| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Division of Endocrinology and Metabolism, Department of Medicine, University of Virginia Health System, Charlottesville, Virginia 22908
Address all correspondence and requests for reprints to: Bruce Gaylinn, Ph.D., Division of Endocrinology & Metabolism, UVa Health System Box 800746, Charlottesville, Virginia 22908.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Details of the molecular interaction of GHRH with its receptor are not well understood. We have been characterizing receptor binding properties and mapping receptor sites in close contact with bound GHRH by photoaffinity cross-linking of labeled GHRH to receptor (6) and analysis of the pattern of labeled proteolytic cleavage peptides from the complex (7). In these studies, ovine GHRHR protein was found to give different sized cleavage peptides than human GHRHR. Identification of the ovine GHRHR sequence will allow a more detailed interpretation of these data.
For further understanding of the binding properties and cellular signaling mechanisms of GHRHR, and for use in studies of domestic animals, we cloned the ovine pituitary GHRHR (oGHRHR). This sequence revealed that oGHRHR was C-terminally truncated (lacking sixteen amino acids) relative to other known mammalian GHRHRs. We therefore also cloned bovine GHRHR to determine if this modification was present in a more closely related species. Seeing no truncation in the bovine receptor, we used genomic sequencing to show that the caprine receptor did share the truncation. We examined ligand binding and cAMP signaling in transfected cell lines to confirm that these clones were functional and to investigate the role of the C-terminal domain in receptor function.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cloning and sequence analysis of ovine GHRHR
pBluescriptII-KS+ plasmid vector containing full-length human
pituitary GHRHR cDNA (2) was digested with
EcoRI to cut out a 1073-bp fragment of the insert. The
restriction enzyme-treated material was run on a 1% agarose gel and
the separated nucleotides, -57 to 1016 of human GHRHR (the numbers
indicate the nucleotide position from start codon of coding region,
these nucleotides encode the protein from the signal peptide to the
middle of the transmembrane 6) was cut out from the gel, flash-frozen
in liquid nitrogen, centrifuged at 14,000 x g for 5
min, and the supernatant precipitated with ethanol in the presence of
salt. This human GHRHR fragment was then radiolabeled with
[
32P] deoxy-CTP to a specific activity of
2 x 109 dpm/µg using random priming
and used as a hybridization probe. As initial screens of 1.5 x
106 plaque forming units produced only
partial-length clones, we rescreened another 1.5 x
106 plaque forming units by PCR to identify
plates that included full length clones; phagemids on the plate were
washed out with SM buffer (5 ml/150 mm-dish), and this wash-out
solution was subjected to PCR using specific primers for human GHRHR
(5'-CCTGCGACCTGGGATGGGCTGCTGTGC-3'; human GHRHR 166–192 and
5'-CCAATACTGAGACTGGGTATGGAGGCTGCC-3'; human GHRHR 975–936). The PCR
conditions were: 94 C (1 min)/65 C (1.5 min)/72 C (2.5 min) x 35
cycles. One out of 34 plate wash-out solutions showed an amplified band
on an agarose gel, then this phagemid wash-out solution was plated for
a second screening with the hybridization probe using Rapid-Hyb
solution and nylon membrane with an annealing temperature of 65 C and
final washing at 65 C in a buffer containing 15
mM NaCl. From this screening, one full-length
clone (oGHRHR) was obtained and its sequence was analyzed by dideoxy
chain termination method and confirmed by thermal dye sequencing.
RT-PCR of mRNA from pooled ovine pituitary
Messenger RNA was prepared from six ovine pituitaries by
extraction of total RNA followed by preparation of mRNA. The
full-length GHRHR cDNA, reverse-transcribed from extracted mRNA, was
amplified by RT-PCR using Taq DNA polymerase and the primers
specific to 5'- and 3'- non coding region adjacent to the coding region
on both sides of ovine GHRHR (5'-GGCAGCAGTGACAACAGGGG-3') and
5'-CCATGGGACGCTGTGGAGGGTG-3') with the following PCR condition; 94 C (1
min)/63 C (1 min)/72 C (1.5 min) x 35 cycles. RT-PCR products
were then subcloned into the pCR2.1 vector and sequenced.
RT-PCR using a 3'-degenerate primer predicted to hybridize to the missing nucleotides in ovine GHRHR was also performed to investigate whether a longer (nontruncated) form of the GHRHR exists in sheep. A degenerate reverse primer was chosen that matches the sequence of known mammalian GHRHRs for the region that is deleted in the sheep (5'-CACCCTCGAGCGGG[A/G]AGG[T/C][G/T]T, nucleotides 1248–1228 of human GHRHR). This reverse primer was tested with each of two different ovine-specific forward primers, the one in the ovine noncoding region as used above and 5'-CTTTGAAGATGTTGCGTGCTGG-3' in the second extracellular loop. Human GHRHR was used as a positive control for the degenerate primer with forward primer 5'-CCTGCGACCTGGGATGGGCTGCTGTGC-3' (human GHRHR 166–192).
Cloning and sequence analysis of bovine GHRHR
Bovine GHRHR was amplified from mRNA from pooled bovine
pituitaries by RT-PCR using Taq DNA polymerase and the same
ovine primers specific to 5'- and 3'-non coding region adjacent to the
coding region on both sides of ovine GHRHR as described above. The PCR
product was sequenced, and a bovine-specific primer pair for
construction of a full-length clone was selected. The full-length
bovine GHRHR (bGHRHR) was then amplified by RT-PCR using high fidelity
Pfu polymerase and primers matching noncoding regions of the cDNA
(5'-GGCAGCAGTGACAACAGGGGACAG-3' and 5'-CCAGGTAGCTGCCCAAGTTCAGGT-3')
with PCR condition of 95 C (1 min)/60 C (1 min)/74 C (3.5 min) x
35 cycles. The PCR product was subcloned into the SrfI site of
pCR-Script vector.
Construction of human truncated GHRHR
A human GHRHR mutant (htrGHRHR) with a 3'-truncation at the same
place as oGHRHR was constructed by PCR. Wild-type human GHRHR in
pBluescript plasmid was amplified by PCR using pfu
polymerase with primers 5'-CTGAGGCTGGTGGAGGGAGCCA-3' (human -36–15)
and 5'- GTGGT1T1CACTTAGCACGGGTCCTCCAG-3' (human 1229–1203, 1T1 =
single nucleotide change that introduces a stop codon as found in the
sheep). The PCR product was gel-purified and subcloned into pCR-Script
vector and the whole nucleotide sequence was determined by dye cycle
sequencing.
Genomic sequencing
Genomic DNA was prepared from a blood sample from a domestic
goat and from frozen bovine tissue (Pel-Freez) using DNAzol-BD and
DNAzol, respectively, and following manufacturer’s directions (MRC
Inc., Cincinnati, OH).
Five PCR primers were picked to match conserved regions within GHRHR intron 13: two forward, 1) GTGAGGACTGAGATCTCACGGAGATGGCA; and 2) GGCCACGATCCTGAACTTCTGCCAGCCCG); and three reverse: 3) GACAGGAAAGAAGTGCTGGGTGGAAGCATG; 4) GCTCCCATGGGACGCTGTGGAGGGTGGTAG; and 5) TAGCTGCCCAAGTTCAGGTGTGGGCTCCAG.
All six possible different primer pairs (1/3, 1/4, 1/5, 2/3, 2/4, 2/5)
were used to amplify each of three templates: ovine cDNA, caprine
genomic DNA and bovine genomic DNA (0.11 µg genomic DNA/50 µl
reaction). PCR amplification used 35 cycles of 94 C for 30 sec, 60 C
for 30 sec and 72 C for 60 sec. Agarose gel electrophoresis showed that
each primer set gave one clean band with each species. The six products
from the caprine template (ranging from 132 to 232 bp, see Fig. 3
) were
each cloned without purification into the pTarget vector (Promega Corp.) and dye cycle sequenced.
|
The GHRH binding assay we have previously described (6) is
presented here briefly. Cell monolayers were rinsed three times with 5
ml PBS. The cells were scraped into 5 ml PBS and centrifuged. They were
then resuspended and homogenized in a HEPES buffered saline with 10
mM EDTA and protease inhibitors. After centrifugation at
10,000 x g, the upper, membrane layer of the pellets
was resuspended in binding buffer (Tris buffered with 5
mM MgCl2), incubated with
[His1,125I-Tyr10,
Nle27]HumanGHRH-(1–32)-NH2
(125I-GHRHa, 100,000 cpm/0.5 ml incubation
volume) with or without increasing amounts of ovine GHRH or GHRHa at
room temperature for 1 h. The membranes were then pelleted, and
the pellets were counted in a 
-counter. The data were adjusted for
the GHRH probe concentration and analyzed by nonlinear least squares
fitting to mathematical binding competition models using the computer
program GraphPad Prism (GraphPad Software, Inc., Oberlin, OH). In stably transfected cell lines 75–85% of
the total bound counts can be displaced with cold GHRH. Calculations
give receptor densities of 90 to 200 fmol/mg crude membrane
protein.
For cAMP assays, cells were removed from 150-mm culture dishes and replated into 24-well cluster plates (Coster, Cambridge, MA) at 200,000 cells/well for 24 h before testing. Cells were incubated at 37 C with 1 mM isobutylmethylxanthine (IBMX) for 20 min without serum. Hormones were added in fresh warmed media, and plates were incubated for an additional 15 min at 37 C. The medium was then aspirated, plates were frozen in a -70 C freezer, and cells were extracted with 100 mM HCl. cAMP levels in cell lysates were measured by previously described methods (2, 10).
In addition, COS-1 cells were used for transient transfections. oGHRHR was transfected to COS-1 cells by the 2-(diethyl-amino-ethyl) (DEAE)-Dextran method, as previously described (11). Forty-eight hours post transfection the membrane fraction of the transfected cells was prepared as described below for the photoaffinity cross- linking study.
Photoaffinity cross-linking study
Photoaffinity cross-linking was performed to determine the size
of the receptor protein in native ovine pituitary membranes and in COS
cells transfected with oGHRHR, or HtrGHRHR. Photoprobe was prepared and
used as described previously (6). Briefly, GHRHa was
coupled to the photoaffinity cross-linker NHS-ASA (Pierce Chemical Co., Rockford, IL) and iodinated. The
[125I](NHS-ASA)-GHRH derivative was then HPLC
purified to obtain high specific activity. GHRH photoaffinity probe
binding was then assayed in membrane pellets. The ligand-receptor
complex was solubilized from these pellets with 5 mM
3-[(3- cholamidopropyl) dimethylammonio]-1-propane sulfonate (CHAPS).
The CHAPS extracts were photolyzed with log wave UV light for 10 min.
Samples were chloroform-methanol precipitated, resuspended in
SDS-sample buffer, electrophoresed in 10 or 12.5% acrylamide SDS gels
and autoradiographed.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, GenBank
Accession No. AY008834). Nucleotide alignments revealed that ovine
GHRHR had a premature stop codon (Trp408 to stop codon) and an 11
nucleotide deletion near the 3'-end of the coding region (Figs. 1 and 2A). Nucleotide identities with pig,
human, rat, and mouse GHRHRs, and human PACAP, VIP, and secretin
receptors were 88.8, 83.7, 79.1, 78.5, 59.9, 58.9, and 57.7%,
respectively. An amino acid alignment is shown in Fig. 1, and the
percent identity with these and other similar receptors is presented in
Table 1.
|
|
|
, lane 2). The
RT-PCR products were subcloned into pCR2.1 vector and sequenced. Two
distinct cDNAs that encoded GHRH receptor were obtained (RT-PCR clone 1
and 2). RT-PCR clone 1 had the expected sequence, exactly matching the
ovine library clone but with three scattered nucleotide substitutions
that do not cause changes in the encoded amino acid sequence. Clone 2
had a 90 nucleotide insert (retained intron) in the region encoding
transmembrane 5 at the position of the exon-intron 9 boundary (Fig 1).
This insert includes stop codons. This sequence could represent an
alternatively spliced mRNA that would encode a severely shortened form
of ovine GHRHR or could represent an incompletely processed
message.
RT-PCR with degenerate primers
To test the hypothesis that small amounts of full-length ovine
GHRHR message could be present in ovine pituitary, we used RT-PCR with
a 3'-degenerate primer designed to match the deleted nucleotides in the
cloned receptor sequence (Fig. 2A). The degenerate primers to this
region did not amplify ovine pituitary cDNA (Fig. 2C, lanes 3 and 5)
but gave the expected product with human GHRHR (lane 6). As positive
controls to confirm the function of the ovine specific 5'-primers,
3'-primers specific to ovine sequence were used with these 5' primers,
and RT-PCR of ovine pituitary mRNA showed the expected product (Fig. 2C, lanes 2 and 4). Thus, only the mRNA encoding the 407 amino acid
GHRHR was found and no evidence of a 423 amino acid form could be
detected in sheep by either our library cloning or PCR cloning methods
or even with a degenerate PCR approach specifically aimed at the
missing nucleotides found in other GHRHRs.
RT-PCR cloning of bovine GHRHR
Bovine GHRHR cloned by RT-PCR methods (bGHRHR) encoded 423 amino
acids and had no truncation at the carboxy-terminal (GenBank Accession
No. AY008835). Compared with oGHRHR, bGHRHR had 96.5% nucleotide
identity and 92.5% amino acid sequence identity (Fig. 1).
Analysis of bovine and caprine genomic DNA
The size of PCR products from amplification of exon 13 of bovine
and caprine genomic GHRHR DNA were compared with those from ovine cDNA
using agarose gels. As expected, the bovine products were larger than
those from sheep, consistent our previous results showing the 11-bp
deletion that causes the ovine truncation. The ovine and caprine
products were not distinguishable in size and so the caprine products
(shown in Fig. 3) were sequenced to test
if they contained the previously characterized deletion and to confirm
that they were not the result of contamination with the wrong template.
The caprine genomic sequence included the identical deletion seen in
the ovine cDNA but also demonstrated specific sequence differences
proving that it was unique and different from the ovine. In the 174-bp
region sequenced, ovine and bovine receptors are 6.9% different. The
new caprine sequence was 8.1% different from bovine and 2.3%
different from ovine. The caprine exon 13 sequence included 4
nucleotide differences from the ovine which were confirmed in each of 4
to 6 sequencing reactions from 6 independent PCR products. As the
majority of the region sequenced is after the stop codon, these
ovine/caprine sequence differences do not represent amino acid
changes.
Photoaffinity cross-linking studies
Photoaffinity cross-linking was performed to compare the size of
the native receptors in ovine and bovine pituitary membranes, and in
cells expressing the cloned ovine, human wild-type, and human truncated
GHRHRs (Figs. 4 and 5). GHRH photoprobe cross-linking to the
GHRHR was not seen in nontransfected cells and in the presence of
receptor was completely competed by 10 nM unlabeled GHRH
(Fig. 5). Figure 4A demonstrates that the endogenous receptors in ovine
and bovine pituitary differ slightly in gel mobility and this
difference is maintained after complete deglycosylation. Figure 4B
shows that this same mobility difference is seen when human GHRHR
(hGHRHR) is compared with human receptor truncated to match the ovine
sequence (htrGHRH). In a previous publication that examined GHRH
receptor protein purification, we reported that endogenous ovine and
bovine receptors appeared to differ by about 2 kDa in size
(12). Consistent with this, the sequences reported here
predict a difference of 1.8 kDa. Figure 5 shows that when run on higher
percentage gels the native ovine pituitary receptor appears as two or
more bands in the 50–60 kDa range. N-glycosidase treatment
demonstrates that these bands are not due to the expression of
different receptor messages but are caused by variations in
glycosylation (Fig. 5A, lane 2).
|
|
and 7).
Computerized nonlinear regression fitting to a single binding site
model resulted in calculated dissociation constants (with 95%
confidence limits) for GHRH on oGHRHR, bGHRHR, hGHRHR, htrGHRHR, or
ovine pituitary membranes of 0.448 (0.25–0.80), 0.392
(0.28–0.54), 0.280 (0.18–0.44), 0.300 (0.21–0.42), or 0.310
(0.26–0.37), respectively. Stable cell lines used had receptor
expression levels within a factor of 2.5. None of these receptors had
binding affinities that were statistically different. Vector
transfected control cells did not show specific binding.
|
|
GHRH stimulated cAMP signaling at wild-type GHRHR
GHRH stimulated intracellular cAMP accumulation in HEK293
expressing oGHRHR and bGHRHR were examined together (Fig. 8) and analyzed by computer fitting to a
simple (no cooperativity), single site dose-response model. The
EC50s for cAMP response (with 95% confidence
intervals) in these transfected HEK293 cells were 0.991 (0.51–1.9) and
11.5 (9.1–14.7) nM, respectively (Fig. 8). Though these
exact numbers varied in different runs and with details of the assay
conditions, within the same run the oGHRHR consistently showed an
EC50 that was significantly lower than that of
bGHRHR or hGHRHR.
|
shows that the truncation had no detectable effect on GHRH binding.
Figure 9 shows that the
EC50 (with 95% confidence intervals) for
stimulation of cAMP accumulation was changed from 3.45 (2.4–5.0)
nM for the wild-type hGHRHR to 0.313 (0.18–0.52)
nM for htrGHRHR. The cAMP measurements were adjusted for
differences in live cell number by normalizing for the maximal
isoproterenol response in matched wells. As before, these
EC50s varied from run to run, but within a run
the htrGHRHR was consistently more sensitive to GHRH stimulation by
from 11- to 50-fold. This suggests that the truncation alone is
sufficient to explain the EC50 difference between
ovine and human receptor.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). RT-PCR from pooled sheep pituitaries from a different
source confirmed the shorter 407 amino acid sequence found in the ovine
cDNA library. As Northern blotting suggests that alternative forms of
receptor message could be present (1, 2, 3), we used RT-PCR
specifically aimed at the deleted sequence and found that we could
detect no trace of the 423 amino acid form of the receptor in
sheep. To study evolutionary changes in GHRHR and to see if a more closely related species would share this truncation, we also cloned bovine GHRHR. Bovine GHRHR cloned by RT-PCR (bGHRHR) had over 90% identity in nucleotide and amino acid sequence with that of oGHRHR, however it was not truncated. This led us to sequence the crucial region of caprine genomic DNA, which showed that goats and sheep share the identical truncation.
Photoaffinity cross-linking showed that the major functional GHRHR protein in sheep pituitary membranes was smaller than that in bovine pituitary by the amount predicted by the cloned sequences. When hGHRHR was truncated to match the oGHRHR, photoaffinity cross-linking to the recombinant receptors confirmed that the truncation is sufficient to explain the observed mobility difference. This demonstrates that the 407 amino acid form of the receptor is the major and probably the only pituitary GHRHR in sheep.
Despite its truncation, ligand binding at the ovine receptor was not different from that at wild-type human and bovine GHRHRs. The same truncation when introduced into the human GHRHR also did not alter ligand binding. In contrast, the truncated receptors (oGHRHR and htrGHRHR) displayed enhanced cAMP signaling. The maximal amount of cAMP produced relative to the maximal isoproterenol response was not different (possibly indicating a saturating, on or off effect or a limitation of our assay), but the dosage of GHRH required to achieve this maximal response was decreased with the truncation.
In general, the extracellular amino-terminus, extracellular loops and/or transmembrane domains of G protein-coupled receptors are thought to be involved in ligand binding, while the intracellular loops and intracellular carboxy-terminus are involved in G protein coupling and signal transduction (13). There are several possible mechanisms through which this ovine truncation could effect signaling. This C-terminal region of the receptor can be directly or indirectly involved in G protein coupling (14, 15) and ß-arrestin interactions (16). The truncation also removes a potential site for palmitoylation that could be involved in receptor down regulation (17, 18). However, the most likely mechanism is suggested by the 6 potential phosphorylation sites this truncation removes. Many receptors are known to have C-terminal phosphorylation sites that function in agonist-induced down regulation through a pathway involving a family of receptor-specific kinases (GRKs), ß-arrestin, and internalization via clathrin coated vesicles (19). Though many variations on this theme are known, removal of C-terminal phosphorylation sites often inhibits receptor down-regulation (20). In addition, heterologous down-regulation not involving receptor agonist or GRKs can also act through receptor phosphorylation (21).
Among the family B receptors, several (15, 22, 23, 24) including hGHRHR (25) have specifically been shown to display agonist-induced C-terminal phosphorylation and down regulation. C-terminal truncations of the calcitonin receptor inhibited internalization and could also increase receptor affinity (26). At the PTH receptor, C-terminal truncation could increase receptor affinity (14) and phosphorylation was not required for internalization (22). Also at the PTH receptor, binding of a receptor-specific kinase was able to inhibit signaling in a phosphorylation independent manner (27). Studies of the secretin receptor suggest that the major pathway for internalization is phosphorylation independent, but phosphorylation interferes with G protein coupling (15). For the PACAP receptor the proximal part of the C-terminal tail appears to be needed for G protein coupling while the distal part is involved in internalization (28). Studies of the glucagon and GIP receptors showed that the C-terminal tail was not required for binding or signaling, but its removal inhibited receptor endocytosis (29, 30).
Thus, while the details of the mechanism differ even in closely related receptors, the general theme is that the distal part of the receptor tail includes conserved serine and threonine residues that undergo agonist-induced phosphorylation and can be key to down regulation through internalization and/or G protein uncoupling. This is consistent with our results demonstrating that this domain, which is missing in the oGHRHR, is inhibitory to cAMP signaling. Specific details of the mechanism of this inhibition are yet to be established.
Because this truncation might be expected to bias an animal toward a subtly increased endogenous GH, its discovery in domestic sheep leads to the speculation that this mutation could be a recent consequence of domestication and breeding that selected for meat, milk and wool production. To test this hypothesis, we examined the receptor sequences in cow and goat, two other species in the mammalian family bovidae (order artiodactyla). Because goats and sheep were found to share the identical truncation while cows do not, we conclude that this change occurred millions of years ago after the divergence of the subfamilies bovinae and caprinae but before the divergence of the genera ovis and capra (sheep and goats). The physiological significance of this altered receptor and its distribution among the 10 genera within the subfamily caprinae remains to be studied.
In conclusion, we have cloned ovine and bovine pituitary GHRHRs. The ovine receptor has a unique truncation on its carboxy-terminal tail. This truncation did not affect ligand binding but caused a leftward shift (lower EC50) in the GHRH dose-response curve for cAMP activation in cell lines expressing these receptors. This increased sensitivity to GHRH was reproduced when human receptor was truncated to match the ovine sequence. These data suggest that this C-terminal receptor domain does not effect ligand binding affinity but acts to inhibit cAMP signaling, possibly through receptor phosphorylation and uncoupling or internalization.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Current address: Division of Endocrinology and Metabolism, National
Children’s Hospital, 3–35-31 Taishido, Setagaya-ku, Tokyo 154-8509,
Japan.
Received September 26, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(s) complex leads to rapid depalmitoylation and inhibition
of repalmitoylation of both the receptor and Galpha(s). J Biol
Chem 274:31014–31019This article has been cited by other articles:
 |
|
 |
|
  A. S. Mechaly, J. Vinas, and F. Piferrer Identification of Two Isoforms of the Kisspeptin-1 Receptor (kiss1r) Generated by Alternative Splicing in a Modern Teleost, the Senegalese Sole (Solea senegalensis) Biol Reprod, January 1, 2009; 80(1): 60 - 69. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Bedard, J. Strecko, K. Theriault, J. Bedard, C. Veyrat-Durebex, and P. Gaudreau Effects of a high-glucose environment on the pituitary growth hormone-releasing hormone receptor: type 1 diabetes compared with in vitro glucotoxicity Am J Physiol Endocrinol Metab, April 1, 2008; 294(4): E740 - E751. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A. Toogood, S. Harvey, M. O. Thorner, and B. D. Gaylinn Cloning of the Chicken Pituitary Receptor for Growth Hormone-Releasing Hormone Endocrinology, April 1, 2006; 147(4): 1838 - 1846. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Alba and R. Salvatori Naturally-occurring missense mutations in the human growth hormone-releasing hormone receptor alter ligand binding J. Endocrinol., September 1, 2005; 186(3): 515 - 521. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. E. Mayo, L. J. Miller, D. Bataille, S. Dalle, B. Goke, B. Thorens, and D. J. Drucker International Union of Pharmacology. XXXV. The Glucagon Receptor Family Pharmacol. Rev., March 1, 2003; 55(1): 167 - 194. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Salvatori, X. Fan, P. E. Mullis, A. Haile, and M. A. Levine Decreased Expression of the GHRH Receptor Gene Due to a Mutation in a Pit-1 Binding Site Mol. Endocrinol., March 1, 2002; 16(3): 450 - 458. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
