mitochondrial P450 systems (20, 21). This problem has been circumvented by the construction of a fusion protein, termed F2, consisting of H2N-P450scc-Adrenodoxin Reductase-Adrenodoxin-COOH, which fixes the molar ratio of these three proteins at 1:1:1 (19, 22). This same mitochondrial fusion protein architecture has proven successful with P450c27 (vitamin D-25-hydroxylase) (23), and P450c11ß (steroid 11ß-hydroxylase) (24). The F2 fusion protein has a higher Km but also has a higher Vmax when compared with the cholesterol side chain cleavage system composed of the three independent proteins, so that its catalytic efficiency is the same (19). Despite these advances, it remains difficult to study StAR activity because it requires cotransfection of F2 and StAR constructs and because all naturally occurring cell systems that contain the normal 3-component cholesterol side chain cleavage system also contain other steroidogenic enzymes (e.g. 3ß-hydroxysteroid dehydrogenase, 3ßHSD) that metabolize pregnenolone to other steroids. To circumvent these difficulties and to facilitate the study of factors that foster intramitochondrial cholesterol transfer, we stably expressed the F2 fusion of the cholesterol side chain cleavage system in nonsteroidogenic COS-1 cells. We have characterized these cell lines in detail, showing they are useful, novel reagents for the study of steroidogenesis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Construction of the F2 stable expression vector
The F2 cDNA cassette (19) was excised from its pECE expression vector (25) as a KpnI-EcoRI fragment and cloned into the pcDNA3 cloning vector (Invitrogen) linearized with KpnI and EcoRI, positioning the F2 construct so it would be driven by the human cytomegalovirus (CMV) immediate early promoter. The resulting construct is called F2-pcDNA3. The pcDNA3 cloning vector contains a Neomycin resistance gene (neo), thus allowing clones carrying F2-pcDNA3 to survive under selection by G418 (Geneticin) (Life Technologies, Inc., Gaithersburg, MD).

Stable transfection of COS-1 cells
COS-1 cells were maintained and propagated in DMEM containing 4.5 g glucose/liter, 10% FBS, and antibiotics. The F2-pcDNA3 vector was linearized with PvuI, and subconfluent COS-1 cells were stably transfected with 12 µg of this DNA in 10-cm tissue culture dishes using lipofectamine (Life Technologies, Inc.). Single clones were generated by limiting dilution into a selection medium containing 600 µg/ml G418, 48 h after transfection. The resulting individual colonies were picked and transferred to 2.2-cm 12-well plates (Becton Dickinson and Co., Franklin Lakes, NJ) for propagation, then later to 3.4-cm 6-well plates for enzymatic assay. These clones were tested for enzymatic assay by incubating cells for 24 h with 5 µM (12.5 µg/ml) 22R-OH-C (Sigma, St. Louis, MO) added as an exogenous substrate to each stable cell line grown in 6-well plates containing 1x106 cells. Media were collected and pregnenolone was determined by RIA (ICN Pharmaceuticals, Inc., Costa Mesa, CA) to identify clones expressing cholesterol side chain cleavage activity.

Transient transfection of COS-F2–130 cells
Transient transfection of COS-F2–130 cells was performed using FuGENE 6 (Roche Molecular Biochemicals, Indianapolis, IN). The pECE-based vectors individually expressing human P450scc (pEscc) (26), adrenodoxin (pEAdx) (26), and the active form of adrenodoxin reductase (pEAR18-) (27) have been described.

RT-PCR
Total RNA was isolated from COS-1, COS-F2 stable clones no. 87 and 130 and NCI-H295A cells (28, 29, 30). cDNA was synthesized using reverse transcriptase Superscript II (Life Technologies, Inc.), and PCR was performed using 0.4 µg of cDNA with primers for human P450scc, Adx, AdRed, or GAPDH for 25 cycles of amplification. The sequences of the primers and the PCR conditions used were as described by Harikrishna et al. (19). Primers used for spanning the P450scc/AdRed junction of F2 were scc no. 1 and AR no. 6 (19), and those for spanning the AdRed/Adx junction were AR no. 5 and Adx no. 10 (19). The primers used for human P450scc were 5'GATGCCATCTAC-CAGATGTT3' for sense and 5'CTCTGAAGTTCTCCAGCATA3' for antisense to produce a 750-bp fragment. The primers for AdRed were no. 6 and no. 7 to yield a 200-bp fragment and for Adx no. 9 and no. 10 to yield a 371-bp fragment (19). The 502-bp human GAPDH sequence was amplified using primers and conditions as described (31).

Western immunoblotting
For immunoblotting, 45 µg of mitochondrial proteins were separated on an SDS 6.5% polyacrylamide gel, transferred to a polyvinylidene difluoride membrane (Millipore Corp.), blocked in a buffer containing 25 mM Tris, 154 mM NaCl, 0.05% Triton X-100 and 5% nonfat dry milk at 20 C for 1 h, incubated with antisera to human P450scc or AdRed (32) for 60 min in the same buffer, washed, then incubated with goat antirabbit IgG conjugated with horseradish peroxidase (Roche Molecular Biochemicals) for 60 min. The membrane was washed for 30–60 min and the antigen-antibody complexes were detected by ECL (Amersham Pharmacia Biotech, Arlington Heights, IL).

TLC
Cultured COS-1 and COS-F2–130 cells were incubated with 40,000 cpm [14C] pregnenolone (NEN Life Science Products, Boston, MA) for various times. A 0.4 ml aliquot of culture medium was extracted with ethylacetate/isooctane (1:1), concentrated by evaporation, dissolved in 20 µl methylene chloride, and analyzed by TLC in chloroform/ethylacetate (3:1) (33) using Whatman PE SIL G/UV silica gel plates (Whatman, Maidstone, UK). Mitochondria (10 µg protein) from COS-F2–130 and COS-1 cells were incubated with 40,000 cpm [14C] pregnenolone (NEN Life Science Products) and 1 µM pregnenolone in the presence of mitochondrial buffer as described (34) in a volume of 250 µl. After 0 or 1 h incubation, steroids were analyzed by TLC as described for whole cells.

Mitochondrial assay of StAR activity
Mitochondria were isolated from mouse Leydig MA-10 or COS-F2 stable cells as described (34). Cells were harvested and centrifuged at 500 g, the pellet was frozen at -20 C for 15 min, and washed with buffer containing 0.25 M sucrose, 1 mM EGTA, 10 mM HEPES (N-2-hydroxyethyl-piperazine-N'-2-ethanesulfonic acid), pH 7.4, 0.1% BSA, 1 mM dithiothreitol and a protease inhibitor mixture (Roche Molecular Biochemicals) containing Leupeptin (1 µM), pefabloc SC (0.4–4 mM), aprotinin (0.01–0.3 µM), and 1 mM EDTA (35). The washed pellet was homogenized by 15 strokes of a Tenbroeck tissue grinder (Corning, Inc., Corning, NY). The homogenate was cleared of debris at 1,500 x g for 10 min, following which the mitochondria were pelleted at 10,000 x g for 10 min. The crude mitochondrial pellet was washed twice with the same buffer to produce the enriched mitochondrial fraction. These purified mitochondria were used immediately or stored at -70 C. Mitochondrial assays were carried out with 2 µg of mitochondrial protein incubated in the absence or presence of purified recombinant StAR proteins (kindly provided by Dr. Himanshu Bose from our laboratory) at 37 C for 60 min with a total volume of 50 µl as described (34). Mitochondrial assays using mitochondria form MA-10 cells, but not other cells, included trilostane (kindly provided by Dr. Jerome F. Strauss III, University of Pennsylvania, Philadelphia, PA), an inhibitor of 3ß-HSD, at a final concentration of 250 ng/ml. The amount of pregnenolone produced by isolated mitochondria was measured by immunoassay.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of F2/COS-1 stable clones by enzymatic assay
To produce stable cell lines, the linearized F2 cDNA construct in the pcDNA3 expression vector (F2-pcDNA3) was transfected into COS-1 cells, and single clones were selected using G418. A total of 55 surviving clones were screened for P450scc activity by measuring the conversion of 22R-hydroxycholesterol (22R-OH-C) to pregnenolone. 22R-OH-C is a soluble hydroxysterol that readily enters mitochondria without the action of StAR, and hence is a commonly used indicator for maximal steroidogenic capacity (9, 15, 16, 34). 22R-OH-C was used at a concentration of 5 µM, which is above the 2.8 µM Km for the F2 fusion protein (19). Among the 55 G418-resistant clones, 6 had low activity, secreting less than 20 ng of pregnenolone per ml medium per 24 h; 3 had medium activity, producing 20–50 ng/ml medium/24 h, and 9 had high activity, producing > 50 ng/ml medium/24 h. Thirty-seven additional clones that made less than 5 ng pregnenolone/ml medium/24 h were eliminated, as this was not greater than the RIA background of 2–3 ng seen in COS-1 cells or in medium alone. We chose four clones for further study: clone no. 130, which was the most active; clone no. 87, which had intermediate activity; clone no. 71, which had low activity; and clone no. 211, which was a control harboring an empty pcDNA3 vector. The active cell lines are designated COS-F2–130, and COS-F2–87. Figure 1Go shows the activities (on a log scale) of these four clones and of COS-1 cells in the presence or absence of 5 µM 22R-OH-C. A small amount of pregnenolone was produced by COS-F2–130 and -87 in the absence of 22R-OH-C, showing StAR-independent steroidogenesis from endogenous cholesterol substrate. The morphology and growth rate of these cell lines varied. At low dilution, COS-F2–130 cells were more angular, tended to spread out and grew more slowly than COS-1 cells. However, upon reaching confluency, the various cell lines became indistinguishable.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. Steroidogenic activity of stable clones. Single clones of COS-1 cells carrying the stably transfected F2 construct were selected with 600 µg/ml G418. Clones were identified by incubation with 5 µM of 22R-hydroxylcholesterol (22R-OH-C) for 24 h; the activities of four representative clones (from a total of 55) are shown. Pregnenolone was also produced by cells from clones no. 130 and no. 87 that were not incubated with 22R-OH-C, indicating the use of endogenous cholesterol. The low levels of pregnenolone apparently produced by clone no. 211 harboring an empty vector and untransfected COS-1 cells correspond to the assay background, determined by RIA of the medium alone without exposure to cells, and shown as a line parallel to the x-axis. The data shown here are means ± SEM of three experiments, each performed in duplicate; note that the y-axis is shown as a log scale.

 
Expression of F2 in the stable clones
To determine if the F2 RNA was transcribed properly, we prepared RNA from COS-F2–130, COS-F2–87, NCI-H295A and COS-1 cells and performed RT-PCR (Fig. 2Go). Oligonucleotide primers for P450scc, AdRed, and Adx produced PCR products of the expected sizes. Low levels of endogenous AdRed and Adx (but not P450scc) were detected in COS-1 cells, consistent with the ubiquitous expression of Adx and AdRed (27, 36). Paired primers spanning the junctions P450scc/AdRed and AdRed/Adx were also used to ensure the proper transcription of the F2 construct (Fig. 2Go). As expected, only COS-F2–130 and COS-F2–87 cells yielded the properly transcribed products with P450scc/AdRed or AdRed/Adx primers; these products of the engineered F2 fusion protein were not seen in NCI-H295A or COS-1 cells.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 2. Transcription of F2 in the stable clones. The proper transcription of F2 was demonstrated by RT-PCR using primers flanking the junctions of P450scc-AR or AR-Adx. cDNA was prepared from 4 µg of RNA from each cell line and 5 µl of the cDNA product from the RT reaction was amplified for 25 cycles with the primer pairs indicated. The GAPDH amplification shows that the RNA samples were intact and that approximately equal amounts of RNA were present in each sample. The amplifications with oligonucleotides within the sequences of P450scc, Adx, and AdRed show that each is present in clones 87 and 130 and in NCI-H295A cells; minimal levels of Adx and AdRed are seen in COS-1 cells but no P450scc is seen. Amplification with P450scc/AdRed and AdRed/Adx pairs shows that the fusion sequence is expressed in clones 87 and 130, but not in COS-1 or NCI-H295A cells. (-) designates no template control for PCR.

 
To determine if this RNA was translated into the F2 fusion protein, we performed Western blotting of mitochondrial protein from COS-F2–130, COS-F2–87, COS-1, and NCI-H295A cells (Fig. 3Go). The expected 121-kDa F2 fusion protein was readily detected in COS-F2–130 cells using antisera to either P450scc or AdRed, but could only be seen in COS-F2–87 cells when the films were overexposed (not shown). By contrast, only the monomeric 60 kDa P450scc and 54 kDa AdRed were detected in NCI-H295A cells. As expected, COS-1 cells had a low level of endogenous AdRed but no P450scc (19, 26, 27). The level of F2 fusion protein expression in COS-F2–130 was about 10-fold greater than that in COS-F2–87, consistent with the activity data in Fig. 1Go. Thus, the stably transfected COS-1 cells express the expected sizes of F2 mRNA and protein, and this mRNA and protein are not subject to rapid enzymatic degradation.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Western blots. Mitochondrial proteins from COS-F2–130, COS-F2–87, COS-1, and NCI-H295A cells were displayed on 6.5% polyacrylamide SDS gels, transferred to nitrocellulose, and probed with antisera to human P450scc (left) or AdRed (right). The expected 121-kDa band corresponding to the full-length F2 protein is readily seen in COS-F2–130 cells and barely seen in COS-F2–87 cells, and is detected with antisera to both P450scc and AdRed. The expected 60-kDa P450scc band is seen in control NCI-H295A cells but COS-1 cells do not contain either F2 or free P450scc protein. The 54- kDa AdRed protein was expressed in all cell lines examined. Molecular size markers are shown in kDa.

 
Steroid metabolism in COS-F2–130 cells
The COS-F2–130 cell line was identified by its ability to produce large amounts of pregnenolone (Fig. 1Go). To determine whether pregnenolone is the final steroidal product in COS-F2–130 cells, we added [14C] pregnenolone to COS-1 and COS-F2–130 cells and examined the resulting steroids by TLC and phosphorimager analysis (Fig. 4Go). Whole COS-1 and COS-F2–130 cells convert 0.7% of the radiolabeled pregnenolone to progesterone after 1 h and 2.5% after 5 h, probably using the type I 3ßHSD found at low levels in most extraglandular tissues, including the kidney (37). Mitochondria isolated from COS-1 or COS-F2–130 cells converted 0.1% of the radiolabeled pregnenolone to progesterone after 1 h, but mitochondria from MA-10 cells converted 6% of the incubated pregnenolone to progesterone and another unidentified product in 1 h, consistent with the presence of type II 3ßHSD in MA-10 cell mitochondria (38). Thus COS-F2–130 cells provide a unique steroidogenic environment in which pregnenolone is the overwhelmingly predominant final product.



View larger version (85K):
[in this window]
[in a new window]
 
Figure 4. Steroidogenesis in COS-F2–130 cells. Whole COS-F2–130 and COS-1 cells (left) and mitochondria isolated from COS-F2–130, COS-1 and MA-10 cells (right) were incubated with [14C] pregnenolone for the times indicated and the resulting steroidal products were analyzed by TLC. The migration of reagent grade [14C] progesterone and [14C] pregnenolone are shown at the left. The phosphorimager quantitation of the conversions of pregnenolone to progesterone are provided in the Results.

 
Steroidogenic activity of isolated mitochondria from the stable clones
We and others have used mitochondria from isolated steroidogenic cells to assay the capacity of various proteins (e.g. StAR and MLN64) to foster steroidogenesis by increasing the flow of cholesterol from the outer to inner mitochondrial membrane (34, 39, 40, 41). However, because 3ßHSD is present in mitochondria as well as in cytoplasm (38), such assays are complicated by having unknown quantities of the pregnenolone product converted to other steroids that are not detected by the pregnenolone immunoassay. The presence of the F2 protein in nonsteroidogenic COS-1 cells provides a unique steroidogenic cell system in which pregnenolone is the final steroidal product, as COS-1 cells lack downstream steroidogenic enzymes. Thus, we examined the suitability of isolated mitochondria from COS-F2–130 cells for assays of StAR activity in vitro. In the absence of StAR protein, mitochondria from steroidogenic cells will produce small amounts of pregnenolone from the cholesterol preexisting in the mitochondria. Under these conditions, mitochondria from COS-F2–130 cells produced 0.56 ng of pregnenolone per µg mitochondrial protein, compared with 1.82 ng by mitochondria from MA-10 cells, 0.13 ng by COS-F2–87 cells, and 0.09 ng by clone no. 71. The level of pregnenolone assayed from mitochondria of clone no. 211 or COS-1 cells was indistinguishable from the background measured in buffer alone without exposure to mitochondria (Fig. 5Go). Thus, mitochondria from COS-F2–130 cells possessed the highest steroidogenic capacity among the COS-F2 stable clones, but this was only about one third of the activity seen with MA-10 mitochondria.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. Steroidogenic activity of isolated mitochondria. Mitochondria (2 µg protein) from MA-10, COS-F2 clones no. 130, no. 87, no. 71, no. 211, and COS-1 cells were incubated at 37 C for 60 min without added substrate, and the amount of pregnenolone produced from their endogenous cholesterol stores was measured by RIA. COS-F2–130 cells exhibited greater steroidogenic capacity than the other stable cell lines, but less than MA-10 cells. The assay background shown as a line parallel to the x-axis was determined as buffer alone in the absence of mitochondria. Results are means ± SEM from eight independent experiments for MA-10 and COS-F2–130 mitochondria; six experiments for COS-F2–87 and no. 71, and four experiments for no. 211 and COS-1 mitochondria, each performed in duplicate.

 
Mitochondria from COS-F2–130 cells were then incubated with 10-8 M to 10-5 M StAR protein. Purified recombinant 6His-tagged N-62 StAR was biologically active and stimulated steroidogenesis in mitochondria from both COS-F2–130 and MA-10 cells in a dose-dependent manner, but the MA-10 mitochondria produced a steeper, clearer, and more robust response, consistent with their greater level of basal steroidogenesis (Fig. 6Go). Compared with a buffer blank, 10-8 M N-62 StAR protein stimulated steroidogenesis 7.4 ± 1.2 fold in mitochondria from MA-10 cells and 4.2 ± 0.2-fold in mitochondria from COS-F2–130 cells. When incubated with 10-8 M N-62 StAR, mitochondria from MA-10 cells produced 9.6 ± 1.0 ng pregnenolone and mitochondria from COS-F2–130 cells produced 2.2 ± 0.3 ng pregnenolone.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 6. In vitro assay of StAR activity. Bacterially expressed human 6His-tag N-62 StAR protein was incubated with 2 µg of mitochondria from MA-10 or COS-F2–130 cells, and the amount of pregnenolone produced from endogenous mitochondrial cholesterol was measured by RIA. The data are shown as a percentage of the control values for mitochondria from each cell type incubated with buffer alone. Data are means ± SEM from five experiments, each performed singly or in duplicate.

 
Transient expression of StAR in COS-F2–130 cells
COS-1 cells transiently transfected with the vector expressing the F2 fusion protein are widely used in the study of StAR action (9, 34, 40, 41, 42, 43, 44, 45, 46, 47). To determine whether COS-F2–130 cells can exhibit an acute steroidogenic response, we transiently transfected these cells with expression vectors for N-62 StAR or full-length StAR and measured pregnenolone synthesis. Western blotting using StAR antibody (48) confirmed the expression of StAR in COS-F2–130 cells transfected with the N-62 StAR expression vector, but not with mock transfection (not shown). Transient transfection of COS-F2–130 cells with expression vectors for N-62 StAR and full-length StAR enhanced steroidogenesis to a similar extent, producing 20-fold more pregnenolone than empty vector or mock transfection (Fig. 7Go). Furthermore, pregnenolone synthesis fostered by N-62 StAR or full-length StAR using endogenous cholesterol is 45% of the maximal steroidogenic capacity, as indicated by incubation with 22R-OH-C, consistent with previous observations (34). COS-F2–130 cells from different passages gave same degree of pregnenolone synthesis, indicating that this clonal cell line is stable.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 7. Steroidogenic activity of COS-F2–130 cells transfected with expression vectors for StAR. COS-F2–130 cells mock transfected or transfected with empty vector produce low levels of pregnenolone; when these cells are incubated with 22R-OH-C, pregnenolone production is increased substantially (set at 100% in this figure). Cells transfected with vectors for full-length (FL) StAR or for N-62 StAR have about 45–50% of maximal activity, showing the increased flow of cholesterol into mitochondria. By contrast, COS-1 cells, with or without StAR transfection, produce no pregnenolone. Data with COS-F2–130 cells (five left bars) are mean ± SEM of six experiments, each performed in duplicate; data with COS-1 cells (four right bars) are means ± SEM of four experiments, each performed in triplicate.

 
Function of the AdRed and Adx moieties in the F2 fusion protein
The limiting factor in the activity of the P450scc system is the availability of Adx (18, 19, 24). To examine the adequacy of each component of the side chain cleavage system in COS-F2–130 cells, increasing amounts (0.01, 0.1, 1.0, 3.0 µg) of expression vectors for Adx, P450scc and AdRed were transiently transfected into these cells. As expected, transfection of COS-F2–130 cells with the vector expressing Adx did not increase the activity of the F2 protein expressed by these cells (Fig. 8AGo), as we have previously shown that the Adx moiety in the F2 fusion protein supplies electrons directly to the P450scc moiety, because mutation of the Adx moiety in F2 ablates activity (22). Also as expected, transfection of COS-F2–130 cells with a vector expressing P450scc increased activity, as the free P450scc produced by this vector should be catalytically active, receiving electrons from the free Adx and AdRed endogenously produced by COS-1 cells. Surprisingly, transfection of COS-F2–130 cells with the vector expressing AdRed increased activity, suggesting that free AdRed can donate electrons to the Adx moiety of the F2 fusion protein. This is consistent with our previous observation that mutation of the AdRed moiety in F2 did not reduce activity (22) and suggests that a major source of electrons donated to the Adx moiety of F2 is free AdRed rather than the AdRed moiety of F2. As expected, free Adx fostered the activity of free P450scc substantially, but AdRed fostered activity only minimally when vectors for the two proteins were transfected together, and triple transfection did not increase pregnenolone production further, again showing that it is the Adx moiety that is limiting (Fig. 8BGo). Thus, the level of P450scc activity achieved by the F2 fusion protein in COS-F2–130 cells is substantially less than that achieved in triple transfection. Hence the catalytically active F2 protein appears to be expressed at relatively low levels compared with the level of protein expression possible in transient transfection.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 8. Transfection of COS-F2–130 cells with expression vectors for Adx, P450scc or AdRed. A, Transfection with 0.01, 0.1, 1 and 3 µg of the pEAdx vector expressing adrenodoxin did not increase the basal level of pregnenolone produced by COS-F2–130 cells, but transfection with the same amounts of the pEscc vector expressing human P450scc or the pEAR18- vector expressing human AdRed increased steroidogenesis in a dose-dependent fashion. Results are the means ± SEM from four separate transfections performed in duplicate or triplicate. B, Transfection of 1 µg of pEAdx, pEscc or pEAR18- alone or in combination with each other into COS-F2–130 cells. Bluescript was added to keep DNA amount constant at 3 µg in each transfection in both panels. Mock, empty vector (pECE) or bluescript alone were included as controls and pregnenolone they produced was similar to COS-F2–130 cells alone. The data are means ± SEM from three separate transfections, each performed in duplicate or triplicate.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have established a functional new cell line termed COS-F2–130, consisting of COS-1 cells expressing a stably integrated vector for the F2 fusion protein of the human cholesterol side chain cleavage system. The only steroidogenic enzyme this cell line expresses is the P450scc system, and not any of the downstream enzymes in the steroidogenic pathway, so that pregnenolone is the final steroid produced. COS-F2–130 cells exhibit both StAR-dependent and StAR-independent steroidogenesis, and hence should prove useful in studies of StAR and StAR-like proteins.

Studies with the mitochondrial electron-transport proteins in COS-F2–130 cells showed that the Adx moiety of F2 supplies electrons directly to the P450scc moiety, but that free AdRed, instead of the AdRed moiety of F2, enhances the activity of the fusion enzyme by donating electrons to the Adx moiety of F2. Transient expression of free P450scc enhances steroidogenesis by receiving electrons from endogenous free Adx and AdRed. These data confirm that the Adx moiety is the limiting factor for P450scc in COS-F2–130 cells, as free Adx significantly promotes P450scc activity and cotransfections of all the three components do not produce more pregnenolone than Adx-P450scc cotransfections. It is possible that P450scc and other mitochondrial P450 enzymes have a broader range of electron donors than the AdRed/Adx system. A fusion protein termed F4, comprising H2N-P450scc-oxidoreductase-COOH is catalytically active, receiving electrons from the P450 oxidoreductase normally found in the endoplasmic reticulum (22).

Mitochondrial (type I) cytochrome P450 enzymes receive electrons from NADPH via an electron transport chain consisting of a flavopotein (AdRed) and an iron-sulfur protein (Adx); by contrast, microsomal (type II) P450 enzymes receive electrons from NADPH directly via the flavoprotein P450 oxidoreductase (OR), without requiring an iron-sulfur intermediate (5). A naturally occurring fusion protein of a type II P450 has been described in Bacillus megaterium (49, 50), leading to the successful adaptation of this naturally occurring H2N-P450-OR-COOH architecture to numerous artificial fusion proteins of type II P450 enzymes (51, 52, 53, 54, 55). However, no naturally occurring fusion proteins of type I P450 enzymes have been described, and the observation that the same surface of Adx interacts with both the P450 and the AdRed moieties indicated that type II P450 enzymes do not form a ternary complex (24, 56, 57, 58), suggesting that fusion proteins of the three components of mitochondrial P450 system should be inert. Nevertheless, several such type II fusion proteins have been built using various P450 moieties and various architectures (19, 22, 23, 24). It has been suggested that fusion proteins of the F2 architecture (19) are catalytically active because the carboxy-terminal Adx moiety is free to rotate about the linking hinge peptide, permitting the same surface of Adx alternately to interact with the P450 and AdRed moieties (57, 58). However, this has not been demonstrated experimentally, and the catalytic activity of proteins with the architectures H2N-P450scc-Adx-AdRed-COOH (19, 22), H2N-P450scc-OR-COOH (22), and H2N-P45011ß-AdRed-Adx-COOH (24) appears to be inconsistent with this explanation. Mutagenesis of the Adx moiety in F2 eliminated activity, but mutagenesis of the AdRed moiety did not (22). Using COS-F2–130 cells, we have now confirmed our earlier work with Adx mutagenesis (22) showing that the F2 P450 moiety receives electrons only from the fused F2 moiety and cannot receive electrons from free Adx, even when it is overexpressed. Furthermore, our current data show that overexpression of free AdRed does support increased F2 enzymatic activity, indicating that free AdRed can donate electrons to the fused Adx moiety of F2. As mutagenesis of the fused AdRed moiety of F2 did not reduce activity, the current data would suggest that free AdRed is the principal source of electrons employed by F2 fusion proteins.


    Acknowledgments
 
We thank Dr. Himanshu S. Bose for the recombinant N-62 StAR protein, Dr. Maengseok Song for his valuable discussions, Dr. Ningwu Huang for the GAPDH primers, and Dr. Jerome F. Strauss III for the trilostane.


    Footnotes
 
1 This work was supported by NIH Grants DK-37922, DK-42154, and HD-34449 (to W.L.M.). Back

Received December 18, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Stone D, Hechter O 1955 Studies on ACTH action in perfused bovine adrenals: aspects of progesterone as an intermediary in cortico-steroidogenesis. Arch Biochem Biophys 54:121–128[CrossRef]
  2. Lambeth JD, Pember SO 1983 Cytochrome P-450scc-adrenodoxin complex: reduction properties of the substrate-associated cytochrome and relation of the reduction states of heme and iron-sulfur centers to association of the proteins. J Biol Chem 258:5596–5602[Free Full Text]
  3. Privalle CT, Crivello JF, Jefcoate CR 1983 Regulation of intramitochondrial cholesterol transfer to side-chain cleavage cytochrome P-450 in rat adrenal gland. Proc Natl Acad Sci USA 80:702–706[Abstract/Free Full Text]
  4. Jefcoate CR, DiBartolomeis MJ, Williams CA, McNamara BC 1987 ACTH regulation of cholesterol movement in isolated adrenal cells. J Steroid Biochem 27:721–729[CrossRef][Medline]
  5. Miller WL 1988 Molecular biology of steroid hormone synthesis. Endocr Rev 9:295–318[Abstract/Free Full Text]
  6. Lambeth JD, Seybert D, Kamin H 1979 Ionic effects on adrenal steroidogenic electron transport: the role of adrenodoxin as an electron shuttle. J Biol Chem 254:7255–7264[Abstract/Free Full Text]
  7. Hanukoglu I, Jefcoate CR 1980 Mitochondrial cytochrome P-450scc: mechanism of electron transport by adrenodoxin. J Biol Chem 255:3057–3061[Free Full Text]
  8. Clark BJ, Wells J, King SR, Stocco DM 1994 The purification, cloning and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). J Biol Chem 269:28314–28322[Abstract/Free Full Text]
  9. Lin D, Sugawara T, Strauss III JF, Clark BJ, Stocco DM, Saenger P, Rogol A, Miller WL 1995 Role of steroidogenic acute regulatory protein in adrenal and gonadal steroidogenesis. Science 267:1828–1831[Abstract/Free Full Text]
  10. Stocco DM, Clark BJ 1996 Regulation of the acute production of steroids in steroidogenic cells. Endocr Rev 17:221–244[Abstract/Free Full Text]
  11. Waterman MR, Simpson ER 1989 Regulation of steroid hydroxylase gene expression is multifactorial in nature. Recent Prog Horm Res 45:533–566
  12. Moore CCD, Miller WL 1991 The role of transcriptional regulation in steroid hormone biosynthesis. J Steroid Biochem Mol Biol 40:517–525[CrossRef][Medline]
  13. Hum DW, Miller WL 1993 Transcriptional regulation of human genes for steroidogenic enzymes. Clin Chem 39:333–340[Abstract]
  14. Morisaki M, Duque C, Ikekawa H, Shikita M 1980 Substrate specificity of adrenocoritcal cytochrome P450. I. Effect of structural modification of cholesterol side chain on pregnenolone production. J Steroid Biochem 13:545–550[CrossRef][Medline]
  15. Jefcoate CR, Simpson ER, Boyd GS 1974 Spectral properties of rat adrenal-mitochondrial cytochrome P-450. Eur J Biochem 42:539–551[Medline]
  16. Toaff ME, Schleyer H, Strauss III JF 1982 Metabolism of 25-hydroxycholesterol by rat luteal mitochondria and dispersed cells. Endocrinology 111:1785–1790[Abstract/Free Full Text]
  17. Stocco DM, Clark BJ, Lin D, Sugawara T, Strauss III JF, Miller WL 1996 Characterization of the protein responsible for the acute regulation of steroidogenesis in mouse Leydig tumor cells. In: Desjardins C (ed) Cellular and Molecular Regulation of Testicular Cells. Springer-Verlag, New York, pp 311–336
  18. Zuber MX, Mason JI, Simpson ER, Waterman MR 1988 Simultaneous transfection of COS-1 cells with mitochondrial and microsomal steroid hydroxylases: incorporation of a steroidogenic pathway into non-steroidogenic cells. Proc Natl Acad Sci USA 85:699–703[Abstract/Free Full Text]
  19. Harikrishna JA, Black SM, Szklarz GD, Miller WL 1993 Construction and function of fusion enzymes of the human cytochrome P450scc system. DNA Cell Biol 12:371–379[Medline]
  20. Cao P, Bernhardt R 1999 Interaction of CYP11B1 (cytochrome P-45011ß) with CYP11A1 (cytochrome P-450scc) in COS-1 cells. Eur J Biochem 262:720–726[Medline]
  21. Itoh S, Iemura O, Yoshimura T, Tsujikawa K, Yamada E, Nonaka Y, Okamoto M, Mimura T, Kohama Y 1997 Simultaneous expression of ferredoxin, ferredoxin reductase and P450 in COS7 cells. Biochim Biophys Acta 1318:284–290[Medline]
  22. Black SM, Harikrishna JA, Szklarz GD, Miller WL 1994 The mitochondrial environment is required for activity of the cholesterol side-chain cleavage enzyme, cytochrome P450scc. Proc Natl Acad Sci USA 91:7247–7251[Abstract/Free Full Text]
  23. Dilworth FJ, Black SM, Guo YD, Miller WL, Jones G 1996 Construction of a P450c27 fusion enzyme—a useful tool for analysis of vitamin D3-25-hydroxylase activity. Biochem J 320:267–271
  24. Cao P, Bulow H, Dumas B, Bernhardt R 2000 Construction and characterization of a catalytic fusion protein system: P-45011ß-adrenodoxin reductase-adrenodoxin. Biochim Biophys Acta 1476:253–264[CrossRef][Medline]
  25. Ellis L, Clauser E, Morgan DO, Edery M, Roth RA, Rutter WJ 1986 Replacement of insulin receptor tyrosine residues 1162 and 1163 compromises insulin-stimulated kinase activity and uptake of 2-deoxyglucose. Cell 45:721–732[CrossRef][Medline]
  26. Brentano ST, Miller WL 1992 Regulation of human P450scc and adrenodoxin mRNAs in JEG-3 cytotrophoblast cells. Endocrinology 131:3010–3018[Abstract/Free Full Text]
  27. Brentano ST, Black SM, Lin D, Miller WL 1992 cAMP post-transcriptionally diminishes the abundance of adrenodoxin reductase mRNA. Proc Natl Acad Sci USA 89:4099–4103[Abstract/Free Full Text]
  28. Gazdar AF, Oie HK, Shackleton CH, Chen TR, Triche TJ, Myers CE, Chrousos GP, Brennan MF, Stein CA, LaRocca RV 1990 Establishment and characterization of a human adrenocortical carcinoma cell line that expresses multiple pathways of steroid biosynthesis. Cancer Res 50:5488–5496[Abstract/Free Full Text]
  29. Staels B, Hum DW, Miller WL 1993 Regulation of steroidogenesis in NCI-H295 cells: a cellular model of the human fetal adrenal. Mol Endocrinol 7:423–433[Abstract/Free Full Text]
  30. Rodriguez H, Hum DW, Staels B, Miller WL 1997 Transcription of the human genes for cytochrome P450scc and P450c17 is regulated differently in human adrenal NCI-H295 cells than in mouse adrenal Y1 cells. J Clin Endocrinol Metab 82:365–371[Abstract/Free Full Text]
  31. Huang N, Miller W 2000 Cloning of factors related to HIV-inducible LBP proteins that regulate steroidogenic factor-1-independent human placental transcription of the cholesterol side-chain cleavage enzyme, P450scc. J Biol Chem 275:2852–2858[Abstract/Free Full Text]
  32. Black SM, Szklarz GD, Harikrishna JA, Lin D, Wolf CR, Miller WL 1993 Regulation of proteins of the cholesterol side-chain cleavage system in Y-1 and JEG-3 cells. Endocrinology 132:539–545[Abstract/Free Full Text]
  33. Lin D, Black SM, Nagahama Y, Miller WL 1993 Steroid 17{alpha}-hydroxylase and 17,20 lyase activities of P450c17: contributions of serine106 and P450 reductase. Endocrinology 132:2498–2506[Abstract/Free Full Text]
  34. Bose HS, Whittal RM, Huang MC, Baldwin MA, Miller WL 2000 N-218 MLN64, a protein with StAR-like steroidogenic activity is folded and cleaved similarly to StAR. Biochemistry 39:11722–11731[CrossRef][Medline]
  35. Rickwood D, Wilson MT, Darly-Usmar VM 1987 Isolation and characterization of intact mitochondria. In: Darly-Usmar VM, Rickwood D, Wilson MT (eds) Mitochondria: A Practical Approach. IRL Press, Washington, DC, pp 1–16
  36. Picado-Leonard J, Voutilainen R, Kao L, Chung B, Strauss III JF, Miller WL 1988 Human adrenodoxin: cloning of three cDNAs and cycloheximide enhancement in JEG-3 cells. J Biol Chem 263:3240–3244[Abstract/Free Full Text]
  37. Simard J, Durocher F, Mebarki F, Turgeon C, Sanchez R, Labrie Y, Couet J, Trudel C, Rheaume E, Morel Y, Luu-The V, Labrie F 1996 Molecular biology and genetics of the 3ß-hydroxysteroid dehydrogenase/{Delta}5-{Delta}4 isomerase gene family. J Endocrinol [Suppl] 150:S189–S207
  38. Cherradi N, Rossier MF, Vallotton MB, Timberg R, Friedberg I, Orly J, Wang XJ, Stocco DM, Capponi AM 1997 Submitochondrial distribution of three key steroidogenic proteins (steroidogenic acute regulatory protein and cytochrome P450scc and 3ß-hydroxysteroid dehydrogenase isomerase enzymes) upon stimulation by intracellular calcium in adrenal glomerulosa cells. J Biol Chem 272:7899–7907[Abstract/Free Full Text]
  39. King SR, Ronen-Fuhrmann T, Timberg R, Clark BJ, Orly J, Stocco DM 1995 Steroid production after in vitro transcription, translation, and mitochondrial processing of protein products of complementary deoxyribonucleic acid for steroidogenic acute regulatory protein. Endocrinology 136:5165–5176[Abstract]
  40. Arakane F, Kallen CB, Watari H, Foster JA, Sepuri NBV, Pain D, Stayrook SE, Lewis M, Gerton GL, Strauss III JF 1998 The mechanism of action of steroidogenic acute regulatory protein (StAR): StAR acts on the outside of mitochondria to stimulate steroidogenesis. J Biol Chem 273:16339–16345[Abstract/Free Full Text]
  41. Kallen CB, Billheimer JT, Summers SA, Stayrook SE, Lewis M, Strauss III JF 1998 Steroidogenic acute regulatory protein (StAR) is a sterol transfer protein. J Biol Chem 273:26285–26288[Abstract/Free Full Text]
  42. Sugawara T, Holt JA, Driscoll D, Strauss III JF, Lin D, Miller WL, Patterson D, Clancy KP, Hart IM, Clark BJ, Stocco DM 1995 Human steroidogenic acute regulatory protein (StAR): functional activity in COS-1 cells, tissue-specific expression, and mapping of the structural gene to 8p11.2 and an expressed pseudogene to chromosome 13. Proc Natl Acad Sci USA 92:4778–4782[Abstract/Free Full Text]
  43. Arakane F, Sugawara T, Nishino H, Liu Z, Holt JA, Pain D, Stocco DM, Miller WL, Strauss III JF 1996 Steroidogenic acute regulatory protein (StAR) retains activity in the absence of its mitochondrial targeting sequence: implications for the mechanism of StAR action. Proc Natl Acad Sci USA 93:13731–13736[Abstract/Free Full Text]
  44. Fujieda K, Tajima T, Nakae J, Sageshima S, Tachibana K, Suwa S, Sugawara T, Strauss III JF 1997 Spontaneous puberty in 46,XX subjects with congenital lipoid adrenal hypreplasia. J Clin Invest 99:1265–1271[Medline]
  45. Nakae J, Tajima T, Sugawara T, Arakane F, Hanaki K, Hotsubo T, Igarashi N, Igarashi Y, Ishii T, Koda N, Kondo T, Kohno H, Nakagawa Y, Tachibana K, Takeshima Y, Tsubouchi K, Strauss III JF, Fujieda K 1997 Analysis of the steroidogenic acute regulatory protein (StAR) gene in Japanese patients with congenital lipoid adrenal hyerplasia. Hum Mol Genet 6:571–576[Abstract/Free Full Text]
  46. Wang X, Liu Z, Eimerl S, Weiss AM, Orly J, Stocco DM 1998 Effect of truncated forms of the steroidogenic acute regulatory (StAR) protein on intramitochondrial cholesterol transfer. Endocrinology 139:3903–3912[Abstract/Free Full Text]
  47. Katsumata N, Kawada Y, Yamamoto Y, Noda M, Nimura A, Horikawa R, Tanaka T 1999 A novel compound heterozygous mutation in the steroidogenic acute regulatory protein gene in a patient with congenital lipoid adrenal hyperplasia. J Clin Endocrinol Metab 84:3983–3987[Abstract/Free Full Text]
  48. Bose HS, Whittal RM, Baldwin MA, Miller WL 1999 The active form of the steroidogenic acute regulatory protein, StAR, appears to be a molten globule. Proc Natl Acad Sci USA 96:7250–7255[Abstract/Free Full Text]
  49. Narhi LO, Fulco AJ 1986 Characterization of a catalytically self-sufficient 119,000-dalton P450 monooxygenase induced by barbiturates in Bacillus megaterium. J Biol Chem 261:7160–7169[Abstract/Free Full Text]
  50. Narhi LO, Fulco AJ 1987 Identification and characterization of two functional domains in cytochrome P-450BM-3, a catalytically self-sufficient monooxygenase induced by barbiturates in Bacillus megaterium. J Biol Chem 262:6683–6690[Abstract/Free Full Text]
  51. Murakami H, Yabusaki Y, Sakaki T, Shibata M, Ohkawa H 1987 A genetically engineered P450 monooxygenase: construction of the functional fused enzyme between rat cytochrome P450c and NADPH-cytochrome P450 reductase. DNA 6:189–197[Medline]
  52. Yabusaki Y, Murakami H, Ohkawa H 1988 Primary structure of Saccharomyces cerevisiae NADPH-cytochrome P450 reductase deduced from nucleotide sequence of its cloned gene. J Biochem 103:1004–1010[Abstract/Free Full Text]
  53. Sakaki T, Shibata M, Yabusaki Y, Murakami H, Ohkawa H 1990 Expression of bovine cytochrome P450c21 and its fused enzymes with yeast NADPH-cytochrome P450 reductase in Saccaromyces cerevisiae. DNA Cell Biol 9:603–614[Medline]
  54. Shibata M, Sakaki T, Yabusaki Y, Murakami H, Ohkawa H 1990 Genetically engineered P450 monoxygenases: construction of bovine P450c 17/yeast reductase fused enzymes. DNA Cell Biol 9:27–36[Medline]
  55. Fisher CW, Shet MS, Caudle DL, Martin-Wixtrom CA, Estabrook RW 1992 High-level expression in Escherichia coli of enzymatically active fusion proteins containing the domains of mammalian cytochromes P450 and NADPH-P450 reductase flavoprotein. Proc Natl Acad Sci USA 89:10817–10821[Abstract/Free Full Text]
  56. Hanukoglu I, Suh BS, Himmelhoch S, Amsterdam A 1990 Induction and mitochondrial localization of cytochrome P450scc system enzymes in normal and transformed ovarian granulosa cells. J Cell Biol 111:1373–1381[Abstract/Free Full Text]
  57. Coghlan VM, Vickery LE 1991 Site-specific mutations in human ferredoxin that affect binding to ferredoxin reductase and cytochrome P450scc. J Biol Chem 266:18606–18612[Abstract/Free Full Text]
  58. Coghlan VM, Vickery LE 1992 Electrostatic interactions stabilizing ferredoxin electron transfer complexes: disruption by "conservative" mutations. J Biol Chem 267:8932–8935[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
J. Liu, M. B. Rone, and V. Papadopoulos
Protein-Protein Interactions Mediate Mitochondrial Cholesterol Transport and Steroid Biosynthesis
J. Biol. Chem., December 15, 2006; 281(50): 38879 - 38893.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. C. Tuckey, H. S. Bose, I. Czerwionka, and W. L. Miller
Molten Globule Structure and Steroidogenic Activity of N-218 MLN64 in Human Placental Mitochondria
Endocrinology, April 1, 2004; 145(4): 1700 - 1707.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. C. Tuckey, M. J. Headlam, H. S. Bose, and W. L. Miller
Transfer of Cholesterol between Phospholipid Vesicles Mediated by the Steroidogenic Acute Regulatory Protein (StAR)
J. Biol. Chem., November 27, 2002; 277(49): 47123 - 47128.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, M.-C.
Right arrow Articles by Miller, W. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, M.-C.
Right arrow Articles by Miller, W. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals