Endocrinology Vol. 142, No. 6 2660-2668
Copyright © 2001 by The Endocrine Society
Molecular Cloning of Ovine and Bovine Growth Hormone-Releasing Hormone Receptors: The Ovine Receptor Is C-Terminally Truncated1
Reiko Horikawa2,
Bruce D. Gaylinn,
Charles E. Lyons, Jr. and
Michael O. Thorner
Division of Endocrinology and Metabolism, Department of Medicine,
University of Virginia Health System, Charlottesville, Virginia
22908
Address all correspondence and requests for reprints to: Bruce Gaylinn, Ph.D., Division of Endocrinology & Metabolism, UVa Health System Box 800746, Charlottesville, Virginia 22908.
 |
Abstract
|
|---|
To provide information about species differences in GH-releasing
hormone (GHRH) receptors useful for studies of receptor-ligand binding
properties and receptor function, we have cloned the ovine and bovine
pituitary GHRH receptors (GHRHRs). The ovine receptor (oGHRHR) was
cloned from a pituitary complementary DNA library and encodes a protein
that is similar to that of porcine, human, rat, and mouse with,
respectively, 84.3, 80.7, 75.9, and 74.0% amino acid identity.
Surprisingly, oGHRHR has a 16 amino acid truncation at its
carboxyl-terminal end when compared with GHRHRs from other known
mammals. RT-PCR using pooled pituitary RNA from a different population
of sheep could detect only truncated receptor. Bovine GHRHR (bGHRHR)
was cloned by RT-PCR and shows 92.5% amino acid sequence identity with
oGHRHR, but has no truncation. Genomic sequencing of the appropriate
region of goat receptor intron 13 showed that the caprine receptor
shares the same truncation seen in sheep. Photoaffinity cross-linking
of GHRH to ovine and bovine pituitary membranes confirms that the
native ovine pituitary GHRHR protein is smaller by the amount
predicted by the cloned sequences. The truncation did not affect GHRH
binding as oGHRHR, bGHRHR, human GHRHR, and human GHRHR, which was
truncated by site-directed mutagenesis to match the oGHRHR, all showed
comparable GHRH binding affinity when expressed in transfected cell
lines. In contrast, the ovine and truncated human receptors
demonstrated enhanced sensitivity for GHRH stimulation of cAMP (lowered
ED50) relative to hGHRHR and bGHRHR. This suggests that
this C-terminal domain acts to inhibit cAMP signaling possibly through
a role in receptor down regulation.
 |
Introduction
|
|---|
GH-RELEASING hormone (GHRH) acts on
somatotrophs in the pituitary through its own receptor. Human (1, 2), rat (1), mouse (3), and pig
(4) GHRH receptors (GHRHR) have been cloned and
characterized. Recently a GHRH-like receptor from goldfish has been
reported (5) and unpublished bovine GHRHR complementary
DNA (cDNA) sequence information has been submitted to GenBank
(Accession No. AF184896). This work has revealed that the GHRHR
belongs to a family of G protein-coupled seven transmembrane receptors
(family B) that includes receptors for secretin, PTH, calcitonin, VIP,
glucagon, GIP, CRF, and PACAP. This family has no significant sequence
similarity to the rhodopsin family (family A,) of G protein-coupled
receptors, which includes most of the known seven transmembrane
receptors. GHRHR has high affinity for GHRH [Kd
= 0.2 nM in human (2)] and has low cross
reactivity with structurally related peptides such as secretin, VIP,
and PACAP (1, 2, 3, 4).
Details of the molecular interaction of GHRH with its receptor are not
well understood. We have been characterizing receptor binding
properties and mapping receptor sites in close contact with bound GHRH
by photoaffinity cross-linking of labeled GHRH to receptor
(6) and analysis of the pattern of labeled proteolytic
cleavage peptides from the complex (7). In these studies,
ovine GHRHR protein was found to give different sized cleavage peptides
than human GHRHR. Identification of the ovine GHRHR sequence will allow
a more detailed interpretation of these data.
For further understanding of the binding properties and cellular
signaling mechanisms of GHRHR, and for use in studies of domestic
animals, we cloned the ovine pituitary GHRHR (oGHRHR). This sequence
revealed that oGHRHR was C-terminally truncated (lacking sixteen amino
acids) relative to other known mammalian GHRHRs. We therefore also
cloned bovine GHRHR to determine if this modification was present
in a more closely related species. Seeing no truncation in the bovine
receptor, we used genomic sequencing to show that the caprine receptor
did share the truncation. We examined ligand binding and cAMP signaling
in transfected cell lines to confirm that these clones were functional
and to investigate the role of the C-terminal domain in receptor
function.
 |
Materials and Methods
|
|---|
Materials
The ovine pituitary cDNA library was a gift from Dr. C. M.
Clay (Colorado State University). This library in the uni-ZAP XR
phagemid vector was constructed from the messenger RNA (mRNA) of a
single pituitary from an adult U.S. Western range ewe from Colorado
by oligo(dT) priming and unidirectional cloning (8). The
complexity was 4.5 x 105 independent
clones. [His1,Nle27]Human
GHRH-(132)-NH2 (GHRHa), human secretin, human
VIP, and PACAP-(138) were obtained from Peninsula Laboratories, Inc. (Belmont, CA). The random priming kit (Random Primed DNA
Labeling kit) was purchased from Roche Molecular Biochemicals (Indianapolis, IN); the Sequenase DNA sequencing
kit was from U.S. Biochemical (Cleveland, OH); and Rapid-Hyb
hybridization buffer and High-bond N nylon membranes were from
Amersham Pharmacia Biotech (Arlington Heights, IL). Total
RNA extraction kit was from Ambion, Inc. (Totally RNA kit;
Austin, TX); mRNA extraction kit was from Promega Corp.
(PolyA tract mRNA Isolation kit; Madison, WI); MulV RNA transcriptase
and Taq DNA polymerase (AmpliTaq) were from
Perkin-Elmer Cetus (GeneAmp RNA PCR kit; Norwalk, CT); Pfu
polymerase, pCR-Script cloning kit, pBK-CMV expression vector were from
Stratagene (La Jolla, CA), and the TA cloning kit was from
Invitrogen (San Diego, CA). Dye sequencing was performed
by Dye-Deoxy Terminator Cycle Sequencing kit and ABI Prism sequencer
(Perkin-Elmer Cetus). Ovine pituitaries were a gift from
Dr. Iain Clarke (Prince Henrys Institute of Medical Research,
Victoria, Australia). These were collected over several days from
various breeds that showed up at a slaughterhouse outside Melbourne
Australia. Bovine pituitaries were purchased from Pel-Freez Inc. (Brown
Deer, WI). Restriction enzymes and Geneticin (G418) were from
Life Technologies, Inc. (Gaithersburg, MD). All other
chemicals were obtained from Sigma (St. Louis, MO).
Cloning and sequence analysis of ovine GHRHR
pBluescriptII-KS+ plasmid vector containing full-length human
pituitary GHRHR cDNA (2) was digested with
EcoRI to cut out a 1073-bp fragment of the insert. The
restriction enzyme-treated material was run on a 1% agarose gel and
the separated nucleotides, -57 to 1016 of human GHRHR (the numbers
indicate the nucleotide position from start codon of coding region,
these nucleotides encode the protein from the signal peptide to the
middle of the transmembrane 6) was cut out from the gel, flash-frozen
in liquid nitrogen, centrifuged at 14,000 x g for 5
min, and the supernatant precipitated with ethanol in the presence of
salt. This human GHRHR fragment was then radiolabeled with
[
32P] deoxy-CTP to a specific activity of
2 x 109 dpm/µg using random priming
and used as a hybridization probe. As initial screens of 1.5 x
106 plaque forming units produced only
partial-length clones, we rescreened another 1.5 x
106 plaque forming units by PCR to identify
plates that included full length clones; phagemids on the plate were
washed out with SM buffer (5 ml/150 mm-dish), and this wash-out
solution was subjected to PCR using specific primers for human GHRHR
(5'-CCTGCGACCTGGGATGGGCTGCTGTGC-3'; human GHRHR 166192 and
5'-CCAATACTGAGACTGGGTATGGAGGCTGCC-3'; human GHRHR 975936). The PCR
conditions were: 94 C (1 min)/65 C (1.5 min)/72 C (2.5 min) x 35
cycles. One out of 34 plate wash-out solutions showed an amplified band
on an agarose gel, then this phagemid wash-out solution was plated for
a second screening with the hybridization probe using Rapid-Hyb
solution and nylon membrane with an annealing temperature of 65 C and
final washing at 65 C in a buffer containing 15
mM NaCl. From this screening, one full-length
clone (oGHRHR) was obtained and its sequence was analyzed by dideoxy
chain termination method and confirmed by thermal dye sequencing.
RT-PCR of mRNA from pooled ovine pituitary
Messenger RNA was prepared from six ovine pituitaries by
extraction of total RNA followed by preparation of mRNA. The
full-length GHRHR cDNA, reverse-transcribed from extracted mRNA, was
amplified by RT-PCR using Taq DNA polymerase and the primers
specific to 5'- and 3'- non coding region adjacent to the coding region
on both sides of ovine GHRHR (5'-GGCAGCAGTGACAACAGGGG-3') and
5'-CCATGGGACGCTGTGGAGGGTG-3') with the following PCR condition; 94 C (1
min)/63 C (1 min)/72 C (1.5 min) x 35 cycles. RT-PCR products
were then subcloned into the pCR2.1 vector and sequenced.
RT-PCR using a 3'-degenerate primer predicted to hybridize to the
missing nucleotides in ovine GHRHR was also performed to investigate
whether a longer (nontruncated) form of the GHRHR exists in sheep. A
degenerate reverse primer was chosen that matches the sequence of known
mammalian GHRHRs for the region that is deleted in the sheep
(5'-CACCCTCGAGCGGG[A/G]AGG[T/C][G/T]T, nucleotides 12481228 of
human GHRHR). This reverse primer was tested with each of two different
ovine-specific forward primers, the one in the ovine noncoding region
as used above and 5'-CTTTGAAGATGTTGCGTGCTGG-3' in the second
extracellular loop. Human GHRHR was used as a positive control for the
degenerate primer with forward primer 5'-CCTGCGACCTGGGATGGGCTGCTGTGC-3'
(human GHRHR 166192).
Cloning and sequence analysis of bovine GHRHR
Bovine GHRHR was amplified from mRNA from pooled bovine
pituitaries by RT-PCR using Taq DNA polymerase and the same
ovine primers specific to 5'- and 3'-non coding region adjacent to the
coding region on both sides of ovine GHRHR as described above. The PCR
product was sequenced, and a bovine-specific primer pair for
construction of a full-length clone was selected. The full-length
bovine GHRHR (bGHRHR) was then amplified by RT-PCR using high fidelity
Pfu polymerase and primers matching noncoding regions of the cDNA
(5'-GGCAGCAGTGACAACAGGGGACAG-3' and 5'-CCAGGTAGCTGCCCAAGTTCAGGT-3')
with PCR condition of 95 C (1 min)/60 C (1 min)/74 C (3.5 min) x
35 cycles. The PCR product was subcloned into the SrfI site of
pCR-Script vector.
Construction of human truncated GHRHR
A human GHRHR mutant (htrGHRHR) with a 3'-truncation at the same
place as oGHRHR was constructed by PCR. Wild-type human GHRHR in
pBluescript plasmid was amplified by PCR using pfu
polymerase with primers 5'-CTGAGGCTGGTGGAGGGAGCCA-3' (human -3615)
and 5'- GTGGT1T1CACTTAGCACGGGTCCTCCAG-3' (human 12291203, 1T1 =
single nucleotide change that introduces a stop codon as found in the
sheep). The PCR product was gel-purified and subcloned into pCR-Script
vector and the whole nucleotide sequence was determined by dye cycle
sequencing.
Genomic sequencing
Genomic DNA was prepared from a blood sample from a domestic
goat and from frozen bovine tissue (Pel-Freez) using DNAzol-BD and
DNAzol, respectively, and following manufacturers directions (MRC
Inc., Cincinnati, OH).
Five PCR primers were picked to match conserved regions within GHRHR
intron 13: two forward, 1) GTGAGGACTGAGATCTCACGGAGATGGCA; and 2)
GGCCACGATCCTGAACTTCTGCCAGCCCG); and three reverse: 3)
GACAGGAAAGAAGTGCTGGGTGGAAGCATG; 4) GCTCCCATGGGACGCTGTGGAGGGTGGTAG; and
5) TAGCTGCCCAAGTTCAGGTGTGGGCTCCAG.
All six possible different primer pairs (1/3, 1/4, 1/5, 2/3, 2/4, 2/5)
were used to amplify each of three templates: ovine cDNA, caprine
genomic DNA and bovine genomic DNA (0.11 µg genomic DNA/50 µl
reaction). PCR amplification used 35 cycles of 94 C for 30 sec, 60 C
for 30 sec and 72 C for 60 sec. Agarose gel electrophoresis showed that
each primer set gave one clean band with each species. The six products
from the caprine template (ranging from 132 to 232 bp, see Fig. 3
) were
each cloned without purification into the pTarget vector (Promega Corp.) and dye cycle sequenced.

View larger version (61K):
[in this window]
[in a new window]
|
Figure 3. GHRHR exon 13 PCR products from caprine genomic
DNA. Ethidium stained 1.2% agarose gel. Lane 1, 100 bp ladder
(New England Biolabs, Inc., Beverly, MA). Lane 2, Blank.
Lanes 38, Primer pairs 1/5, 1/4, 1/3, 2/5, 2/4, 2/3 (see
Materials and Methods). Lane 9, Unrelated cDNA template
positive control. Lane 10, No template negative control.
|
|
Expression, binding assays, and cAMP measurements
The KpnI/SacI fragments of oGHRHR cDNA in
pBluescript and HtrGHRHR in pCR-Script were cloned into the
KpnI/SacI site of the mammalian expression vector
pBK-CMV. HEK (human embryonic kidney) 293 cells were stably transfected
with oGHRHR/pBK-CMV or HtrGHRHR/pBK-CMV constructs (20 µg plasmid DNA
per 5 x 105 cells in a 150 mm-dish by the
CaCl2 and low pH method described by Chen and
Okayama (9). The NotI/EcoRI fragment
of bGHRHR cDNA in pCR-Script was also cloned into the
NotI/EcoRI site of pBK-CMV and the bGHRHR/pBK-CMV
construct was transfected into HEK293 cells by the method described
above. Transfected cells were selected in 400 µg/ml G418 and
maintained under continuous selection for more than 4 weeks before use
in the binding and cAMP studies.
The GHRH binding assay we have previously described (6) is
presented here briefly. Cell monolayers were rinsed three times with 5
ml PBS. The cells were scraped into 5 ml PBS and centrifuged. They were
then resuspended and homogenized in a HEPES buffered saline with 10
mM EDTA and protease inhibitors. After centrifugation at
10,000 x g, the upper, membrane layer of the pellets
was resuspended in binding buffer (Tris buffered with 5
mM MgCl2), incubated with
[His1,125I-Tyr10,
Nle27]HumanGHRH-(132)-NH2
(125I-GHRHa, 100,000 cpm/0.5 ml incubation
volume) with or without increasing amounts of ovine GHRH or GHRHa at
room temperature for 1 h. The membranes were then pelleted, and
the pellets were counted in a
-counter. The data were adjusted for
the GHRH probe concentration and analyzed by nonlinear least squares
fitting to mathematical binding competition models using the computer
program GraphPad Prism (GraphPad Software, Inc., Oberlin, OH). In stably transfected cell lines 7585% of
the total bound counts can be displaced with cold GHRH. Calculations
give receptor densities of 90 to 200 fmol/mg crude membrane
protein.
For cAMP assays, cells were removed from 150-mm culture dishes and
replated into 24-well cluster plates (Coster, Cambridge, MA) at 200,000
cells/well for 24 h before testing. Cells were incubated at 37 C
with 1 mM isobutylmethylxanthine (IBMX) for 20 min without
serum. Hormones were added in fresh warmed media, and plates were
incubated for an additional 15 min at 37 C. The medium was then
aspirated, plates were frozen in a -70 C freezer, and cells were
extracted with 100 mM HCl. cAMP levels in cell lysates were
measured by previously described methods (2, 10).
In addition, COS-1 cells were used for transient transfections.
oGHRHR was transfected to COS-1 cells by the
2-(diethyl-amino-ethyl) (DEAE)-Dextran method, as previously described
(11). Forty-eight hours post transfection the membrane
fraction of the transfected cells was prepared as described below for
the photoaffinity cross- linking study.
Photoaffinity cross-linking study
Photoaffinity cross-linking was performed to determine the size
of the receptor protein in native ovine pituitary membranes and in COS
cells transfected with oGHRHR, or HtrGHRHR. Photoprobe was prepared and
used as described previously (6). Briefly, GHRHa was
coupled to the photoaffinity cross-linker NHS-ASA (Pierce Chemical Co., Rockford, IL) and iodinated. The
[125I](NHS-ASA)-GHRH derivative was then HPLC
purified to obtain high specific activity. GHRH photoaffinity probe
binding was then assayed in membrane pellets. The ligand-receptor
complex was solubilized from these pellets with 5 mM
3-[(3- cholamidopropyl) dimethylammonio]-1-propane sulfonate (CHAPS).
The CHAPS extracts were photolyzed with log wave UV light for 10 min.
Samples were chloroform-methanol precipitated, resuspended in
SDS-sample buffer, electrophoresed in 10 or 12.5% acrylamide SDS gels
and autoradiographed.
 |
Results
|
|---|
Isolation and sequence analysis of ovine GHRHR cDNA clone
After screening 3 x 106 plaque-forming
units, we obtained three different clones that encoded oGHRHR. Only one
clone encoded full-length receptor and was further analyzed. The other
two clones were both partial-length GHRHR that lacked the 5'-end of the
coding region. The cloned full-length cDNA encoded 407 amino acids,
which was 16 amino acids shorter than the GHRHR of other known
mammalian species (Fig. 1
, GenBank
Accession No. AY008834). Nucleotide alignments revealed that ovine
GHRHR had a premature stop codon (Trp408 to stop codon) and an 11
nucleotide deletion near the 3'-end of the coding region (Figs. 1
and 2A
). Nucleotide identities with pig,
human, rat, and mouse GHRHRs, and human PACAP, VIP, and secretin
receptors were 88.8, 83.7, 79.1, 78.5, 59.9, 58.9, and 57.7%,
respectively. An amino acid alignment is shown in Fig. 1
, and the
percent identity with these and other similar receptors is presented in
Table 1
.

View larger version (82K):
[in this window]
[in a new window]
|
Figure 1. Amino acid alignment of GHRH receptors. The
full-length ovine pituitary GHRHR was cloned from a pituitary cDNA
library and its sequence confirmed by RT-PCR from pooled pituitaries.
It encodes 407 amino acids, which is 16 residues shorter than GHRHRs of
the other species. These 16 residues are underlined.
Predicted transmembrane spanning domains TM1TM7 are shown
boxed and in bold. Hollow
arrowhead, Putative signal peptide cleavage site; filled
arrowhead, putative glycosylation site; hollow
arrow, site of retained intron in one RT-PCR clone;
filled arrows, potential phosphorylation sites not
present in the ovine sequence; *, stop codon.
|
|

View larger version (43K):
[in this window]
[in a new window]
|
Figure 2. RT-PCR analysis of ovine pituitary GHRHR mRNA. A,
Primer map and C-terminal receptor nucleotide sequence. Ovine GHRHR had
a premature stop codon (tgg to tga; 408W to stop codon) and an 11
nucleotide deletion (dots) in 3'-end of the coding
region, when compared with GHRHR of the other species. To test if any
mRNA without the deletion was present we employed RT-PCR with a
3'-degenerate primer designed to hybridize with the deleted sequence in
related species. No ovine mRNA without the deletion was detected.
Positive controls showed amplified products of the expected sizes
confirming that the primers are functional. Products from RT-PCR
reactions a-e are shown and describes below. B and C, Agarose gel
electrophoresis of RT-PCR products. B, Lane 1; DNA size markers, lane
2; RT-PCR product from pooled ovine pituitary RNA. This product
includes the full coding region of the oGHRHR and was cloned and
sequenced as described in the text. C, Lane 1; DNA size markers, lane
2; Positive control for forward ovine primer (product c in cartoon),
lane 3; PCR with forward ovine primer and degenerate primer to match
deletion (product d in cartoon). No RNA matching the deletion is
detected. Lane 4; PCR positive control for the forward ovine primer
(upper band is product a in cartoon). Lane 5; PCR with
forward ovine primer and degenerate primer to match deletion (product b
in cartoon). No RNA matching the deletion is detected. Lane 6; PCR with
human GHRHR cDNA as a positive control for the degenerate primer (using
a human-specific forward primer, product e in cartoon). PCR conditions
are given in text.
|
|
RT-PCR cloning of ovine GHRHR
To determine whether our oGHRHR clone isolated from the cDNA
library truly represents the GHRHR expressed in sheep pituitary, GHRH
receptor sequence was amplified by RT-PCR from an independent
(Australian) source of pooled ovine pituitary RNA. The PCR product
appeared as one major band on 1% agarose gels (Fig. 2B
, lane 2). The
RT-PCR products were subcloned into pCR2.1 vector and sequenced. Two
distinct cDNAs that encoded GHRH receptor were obtained (RT-PCR clone 1
and 2). RT-PCR clone 1 had the expected sequence, exactly matching the
ovine library clone but with three scattered nucleotide substitutions
that do not cause changes in the encoded amino acid sequence. Clone 2
had a 90 nucleotide insert (retained intron) in the region encoding
transmembrane 5 at the position of the exon-intron 9 boundary (Fig 1
).
This insert includes stop codons. This sequence could represent an
alternatively spliced mRNA that would encode a severely shortened form
of ovine GHRHR or could represent an incompletely processed
message.
RT-PCR with degenerate primers
To test the hypothesis that small amounts of full-length ovine
GHRHR message could be present in ovine pituitary, we used RT-PCR with
a 3'-degenerate primer designed to match the deleted nucleotides in the
cloned receptor sequence (Fig. 2A
). The degenerate primers to this
region did not amplify ovine pituitary cDNA (Fig. 2C
, lanes 3 and 5)
but gave the expected product with human GHRHR (lane 6). As positive
controls to confirm the function of the ovine specific 5'-primers,
3'-primers specific to ovine sequence were used with these 5' primers,
and RT-PCR of ovine pituitary mRNA showed the expected product (Fig. 2C
, lanes 2 and 4). Thus, only the mRNA encoding the 407 amino acid
GHRHR was found and no evidence of a 423 amino acid form could be
detected in sheep by either our library cloning or PCR cloning methods
or even with a degenerate PCR approach specifically aimed at the
missing nucleotides found in other GHRHRs.
RT-PCR cloning of bovine GHRHR
Bovine GHRHR cloned by RT-PCR methods (bGHRHR) encoded 423 amino
acids and had no truncation at the carboxy-terminal (GenBank Accession
No. AY008835). Compared with oGHRHR, bGHRHR had 96.5% nucleotide
identity and 92.5% amino acid sequence identity (Fig. 1
).
Analysis of bovine and caprine genomic DNA
The size of PCR products from amplification of exon 13 of bovine
and caprine genomic GHRHR DNA were compared with those from ovine cDNA
using agarose gels. As expected, the bovine products were larger than
those from sheep, consistent our previous results showing the 11-bp
deletion that causes the ovine truncation. The ovine and caprine
products were not distinguishable in size and so the caprine products
(shown in Fig. 3
) were sequenced to test
if they contained the previously characterized deletion and to confirm
that they were not the result of contamination with the wrong template.
The caprine genomic sequence included the identical deletion seen in
the ovine cDNA but also demonstrated specific sequence differences
proving that it was unique and different from the ovine. In the 174-bp
region sequenced, ovine and bovine receptors are 6.9% different. The
new caprine sequence was 8.1% different from bovine and 2.3%
different from ovine. The caprine exon 13 sequence included 4
nucleotide differences from the ovine which were confirmed in each of 4
to 6 sequencing reactions from 6 independent PCR products. As the
majority of the region sequenced is after the stop codon, these
ovine/caprine sequence differences do not represent amino acid
changes.
Photoaffinity cross-linking studies
Photoaffinity cross-linking was performed to compare the size of
the native receptors in ovine and bovine pituitary membranes, and in
cells expressing the cloned ovine, human wild-type, and human truncated
GHRHRs (Figs. 4
and 5
). GHRH photoprobe cross-linking to the
GHRHR was not seen in nontransfected cells and in the presence of
receptor was completely competed by 10 nM unlabeled GHRH
(Fig. 5
). Figure 4A
demonstrates that the endogenous receptors in ovine
and bovine pituitary differ slightly in gel mobility and this
difference is maintained after complete deglycosylation. Figure 4B
shows that this same mobility difference is seen when human GHRHR
(hGHRHR) is compared with human receptor truncated to match the ovine
sequence (htrGHRH). In a previous publication that examined GHRH
receptor protein purification, we reported that endogenous ovine and
bovine receptors appeared to differ by about 2 kDa in size
(12). Consistent with this, the sequences reported here
predict a difference of 1.8 kDa. Figure 5
shows that when run on higher
percentage gels the native ovine pituitary receptor appears as two or
more bands in the 5060 kDa range. N-glycosidase treatment
demonstrates that these bands are not due to the expression of
different receptor messages but are caused by variations in
glycosylation (Fig. 5A
, lane 2).

View larger version (59K):
[in this window]
[in a new window]
|
Figure 4. Photoaffinity cross-linking to native, recombinant
and truncated GHRHRs. Autoradiographs of 7.5% SDS polyacrylamide gels
of samples cross-linked with 125I-hGHRH photoprobe with and
without N-glycosidase treatment. A, Native receptors in
pituitary membranes. Lanes 1 and 2: ovine pituitary. Lanes 3 and 4,
Bovine pituitary. The observed receptor protein mobility differences
match that expected from the cloned cDNA sequences. B, Recombinant
hGHRHR with and without truncation. Lanes 1 and 2, hGHRHR. Lanes 3 and
4, htrGHRHR. The observed receptor protein mobility differences mirror
those seen in Fig. 4A and fit that expected from the cDNA sequences.
|
|

View larger version (70K):
[in this window]
[in a new window]
|
Figure 5. Photoaffinity cross-linking to native and
recombinant oGHRHR. Autoradiographs of 10% SDS polyacrylamide gels
of samples cross-linked with 125I-hGHRH photoprobe. A,
Ovine pituitary membranes. Lane 1, Ovine pituitary. Lane 2, After
N-glycosidase treatment. Lane 3, Cross-linking in the
presence of 10 nM unlabeled hGHRH. B: Lanes 1 and 2, Ovine
pituitary. Lanes 3 and 4, Recombinant oGHRHR. Lanes 5 and 6,
Nontransfected HEK293 cells. The second lane of each pair (lanes 2, 4,
and 6) was cross-linked in the presence of 10 nM unlabeled
hGHRH.
|
|
GHRH binding studies
Specific binding of 125I-GHRHa (a 32 amino
acid human analog stabilized against methionine oxidation) to crude
membrane fractions from cell lines expressing recombinant receptors or
from ovine pituitary were examined (Figs. 6
and 7
).
Computerized nonlinear regression fitting to a single binding site
model resulted in calculated dissociation constants (with 95%
confidence limits) for GHRH on oGHRHR, bGHRHR, hGHRHR, htrGHRHR, or
ovine pituitary membranes of 0.448 (0.250.80), 0.392
(0.280.54), 0.280 (0.180.44), 0.300 (0.210.42), or 0.310
(0.260.37), respectively. Stable cell lines used had receptor
expression levels within a factor of 2.5. None of these receptors had
binding affinities that were statistically different. Vector
transfected control cells did not show specific binding.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 6. Binding of 125I-hGHRH to crude
membrane preparations was competed by increasing amounts of unlabeled
hGHRH. Data for each preparation are shown together with their computer
generated best-fit curves to a single binding site model. Expression
levels in these stable cell lines differed within a factor of two, but
were normalized to allow a visual comparison of binding affinities,
which were statistically indistinguishable. Vector transfected controls
done in parallel showed no specific binding. Data are shown as
mean ± SE. All experiments were performed in at least
triplicate.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
Figure 7. Binding was analyzed as in Fig. 6 , but with hGHRHR
and htrGHRHR transfected HEK293 stable cell lines examined in parallel.
Expression of hGHRHR binding sites (Bo) was 1.5-fold
greater than htrGHRHR but were normalized to demonstrate the similarity
of the binding affinities.
|
|
Specificity of ovine GHRHR
The binding and signaling response of the ovine receptor to other
peptides homologous to GHRH was examined. The binding of
125I-GHRHa at the recombinant oGHRHR was competed
by ovine or human GHRH in a dose dependent manner, but not by secretin,
VIP, or PACAP at up to 100 nM (with a small but not
statistically significant effect from PACAP at the highest dose, data
not shown). Consistent with this, cAMP signaling at the oGHRHR was
activated by sub nanomolar levels of GHRH, not by 100 nM
VIP and only slightly by 100 nM PACAP (data not shown).
This slight cross-reactivity with 100 nM PACAP has been
previously reported for the hGHRHR (2). These data confirm
that the cloned oGHRHR has the specificity expected of a GHRHR.
GHRH stimulated cAMP signaling at wild-type GHRHR
GHRH stimulated intracellular cAMP accumulation in HEK293
expressing oGHRHR and bGHRHR were examined together (Fig. 8
) and analyzed by computer fitting to a
simple (no cooperativity), single site dose-response model. The
EC50s for cAMP response (with 95% confidence
intervals) in these transfected HEK293 cells were 0.991 (0.511.9) and
11.5 (9.114.7) nM, respectively (Fig. 8
). Though these
exact numbers varied in different runs and with details of the assay
conditions, within the same run the oGHRHR consistently showed an
EC50 that was significantly lower than that of
bGHRHR or hGHRHR.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 8. cAMP formation in response to hGHRH at ovine GHRHR
(oGHRHR) and bovine GHRHR (bGHRHR) receptor transfected stable HEK293
cell lines. Data are shown as mean ± SE.
|
|
Effects of truncation on GHRH binding and cAMP signaling
The cloned oGHRHR was able to stimulate cAMP signaling at lower
levels of GHRH than we had seen with the hGHRHR or bGHRHR. This
suggested that the truncation might be potentiating cAMP signaling, but
other differences in the receptors could be responsible for this
effect. To test the hypothesis that the truncation caused the
potentiation, we truncated the human receptor to match the oGHRHR and
compared it side by side with the wild-type human receptor. Figure 7
shows that the truncation had no detectable effect on GHRH binding.
Figure 9
shows that the
EC50 (with 95% confidence intervals) for
stimulation of cAMP accumulation was changed from 3.45 (2.45.0)
nM for the wild-type hGHRHR to 0.313 (0.180.52)
nM for htrGHRHR. The cAMP measurements were adjusted for
differences in live cell number by normalizing for the maximal
isoproterenol response in matched wells. As before, these
EC50s varied from run to run, but within a run
the htrGHRHR was consistently more sensitive to GHRH stimulation by
from 11- to 50-fold. This suggests that the truncation alone is
sufficient to explain the EC50 difference between
ovine and human receptor.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 9. cAMP formation in response to hGHRH at human GHRHR
(hGHRHR) and truncated hGHRHR (htrGHRHR) receptor transfected HEK293
stable cell lines. Data are shown as mean ± SE. Data
were normalized to the isoproterenol response in parallel wells to
adjust for the number of live cells. The leftward shift (decreased
ED50) seen in the truncated receptor mirrors the difference
seen between oGHRHR and bGHRHR in Fig. 8 .
|
|
 |
Discussion
|
|---|
In this study we have cloned ovine GHRHR from a pituitary cDNA
library from an adult ewe. Amino acid sequence comparisons were made
between the ovine clone (oGHRHR) and human, porcine, rat or mouse
GHRHRs, as well as human PACAP, VIP, and secretin receptors. The high
percentage of identity between oGHRHR and GHRHR of the other species
strongly suggest that this cloned receptor is the ovine counterpart to
the known GHRHRs. The receptor was then characterized for GHRH binding
and signaling and specificity for GHRH over related peptides. This
confirmed that it is a functional GHRHR. oGHRHR was unique in that it
lacked the last 16 amino acids when compared with GHRHRs from other
mammals (407 vs. 423 amino acids). The truncation was caused
by the change in tryptophan 408 to a stop codon (TGG to TGA). This was
followed by an 11 nucleotide deletion, after which the sequence which
would have encoded the conserved C-terminal end of the protein began
again (Fig. 2A
). RT-PCR from pooled sheep pituitaries from a different
source confirmed the shorter 407 amino acid sequence found in the ovine
cDNA library. As Northern blotting suggests that alternative forms of
receptor message could be present (1, 2, 3), we used RT-PCR
specifically aimed at the deleted sequence and found that we could
detect no trace of the 423 amino acid form of the receptor in
sheep.
To study evolutionary changes in GHRHR and to see if a more closely
related species would share this truncation, we also cloned bovine
GHRHR. Bovine GHRHR cloned by RT-PCR (bGHRHR) had over 90% identity in
nucleotide and amino acid sequence with that of oGHRHR, however it was
not truncated. This led us to sequence the crucial region of caprine
genomic DNA, which showed that goats and sheep share the identical
truncation.
Photoaffinity cross-linking showed that the major functional GHRHR
protein in sheep pituitary membranes was smaller than that in bovine
pituitary by the amount predicted by the cloned sequences. When hGHRHR
was truncated to match the oGHRHR, photoaffinity cross-linking to the
recombinant receptors confirmed that the truncation is sufficient to
explain the observed mobility difference. This demonstrates that the
407 amino acid form of the receptor is the major and probably the only
pituitary GHRHR in sheep.
Despite its truncation, ligand binding at the ovine receptor was not
different from that at wild-type human and bovine GHRHRs. The same
truncation when introduced into the human GHRHR also did not alter
ligand binding. In contrast, the truncated receptors (oGHRHR and
htrGHRHR) displayed enhanced cAMP signaling. The maximal amount of cAMP
produced relative to the maximal isoproterenol response was not
different (possibly indicating a saturating, on or off effect or a
limitation of our assay), but the dosage of GHRH required to achieve
this maximal response was decreased with the truncation.
In general, the extracellular amino-terminus, extracellular loops
and/or transmembrane domains of G protein-coupled receptors are thought
to be involved in ligand binding, while the intracellular loops and
intracellular carboxy-terminus are involved in G protein coupling and
signal transduction (13). There are several possible
mechanisms through which this ovine truncation could effect signaling.
This C-terminal region of the receptor can be directly or indirectly
involved in G protein coupling (14, 15) and ß-arrestin
interactions (16). The truncation also removes a potential
site for palmitoylation that could be involved in receptor down
regulation (17, 18). However, the most likely mechanism is
suggested by the 6 potential phosphorylation sites this truncation
removes. Many receptors are known to have C-terminal phosphorylation
sites that function in agonist-induced down regulation through a
pathway involving a family of receptor-specific kinases (GRKs),
ß-arrestin, and internalization via clathrin coated vesicles
(19). Though many variations on this theme are known,
removal of C-terminal phosphorylation sites often inhibits receptor
down-regulation (20). In addition, heterologous
down-regulation not involving receptor agonist or GRKs can also act
through receptor phosphorylation (21).
Among the family B receptors, several (15, 22, 23, 24)
including hGHRHR (25) have specifically been shown to
display agonist-induced C-terminal phosphorylation and down regulation.
C-terminal truncations of the calcitonin receptor inhibited
internalization and could also increase receptor affinity
(26). At the PTH receptor, C-terminal truncation could
increase receptor affinity (14) and phosphorylation was
not required for internalization (22). Also at the PTH
receptor, binding of a receptor-specific kinase was able to inhibit
signaling in a phosphorylation independent manner (27).
Studies of the secretin receptor suggest that the major pathway for
internalization is phosphorylation independent, but phosphorylation
interferes with G protein coupling (15). For the PACAP
receptor the proximal part of the C-terminal tail appears to be needed
for G protein coupling while the distal part is involved in
internalization (28). Studies of the glucagon and GIP
receptors showed that the C-terminal tail was not required for binding
or signaling, but its removal inhibited receptor endocytosis (29, 30).
Thus, while the details of the mechanism differ even in closely related
receptors, the general theme is that the distal part of the receptor
tail includes conserved serine and threonine residues that undergo
agonist-induced phosphorylation and can be key to down regulation
through internalization and/or G protein uncoupling. This is consistent
with our results demonstrating that this domain, which is missing in
the oGHRHR, is inhibitory to cAMP signaling. Specific details of the
mechanism of this inhibition are yet to be established.
Because this truncation might be expected to bias an animal toward a
subtly increased endogenous GH, its discovery in domestic sheep leads
to the speculation that this mutation could be a recent consequence of
domestication and breeding that selected for meat, milk and wool
production. To test this hypothesis, we examined the receptor sequences
in cow and goat, two other species in the mammalian family bovidae
(order artiodactyla). Because goats and sheep were found to share the
identical truncation while cows do not, we conclude that this change
occurred millions of years ago after the divergence of the subfamilies
bovinae and caprinae but before the divergence of the genera ovis and
capra (sheep and goats). The physiological significance of this altered
receptor and its distribution among the 10 genera within the subfamily
caprinae remains to be studied.
In conclusion, we have cloned ovine and bovine pituitary GHRHRs. The
ovine receptor has a unique truncation on its carboxy-terminal tail.
This truncation did not affect ligand binding but caused a leftward
shift (lower EC50) in the GHRH dose-response
curve for cAMP activation in cell lines expressing these receptors.
This increased sensitivity to GHRH was reproduced when human receptor
was truncated to match the ovine sequence. These data suggest that this
C-terminal receptor domain does not effect ligand binding affinity but
acts to inhibit cAMP signaling, possibly through receptor
phosphorylation and uncoupling or internalization.
 |
Acknowledgments
|
|---|
The authors express sincere thanks to Drs. Colin M. Clay and
Iain Clarke for supplying critical reagents and to Dr. Kevin R. Lynch,
Dr. Christian Strasburger, Dr. Monica Skinner, Hsienwie Lu, Izumi
Kobayashi and Arvilla Mastromarino for their technical help and
stimulating discussions. We would also like to acknowledge the
technical support of the Center for Cellular and Molecular Studies in
Reproduction (NIH P30-HD28934), the UVa Biomolecular Research Facility,
and the Pratt Fund.
 |
Footnotes
|
|---|
1 This work was supported by NIH Grant R-01-DK-45350 (to B.D.G.). The
GenBank Accession Numbers for ovine and bovine GHRH receptor cDNA are
AY008834 and AY008835, respectively. A part of this work was presented
at 10th International Congress of Endocrinology (78th Endocrine Society
meeting) (Abstract P1619). 
2 Current address: Division of Endocrinology and Metabolism, National
Childrens Hospital, 335-31 Taishido, Setagaya-ku, Tokyo 154-8509,
Japan. 
Received September 26, 2000.
 |
References
|
|---|
-
Mayo KE 1992 Molecular cloning and expression
of a pituitary-specific receptor for growth hormone-releasing hormone.
Mol Endocrinol 6:17341744[Abstract/Free Full Text]
-
Gaylinn BD, Harrison JK, Zysk JR, Lyons CE, Lynch KR,
Thorner MO 1993 Molecular cloning and expression of a human
anterior pituitary receptor for growth hormone-releasing hormone. Mol
Endocrinol 7:7784[Abstract/Free Full Text]
-
Lin C, Lin S-C, Chang C-P, Rosenfeld MG 1992 Pit-1-dependent expression of the receptor for growth hormone releasing
factor mediates pituitary cell growth. Nature 360:765768[CrossRef][Medline]
-
Hsiung HM, Smith DP, Zhang X-Y, Bennett T, Rosteck Jr
PR, Lai M-H 1993 Structure and functional expression of
complementary DNA for porcine growth hormone-releasing hormone
receptor. Neuropeptide 25:110[CrossRef][Medline]
-
Chan KW, Yu KL, Rivier J, Chow BK 1998 Identification and characterization of a receptor from goldfish
specific for a teleost growth hormone-releasing hormone-like peptide.
Neuroendocrinology 68:4456[CrossRef][Medline]
-
Gaylinn BD, Lyons CE, Zysk JR, Clarke IJ, Thorner
MO 1994 Photoaffinity cross-linking to the pituitary receptor for
growth hormone-releasing factor. Endocrinology 135:950955[Abstract]
-
Gaylinn BD, Lyons CE, Thorner MO New GHRH analogs
for mapping the GHRH receptor binding site by photoaffinity
crosslinking. 4th International Pituitary Congress, San Diego CA, 1996 (Abstract)
-
Turzillo AM, Campion CE, Clay CM, Nett TM 1994 Regulation of gonadotropin- releasing hormone (GnRH) receptor messenger
ribonucleic acid and GnRH receptors during the early preovulatory
period in the ewe. Endocrinology 135:13531358[Abstract]
-
Chen C, Okayama H 1987 High-efficiency
transformation of mammalian cells by plasmid DNA. Mol Cell Biol 7:27452752[Abstract/Free Full Text]
-
Juppner H, Abou-Samra A-B, Freeman M, Kong X-F, Schipani
E, Richards J, Kolakowski LF, Hock J, Potts Jr JT, Kronenberg HM, Segre
GV 1991 A G protein-linked receptor for parathyroid
hormone-related peptide. Science 254:10241026[Abstract/Free Full Text]
-
Cullen BR 1987 Use of eukaryotic expression
technology in the functional analysis of cloned genes. Methods Enzymol 152:684704[Medline]
-
Zysk JR, Gaylinn BD, Lyons CE, Johnson B, Eppler CM,
Baumbach WR, Thorner MO 1996 Purification of the growth hormone
releasing hormone (GHRH) receptor with a C-terminal, biotinylated
affinity ligand. Biochem Biophys Res Commun 221:133139[CrossRef][Medline]
-
Strader CD, Fong TM, Tota MR, Underwood D 1994 Structure and function of G protein-coupled receptors. Annu Rev Biochem 63:101132[CrossRef][Medline]
-
Iida-Klein A, Guo J, Xie LY, Juppner H, Potts Jr JT,
Kronenberg HN, Bringhurst FR, Abou-Samara AB, Segre GV 1995 Truncation of the carboxyl-terminal region of the rat parathyroid
hormone (PTH)/PTH-related peptide receptor enhances PTH stimulation of
adenylyl cyclase but not phopholipase C. J Biol Chem 270:84588465[Abstract/Free Full Text]
-
Holtmann MH, Roettger BF, Pinon DI, Miller LJ 1996 Role of receptor phosphorylation in desensitization and internalization
of the secretin receptor. J Biol Chem 271:2356623571[Abstract/Free Full Text]
-
Zhang J, Ferguson SS, Barak LS, Aber MJ, Giros B,
Lefkowitz RJ, Caron MG 1997 Molecular mechanisms of G
protein-coupled receptor signaling: role of G protein-coupled receptor
kinases and arrestins in receptor desensitization and resensitization.
Receptors Channels 5:193199[Medline]
-
Loisel TP, Ansanay H, Adam L, Marullo S, Seifert R,
Lagace M, Bouvier M 1999 Activation of the ß(2)-adrenergic
receptor-G
(s) complex leads to rapid depalmitoylation and inhibition
of repalmitoylation of both the receptor and Galpha(s). J Biol
Chem 274:3101431019[Abstract/Free Full Text]
-
Palmer TM, Stiles GL 2000 Identification of
threonine residues controlling the agonist-dependent phosphorylation
and desensitization of the rat A(3) adenosine receptor. Mol Pharmacol 57:539545[Abstract/Free Full Text]
-
Pitcher JA, Freedman NJ, Lefkowitz RA 1998 G
protein-coupled receptor kinases. Annu Rev Biochem 67:653692[CrossRef][Medline]
-
Bouvier M, Hausdorff WP, De Blasi A, ODowd BF, Kobilka
BK, Caron MG, Lefkowitz RJ 1988 Removal of phosphorylation sites
from the ß2-adrenergic receptor delays onset of agonist-promoted
desensitization. Nature 333:370373[CrossRef][Medline]
-
Hipkin RW, Wang Y, Schonbrunn A 2000 Protein kinase
C activation stimulates the phosphorylation and internalization of the
sst2A somatostatin receptor. J Biol Chem 275:55915599[Abstract/Free Full Text]
-
Malecz N, Bambino T, Bencsik M, Nissenson RA 1998 Identification of phosphorylation sites in the G protein-coupled
receptor for parathyroid hormone. Receptor phosphorylation is not
required for agonist-induced internalization. Mol Endocrinol 12:18461856[Abstract/Free Full Text]
-
Nygaard SC, Kuestner RE, Moore EE, Stroop SD 1997 Phosphorylation of the human calcitonin receptor by multiple kinases is
localized to the C-terminus. J Bone Miner Res 12:16811690[CrossRef][Medline]
-
McDonald TP, Dinnis DM, Morrison CF, Harmar AJ 1998 Desensitization of the human vasoactive intestinal peptide receptor
(hVIP2/PACAP R): evidence for agonist-induced receptor phosphorylation
and internalization. Ann NY Acad Sci 865:6472[CrossRef][Medline]
-
Gaylinn BD, Lyons Jr CE, Thorner MO
Internalization and phosphorylation of GHRH receptor. Program of the
80th Annual Meeting of The Endocrine Society, New Orleans, LA, 1998, p
298 (Abstract)
-
Findlay DM, Houssami S, Lin HY, Myers DE, Brady CL,
Darcy PK, Ikeda K, Martin TJ, Sexton PM 1994 Truncation of the
porcine calcitonin receptor cytoplasmic tail inhibits internalization
and signal transduction but increases receptor affinity. Mol Endocrinol 8:16911700[Abstract/Free Full Text]
-
Dicker F, Quitterer U, Winstel R, Honold K, Lohse
MJ 1999 Phosphorylation-independent inhibition of parathyroid
hormone receptor signaling by G protein-coupled receptor kinases. Proc
Natl Acad Sci USA 96:54765481[Abstract/Free Full Text]
-
Lyu RM, Germano PM, Choi JK, Le SV, Pisegna JR 2000 Identification of an essential amino acid motif within the C-terminus
of the PACAP type I receptor (PAC1) that is critical for signal
truncation but not for receptor internalization. J Biol Chem 275:3613436142[Abstract/Free Full Text]
-
Buggy JJ, Heurich RO, MacDougall M, Kelley KA,
Livingston JN, Yoo-Warren H, Rossomando AJ 1997 Role of the
glucagon receptor COOH-terminal domain in glucagon-mediated
signaling and receptor internalization. Diabetes 46:14001405[Abstract]
-
Wheeler MB, Gelling RW, Hinke SA, Tu B, Pederson RA,
Lynn F, Ehses J, McIntosh CH 1999 Characterization of the
carboxyl-terminal domain of the rat glucose-dependent insulinotropic
polypeptide (GIP) receptor. A role for serines 426 and 427 in
regulating the rate of internalization. J Biol Chem 274:2459324601[Abstract/Free Full Text]
-
Hall TA 1999 BioEdit: a user-friendly
biological sequence alignment editor and analysis program for Windows
95/98/NT. Nucleic Acids Symp Ser 41:9598
This article has been cited by other articles:

|
 |

|
 |
 
A. S. Mechaly, J. Vinas, and F. Piferrer
Identification of Two Isoforms of the Kisspeptin-1 Receptor (kiss1r) Generated by Alternative Splicing in a Modern Teleost, the Senegalese Sole (Solea senegalensis)
Biol Reprod,
January 1, 2009;
80(1):
60 - 69.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Bedard, J. Strecko, K. Theriault, J. Bedard, C. Veyrat-Durebex, and P. Gaudreau
Effects of a high-glucose environment on the pituitary growth hormone-releasing hormone receptor: type 1 diabetes compared with in vitro glucotoxicity
Am J Physiol Endocrinol Metab,
April 1, 2008;
294(4):
E740 - E751.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Toogood, S. Harvey, M. O. Thorner, and B. D. Gaylinn
Cloning of the Chicken Pituitary Receptor for Growth Hormone-Releasing Hormone
Endocrinology,
April 1, 2006;
147(4):
1838 - 1846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Alba and R. Salvatori
Naturally-occurring missense mutations in the human growth hormone-releasing hormone receptor alter ligand binding
J. Endocrinol.,
September 1, 2005;
186(3):
515 - 521.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. E. Mayo, L. J. Miller, D. Bataille, S. Dalle, B. Goke, B. Thorens, and D. J. Drucker
International Union of Pharmacology. XXXV. The Glucagon Receptor Family
Pharmacol. Rev.,
March 1, 2003;
55(1):
167 - 194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Salvatori, X. Fan, P. E. Mullis, A. Haile, and M. A. Levine
Decreased Expression of the GHRH Receptor Gene Due to a Mutation in a Pit-1 Binding Site
Mol. Endocrinol.,
March 1, 2002;
16(3):
450 - 458.
[Abstract]
[Full Text]
[PDF]
|
 |
|