help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Horikawa, R.
Right arrow Articles by Thorner, M. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horikawa, R.
Right arrow Articles by Thorner, M. O.
Endocrinology Vol. 142, No. 6 2660-2668
Copyright © 2001 by The Endocrine Society


ARTICLES

Molecular Cloning of Ovine and Bovine Growth Hormone-Releasing Hormone Receptors: The Ovine Receptor Is C-Terminally Truncated1

Reiko Horikawa2, Bruce D. Gaylinn, Charles E. Lyons, Jr. and Michael O. Thorner

Division of Endocrinology and Metabolism, Department of Medicine, University of Virginia Health System, Charlottesville, Virginia 22908

Address all correspondence and requests for reprints to: Bruce Gaylinn, Ph.D., Division of Endocrinology & Metabolism, UVa Health System Box 800746, Charlottesville, Virginia 22908.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To provide information about species differences in GH-releasing hormone (GHRH) receptors useful for studies of receptor-ligand binding properties and receptor function, we have cloned the ovine and bovine pituitary GHRH receptors (GHRHRs). The ovine receptor (oGHRHR) was cloned from a pituitary complementary DNA library and encodes a protein that is similar to that of porcine, human, rat, and mouse with, respectively, 84.3, 80.7, 75.9, and 74.0% amino acid identity. Surprisingly, oGHRHR has a 16 amino acid truncation at its carboxyl-terminal end when compared with GHRHRs from other known mammals. RT-PCR using pooled pituitary RNA from a different population of sheep could detect only truncated receptor. Bovine GHRHR (bGHRHR) was cloned by RT-PCR and shows 92.5% amino acid sequence identity with oGHRHR, but has no truncation. Genomic sequencing of the appropriate region of goat receptor intron 13 showed that the caprine receptor shares the same truncation seen in sheep. Photoaffinity cross-linking of GHRH to ovine and bovine pituitary membranes confirms that the native ovine pituitary GHRHR protein is smaller by the amount predicted by the cloned sequences. The truncation did not affect GHRH binding as oGHRHR, bGHRHR, human GHRHR, and human GHRHR, which was truncated by site-directed mutagenesis to match the oGHRHR, all showed comparable GHRH binding affinity when expressed in transfected cell lines. In contrast, the ovine and truncated human receptors demonstrated enhanced sensitivity for GHRH stimulation of cAMP (lowered ED50) relative to hGHRHR and bGHRHR. This suggests that this C-terminal domain acts to inhibit cAMP signaling possibly through a role in receptor down regulation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GH-RELEASING hormone (GHRH) acts on somatotrophs in the pituitary through its own receptor. Human (1, 2), rat (1), mouse (3), and pig (4) GHRH receptors (GHRHR) have been cloned and characterized. Recently a GHRH-like receptor from goldfish has been reported (5) and unpublished bovine GHRHR complementary DNA (cDNA) sequence information has been submitted to GenBank (Accession No. AF184896). This work has revealed that the GHRHR belongs to a family of G protein-coupled seven transmembrane receptors (family B) that includes receptors for secretin, PTH, calcitonin, VIP, glucagon, GIP, CRF, and PACAP. This family has no significant sequence similarity to the rhodopsin family (family A,) of G protein-coupled receptors, which includes most of the known seven transmembrane receptors. GHRHR has high affinity for GHRH [Kd = 0.2 nM in human (2)] and has low cross reactivity with structurally related peptides such as secretin, VIP, and PACAP (1, 2, 3, 4).

Details of the molecular interaction of GHRH with its receptor are not well understood. We have been characterizing receptor binding properties and mapping receptor sites in close contact with bound GHRH by photoaffinity cross-linking of labeled GHRH to receptor (6) and analysis of the pattern of labeled proteolytic cleavage peptides from the complex (7). In these studies, ovine GHRHR protein was found to give different sized cleavage peptides than human GHRHR. Identification of the ovine GHRHR sequence will allow a more detailed interpretation of these data.

For further understanding of the binding properties and cellular signaling mechanisms of GHRHR, and for use in studies of domestic animals, we cloned the ovine pituitary GHRHR (oGHRHR). This sequence revealed that oGHRHR was C-terminally truncated (lacking sixteen amino acids) relative to other known mammalian GHRHRs. We therefore also cloned bovine GHRHR to determine if this modification was present in a more closely related species. Seeing no truncation in the bovine receptor, we used genomic sequencing to show that the caprine receptor did share the truncation. We examined ligand binding and cAMP signaling in transfected cell lines to confirm that these clones were functional and to investigate the role of the C-terminal domain in receptor function.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
The ovine pituitary cDNA library was a gift from Dr. C. M. Clay (Colorado State University). This library in the uni-ZAP XR phagemid vector was constructed from the messenger RNA (mRNA) of a single pituitary from an adult U.S. Western range ewe from Colorado by oligo(dT) priming and unidirectional cloning (8). The complexity was 4.5 x 105 independent clones. [His1,Nle27]Human GHRH-(1–32)-NH2 (GHRHa), human secretin, human VIP, and PACAP-(1–38) were obtained from Peninsula Laboratories, Inc. (Belmont, CA). The random priming kit (Random Primed DNA Labeling kit) was purchased from Roche Molecular Biochemicals (Indianapolis, IN); the Sequenase DNA sequencing kit was from U.S. Biochemical (Cleveland, OH); and Rapid-Hyb hybridization buffer and High-bond N nylon membranes were from Amersham Pharmacia Biotech (Arlington Heights, IL). Total RNA extraction kit was from Ambion, Inc. (Totally RNA kit; Austin, TX); mRNA extraction kit was from Promega Corp. (PolyA tract mRNA Isolation kit; Madison, WI); MulV RNA transcriptase and Taq DNA polymerase (AmpliTaq) were from Perkin-Elmer Cetus (GeneAmp RNA PCR kit; Norwalk, CT); Pfu polymerase, pCR-Script cloning kit, pBK-CMV expression vector were from Stratagene (La Jolla, CA), and the TA cloning kit was from Invitrogen (San Diego, CA). Dye sequencing was performed by Dye-Deoxy Terminator Cycle Sequencing kit and ABI Prism sequencer (Perkin-Elmer Cetus). Ovine pituitaries were a gift from Dr. Iain Clarke (Prince Henry’s Institute of Medical Research, Victoria, Australia). These were collected over several days from various breeds that showed up at a slaughterhouse outside Melbourne Australia. Bovine pituitaries were purchased from Pel-Freez Inc. (Brown Deer, WI). Restriction enzymes and Geneticin (G418) were from Life Technologies, Inc. (Gaithersburg, MD). All other chemicals were obtained from Sigma (St. Louis, MO).

Cloning and sequence analysis of ovine GHRHR
pBluescriptII-KS+ plasmid vector containing full-length human pituitary GHRHR cDNA (2) was digested with EcoRI to cut out a 1073-bp fragment of the insert. The restriction enzyme-treated material was run on a 1% agarose gel and the separated nucleotides, -57 to 1016 of human GHRHR (the numbers indicate the nucleotide position from start codon of coding region, these nucleotides encode the protein from the signal peptide to the middle of the transmembrane 6) was cut out from the gel, flash-frozen in liquid nitrogen, centrifuged at 14,000 x g for 5 min, and the supernatant precipitated with ethanol in the presence of salt. This human GHRHR fragment was then radiolabeled with [{alpha}32P] deoxy-CTP to a specific activity of ~2 x 109 dpm/µg using random priming and used as a hybridization probe. As initial screens of 1.5 x 106 plaque forming units produced only partial-length clones, we rescreened another 1.5 x 106 plaque forming units by PCR to identify plates that included full length clones; phagemids on the plate were washed out with SM buffer (5 ml/150 mm-dish), and this wash-out solution was subjected to PCR using specific primers for human GHRHR (5'-CCTGCGACCTGGGATGGGCTGCTGTGC-3'; human GHRHR 166–192 and 5'-CCAATACTGAGACTGGGTATGGAGGCTGCC-3'; human GHRHR 975–936). The PCR conditions were: 94 C (1 min)/65 C (1.5 min)/72 C (2.5 min) x 35 cycles. One out of 34 plate wash-out solutions showed an amplified band on an agarose gel, then this phagemid wash-out solution was plated for a second screening with the hybridization probe using Rapid-Hyb solution and nylon membrane with an annealing temperature of 65 C and final washing at 65 C in a buffer containing 15 mM NaCl. From this screening, one full-length clone (oGHRHR) was obtained and its sequence was analyzed by dideoxy chain termination method and confirmed by thermal dye sequencing.

RT-PCR of mRNA from pooled ovine pituitary
Messenger RNA was prepared from six ovine pituitaries by extraction of total RNA followed by preparation of mRNA. The full-length GHRHR cDNA, reverse-transcribed from extracted mRNA, was amplified by RT-PCR using Taq DNA polymerase and the primers specific to 5'- and 3'- non coding region adjacent to the coding region on both sides of ovine GHRHR (5'-GGCAGCAGTGACAACAGGGG-3') and 5'-CCATGGGACGCTGTGGAGGGTG-3') with the following PCR condition; 94 C (1 min)/63 C (1 min)/72 C (1.5 min) x 35 cycles. RT-PCR products were then subcloned into the pCR2.1 vector and sequenced.

RT-PCR using a 3'-degenerate primer predicted to hybridize to the missing nucleotides in ovine GHRHR was also performed to investigate whether a longer (nontruncated) form of the GHRHR exists in sheep. A degenerate reverse primer was chosen that matches the sequence of known mammalian GHRHRs for the region that is deleted in the sheep (5'-CACCCTCGAGCGGG[A/G]AGG[T/C][G/T]T, nucleotides 1248–1228 of human GHRHR). This reverse primer was tested with each of two different ovine-specific forward primers, the one in the ovine noncoding region as used above and 5'-CTTTGAAGATGTTGCGTGCTGG-3' in the second extracellular loop. Human GHRHR was used as a positive control for the degenerate primer with forward primer 5'-CCTGCGACCTGGGATGGGCTGCTGTGC-3' (human GHRHR 166–192).

Cloning and sequence analysis of bovine GHRHR
Bovine GHRHR was amplified from mRNA from pooled bovine pituitaries by RT-PCR using Taq DNA polymerase and the same ovine primers specific to 5'- and 3'-non coding region adjacent to the coding region on both sides of ovine GHRHR as described above. The PCR product was sequenced, and a bovine-specific primer pair for construction of a full-length clone was selected. The full-length bovine GHRHR (bGHRHR) was then amplified by RT-PCR using high fidelity Pfu polymerase and primers matching noncoding regions of the cDNA (5'-GGCAGCAGTGACAACAGGGGACAG-3' and 5'-CCAGGTAGCTGCCCAAGTTCAGGT-3') with PCR condition of 95 C (1 min)/60 C (1 min)/74 C (3.5 min) x 35 cycles. The PCR product was subcloned into the SrfI site of pCR-Script vector.

Construction of human truncated GHRHR
A human GHRHR mutant (htrGHRHR) with a 3'-truncation at the same place as oGHRHR was constructed by PCR. Wild-type human GHRHR in pBluescript plasmid was amplified by PCR using pfu polymerase with primers 5'-CTGAGGCTGGTGGAGGGAGCCA-3' (human -36–15) and 5'- GTGGT1T1CACTTAGCACGGGTCCTCCAG-3' (human 1229–1203, 1T1 = single nucleotide change that introduces a stop codon as found in the sheep). The PCR product was gel-purified and subcloned into pCR-Script vector and the whole nucleotide sequence was determined by dye cycle sequencing.

Genomic sequencing
Genomic DNA was prepared from a blood sample from a domestic goat and from frozen bovine tissue (Pel-Freez) using DNAzol-BD and DNAzol, respectively, and following manufacturer’s directions (MRC Inc., Cincinnati, OH).

Five PCR primers were picked to match conserved regions within GHRHR intron 13: two forward, 1) GTGAGGACTGAGATCTCACGGAGATGGCA; and 2) GGCCACGATCCTGAACTTCTGCCAGCCCG); and three reverse: 3) GACAGGAAAGAAGTGCTGGGTGGAAGCATG; 4) GCTCCCATGGGACGCTGTGGAGGGTGGTAG; and 5) TAGCTGCCCAAGTTCAGGTGTGGGCTCCAG.

All six possible different primer pairs (1/3, 1/4, 1/5, 2/3, 2/4, 2/5) were used to amplify each of three templates: ovine cDNA, caprine genomic DNA and bovine genomic DNA (0.11 µg genomic DNA/50 µl reaction). PCR amplification used 35 cycles of 94 C for 30 sec, 60 C for 30 sec and 72 C for 60 sec. Agarose gel electrophoresis showed that each primer set gave one clean band with each species. The six products from the caprine template (ranging from 132 to 232 bp, see Fig. 3Go) were each cloned without purification into the pTarget vector (Promega Corp.) and dye cycle sequenced.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 3. GHRHR exon 13 PCR products from caprine genomic DNA. Ethidium stained 1.2% agarose gel. Lane 1, 100 bp ladder (New England Biolabs, Inc., Beverly, MA). Lane 2, Blank. Lanes 3–8, Primer pairs 1/5, 1/4, 1/3, 2/5, 2/4, 2/3 (see Materials and Methods). Lane 9, Unrelated cDNA template positive control. Lane 10, No template negative control.

 
Expression, binding assays, and cAMP measurements
The KpnI/SacI fragments of oGHRHR cDNA in pBluescript and HtrGHRHR in pCR-Script were cloned into the KpnI/SacI site of the mammalian expression vector pBK-CMV. HEK (human embryonic kidney) 293 cells were stably transfected with oGHRHR/pBK-CMV or HtrGHRHR/pBK-CMV constructs (20 µg plasmid DNA per 5 x 105 cells in a 150 mm-dish by the CaCl2 and low pH method described by Chen and Okayama (9). The NotI/EcoRI fragment of bGHRHR cDNA in pCR-Script was also cloned into the NotI/EcoRI site of pBK-CMV and the bGHRHR/pBK-CMV construct was transfected into HEK293 cells by the method described above. Transfected cells were selected in 400 µg/ml G418 and maintained under continuous selection for more than 4 weeks before use in the binding and cAMP studies.

The GHRH binding assay we have previously described (6) is presented here briefly. Cell monolayers were rinsed three times with 5 ml PBS. The cells were scraped into 5 ml PBS and centrifuged. They were then resuspended and homogenized in a HEPES buffered saline with 10 mM EDTA and protease inhibitors. After centrifugation at 10,000 x g, the upper, membrane layer of the pellets was resuspended in binding buffer (Tris buffered with 5 mM MgCl2), incubated with [His1,125I-Tyr10, Nle27]HumanGHRH-(1–32)-NH2 (125I-GHRHa, 100,000 cpm/0.5 ml incubation volume) with or without increasing amounts of ovine GHRH or GHRHa at room temperature for 1 h. The membranes were then pelleted, and the pellets were counted in a {gamma}-counter. The data were adjusted for the GHRH probe concentration and analyzed by nonlinear least squares fitting to mathematical binding competition models using the computer program GraphPad Prism (GraphPad Software, Inc., Oberlin, OH). In stably transfected cell lines 75–85% of the total bound counts can be displaced with cold GHRH. Calculations give receptor densities of 90 to 200 fmol/mg crude membrane protein.

For cAMP assays, cells were removed from 150-mm culture dishes and replated into 24-well cluster plates (Coster, Cambridge, MA) at 200,000 cells/well for 24 h before testing. Cells were incubated at 37 C with 1 mM isobutylmethylxanthine (IBMX) for 20 min without serum. Hormones were added in fresh warmed media, and plates were incubated for an additional 15 min at 37 C. The medium was then aspirated, plates were frozen in a -70 C freezer, and cells were extracted with 100 mM HCl. cAMP levels in cell lysates were measured by previously described methods (2, 10).

In addition, COS-1 cells were used for transient transfections. oGHRHR was transfected to COS-1 cells by the 2-(diethyl-amino-ethyl) (DEAE)-Dextran method, as previously described (11). Forty-eight hours post transfection the membrane fraction of the transfected cells was prepared as described below for the photoaffinity cross- linking study.

Photoaffinity cross-linking study
Photoaffinity cross-linking was performed to determine the size of the receptor protein in native ovine pituitary membranes and in COS cells transfected with oGHRHR, or HtrGHRHR. Photoprobe was prepared and used as described previously (6). Briefly, GHRHa was coupled to the photoaffinity cross-linker NHS-ASA (Pierce Chemical Co., Rockford, IL) and iodinated. The [125I](NHS-ASA)-GHRH derivative was then HPLC purified to obtain high specific activity. GHRH photoaffinity probe binding was then assayed in membrane pellets. The ligand-receptor complex was solubilized from these pellets with 5 mM 3-[(3- cholamidopropyl) dimethylammonio]-1-propane sulfonate (CHAPS). The CHAPS extracts were photolyzed with log wave UV light for 10 min. Samples were chloroform-methanol precipitated, resuspended in SDS-sample buffer, electrophoresed in 10 or 12.5% acrylamide SDS gels and autoradiographed.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation and sequence analysis of ovine GHRHR cDNA clone
After screening 3 x 106 plaque-forming units, we obtained three different clones that encoded oGHRHR. Only one clone encoded full-length receptor and was further analyzed. The other two clones were both partial-length GHRHR that lacked the 5'-end of the coding region. The cloned full-length cDNA encoded 407 amino acids, which was 16 amino acids shorter than the GHRHR of other known mammalian species (Fig. 1Go, GenBank Accession No. AY008834). Nucleotide alignments revealed that ovine GHRHR had a premature stop codon (Trp408 to stop codon) and an 11 nucleotide deletion near the 3'-end of the coding region (Figs. 1Go and 2AGo). Nucleotide identities with pig, human, rat, and mouse GHRHRs, and human PACAP, VIP, and secretin receptors were 88.8, 83.7, 79.1, 78.5, 59.9, 58.9, and 57.7%, respectively. An amino acid alignment is shown in Fig. 1Go, and the percent identity with these and other similar receptors is presented in Table 1Go.



View larger version (82K):
[in this window]
[in a new window]
 
Figure 1. Amino acid alignment of GHRH receptors. The full-length ovine pituitary GHRHR was cloned from a pituitary cDNA library and its sequence confirmed by RT-PCR from pooled pituitaries. It encodes 407 amino acids, which is 16 residues shorter than GHRHRs of the other species. These 16 residues are underlined. Predicted transmembrane spanning domains TM1–TM7 are shown boxed and in bold. Hollow arrowhead, Putative signal peptide cleavage site; filled arrowhead, putative glycosylation site; hollow arrow, site of retained intron in one RT-PCR clone; filled arrows, potential phosphorylation sites not present in the ovine sequence; *, stop codon.

 


View larger version (43K):
[in this window]
[in a new window]
 
Figure 2. RT-PCR analysis of ovine pituitary GHRHR mRNA. A, Primer map and C-terminal receptor nucleotide sequence. Ovine GHRHR had a premature stop codon (tgg to tga; 408W to stop codon) and an 11 nucleotide deletion (dots) in 3'-end of the coding region, when compared with GHRHR of the other species. To test if any mRNA without the deletion was present we employed RT-PCR with a 3'-degenerate primer designed to hybridize with the deleted sequence in related species. No ovine mRNA without the deletion was detected. Positive controls showed amplified products of the expected sizes confirming that the primers are functional. Products from RT-PCR reactions a-e are shown and describes below. B and C, Agarose gel electrophoresis of RT-PCR products. B, Lane 1; DNA size markers, lane 2; RT-PCR product from pooled ovine pituitary RNA. This product includes the full coding region of the oGHRHR and was cloned and sequenced as described in the text. C, Lane 1; DNA size markers, lane 2; Positive control for forward ovine primer (product c in cartoon), lane 3; PCR with forward ovine primer and degenerate primer to match deletion (product d in cartoon). No RNA matching the deletion is detected. Lane 4; PCR positive control for the forward ovine primer (upper band is product a in cartoon). Lane 5; PCR with forward ovine primer and degenerate primer to match deletion (product b in cartoon). No RNA matching the deletion is detected. Lane 6; PCR with human GHRHR cDNA as a positive control for the degenerate primer (using a human-specific forward primer, product e in cartoon). PCR conditions are given in text.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Sequence comparison as percent amino acid identity

 
RT-PCR cloning of ovine GHRHR
To determine whether our oGHRHR clone isolated from the cDNA library truly represents the GHRHR expressed in sheep pituitary, GHRH receptor sequence was amplified by RT-PCR from an independent (Australian) source of pooled ovine pituitary RNA. The PCR product appeared as one major band on 1% agarose gels (Fig. 2BGo, lane 2). The RT-PCR products were subcloned into pCR2.1 vector and sequenced. Two distinct cDNAs that encoded GHRH receptor were obtained (RT-PCR clone 1 and 2). RT-PCR clone 1 had the expected sequence, exactly matching the ovine library clone but with three scattered nucleotide substitutions that do not cause changes in the encoded amino acid sequence. Clone 2 had a 90 nucleotide insert (retained intron) in the region encoding transmembrane 5 at the position of the exon-intron 9 boundary (Fig 1Go). This insert includes stop codons. This sequence could represent an alternatively spliced mRNA that would encode a severely shortened form of ovine GHRHR or could represent an incompletely processed message.

RT-PCR with degenerate primers
To test the hypothesis that small amounts of full-length ovine GHRHR message could be present in ovine pituitary, we used RT-PCR with a 3'-degenerate primer designed to match the deleted nucleotides in the cloned receptor sequence (Fig. 2AGo). The degenerate primers to this region did not amplify ovine pituitary cDNA (Fig. 2CGo, lanes 3 and 5) but gave the expected product with human GHRHR (lane 6). As positive controls to confirm the function of the ovine specific 5'-primers, 3'-primers specific to ovine sequence were used with these 5' primers, and RT-PCR of ovine pituitary mRNA showed the expected product (Fig. 2CGo, lanes 2 and 4). Thus, only the mRNA encoding the 407 amino acid GHRHR was found and no evidence of a 423 amino acid form could be detected in sheep by either our library cloning or PCR cloning methods or even with a degenerate PCR approach specifically aimed at the missing nucleotides found in other GHRHRs.

RT-PCR cloning of bovine GHRHR
Bovine GHRHR cloned by RT-PCR methods (bGHRHR) encoded 423 amino acids and had no truncation at the carboxy-terminal (GenBank Accession No. AY008835). Compared with oGHRHR, bGHRHR had 96.5% nucleotide identity and 92.5% amino acid sequence identity (Fig. 1Go).

Analysis of bovine and caprine genomic DNA
The size of PCR products from amplification of exon 13 of bovine and caprine genomic GHRHR DNA were compared with those from ovine cDNA using agarose gels. As expected, the bovine products were larger than those from sheep, consistent our previous results showing the 11-bp deletion that causes the ovine truncation. The ovine and caprine products were not distinguishable in size and so the caprine products (shown in Fig. 3Go) were sequenced to test if they contained the previously characterized deletion and to confirm that they were not the result of contamination with the wrong template. The caprine genomic sequence included the identical deletion seen in the ovine cDNA but also demonstrated specific sequence differences proving that it was unique and different from the ovine. In the 174-bp region sequenced, ovine and bovine receptors are 6.9% different. The new caprine sequence was 8.1% different from bovine and 2.3% different from ovine. The caprine exon 13 sequence included 4 nucleotide differences from the ovine which were confirmed in each of 4 to 6 sequencing reactions from 6 independent PCR products. As the majority of the region sequenced is after the stop codon, these ovine/caprine sequence differences do not represent amino acid changes.

Photoaffinity cross-linking studies
Photoaffinity cross-linking was performed to compare the size of the native receptors in ovine and bovine pituitary membranes, and in cells expressing the cloned ovine, human wild-type, and human truncated GHRHRs (Figs. 4Go and 5Go). GHRH photoprobe cross-linking to the GHRHR was not seen in nontransfected cells and in the presence of receptor was completely competed by 10 nM unlabeled GHRH (Fig. 5Go). Figure 4AGo demonstrates that the endogenous receptors in ovine and bovine pituitary differ slightly in gel mobility and this difference is maintained after complete deglycosylation. Figure 4BGo shows that this same mobility difference is seen when human GHRHR (hGHRHR) is compared with human receptor truncated to match the ovine sequence (htrGHRH). In a previous publication that examined GHRH receptor protein purification, we reported that endogenous ovine and bovine receptors appeared to differ by about 2 kDa in size (12). Consistent with this, the sequences reported here predict a difference of 1.8 kDa. Figure 5Go shows that when run on higher percentage gels the native ovine pituitary receptor appears as two or more bands in the 50–60 kDa range. N-glycosidase treatment demonstrates that these bands are not due to the expression of different receptor messages but are caused by variations in glycosylation (Fig. 5AGo, lane 2).



View larger version (59K):
[in this window]
[in a new window]
 
Figure 4. Photoaffinity cross-linking to native, recombinant and truncated GHRHRs. Autoradiographs of 7.5% SDS polyacrylamide gels of samples cross-linked with 125I-hGHRH photoprobe with and without N-glycosidase treatment. A, Native receptors in pituitary membranes. Lanes 1 and 2: ovine pituitary. Lanes 3 and 4, Bovine pituitary. The observed receptor protein mobility differences match that expected from the cloned cDNA sequences. B, Recombinant hGHRHR with and without truncation. Lanes 1 and 2, hGHRHR. Lanes 3 and 4, htrGHRHR. The observed receptor protein mobility differences mirror those seen in Fig. 4AGo and fit that expected from the cDNA sequences.

 


View larger version (70K):
[in this window]
[in a new window]
 
Figure 5. Photoaffinity cross-linking to native and recombinant oGHRHR. Autoradiographs of 10% SDS polyacrylamide gels of samples cross-linked with 125I-hGHRH photoprobe. A, Ovine pituitary membranes. Lane 1, Ovine pituitary. Lane 2, After N-glycosidase treatment. Lane 3, Cross-linking in the presence of 10 nM unlabeled hGHRH. B: Lanes 1 and 2, Ovine pituitary. Lanes 3 and 4, Recombinant oGHRHR. Lanes 5 and 6, Nontransfected HEK293 cells. The second lane of each pair (lanes 2, 4, and 6) was cross-linked in the presence of 10 nM unlabeled hGHRH.

 
GHRH binding studies
Specific binding of 125I-GHRHa (a 32 amino acid human analog stabilized against methionine oxidation) to crude membrane fractions from cell lines expressing recombinant receptors or from ovine pituitary were examined (Figs. 6Go and 7Go). Computerized nonlinear regression fitting to a single binding site model resulted in calculated dissociation constants (with 95% confidence limits) for GHRH on oGHRHR, bGHRHR, hGHRHR, htrGHRHR, or ovine pituitary membranes of 0.448 (0.25–0.80), 0.392 (0.28–0.54), 0.280 (0.18–0.44), 0.300 (0.21–0.42), or 0.310 (0.26–0.37), respectively. Stable cell lines used had receptor expression levels within a factor of 2.5. None of these receptors had binding affinities that were statistically different. Vector transfected control cells did not show specific binding.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 6. Binding of 125I-hGHRH to crude membrane preparations was competed by increasing amounts of unlabeled hGHRH. Data for each preparation are shown together with their computer generated best-fit curves to a single binding site model. Expression levels in these stable cell lines differed within a factor of two, but were normalized to allow a visual comparison of binding affinities, which were statistically indistinguishable. Vector transfected controls done in parallel showed no specific binding. Data are shown as mean ± SE. All experiments were performed in at least triplicate.

 


View larger version (13K):
[in this window]
[in a new window]
 
Figure 7. Binding was analyzed as in Fig. 6Go, but with hGHRHR and htrGHRHR transfected HEK293 stable cell lines examined in parallel. Expression of hGHRHR binding sites (Bo) was 1.5-fold greater than htrGHRHR but were normalized to demonstrate the similarity of the binding affinities.

 
Specificity of ovine GHRHR
The binding and signaling response of the ovine receptor to other peptides homologous to GHRH was examined. The binding of 125I-GHRHa at the recombinant oGHRHR was competed by ovine or human GHRH in a dose dependent manner, but not by secretin, VIP, or PACAP at up to 100 nM (with a small but not statistically significant effect from PACAP at the highest dose, data not shown). Consistent with this, cAMP signaling at the oGHRHR was activated by sub nanomolar levels of GHRH, not by 100 nM VIP and only slightly by 100 nM PACAP (data not shown). This slight cross-reactivity with 100 nM PACAP has been previously reported for the hGHRHR (2). These data confirm that the cloned oGHRHR has the specificity expected of a GHRHR.

GHRH stimulated cAMP signaling at wild-type GHRHR
GHRH stimulated intracellular cAMP accumulation in HEK293 expressing oGHRHR and bGHRHR were examined together (Fig. 8Go) and analyzed by computer fitting to a simple (no cooperativity), single site dose-response model. The EC50s for cAMP response (with 95% confidence intervals) in these transfected HEK293 cells were 0.991 (0.51–1.9) and 11.5 (9.1–14.7) nM, respectively (Fig. 8Go). Though these exact numbers varied in different runs and with details of the assay conditions, within the same run the oGHRHR consistently showed an EC50 that was significantly lower than that of bGHRHR or hGHRHR.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 8. cAMP formation in response to hGHRH at ovine GHRHR (oGHRHR) and bovine GHRHR (bGHRHR) receptor transfected stable HEK293 cell lines. Data are shown as mean ± SE.

 
Effects of truncation on GHRH binding and cAMP signaling
The cloned oGHRHR was able to stimulate cAMP signaling at lower levels of GHRH than we had seen with the hGHRHR or bGHRHR. This suggested that the truncation might be potentiating cAMP signaling, but other differences in the receptors could be responsible for this effect. To test the hypothesis that the truncation caused the potentiation, we truncated the human receptor to match the oGHRHR and compared it side by side with the wild-type human receptor. Figure 7Go shows that the truncation had no detectable effect on GHRH binding. Figure 9Go shows that the EC50 (with 95% confidence intervals) for stimulation of cAMP accumulation was changed from 3.45 (2.4–5.0) nM for the wild-type hGHRHR to 0.313 (0.18–0.52) nM for htrGHRHR. The cAMP measurements were adjusted for differences in live cell number by normalizing for the maximal isoproterenol response in matched wells. As before, these EC50s varied from run to run, but within a run the htrGHRHR was consistently more sensitive to GHRH stimulation by from 11- to 50-fold. This suggests that the truncation alone is sufficient to explain the EC50 difference between ovine and human receptor.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 9. cAMP formation in response to hGHRH at human GHRHR (hGHRHR) and truncated hGHRHR (htrGHRHR) receptor transfected HEK293 stable cell lines. Data are shown as mean ± SE. Data were normalized to the isoproterenol response in parallel wells to adjust for the number of live cells. The leftward shift (decreased ED50) seen in the truncated receptor mirrors the difference seen between oGHRHR and bGHRHR in Fig. 8Go.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study we have cloned ovine GHRHR from a pituitary cDNA library from an adult ewe. Amino acid sequence comparisons were made between the ovine clone (oGHRHR) and human, porcine, rat or mouse GHRHRs, as well as human PACAP, VIP, and secretin receptors. The high percentage of identity between oGHRHR and GHRHR of the other species strongly suggest that this cloned receptor is the ovine counterpart to the known GHRHRs. The receptor was then characterized for GHRH binding and signaling and specificity for GHRH over related peptides. This confirmed that it is a functional GHRHR. oGHRHR was unique in that it lacked the last 16 amino acids when compared with GHRHRs from other mammals (407 vs. 423 amino acids). The truncation was caused by the change in tryptophan 408 to a stop codon (TGG to TGA). This was followed by an 11 nucleotide deletion, after which the sequence which would have encoded the conserved C-terminal end of the protein began again (Fig. 2AGo). RT-PCR from pooled sheep pituitaries from a different source confirmed the shorter 407 amino acid sequence found in the ovine cDNA library. As Northern blotting suggests that alternative forms of receptor message could be present (1, 2, 3), we used RT-PCR specifically aimed at the deleted sequence and found that we could detect no trace of the 423 amino acid form of the receptor in sheep.

To study evolutionary changes in GHRHR and to see if a more closely related species would share this truncation, we also cloned bovine GHRHR. Bovine GHRHR cloned by RT-PCR (bGHRHR) had over 90% identity in nucleotide and amino acid sequence with that of oGHRHR, however it was not truncated. This led us to sequence the crucial region of caprine genomic DNA, which showed that goats and sheep share the identical truncation.

Photoaffinity cross-linking showed that the major functional GHRHR protein in sheep pituitary membranes was smaller than that in bovine pituitary by the amount predicted by the cloned sequences. When hGHRHR was truncated to match the oGHRHR, photoaffinity cross-linking to the recombinant receptors confirmed that the truncation is sufficient to explain the observed mobility difference. This demonstrates that the 407 amino acid form of the receptor is the major and probably the only pituitary GHRHR in sheep.

Despite its truncation, ligand binding at the ovine receptor was not different from that at wild-type human and bovine GHRHRs. The same truncation when introduced into the human GHRHR also did not alter ligand binding. In contrast, the truncated receptors (oGHRHR and htrGHRHR) displayed enhanced cAMP signaling. The maximal amount of cAMP produced relative to the maximal isoproterenol response was not different (possibly indicating a saturating, on or off effect or a limitation of our assay), but the dosage of GHRH required to achieve this maximal response was decreased with the truncation.

In general, the extracellular amino-terminus, extracellular loops and/or transmembrane domains of G protein-coupled receptors are thought to be involved in ligand binding, while the intracellular loops and intracellular carboxy-terminus are involved in G protein coupling and signal transduction (13). There are several possible mechanisms through which this ovine truncation could effect signaling. This C-terminal region of the receptor can be directly or indirectly involved in G protein coupling (14, 15) and ß-arrestin interactions (16). The truncation also removes a potential site for palmitoylation that could be involved in receptor down regulation (17, 18). However, the most likely mechanism is suggested by the 6 potential phosphorylation sites this truncation removes. Many receptors are known to have C-terminal phosphorylation sites that function in agonist-induced down regulation through a pathway involving a family of receptor-specific kinases (GRKs), ß-arrestin, and internalization via clathrin coated vesicles (19). Though many variations on this theme are known, removal of C-terminal phosphorylation sites often inhibits receptor down-regulation (20). In addition, heterologous down-regulation not involving receptor agonist or GRKs can also act through receptor phosphorylation (21).

Among the family B receptors, several (15, 22, 23, 24) including hGHRHR (25) have specifically been shown to display agonist-induced C-terminal phosphorylation and down regulation. C-terminal truncations of the calcitonin receptor inhibited internalization and could also increase receptor affinity (26). At the PTH receptor, C-terminal truncation could increase receptor affinity (14) and phosphorylation was not required for internalization (22). Also at the PTH receptor, binding of a receptor-specific kinase was able to inhibit signaling in a phosphorylation independent manner (27). Studies of the secretin receptor suggest that the major pathway for internalization is phosphorylation independent, but phosphorylation interferes with G protein coupling (15). For the PACAP receptor the proximal part of the C-terminal tail appears to be needed for G protein coupling while the distal part is involved in internalization (28). Studies of the glucagon and GIP receptors showed that the C-terminal tail was not required for binding or signaling, but its removal inhibited receptor endocytosis (29, 30).

Thus, while the details of the mechanism differ even in closely related receptors, the general theme is that the distal part of the receptor tail includes conserved serine and threonine residues that undergo agonist-induced phosphorylation and can be key to down regulation through internalization and/or G protein uncoupling. This is consistent with our results demonstrating that this domain, which is missing in the oGHRHR, is inhibitory to cAMP signaling. Specific details of the mechanism of this inhibition are yet to be established.

Because this truncation might be expected to bias an animal toward a subtly increased endogenous GH, its discovery in domestic sheep leads to the speculation that this mutation could be a recent consequence of domestication and breeding that selected for meat, milk and wool production. To test this hypothesis, we examined the receptor sequences in cow and goat, two other species in the mammalian family bovidae (order artiodactyla). Because goats and sheep were found to share the identical truncation while cows do not, we conclude that this change occurred millions of years ago after the divergence of the subfamilies bovinae and caprinae but before the divergence of the genera ovis and capra (sheep and goats). The physiological significance of this altered receptor and its distribution among the 10 genera within the subfamily caprinae remains to be studied.

In conclusion, we have cloned ovine and bovine pituitary GHRHRs. The ovine receptor has a unique truncation on its carboxy-terminal tail. This truncation did not affect ligand binding but caused a leftward shift (lower EC50) in the GHRH dose-response curve for cAMP activation in cell lines expressing these receptors. This increased sensitivity to GHRH was reproduced when human receptor was truncated to match the ovine sequence. These data suggest that this C-terminal receptor domain does not effect ligand binding affinity but acts to inhibit cAMP signaling, possibly through receptor phosphorylation and uncoupling or internalization.


    Acknowledgments
 
The authors express sincere thanks to Drs. Colin M. Clay and Iain Clarke for supplying critical reagents and to Dr. Kevin R. Lynch, Dr. Christian Strasburger, Dr. Monica Skinner, Hsienwie Lu, Izumi Kobayashi and Arvilla Mastromarino for their technical help and stimulating discussions. We would also like to acknowledge the technical support of the Center for Cellular and Molecular Studies in Reproduction (NIH P30-HD28934), the UVa Biomolecular Research Facility, and the Pratt Fund.


    Footnotes
 
1 This work was supported by NIH Grant R-01-DK-45350 (to B.D.G.). The GenBank Accession Numbers for ovine and bovine GHRH receptor cDNA are AY008834 and AY008835, respectively. A part of this work was presented at 10th International Congress of Endocrinology (78th Endocrine Society meeting) (Abstract P1–619). Back

2 Current address: Division of Endocrinology and Metabolism, National Children’s Hospital, 3–35-31 Taishido, Setagaya-ku, Tokyo 154-8509, Japan. Back

Received September 26, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mayo KE 1992 Molecular cloning and expression of a pituitary-specific receptor for growth hormone-releasing hormone. Mol Endocrinol 6:1734–1744[Abstract/Free Full Text]
  2. Gaylinn BD, Harrison JK, Zysk JR, Lyons CE, Lynch KR, Thorner MO 1993 Molecular cloning and expression of a human anterior pituitary receptor for growth hormone-releasing hormone. Mol Endocrinol 7:77–84[Abstract/Free Full Text]
  3. Lin C, Lin S-C, Chang C-P, Rosenfeld MG 1992 Pit-1-dependent expression of the receptor for growth hormone releasing factor mediates pituitary cell growth. Nature 360:765–768[CrossRef][Medline]
  4. Hsiung HM, Smith DP, Zhang X-Y, Bennett T, Rosteck Jr PR, Lai M-H 1993 Structure and functional expression of complementary DNA for porcine growth hormone-releasing hormone receptor. Neuropeptide 25:1–10[CrossRef][Medline]
  5. Chan KW, Yu KL, Rivier J, Chow BK 1998 Identification and characterization of a receptor from goldfish specific for a teleost growth hormone-releasing hormone-like peptide. Neuroendocrinology 68:44–56[CrossRef][Medline]
  6. Gaylinn BD, Lyons CE, Zysk JR, Clarke IJ, Thorner MO 1994 Photoaffinity cross-linking to the pituitary receptor for growth hormone-releasing factor. Endocrinology 135:950–955[Abstract]
  7. Gaylinn BD, Lyons CE, Thorner MO New GHRH analogs for mapping the GHRH receptor binding site by photoaffinity crosslinking. 4th International Pituitary Congress, San Diego CA, 1996 (Abstract)
  8. Turzillo AM, Campion CE, Clay CM, Nett TM 1994 Regulation of gonadotropin- releasing hormone (GnRH) receptor messenger ribonucleic acid and GnRH receptors during the early preovulatory period in the ewe. Endocrinology 135:1353–1358[Abstract]
  9. Chen C, Okayama H 1987 High-efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol 7:2745–2752[Abstract/Free Full Text]
  10. Juppner H, Abou-Samra A-B, Freeman M, Kong X-F, Schipani E, Richards J, Kolakowski LF, Hock J, Potts Jr JT, Kronenberg HM, Segre GV 1991 A G protein-linked receptor for parathyroid hormone-related peptide. Science 254:1024–1026[Abstract/Free Full Text]
  11. Cullen BR 1987 Use of eukaryotic expression technology in the functional analysis of cloned genes. Methods Enzymol 152:684–704[Medline]
  12. Zysk JR, Gaylinn BD, Lyons CE, Johnson B, Eppler CM, Baumbach WR, Thorner MO 1996 Purification of the growth hormone releasing hormone (GHRH) receptor with a C-terminal, biotinylated affinity ligand. Biochem Biophys Res Commun 221:133–139[CrossRef][Medline]
  13. Strader CD, Fong TM, Tota MR, Underwood D 1994 Structure and function of G protein-coupled receptors. Annu Rev Biochem 63:101–132[CrossRef][Medline]
  14. Iida-Klein A, Guo J, Xie LY, Juppner H, Potts Jr JT, Kronenberg HN, Bringhurst FR, Abou-Samara AB, Segre GV 1995 Truncation of the carboxyl-terminal region of the rat parathyroid hormone (PTH)/PTH-related peptide receptor enhances PTH stimulation of adenylyl cyclase but not phopholipase C. J Biol Chem 270:8458–8465[Abstract/Free Full Text]
  15. Holtmann MH, Roettger BF, Pinon DI, Miller LJ 1996 Role of receptor phosphorylation in desensitization and internalization of the secretin receptor. J Biol Chem 271:23566–23571[Abstract/Free Full Text]
  16. Zhang J, Ferguson SS, Barak LS, Aber MJ, Giros B, Lefkowitz RJ, Caron MG 1997 Molecular mechanisms of G protein-coupled receptor signaling: role of G protein-coupled receptor kinases and arrestins in receptor desensitization and resensitization. Receptors Channels 5:193–199[Medline]
  17. Loisel TP, Ansanay H, Adam L, Marullo S, Seifert R, Lagace M, Bouvier M 1999 Activation of the ß(2)-adrenergic receptor-G{alpha}(s) complex leads to rapid depalmitoylation and inhibition of repalmitoylation of both the receptor and Galpha(s). J Biol Chem 274:31014–31019[Abstract/Free Full Text]
  18. Palmer TM, Stiles GL 2000 Identification of threonine residues controlling the agonist-dependent phosphorylation and desensitization of the rat A(3) adenosine receptor. Mol Pharmacol 57:539–545[Abstract/Free Full Text]
  19. Pitcher JA, Freedman NJ, Lefkowitz RA 1998 G protein-coupled receptor kinases. Annu Rev Biochem 67:653–692[CrossRef][Medline]
  20. Bouvier M, Hausdorff WP, De Blasi A, O’Dowd BF, Kobilka BK, Caron MG, Lefkowitz RJ 1988 Removal of phosphorylation sites from the ß2-adrenergic receptor delays onset of agonist-promoted desensitization. Nature 333:370–373[CrossRef][Medline]
  21. Hipkin RW, Wang Y, Schonbrunn A 2000 Protein kinase C activation stimulates the phosphorylation and internalization of the sst2A somatostatin receptor. J Biol Chem 275:5591–5599[Abstract/Free Full Text]
  22. Malecz N, Bambino T, Bencsik M, Nissenson RA 1998 Identification of phosphorylation sites in the G protein-coupled receptor for parathyroid hormone. Receptor phosphorylation is not required for agonist-induced internalization. Mol Endocrinol 12:1846–1856[Abstract/Free Full Text]
  23. Nygaard SC, Kuestner RE, Moore EE, Stroop SD 1997 Phosphorylation of the human calcitonin receptor by multiple kinases is localized to the C-terminus. J Bone Miner Res 12:1681–1690[CrossRef][Medline]
  24. McDonald TP, Dinnis DM, Morrison CF, Harmar AJ 1998 Desensitization of the human vasoactive intestinal peptide receptor (hVIP2/PACAP R): evidence for agonist-induced receptor phosphorylation and internalization. Ann NY Acad Sci 865:64–72[CrossRef][Medline]
  25. Gaylinn BD, Lyons Jr CE, Thorner MO Internalization and phosphorylation of GHRH receptor. Program of the 80th Annual Meeting of The Endocrine Society, New Orleans, LA, 1998, p 298 (Abstract)
  26. Findlay DM, Houssami S, Lin HY, Myers DE, Brady CL, Darcy PK, Ikeda K, Martin TJ, Sexton PM 1994 Truncation of the porcine calcitonin receptor cytoplasmic tail inhibits internalization and signal transduction but increases receptor affinity. Mol Endocrinol 8:1691–1700[Abstract/Free Full Text]
  27. Dicker F, Quitterer U, Winstel R, Honold K, Lohse MJ 1999 Phosphorylation-independent inhibition of parathyroid hormone receptor signaling by G protein-coupled receptor kinases. Proc Natl Acad Sci USA 96:5476–5481[Abstract/Free Full Text]
  28. Lyu RM, Germano PM, Choi JK, Le SV, Pisegna JR 2000 Identification of an essential amino acid motif within the C-terminus of the PACAP type I receptor (PAC1) that is critical for signal truncation but not for receptor internalization. J Biol Chem 275:36134–36142[Abstract/Free Full Text]
  29. Buggy JJ, Heurich RO, MacDougall M, Kelley KA, Livingston JN, Yoo-Warren H, Rossomando AJ 1997 Role of the glucagon receptor COOH-terminal domain in glucagon-mediated signaling and receptor internalization. Diabetes 46:1400–1405[Abstract]
  30. Wheeler MB, Gelling RW, Hinke SA, Tu B, Pederson RA, Lynn F, Ehses J, McIntosh CH 1999 Characterization of the carboxyl-terminal domain of the rat glucose-dependent insulinotropic polypeptide (GIP) receptor. A role for serines 426 and 427 in regulating the rate of internalization. J Biol Chem 274:24593–24601[Abstract/Free Full Text]
  31. Hall TA 1999 BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
A. S. Mechaly, J. Vinas, and F. Piferrer
Identification of Two Isoforms of the Kisspeptin-1 Receptor (kiss1r) Generated by Alternative Splicing in a Modern Teleost, the Senegalese Sole (Solea senegalensis)
Biol Reprod, January 1, 2009; 80(1): 60 - 69.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. Bedard, J. Strecko, K. Theriault, J. Bedard, C. Veyrat-Durebex, and P. Gaudreau
Effects of a high-glucose environment on the pituitary growth hormone-releasing hormone receptor: type 1 diabetes compared with in vitro glucotoxicity
Am J Physiol Endocrinol Metab, April 1, 2008; 294(4): E740 - E751.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. A. Toogood, S. Harvey, M. O. Thorner, and B. D. Gaylinn
Cloning of the Chicken Pituitary Receptor for Growth Hormone-Releasing Hormone
Endocrinology, April 1, 2006; 147(4): 1838 - 1846.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. Alba and R. Salvatori
Naturally-occurring missense mutations in the human growth hormone-releasing hormone receptor alter ligand binding
J. Endocrinol., September 1, 2005; 186(3): 515 - 521.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
K. E. Mayo, L. J. Miller, D. Bataille, S. Dalle, B. Goke, B. Thorens, and D. J. Drucker
International Union of Pharmacology. XXXV. The Glucagon Receptor Family
Pharmacol. Rev., March 1, 2003; 55(1): 167 - 194.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Horikawa, R.
Right arrow Articles by Thorner, M. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horikawa, R.
Right arrow Articles by Thorner, M. O.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals