help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Demary, K.
Right arrow Articles by Spanjaard, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Demary, K.
Right arrow Articles by Spanjaard, R. A.
Endocrinology Vol. 142, No. 6 2600-2605
Copyright © 2001 by The Endocrine Society


ARTICLES

Redox Control of Retinoic Acid Receptor Activity: A Novel Mechanism for Retinoic Acid Resistance in Melanoma Cells1

Kristian Demary, Ling Wong, James S. Liou, Douglas V. Faller and Remco A. Spanjaard

Departments of Otolaryngology (K.D., L.W., R.A.S.) and Medicine (J.S.L., D.V.F.), Cancer Research Center, Boston University School of Medicine, Boston, Massachusetts 02118

Address all correspondence and requests for reprints to: Remco A. Spanjaard, Ph.D., Boston University School of Medicine, Cancer Research Center, 715 Albany Street R903, Boston, Massachusetts 02118. E-mail: rspan{at}bu.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Retinoic acid (RA) slows growth and induces differentiation of tumor cells through activation of RA receptors (RARs). However, melanoma cell lines display highly variable responsiveness to RA, which is a poorly understood phenomenon. By using Northern and Western blot analyses, we show that RA-resistant A375 and RA-responsive S91 melanoma cells express comparable levels of major components of RAR-signaling pathways. However, A375 cells have substantially higher intracellular reactive oxygen species (ROS) levels than S91 cells. Lowering ROS levels in A375 cells through hypoxic culture conditions restores RAR-dependent trans-activity, which could be further enhanced by addition of the antioxidant N-acetyl-cysteine. Hypoxia also enhances RAR activity in the moderately RA-responsive C32 cells, which have intermediate ROS levels. Conversely, increasing oxidative stress in highly RA-responsive S91 and B16 cells, which have low ROS levels, by treatment with H2O2 impairs RAR activity. Consistent with these observations, RA more potently inhibited the proliferation of hypoxic A375 cells than that of normoxic cells. Oxidative states diminish, whereas reducing conditions enhance, DNA binding of retinoid X receptor/RAR heterodimers in vitro, providing a molecular basis for the observed inverse correlation between RAR activity and ROS levels. The redox state of melanoma cells provides a novel, epigenetic control mechanism of RAR activity and RA resistance.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
RETINOIDS HAVE shown clinical potential as differentiation-inducing agents in some (pre)malignant lesions (1, 2, 3, 4). Retinoic acid (RA) acts through activation of RA receptors (RARs), which are members of the nuclear hormone receptor superfamily of ligand-dependent transcription factors to which estrogen receptors and glucocorticoid receptors (GR) also belong (5, 6). A hallmark characteristic of these proteins is a highly conserved DNA-binding domain (DBD), which consists of two zinc fingers that are responsible for sequence-specific DNA binding to their cognate hormone response element. RARs are typically found in a 1:1 heterodimer complex with retinoid X receptor (RXR), another member of the superfamily. In response to RA, this complex binds to an RA response element (RARE), usually located in the promoter region of a target gene, and modulates gene transcription, which ultimately can have important physiological consequences for the cell or even the entire organism, particularly during embryonic development (7).

We previously showed that RA slows growth and induces reversible differentiation of S91 melanoma cells, which is a complex process accompanied by various specific RAR-mediated changes in gene regulation (8). Unfortunately, however, many other melanoma cell lines, such as A375 cells, are completely resistant to the effects of RA (8, 9), and RA has been found to be a disappointing therapeutic for this disease, even in combination with interferon (10, 11). The lack of insight into the mechanism of RA resistance of melanoma cells greatly hampers efforts to improve clinical protocols that use this drug.

In this report we investigated which factor(s) determines RA responsiveness and RA resistance, and the molecular basis of RA resistance in melanoma cells using S91 and A375 cells as contrasting models of RA responsiveness and RA resistance, respectively. Our research shows that both RA-resistant and RA-responsive cells appear to express the major determinants of RA signaling pathways, suggesting that RA resistance in A375 cells is not due to genetic mutations, but, rather, that RAR activity is repressed through an epigenetic mechanism.

One such potential mechanism is increased intracellular oxidative stress, which has been shown to negatively regulate the activity of several different transcription factors (12). Indeed, we observed an inverse correlation between RAR activity and basal intracellular ROS levels in melanoma cells. RA-resistant melanoma cells could be resensitized to RA by lowering oxidative stress levels, which are probably mediated by redox-dependent DNA-binding activity of RXR/RAR heterodimers. Manipulation of the basal cellular redox state may provide a new strategy for hormone treatment of seemingly hormone-resistant tumors, which may have previously unrecognized physiological and clinical consequences.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Cell culture conditions and hormones
Melanoma cells were obtained from American Type Culture Collection (Manassas, VA) and cultured in DMEM or RPMI 1640 with 10% FCS under normoxic conditions (21% O2/5% CO2/74% N2) as previously described (5). Hypoxia was obtained by first growing cells for 24 h in a sealed chamber with 95% N2/5% CO2; hyperoxia was achieved by growing cells in a chamber with 40% O2/5% CO2/55% N2 and 1 or 0.1 mM H2O2 for S91 and B16 cells, respectively. Cells were then treated with 1 µM RA (Sigma, St. Louis, MO) or 0.1% dimethylsulfoxide (solvent control) and continued to grow for another 24 h under hypoxia or hyperoxia before being harvested for Luc assays. For experiments measuring GR-mediated activity, FCS was used that was stripped of glucocorticoid by treatment with activated charcoal (Bio-Rad Laboratories, Inc., Hercules, CA), and 1 µM water-soluble dexamethasone (dex; Sigma) was added for 24 h to the medium where noted in the text.

Proliferation assay
Cell were seeded at 6500 (S91) or 2500 (A375) cells/well when maintained under normoxic conditions or 7500 (A375) cells/well for hypoxic culture conditions 24 h before treatment in triplicate in 96-well plates and treated for 5 days with dimethylsulfoxide or 1 µM RA under normoxia (S91 and A375) or hypoxia (A375 only). On day 5, relative viable cell numbers were determined using the CellTiter 96 AQueous Nonradioactive Cell Proliferation Assay Kit (Promega Corp., Madison, WI) at A490 nM as previously described (8).

Transient transfections, plasmids, and Luc assays
S91, B16, and A375 cells were transfected by electroporation as previously described (13), C32 cells were transfected by Lipofectamine Plus according to the manufacturer’s instructions (Life Technologies, Inc., Grand Island, NY) and were left overnight before being transferred to hypoxic or hyperoxic conditions as needed. Luc assays and normalization of Luc activity by protein concentration were performed as previously described (13). Reporter plasmids p-mouse mammary tumor virus-luciferase (14) (to determine GR-mediated activity) and pRARE3Luc (13) (to determine RAR-mediated activity) have been described; the latter contains three repeats of the RARE sequence GTAGGGTTCACCGAAAGTTCAC. Plasmid {Delta}RARELuc is identical to RARE3Luc, but it contains the sequence AGTTACTTATTGCTGAGGTCAAGTTA instead of the RARE repeats.

Northern blot and Western blot analyses
Total RNA isolation, Northern blot procedures, and preparation of 32P-labeled complementary DNA probes were performed as previously described (8, 13). Preparation of whole cell extracts, immunoblotting procedures, and detection by chemiluminescence (Amersham Pharmacia Biotech, Piscataway, NY) were performed as previously described (8). Antibodies were obtained from Santa Cruz, except for anti-steroid receptor coactivator 1 (SRC-1) (Affinity BioReagents, Inc., Golden, CO).

ROS determinations
Cells were plated at a density of 2 x 105/6 cm dish, left untreated for 24 h, then harvested, washed in PBS, and resuspended in 5 µg/ml 2',7'-dichlorodihydrofluorescein diacetate (Molecular Probes, Inc., Eugene, OR) in HBSS. Samples were incubated for 15 min at room temperature and analyzed immediately using a FACScan flow cytometer.

Electrophoretic mobility shift assay (EMSA) conditions
In vitro translated RXR{alpha} and RARß were obtained through the TnT Quick Coupled Transcription/Translation kit according to the manufacturer’s protocol (Promega Corp.). Preparation of 32P end-labeled ßRARE-containing oligonucleotide and EMSA conditions were previously described (13), except that dithiothreitol was omitted from the binding buffer.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
To assess the RA responsiveness of melanoma cells, cells were transiently transfected with a reporter plasmid that drives RAR-dependent expression of an inducible luciferase (Luc) gene under the control of three copies of the RARE of the RARß gene (RARE3Luc). RAR-dependent induction of Luc activity can thus be measured as a primary response. As expected, S91 cells show a robust induction of Luc activity in the presence of RA, whereas A375 cells show virtually no response (8) (Fig. 1AGo).



View larger version (57K):
[in this window]
[in a new window]
 
Figure 1. RA-responsive S91 cells and RA-resistant A375 cells both contain major components of RAR-signaling pathways. A, Induction of Luc activity in S91 cells, but not in A375 cells, after RA treatment. The experiment was performed a minimum of three times, and a representative experiment is shown. Data are expressed as the mean ± SD of triplicate samples. B, Northern blot analysis (20 µg RNA/lane) showing equal levels of RAR expression in both untreated S91 and A375 cells, but only S91 cells show strong induction of RARß and moderate induction of RAR{gamma} after RA treatment. Cyclophilin served as the loading control. C, Western blot analysis (25 µg protein/lane) showing RA-independent, equal levels of RXR{alpha}, coactivator SRC-1, and corepressors mSin3a and HDAC-1 in both cell lines. ß-Actin served as the loading control.

 
Because lack of RAR expression would provide perhaps the simplest mechanism of RA resistance, we evaluated the expression levels of all three RAR genes by Northern blot analysis in the absence or presence of RA, as shown in Fig. 1BGo. In the absence of RA, both cell lines expressed about equal amounts of RAR{alpha} and RAR{gamma} and virtually no RARß. In the presence of RA, S91 cells showed the expected strong induction of RARß and weaker up-regulation of RAR{gamma}, whereas in A375 cells again no RA-dependent effect was detectable. This suggests that the difference in RA responsiveness is not due to major defects in RAR expression levels between the two lines.

However, a number of corepressor and coactivator proteins have been identified recently that mediate RAR-dependent gene regulation (15, 16), and we decided to examine expression levels of some representative factors. Whole cell extracts were made from cells grown for 24 h in the absence or presence of RA, and expression was detected by Western blot analysis. As shown in Fig. 1CGo, S91 and A375 cells express about equal levels of RXR{alpha}, the coactivator SRC-1, and the corepressors mSin3A and HDAC-1 in an RA-independent fashion. p300 could also be detected, whereas RXRß expression was extremely low or absent in both lines (data not shown). These findings indicate that major components required for ligand-dependent productive RAR-signaling are present in the RA-resistant A375 cells despite the functional inactivity of the RARs. Transfection studies with vectors expressing individual RXR and/or RAR isoform complementary DNAs did not restore RA responsiveness in A375 cells, further arguing against the possibility of inactivating mutations in the endogenous RARs of these cells (data not shown).

Earlier reports showed that the functional activity of several important transcription factors, such as activating protein-1, nuclear factor-{kappa}B, and the estrogen receptor, is regulated by the cellular redox state. Reducing conditions promote DNA binding and transcriptional activity, whereas oxidizing conditions cause inhibition (12, 17, 18, 19). If RAR activity could be regulated in a similar fashion, differences in the oxidative stress levels between S91 and A375 cells might engender differences in responsiveness to RA. To test this hypothesis, we determined basal ROS levels of untreated S91 and A375 cells, as well as RA-responsive B16 and C32 melanoma cells as an indicator of the intracellular redox state. Normally grown cells were harvested and incubated with the peroxide-sensitive fluorescent indicator 2',7'-dichlorodihydrofluorescein diacetate, and fluorescence was determined by FACS analysis. As shown in Fig. 2Go, A375 cells had substantially higher ROS levels than S91 cells. B16 cells also had very low ROS levels, whereas C32 cells had intermediate ROS levels. These results are at least consistent with the hypothesis that RAR-dependent gene regulation is impaired by high levels of oxidative stress in A375 cells.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. ROS measurements in S91 (filled gray), A375 (bold), and B16 and C32 melanoma cells (indicated by arrows) show widely varying basal ROS levels.

 
To further test this hypothesis, we lowered or increased generation of intracellular ROS by culturing cells under hypoxic or hyperoxic conditions, respectively (20), and determined RAR-dependent transcriptional activity in response to these conditions. A375 cells were again transiently transfected with RARE3Luc and incubated for 24 h under normoxic or hypoxic conditions, followed by another 24 h in the absence or presence of RA before cells were harvested and Luc activity was determined. Under normoxic conditions again very low levels of induction by RA of Luc activity were detectable in A375 cells compared with the highly RA-responsive S91 cells (Fig. 3AGo). However, A375 cells cultured under hypoxic conditions showed a substantial RA-dependent induction of Luc activity. This effect was even more pronounced in the presence of the antioxidant N-acetyl-cysteine (NAC), which also moderately increased RA responsiveness under normoxic conditions. Restoration of RA responsiveness by hypoxia could also be observed at the level of RA-dependent transcription of an endogenous gene (Fig. 3AGo, top panel). Induction of endogenous RARß gene expression in the presence of RA was only detectable under hypoxic culture conditions, and expression levels were again considerably increased by addition of NAC. The hypoxia-dependent induction of Luc activity in A375 cells by RA was dependent on the presence of an intact RARE, because a reporter construct without the RARE ({Delta}RARELuc) showed no inducible activity under any condition. Thus, in agreement with our hypothesis, lowering of the oxidative stress levels rescued RAR-dependent transcriptional activity in cells that are unresponsive to RA under normoxic culture conditions.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 3. Redox control of RAR- and GR-mediated transcriptional activity and RA-induced growth arrest. A and B, Hypoxia restores and/or enhances RAR- and GR-mediated transcriptional activity, whereas hyperoxia inhibits. Transient transfections with the indicated plasmids and treatment conditions (-, no RA; +, 1 µM RA added) show an inverse correlation between RAR and GR activity and oxidative stress levels. NAC (20 mM) was added where indicated. Top panel in A, Northern blot analysis with the indicated probes and culture conditions. Cyclophilin served as the loading control. The experiment was performed a minimum of three times, and a representative experiment is shown. Data are expressed as the mean ± SD (n >= 3). *, P <= 0.008 compared with untreated cells within each group; •, P <= 0.002 compared with RA-treated cells within each group (by Student’s t test analysis). C, Hypoxia resensitizes A375 cells to RA-induced growth arrest. A375 cells were cultured for 5 days in 96-well plates in the absence or presence of 1 µM RA under normoxic or hypoxic conditions. Cell numbers were determined by colorimetric assay, based on the cellular conversion of a tetrazolium salt into a formazan that is measured at 490 nM and that directly correlates with the number of viable cells. Absorbances of untreated cells were used to calculate the percent inhibition of proliferation due to RA treatment under normoxic and hypoxic culture conditions, respectively. The experiment was performed a minimum of three times, and a representative experiment is shown. Data are expressed as the mean ± SD (n >= 3). *, P <= 0.027 (by Student’s t test analysis) compared with normoxic cells. Hypo, Hypoxia; norm, normoxia; hyper, hyperoxia.

 
To extend these observations, we also examined redox-dependent RAR activity in other melanoma cell lines (Fig. 3AGo). C32 cells, which have intermediate ROS levels, showed intermediate RA-dependent induction of Luc activity, which was also significantly increased under hypoxic culture conditions. We then subjected the most RA-responsive cells (S91 and B16), which also have the lowest measured ROS levels, to hyperoxic culture conditions and assayed for RA-dependent Luc activity. Hyperoxia resulted in suppression of RA-dependent Luc induction. Taken together, these results show that endogenous RAR activity correlates inversely with intracellular ROS levels in these cell lines, and that receptor-dependent activity is subjected to redox control. Alternative explanations for reactivation of RARs through slower cell replication or metabolism (21) as a result of hypoxic exposure seem unlikely, because treatment of normoxic A375 cells with hydroxyurea and aphidicolin (blockers of DNA synthesis), clotrimazole and 2-deoxy-D-glucose (blockers of ATP generation), or the more metabolically stable retinoid Am580 did not restore RA responsiveness. Desferrioxamine and cobaltous chloride, which can activate the oxygen-sensing pathway under normoxic culture conditions (22), did not have any significant effect (data not shown).

Members of the nuclear hormone receptor superfamily share a highly conserved DBD, and they may behave in a fashion similar to the RARs to altered redox conditions in melanoma cells. As a representative, but distinctly different, receptor we tested the redox dependence of GR-mediated activity. A375 cells were transfected with the dex-inducible mouse mammary tumor virus promoter linked to the Luc gene, and induction of Luc activity in response to treatment was again determined under normoxic or hypoxic culture conditions (Fig. 3BGo). Under normoxic culture conditions, a moderate induction level of GR-mediated gene expression by dex was detected, indicating that GR-mediated activity is somewhat less suppressed than RAR-mediated activity in these cells. However, hypoxia again substantially increased GR-dependent Luc induction, showing that both endogenous RAR and GR-mediated functional activity increased under lower oxidative stress levels. As expected, a similar effect of hypoxia was seen for phorbol 12-myristate 13-acetate-induced activating protein-1 activity (data not shown).

Next, we examined whether the effects of different ROS levels on RAR activity and gene expression would also have physiological consequences, such as RA-dependent growth inhibition. A375 cells were propagated in 96-well plates under normoxic or hypoxic conditions in the absence or presence of RA, and after 5 days relative cell numbers were determined by a colorimetric assay, in which A490 nm directly correlates with the number of viable cells (8). The absorbance values of control cells were used to calculate the percent inhibition of proliferation in RA-treated cells under normoxic and hypoxic conditions, respectively (Fig. 3CGo). Under normoxic conditions, A375 cells were highly resistant to RA and displayed less than 10% growth inhibition. Under hypoxic conditions, however, RA-dependent inhibition of A375 cell proliferation almost doubled to 20% at the highest concentration of 1 µM RA tested, showing that these cells could be resensitized to RA, consistent with our earlier results. On the other hand, this effect is still less severe than that observed in highly RA-responsive S91 and B16 cells (23) (data not shown), but other, downstream events may limit RA-dependent growth suppression in A375 cells. Unfortunately, the potentially additional growth-suppressive effects of NAC could not be assessed due to the reactivity of NAC with components of the MTS assay (data not shown). Thus, reduced ROS levels in A375 cells increase RAR-dependent gene regulation, which then results in increased sensitivity to RA-mediated growth suppression.

Previous in vitro experiments showed that the DNA-binding activity of estrogen receptors and GR is dependent on redox-sensitive Cys residues in the DBD (12, 24, 25, 26), and we proposed that the related RARs would behave analogously. The effects of oxidizing and reducing buffer conditions on the DNA-binding activity of RXR/RAR heterodimers was therefore determined. RARß and RXR{alpha} were translated in vitro in a rabbit reticulocyte lysate system, and their DNA-binding activity to a 32P end-labeled oligonucleotide containing the ßRARE sequence was detected by EMSA. RARß was chosen to represent this experiment because this isoform gave more gel-shifted material per µl lysate than RAR{alpha} or RAR{gamma} (data not shown). As shown in Fig. 4Go, lysates containing only RARß or RXR{alpha} showed no binding (lanes 1 and 2, respectively), but did demonstrate DNA binding when mixed together through formation of RXR{alpha}/RARß heterodimers (HD; lane 3). Addition of 250 mM H2O2 during incubation significantly reduced the amount of bound HD (lane 4). To change the redox conditions during EMSA, we then used half the amount of RXR{alpha} and RARß lysate to dilute the reducing agents present in the incubation buffer from the reticulocyte lysate, which resulted in strongly diminished HD formation (lane 5). Conversely, addition of 10 mM 2-mercaptoethanol or dithiothreitol (lanes 6 and 7, respectively) to the buffer resulted in a marked increase in HD-binding activity, restoring approximately full levels of binding activity (compare to lane 3). Similar results were obtained with in vitro translated RAR{alpha} and RAR{gamma}/RXR{alpha} HDs (data not shown). These results demonstrate that oxidative conditions decrease, whereas reducing conditions reversibly increase, the HD DNA-binding activity of RARs. These effects of redox states on RAR DNA binding may mediate the observed effects on the functional activity of these receptors.



View larger version (60K):
[in this window]
[in a new window]
 
Figure 4. EMSA showing that the RXR{alpha}/RARß HD (heterodimer) DNA-binding activity to ßRARE probe decreases with oxidizing and increases under reducing conditions. Compounds (250 mM H2O2, 10 mM 2-mercaptoethanol, or DTT) were added as indicated.

 
The redox state of the cell is, therefore, a novel in vivo prognostic indicator of RAR-dependent transcriptional activity and may be applicable across the entire nuclear hormone receptor superfamily. We show in this report that ROS levels of these melanoma cells are inversely correlated with endogenous nuclear hormone receptor activity, thus providing a novel epigenetic control mechanism. A375 cells, which are completely RA resistant under normal culture conditions, can be resensitized to RA by lowering oxidative stress levels. This effect is most likely mediated through redox control of Cys residues in the DBD (9), although other pathways may exist (27).

These findings have a number of potentially important implications in both pathological and physiological circumstances. It is likely that there are instances of apparent hormone resistance in certain tumors that may be due to epigenetic changes in the intracellular redox balance of the cells rather than being caused by mutations or deletions in the receptor signaling pathways (28, 29, 30). Thus, it may be promising to investigate the potential clinical effects of combining antioxidants with hormone therapy in hormone-resistant tumors to determine whether they can be resensitized via this strategy. Indeed, our results suggest that tumors that are already hormone sensitive may be rendered even more sensitive. Consistent with our results, Makishima et al. (31) showed that 9-cis-RA {alpha}-tocopherol ester, which has antioxidant activity, enhanced RA-dependent differentiation of acute promyelocytic leukemia cells.

The redox state of a cell may also change during normal development and differentiation of an organism (32), and the resulting modulation of RAR activity may provide a novel and previously unrecognized level of control of nuclear hormone receptor activity. Interestingly, antioxidants were shown to prevent, rather than increase, RA-induced apoptosis of embryonic stem cells (33), demonstrating that the cellular redox state controls a complex and cell type-dependent response to RA.


    Acknowledgments
 
We thank Dr. Ai Leen Lam for assistance with statistical analyses.


    Footnotes
 
1 This work was supported by American Cancer Society Grant RPG-97–161-01-CNE (to R.A.S.) and NIH Grant CA-50459 (to D.V.F.). Back

Received November 8, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Moon RC, Mehta RG, Detrisac CJ 1992 Retinoids as chemopreventive agents for breast cancer. Cancer Detect Prev 16:73–79[Medline]
  2. Smith MA, Parkinson DR, Cheson BD, Friedman MA 1992 Retinoids in cancer therapy. J Clin Oncol 10:839–864[Abstract/Free Full Text]
  3. McBurney MW, Costa S, Pratt MA 1993 Retinoids and cancer: a basis for differentiation therapy. Cancer Invest 11:590–598[Medline]
  4. Lotan R 1996 Retinoids in cancer chemoprevention. FASEB J 10:1031–1039[Abstract]
  5. Chambon P 1994 The retinoid signaling pathway: molecular and genetic analyses. Semin Cell Biol 5:115–125[CrossRef][Medline]
  6. Glass CK, Rosenfeld MG, Rose DW, Kurokawa R, Kamei Y, Xu L, Torchia J, Ogliastro MH, Westin S 1997 Mechanisms of transcriptional activation by retinoic acid receptors. Biochem Soc Trans 25:602–605[Medline]
  7. Morriss-Kay GM, Ward SJ 1999 Retinoids and mammalian development. Int Rev Cytol 188:73–131[Medline]
  8. Spanjaard RA, Lee PJ, Sarkar S, Goedegebuure PS, Eberlein TJ 1997 Clone 10d/BM28 (CDCL1), an early S-phase protein, is an important growth regulator of melanoma. Cancer Res 57:5122–5128[Abstract/Free Full Text]
  9. Schadendorf D, Worm M, Jurgovsky K, Dippel E, Reichert U, Czarnetzki BM 1995 Effects of various synthetic retinoids on proliferation and immunophenotype of human melanoma cells in vitro. Recent Results Cancer Res 139:183–193[Medline]
  10. Rosenthal MA, Oratz R Phase 1998 II clinical trial of recombinant {alpha}2b interferon and 13 cis retinoic acid in patients with metastatic melanoma. Am J Clin Oncol 21:352–354[CrossRef][Medline]
  11. Sondak VK, Liu PY, Flaherty LE, Fletcher WS, Periman P, Gandara DR, Taylor SA, Balcerzak SP, Meyskens Jr FL 1999 A phase II evaluation of all-trans-retinoic acid plus interferon {alpha}-2a in stage IV melanoma: a Southwest Oncology Group study. Cancer J Sci Am 5:41–47[Medline]
  12. Morel Y, Barouki R 1999 Repression of gene expression by oxidative stress. Biochem J 342:481–496
  13. Spanjaard RA, Ikeda M, Lee PJ, Charpentier B, Chin WW, Eberlein TJ 1997 Specific activation of retinoic acid receptors (RARs) and retinoid X receptors reveals a unique role for RAR{gamma} in induction of differentiation and apoptosis of S91 melanoma cells. J Biol Chem 272:18990–18999[Abstract/Free Full Text]
  14. Spanjaard RA, Darling DS, Chin WW 1991 Ligand-binding and heterodimerization activities of a conserved region in the ligand-binding domain of the thyroid hormone receptor. Proc Natl Acad Sci USA 88:8587–8591[Abstract/Free Full Text]
  15. McKenna NJ, Xu J, Nawaz Z, Tsai SY, Tsai MJ, O’Malley BW 1999 Nuclear receptor coactivators: multiple enzymes, multiple complexes, multiple functions. J Steroid Biochem Mol Biol 69:3–12[CrossRef][Medline]
  16. Westin S, Rosenfeld MG, Glass CK 2000 Nuclear receptor coactivators. Adv Pharmacol 47:89–112
  17. Abate C, Patel L, Rauscher III FJ, Curran T 1990 Redox regulation of Fos and Jun DNA-binding activity in vitro. Science 249:1157–1161[Abstract/Free Full Text]
  18. Toledano MB, Leonard WJ 1991 Modulation of transcription factor NF-{kappa}B binding activity by oxidation-reduction in vitro. Proc Natl Acad Sci USA 88:4328–4332[Abstract/Free Full Text]
  19. Hayashi S, Hajiro-Nakanishi K, Makino Y, Eguchi H, Yodoi J, Tanaka H 1997 Functional modulation of estrogen receptor by redox state with reference to thioredoxin as a mediator. Nucleic Acids Res 25:4035–4040[Abstract/Free Full Text]
  20. Chance B, Sies H, Boveris A 1979 Hydroperoxide metabolism in mammalian organs. Physiol Rev 59:527–605[Free Full Text]
  21. Dang CV, Semenza GL 1999 Oncogenic alterations of metabolism. Trends Biochem Sci 24:68–72[CrossRef][Medline]
  22. Semenza GL 1999 Perspectives on oxygen sensing. Cell 98:281–284[CrossRef][Medline]
  23. Lotan R, Giotta G, Nork E, Nicolson GL 1978 Characterization of the inhibitory effects of retinoids on the in vitro growth of two malignant murine melanomas. J Natl Cancer Inst 60:1035–1041
  24. Liang X, Lu B, Scott GK, Chang CH, Baldwin MA, Benz CC 1998 Oxidant stress impaired DNA-binding of estrogen receptor from human breast cancer. Mol Cell Endocrinol 146:151–161[CrossRef][Medline]
  25. Silva CM, Cidlowski JA 1989 Direct evidence for intra- and intermolecular disulfide bond formation in the human glucocorticoid receptor. Inhibition of DNA binding and identification of a new receptor-associated protein. J Biol Chem 264:6638–6647[Abstract/Free Full Text]
  26. Hutchison KA, Matic G, Meshinchi S, Bresnick EH, Pratt WB 1991 Redox manipulation of DNA binding activity and BuGR epitope reactivity of the glucocorticoid receptor. J Biol Chem 266:10505–10509[Abstract/Free Full Text]
  27. Okamoto K, Tanaka H, Ogawa H, Makino Y, Eguchi H, Hayashi S, Yoshikawa N, Poellinger L, Umesono K, Makino I 1999 Redox-dependent regulation of nuclear import of the glucocorticoid receptor. J Biol Chem 274:10363–10371[Abstract/Free Full Text]
  28. Pemrick SM, Lucas DA, Grippo JF 1994 The retinoid receptors. Leukemia 8:1797–1806[Medline]
  29. Iwase H, Omoto Y, Iwata H, Hara Y, Ando Y, Kobayashi S 1998 Genetic and epigenetic alterations of the estrogen receptor gene and hormone independence in human breast cancer. Oncology 55:11–16
  30. Lin B, Chen GQ, Xiao D, Kolluri SK, Cao X, Su H, Zhang XK 2000 Orphan receptor COUP-TF is required for induction of retinoic acid receptor ß, growth inhibition, and apoptosis by retinoic acid in cancer cells. Mol Cell Biol 20:957–970
  31. Makishima M, Umesono K, Shudo K, Kishi K, Honma Y 1998 Induction of differentiation in acute promyelocytic leukemia cells by 9-cis retinoic acid {alpha}-tocopherol ester (9-cis tretinoin tocoferil). Blood 91:4715–4726[Abstract/Free Full Text]
  32. Allen RG 1991 Oxygen-reactive species and antioxidant responses during development: the metabolic paradox of cellular differentiation. Proc Soc Exp Biol Med 196:117–129[CrossRef][Medline]
  33. Castro-Obregon S, Covarrubias L 1996 Role of retinoic acid and oxidative stress in embryonic stem cell death and neuronal differentiation. FEBS Lett 381:93–97[CrossRef][Medline]



This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
U. Yokoyama, Y. Sato, T. Akaike, S. Ishida, J. Sawada, T. Nagao, H. Quan, M. Jin, M. Iwamoto, S. Yokota, et al.
Maternal vitamin A alters gene profiles and structural maturation of the rat ductus arteriosus
Physiol Genomics, September 11, 2007; 31(1): 139 - 157.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
Q. Ding, T. Jin, Z. Wang, and Y. Chen
Catalase potentiates retinoic acid-induced THP-1 monocyte differentiation into macrophage through inhibition of peroxisome proliferator-activated receptor {gamma}
J. Leukoc. Biol., June 1, 2007; 81(6): 1568 - 1576.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
Y. Kato, B. C. Salumbides, X.-F. Wang, D. Z. Qian, S. Williams, Y. Wei, T. B. Sanni, P. Atadja, and R. Pili
Antitumor effect of the histone deacetylase inhibitor LAQ824 in combination with 13-cis-retinoic acid in human malignant melanoma
Mol. Cancer Ther., January 1, 2007; 6(1): 70 - 81.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
R. K. Selvaraj and K. C. Klasing
Lutein and Eicosapentaenoic Acid Interact to Modify iNOS mRNA Levels through the PPAR{gamma}/RXR Pathway in Chickens and HD11 Cell Lines
J. Nutr., June 1, 2006; 136(6): 1610 - 1616.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. Kohrle, F. Jakob, B. Contempre, and J. E. Dumont
Selenium, the Thyroid, and the Endocrine System
Endocr. Rev., December 1, 2005; 26(7): 944 - 984.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
J. Santos-Guzman, T. Arnhold, H. Nau, C. Wagner, S. H. Fahr, G. E. Mao, M. A. Caudill, J. C. Wang, S. M. Henning, M. E. Swendseid, et al.
Antagonism of Hypervitaminosis A-Induced Anterior Neural Tube Closure Defects with a Methyl-Donor Deficiency in Murine Whole-Embryo Culture
J. Nutr., November 1, 2003; 133(11): 3561 - 3570.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Demary, K.
Right arrow Articles by Spanjaard, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Demary, K.
Right arrow Articles by Spanjaard, R. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals